LD2SNPing v2.0 User Manual
Contents
1. Fig 26 Color setting for 2D LD display graphics 2 SNP10 distance xls in example file folder of LD2SNPing is used as an example Step 1 Click the pull down window arrow 1 Step 2 Select the needed block numbers e g 10 in arrow 2 The default color setting is gray scale If there is not necessary to change then go to next step f users want to change each color please see Fig 27 for detail Step 3 Click the repaint box arrow 3 The color resetting is completely finished Animation Figs 25 29 in one animation gt Select a new color preview CI snes Ss MORF Yes Ca ncel Reset R New New selection J J 4 J selection Cl MPF BOIS Cancel Reset R Cancel Reset R Fig 27 Color setting for 2D LD display graphics 3 The steps to change each color in each block are followed Step 1 Click the needed box for color change arrow 1 Step 2 The color panel for a new color selection appears arrow 2 Here the standard color panel is provided Steps 3 and 4 Clicking the desired color box arrow 3 such as the gray color indicated by arrow 4 Step 5 The new selection color appears in the blank color panel in the right side as indicated by arrow 6 Finally clicking the Yes box indicated by arrow 7 to confirm the color setting Animation Figs 25 29 in one animation 33 Updated 2009 05 07 Select a new color standard S HSB2. These sample files show the format of SNP genotypes and provide the chance for users to practice the LD2SNPing software 6 Multiple rsID ssID information browsers for LD calculation visualization On line retrieval of genotype frequency of different populations for multiple SNPs from NCBI Ss Sy eS Cae ee sT 5 pT 4 oF 3 3 fA a NN f A gt UJ i N A R A j m aa Se input file Fig 8 LD SNPing entry screen and function Arrows 1 2 and 3 indicate LD calculator and visualization Arrows 4 5 6 indicate SNP related search without LD function 13 Updated 2009 05 07 LD SNPing User Manual 4 2 LD free functions 4 2 1 Single rsID information browser and RFLP enzyme mining On line retrieval of individual SNP information among different populations from NCBI After inputting rsID e g rs17884306 and selecting ssID e g ss48297306 the population class total sample major allele minor allele genotype frequency HWP P value of the Hardy Weinberg equilibrium and data source are provided as shown in Fig 9A These data are completely matched to that of NCBI http www ncbi nlm nih gov SNP snp _ref cgi rs 17884306 as shown in Fig 9B Please note that different ssID may change their corresponding genotype frequency This is the nature characteristic of dbSNP in NCBI because these data were reported from different laboratories into different ssID for the same rsID Clicking th
3. 31 Updated 2009 05 07 LD SNPing User Manual 4 3 5 5 Color setting for 2D LD display graphics In the Fig 25 arrow 1 indicates the function of select color blocks and the default number 1s five blocks The color gradient for the LD measure value raining 0 0 0 2 for gray 0 2 0 4 for blue 0 4 0 6 for green 0 6 0 8 for yellow and 0 8 1 0 for red is default setting Users can choose the block number and the color display if needed please see detail in Figs 26 29 Contri e SNP10 _ 4A C Select Scope seis f SNP7 F t zf SNPO F Z _ Va JL PA eee a SNP1 i i i 5 E S N Fig 25 Color setting for 2D LD display graphics 1 SNP10 distance xls in example file folder of LD2SNPing is used as an example Arrow 1 indicates the pull down window to select block number for colors e g 5 indicates the 5 colors such as gray blue green yellow and red colors Clicking the pull down window arrow 1 is able to select different block number of colors Clicking any colors in the window of select color arrow 2 one by one it allows the users to change color for each clicking After color setting users can click the repaint arrow 3 to get the re colored 2D LD plot Please see next figures for detail steps Color setting for 2D LD display graphics 2 to 5 Animation Figs 25 29 in one animation 32 Updated 2009 05 07 LD SNPing User Manual
4. 4 3 6 2 Close file Sometimes users may lose the way to go to the home screen of LD2SNPing for another analysis In stead of closing and restarting the LD2SNPing the first icon provides the close file function for homing Fig 38 r LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP File AnalysisGraph Show2D Show3D Help Ga a a _ Show Distance _ Select Scope File Search Help ENE I am input file sample file Fig 38 Output information for saving file The function of Fig 37A is demonstrated A Under any situations users can click the close file indicated by arrow to stop the current LD analysis and return to the home screen for another new analysis B Animation 43 Updated 2009 05 07 LD SNPing User Manual 4 3 6 3 Analysis graph 4 3 6 3 1 Brief review for all functions in analysis graph LD2SNPing provided some graphic analysis such as grid bar and pie3D graph to supplement LD analysis to 2D LD visualization and analysis Fig 39 Detail function is described in Figs 40 44 LD2ZSHPing Linkage Disequilibrium plotter and RELE mining for tag SNE File Analysis Graph Show 2D Show 3D Help Grid Graph i s Bar Graph fe wll J PiesSDChart Fig 39 Brief review for all functions in analysis graph Grid bar and pie3D graph are provided 44 Updated 2009 05 07 LD SNPing User Manual 4 3 6 3 2 Analysis graph function Grid graph The st
5. LDA Fig 35 and Haploview Fig 36 Since the JLIN only accept the csv file three example files csv are used to test the visualization between LD 2SNPing and JLIN as shown in Fig 33 Haploview needs the ped and info formats therefore the same data have to change format Their 2D LD plotting is completely matched bors bed Fie Analysis Graph Show 2D Show3D Help SNP1 SNP2 SNP3 SNP4 D0 29471 Sap inkar wrqushbriam plotis asd Me Ants Gaph Show7D ShowJO hhi SNP 0 16773 Sap D 0 O2TORIGTINOIG74AGOF Daim 0 OPOON7E 20016570 Deal 1717561983471074 SNP6 Dio 227271462 1602067377 290 G27910932111803409 Oddattatio 2 5972566762513 Pexcese t 005715287879854 SNP5 d 192383914691291 58 8 0 4440207691509626 SNP4 Maplotypes Msi 6590169300679717 AT lt 0 O94 700S2467740205 TCD 1707994335689192 SNP3 ah THe 06665511100615359 SNP2 a Allele T count 108 freq AlLlLeleiA counte332 fr ot a SNP1 Fig 34 Comparison of LD2SNPing vs JLIN 1 60 Test file sources A XRCC test csv D P for vertical horizontal axis B 10SNP OS standard format csv D7 and C brca case test csv D Q in the example file folder of LD2SNPing respectively The pattern between LD2SNPing and JLIN is completely matched same value with different color gradient between them 39 Updated 2009 05 07 LD SNPing User Manual 4 3 5 11 Comparison of LD plotting between LDA and LD SNPing The v
6. eR AB ab Ab aB Pap Pit 7 Pas Pg D lt 0 min P P P P Pap P Pas Pg D lt 0 min P P P P 2 Pas Ey E Pay Eg P P P P D The Lewontin s D r The square of the standardized measures a Pap Pay Pay Pip 0 The Delvin s population attributable factor pp B ab Pas Pa Pay Pp Pas Ps Pas Pg P value of likelihood ratio test LD P value of Chi square test LD P value of Chi square test Hardy Weinberg Equilibrium Q The Yule s Q 55 Updated 2009 05 07 LD SNPing User Manual Note 1 P values for Linkage Disequilibrium Test Calculating Likelihood ratio Test 1 Number of Randomization The number of randomization test in permutation The default set no in LD2SNPing is set at 1000 The default set no in LDA is 100 1000 or 10000 2 Likelihood Lo The likelihood under the assumption of no disequilibrium Le The likelihood computed using the haplotype frequencies found by the EM algorithm 3 Statistic S L S 2 0 log a Sobs amp Sran 0 4 P value Permutations gt if Sran lt Sobs count 1 P i l Permutations Chi square Test 2nD Bok Pee 2 P value is calculated from incomplete gamma function See Numerical Recipes in C The 2nd edition CAMBRIDGE UNIVERSITY PRESS Ly Note 2 Hardy Weinberg Equilibrium tests ref 9 g N 1 PWN ay nas N n x Nyag Nap Mpp Nap 2 1 where C gt g ak Page ee
7. New selection preview Cl PIF MPF Cancel Reset R LD SNPing User Manual Select a new color Standard S HSB RGB preview CI MOF MAF Cancel Reset R Select a new color preview Cl Cy es moe Fig 28 Color setting for 2D LD display graphics 4 In addition to the standard color panel as shown in Fig 27 the LD2SNPing also provides other two types of color panel such as HSB and RGB which are shown in the up and down of the right side respectively Animation Figs 25 29 in one animation Fig 29 Color setting for 2D LD display graphics 5 SNP10 distance xls in example file folder of LD2SNPing is used as an example Here we provide the summary for changing colors as described in Figs 25 28 A The original color setting in Fig 26 B Changing the color setting one by one and the outcome is shown in C after clicking the repaint Animation Figs 25 29 in one animation 34 Updated 2009 05 07 LD SNPing User Manual 4 3 5 6 LD measure text data for all SNPs The LD2SNPing provides the both the visualization for LD plot and the text data for LD related information In Fig 30 the immediate response to check the specific pair wised SNPs is demonstrated If users want to view the LD related information for all SNPs within this plot please see detail in Figs 31 and 32 LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP File
8. information in doSNP of NCBI and its SNP RFLP enzyme information is provided by clicking the box for each tag SNP one by one The result of rsID RFLP is similar to that of Fig 10 not shown here B The tagSNP result of BRCA1 gene from HapMap version NCBI B36 assembly dbSNP b126 Animation Note Tag SNP selection candidates from different operation times in HapMap may be not be consistent completely due to the greedy algorithm built Some tag SNPs may or may not find in next test Likely LD SNPing has the same performance Animation Animation 16 Updated 2009 05 07 LD SNPing User Manual rn LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP File Search Help Solace rout OTRON amit i a Example BRCA2 RSID Nam 1s799916 Data 188176199 Data rs8176092 Data 6s799923 Data E tO iE 3 hitp ferew hapmap orgs gi perl gbrowse hapmap_B36 name Sequence NM _007295 WAR 02 Rim Population descriptors YRI Yoruba in Ibadan Nigeria JPT Jepanese in Tokyo Japan CHB Han Chinese in Beijing China CEU CEPH Utah residents with ancestry from nonhem and western Europe o Entrez genes NN_907294 BRCAL breast cancer 1 early onset isoform 1 JO aa BRCAL breast cancer 1 early onset isoform 1 NMN_007297 BRCAL breast cancer 1 early onset isoform NM_007298 n ie ope ae eS Bars ee a Se ee SE BS i 2 eee ee ie Le ee Ska ea eae BRCA
9. simulation for 100 randomized genotypes was computationally generated to fit their genotype frequency Different times to perform the simulation may lead to the different genotype orders in a population To provide the more reliable LD value we designed ten different simulations to perform their LD analysis and the average of these LD values was provided in LD2SNPing Although the possible linkage between different SNPs within the same individual is ignored this method provides the LD evaluation for SNPs with genotype frequencies alone However this kind of evaluation is not suggested if the HapMap is available for the selected SNP ID SNP information from different opulations was not suggested to perform the LD calculation Reference cluster ID ss66856885 v Frequency C HapMap Frequency C HapMap Simulation All reference cister D 3 Frequency C HapMap m Simulation All Reteronce cuter D 4 Frequency C HapMap Simulation _ All a on aceno pa v ee Frequency _ HapMap v Simulation _ All Reference cluster ID 6 ss66856885 s66856885 41446050 JPT_GENO_PANEL w _GENO_PANEL on oe C 0 333 C T 0 417 T T 0 250 Frequency C HapMap ee Simulation All OO 26 Updated 2009 05 07 LD SNPing User Manual rs41446050 Sample Ascertainment Genotype Detail new Alleles Individual Chrom CICI CECEN BWP or Group Sample Cnt ve mmn e ss66856885 HSP GENO PANEL 54 IG 08
10. 0 006 Nes oer SNP10 Unknown Fieinpt 0366 No Jo233 NP11 Unknown Fieinpt fo006 es oer SNP12 Unknown Fileinput_ 0 006 Yes oer SNP13 Unknown Fileinput 0 000 Yes oer SNP14 Unknown Fieinpt 0037 No Jorm SNP1S Unknown Fileinput_ 0 006 es ogs7 SNP16 Unknown Fieinput 0 236 No fos SNP17 Unknown Fieimpt joom No joos SNP18 Unknown Fieinpt 0360 No 0107 NP19 Unknown Fieno fooo0 es ooo SNP20 Unknown Fieinput 0129 No oe Fig 15 Sample input type A The procedure to input the sample file is indicated from arrows 1 to 3 Sample 4 is used for the example which is derived from the HapMap gene BTD dataset The column without SNP label in the first row is ignored by default NN indicates the no available SNP frequency in this SNP for some individuals suggesting that some data missing is not interfere the LD analysis in LDSNPing B The brief output result Axis D Similar detail result is shown in Fig 20 C Missing data information and MAF values for input SNPs It is provided immediately but hidden in the help function arrow 1 or at the bottom of window system arrow 2 rsID item indicates the user s input names for SNPs Genotype data source indicates the SNP genotype data input way by file input Fig 15 or NCBI retrieval not shown here MAF Minimal allele frequency Missing data indicates that SNPs with MAF lt 0 01 and they are not shown in 2D LD and 3D LD plots in LD2SNPing HWE P value indica
11. 0 042 OF00 O458 D37 0 050 0300 O 650 0455 0 033 O133 O833 00M 0 065 037 O88 1 000 O11 QAZ 0 467 1 000 o hal ar ia Mal O11F O400 O43 O64 O67 O356 O578 1 000 a 3 2 E sjaje le Jagt e r Fig 19 Many ssID for single rsID The SNP rs2078486 is used as an example A ssID is selectable from pull down window B The SNP frequency for each ssID in dbSNP of NCBI The SNP frequency for each ssID in LD2SNPing is the same as dbSNP of NCBI not shown please check it on line using LD2SNPing Although the genotype frequency data are available most of them are unable to retrieve the genotype raw data for LD measurement except the dataset of HapMap series ss 20037931 25 Updated 2009 05 07 LD SNPing User Manual Each ssID may be derived from different populations for single rsID like Fig 20 rs41446050 The ssID for corresponding rsID is selective using pull down window The SNP frequency of many ssID for rs41446050 in LD2SNPing is the same as in dbSNP of NCBI http www ncbi nlm nih gov SNP snp_ref cgi rs 41446050 Although the genotype frequency data are available all of them are unable to retrieve the genotype raw data for LD measurement in this case Using the genotype frequency the LD2SNPing randomly generates the simulated genotype data to calculate the simulated LD analysis when there is not HapMap raw data Since they have the genotype frequency a
12. 15 0 111 0074 0010 0870 0 130 ss Population CEU GENO PANEL European 68 IG 0 588 0 294 0 118 0 200 0735 0 265 AAM GENO PANEL African American IG 0 403 CHB GENO PANEL Asian 88 IG 0 273 0 545 0 182 0 527 YRI GENO PANEL Sub Saharan African 120 0 850 0 150 0 584 JPT GENO PANEL Asian 24 0 333 0 417 0250 0 584 Fig 20 Single ssiD from different populations for single rsiD rs41446050 ss66856885 is used as an example A Single ssID of different populations is selectable from the pull down window B The SNP frequency of each population of single ssID in dbSNP of NCBI The SNP frequency for each population for single ssID in LD2SNPing is the same as dbSNP of NCBI 21 Updated 2009 05 07 LD SNPing User Manual 4 3 5 LD calculation and 2D visualization 4 3 5 1 Eight functions in control panel of 2D LD plot After dataset input the LD 2SNPing performs of Hardy Weinberg Equilibrium Expectation Maximization EM algorithm and linkage disequilibrium LD calculation for LD related measurement such as D the difference in proportions D the Lewontin s D 7 the square of the standardized measures 6 the Delvin s population attributable factor Q the Yule s Q and p All these formulas are supplemented in the end of this user manual see Appendix In LD2SNPing eight functions are provided in control panel of 2D LD plot as shown in Fig 21 They are described in detail later after Fig 22 A LD2SNPing Linkage Dis
13. 46 4 3 6 3 4 Analysis graph function Pie graph P 47 4 3 6 3 5 Return to 2D LD plot P 48 4 3 7 LD in 3D visualization P 49 4 3 7 1 The difference between 2 D and 3 D plotting P 49 4 3 7 2 Performing 3D LD and changing the parameters in 3D LD plot P 49 4 3 7 3 Representative view of 3D LD plot P 50 4 3 7 4 Zoom in zoom out and rotation of 3D LD plot P 51 4 3 7 5 Changing color for 3D LD plot P 52 4 3 7 6 Selection of block number for 3D LD plot P 53 5 Help P 54 6 Appendix P 55 56 7 References P 57 3 Updated 2009 05 07 LD SNPing User Manual 1 Introduction Single nucleotide polymorphisms SNPs are the most common genetic polymorphisms in the human genome They are increasingly important to the personalized medicine and many association studies However too much SNPs may make it hard to identify the interesting SNPs associated with diseases or cancers Accordingly it is essential to use a small representative subset of informative SNPs for the association studies Linkage disequilibrium LD is one of the common methods to identify these representative SNPs called tag SNPs tSNPs Here we developed the LD2SNPing to compute LD measurement and visualize in 2D and 3D plots for user s input data file or on line retrieval for multiple SNPs from HapMap and NCBI Gene input to provide the tag SNP from HapMap is available SNP ID rs input for the RFLP restriction enzy
14. Analysis Graph Show2D Show3D Help Contri Show Distance _ Select Scope Restore Scope Select Left LD Measure Select Right LD Measure Frequency 2 0 083 SNPS Data Genotype Count Frequency Genotype CC o oo00 CT 2 Jone 0 0 833 Haplotype Data Fig 30 LD measure text data for all pair wised SNPs SNP10 distance xls in example file folder of LD2SNPing is used as an example A Visualization of 2D LD plot spontaneously provides the text data for LD related information by clicking For example moving over the box for SNP5 vs SNP2 as indicated by arrow provides the information B Once clicking the interested box the text data for LD related information is provided Note The likelinood ratio P value is dependent on the number of randomization and it shows minor variation for likelinood ratio P value at different times Please see the formula in the Appendix at the end of the user manual Animation 35 Updated 2009 05 07 LD SNPing User Manual 4 3 5 7 Save text file for output LD measure data The LD2SNPing provides the output for the LD related text data of all SNPs within this plot such as Fig 31 In Fig 32 the steps to save the text data for LD plot are demonstrated The output for LD graph is described later Fig 33 A LD2SNEing Lankage Diseqouilibroom plotter and RFLP mining for tag SNE File Analysis Graph Show 20 Show 3D Help Output LD Measu
15. D SNPing and Haploview is also matched 24 Updated 2009 05 07 LD SNPing User Manual 4 3 4 rsID and ssID searching for SNP frequency information For LD calculation to specific population the selection of specific ssID may be helpful to analyze the population based association studies Different records from different submitters for the same SNP rsID are given with the ssID Fig 19 182078486 http www ncbi nlm nih gov SNP snp_ref cgi rs 2078486 Reference cluster ID rs2078486 1 A 0 033 A G 0 133 G G 0 833 220037931 HapMan CEU HapMap HCB Asian 3 Jo European 1353 l 0 050 JE ofc a DI O42 O467 0732 824116493 AFD EUR PANEL AFD AFR PANEL AFD CHH PANEL HapMap JPT HapMap 1 RI Afar Asan CEPH PDpanel ee 32469447 PORYO se4b297341P1 6366856875 HSP GENO PANEL CAUC I APRIL HISP PACI Asian Sub Saharan Afican 120 European 48 Afncan Amencan 46 Asian 43 Afican Amencan 30 European 34 Asian 26 European Global Global CEU GENO PANEL European AAM GENO PANEL Afiean Amencan CHB GENO PANEL Asian YRI GENO PANEL Sub Saharan African 120 JPT GENO PANEL Asian 90 z i g 0 200 8 i bal DS OFF Ose O 043 0435 DJI 0I 0542 0452 0 100 0 467 053 O25 0118 023 POOD 0769 O251 002 OOF 0077 O885 O020 Dls O88 1 000 0056 O267 O67 O25 0 03 O273 0 497 1 000 0100 OF00 1 000 1004 0304 Oiz 1 000 0 005 O227 O27 0479
16. Fig 17 The Haploview cannot accept the multiple SNP input directly Instead the Haploview provides all the SNPs within the user s input range and subsequently narrow down to user s interested SNPs for LD analysis by manually clicking one by one In Fig 17 the same four SNPs listed in Fig 16 are used as example to perform LD analysis by Haploview and their 2D LD result is shown in Fig 18B LD Plot Haplotypes Check Merkers Tagger Using 45 singletons and O trios from 45 families Name Ponton Obd HET PredHET HWopwvel Reno FemTno MendErr MAF jes 3410149 i i po 100 0 15733619 1 1100 0 933087241 20 k 100 0 ws11571315 h 100 0 15733618 j i i000 124553808 j j 867 wel 1571316 FA o LI p78 is16840252 j i 100 0 xx231772 100 0 1231773 f a 1000 bes 1571317 f k 100 0 brx23174 f j 100 0 100 0 100 0 100 0 8 1000 TOON AW AUN Ie 231779 11065442 _ 13231700 _ bes 1571324 31 1571318 rs 3384548 SSSCeceocSeoeeeeoeoeueeees A A A AA AAA AA AAA AAAA Minimum minor allele freq 0 0010 Select Al Deselect All Rest Values _ __Rescove Markers Fig 17 Manual selection from range based SNP retrieval of HapMap using Haploview If the LD analysis for only some of the SNP panel is interested it should be firstly input the range covering all SNPs e g Chr2 204 438 754 204 446 928 Second users have to manually select interested SNPs indicated by arrow line Final
17. ID and ssID for further LD calculation and visualization Fig 6 only input action is shown here and the output result is shown in output section later LD2SNPing provides the method for users to input some SNP IDs and automatically retrieve the SNP frequency information from dbSNP in NCBI on line Fig 6 LD measurements between these SNPs are provided without the knowledge of the SNP information for these SNP IDs see output section later n LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP File Search Help m WINN 1 5 3 How many SNPs the user wants to use to pea 4 calculate pairwise LD Reference cluster ID ss hce cluster ID Reference cluster ID Reference cluster ID Eei Reference cluster ID 9 Fig 6 Search rsID input type The input procedures to retrieve several interested SNPs from NCBI using rsID and ssID inputs for LD calculation and visualization are indicated from arrow 1 to arrow 6 In arrow 2 users can key in the desired numbers for SNP ID input Subsequently the box numbers for requested SNP numbers are immediately generated arrow 4 The arrow 5 indicates the pull down window for rsID and ssID selections Once the rsID is selected several corresponding ssID are interchangeable if they are provided in dbSNP of NCBI no shown here it will described later Clicking the box indicated by arrow 6 shows the SNP genotype frequency for selected pop
18. L breast cancer 1 early onset isoform NM_007299 SO SaaS Ba ee a Se eee eee Jc ee ee eee ee eee BRCAL breast cancer 1 early onset isoform NMN_907300 BRCAL breast cancer 1 early onset isoform NM 007302 BRCAL breast cancer 1 early onset isoform NN_907303 n Aer Agaa Be ae eS Se eS we ee ee runanga Li ee Le ee ae be ie a BRCAL breast cancer 1 early onset isoform NM 907304 n de Ce a aye Bi cee ee ee ee ee ee ee eee ee aua aa aan aan aa ee ie he BRCAL breast cancer 1 early onset isoform NMN_9007305 BRCAL breast cancer 1 early onset isoform OC tag SNP Picker tSNPs_Pairviselagger_CEU Fig 12 Result of gene name BRCA1 input using LD SNPing vs HapMap A The input data format shows the SNP nos SNP rsID and their corresponding RFLP data in LD2SNPing BRCA1 tagSNP is based on the record for NM _ 007295 The procedures to retrieve the tagSNP of HapMap hito www hapmap org Four populations such as CEU CHB JPT and YRI are provided for selection as indicated by arrow 3 from gene name input are indicated from arrow 1 to arrow 5 The CEU population is selected for the example with minor allele frequency MAF cut off 0 2 In arrow 5 the original rsID information in doSNP of NCBI and its SNP RFLP enzyme information is provided by clicking the box arrow 6 for each tag SNP one by one The result of rsID RFLP is similar to that of Fig 10 not shown here B The tagSNP result of BRCA1 gene from HapMap ve
19. LD SNPing User Manual LD SN Ping v2 0 Linkage disequilibrium plotter and RFLP mining for tag SNPs LE EPR LEER ACER Contact chyang cc kuas edu tw changhw kmu edu tw chuang isu edu tw 1 Updated 2009 05 07 LD SNPing User Manual LD SNPing v2 0 User Manual 1 Introduction p 4 2 Installation P 5 2 1 System Requirements P 5 2 2 Installing Java P 5 2 2 1 Installing JRE P 5 2 2 2 Installing Java3D P 5 2 3 Installing LD SNPING P 5 3 Input Format P 7 3 1 File input P 7 3 1 1 XLS and CVS Format P 7 3 1 2 DOC Format P 8 3 1 3 TXT Format P 8 3 2 Gene input P 9 3 3 rsID input P 10 3 3 1 Retrieval of the individual SNP information from NCBI P 10 3 3 2 Retrieval of genotype frequency of different populations for multiple SNPs from NCBI P 11 3 4 Sample file input P 12 4 Function of LD SNPing P 13 4 1 Brief review for the function of LD2SNPing P 13 4 2 LD free functions P 14 4 2 1 Single rsID information browser and RFLP enzyme mining P 14 4 2 2 Gene input to find rsID data of tagSNP and RFLP enzyme mining P 16 4 2 3 RFLP enzyme mining tool using rs ID input P 18 4 3 LD available functions P 19 4 3 1 File input for LD calculation visualization P 19 4 3 2 Sample file input for the tutorial of LD calculation visualization P 20 4 3 3 M
20. Nya Nap gp Define the quantity 0 p P Pp So that 4 when HWE holds 2 Pawe gt PN as Mg N n4 P Nag Maz NM4 XP N 45 Mag Ny N AB 56 Updated 2009 05 07 LD SNPing User Manual 7 References 1 LDA a java based linkage disequilibrium analyzer Bioinformatics 2003 19 16 2147 8 http www chgb org cn Ida Ida htm 2 JLIN a java based linkage disequilibrium plotter BMC Bioinformatics 2006 7 60 http www genepi org au projects jlin 3 Haploview analysis and visualization of LD and haplotype maps Bioinformatics 2005 21 2 263 5 http www broad mit edu mpg Haploview 4 HelixTree http www goldenhelix com SNP_Variation HelixTree index html 5 HapMap http www hapmap org 6 dbSNP of NCBI http www ncbi nlm nih gov SNP 7 REBASE enzymes and genes for DNA restriction and modification Nucleic Acids Res 2007 35 Database issue D269 70 http rebase neb com rebase rebase html 8 SNP RFLPing restriction enzyme mining for SNPs in genomes BMC Genomics 2006 7 30 http bio kuas edu tw snp rflp 9 A note on exact tests of Hardy Weinberg equilibrium American journal of human genetics 2005 76 887 93 57 Updated 2009 05 07
21. P File Search Help 7 explain doc test01 xis Gene_BTID x Is testO2 doc O Gene_tat xts C testo3 txt Gene_tp53 x Is User Manual doc C SNP10 xIs 0 snp100 xts file name Il file type Fig 14 File input procedure Clicking the box 1 shows the box 2 open file which provides several different formats of SNP genotype data box 4 for users to familiar with input Users may click the box 3 pull down window to select their interested file in their computer folds if necessary Finally users can click the box 5 to complete the open file In the example of Gene BTD xls in window 4 the brief output result is shown in Fig 15B Similar detail result is shown in Fig 20 Animation 19 Updated 2009 05 07 LD SNPing User Manual 4 3 2 Sample file input for the tutorial of LD calculation visualization These sample files provide the chance for users to practice the LD2SNPing software The SNP is defined by the nucleotide variant allele larger than 1 Minimal allele frequency MAF gt 0 01 of the population Therefore for those allele frequencies less than 1 is not shown in the 2D LD plot in default setting such as the SNP1 3 5 9 11 13 15 19 22 26 28 30 and 32 of sample 4 in Fig 15A Those SNPs with MAF lt 0 01 are not visualized in the 2D LD plot Fig 15B All the MAF values for all SNPs are provided in show SNP data of help Fig 15C rn LD2SNPing Lin
22. Pie3DChart 2x 4 SNP1 4 5 Z 5 SNP1 vs SNP4 Output LD Graph Close File Exit LD Measure Save as ics example File name bar test File type JPG images Fig 42 To perform save and open the bar graph analysis in LD2SNPing A To perform the bar graph analysis B Output of bar graph analysis Animationi 46 Updated 2009 05 07 LD SNPing User Manual 4 3 6 3 4 Analysis graph function Pie graph LD SNPing also provides the pie3D to show the alleles distribution of selected SNP and file saving as shown in Fig 43 l LIZ2SHFPim Linkage Diseqnilibrinm plotter and RFLP mining for tag SHF Alleles Data Analysis Graph Show 2D Show 3D Help Grid Graph Bar Graph Dy 1m Loa j A 1 a PietDCharlt Teci Orn GAME e ey ai Alleles Data Gamela Dada t Alk A Chales 17T Frequerty 0 70837377IIIIIIH Miele Counta T Frequenty 0 I0idapogpiigigiT Alpe Count Frequenty 00 Allele T Gowa 0 Frequency 0 0 Fig 43 The information of alleles Step 1 Open the blank window of Pie3D chart Step 2 Selecting single interested SNP from pull down window as indicted by arrow 2 Step 3 Start to perform the function of pie3D chart for selected SNP Step 4 All the nucleotide distribution in selected SNP is provided as indicated in arrow 4 either by figure or text Step 5 Save and print the pie figure by clicking the right bottom of mouse Animation 47 Updated 2009 05 07 LD
23. R PRRREQY 0 QORRRROGROW OORRORG mm j ji BREE Ee ORR D Eggi LDO Pees rho walhi SINF11 opn a Aly D S 1 0 Bot m 14 2 to m 14 2 D 51 2 Bot m 143 aE 0 90r0rD 000 000000h ooo are fh w i UEP BEE i 1 00000 000 000oon 00000000N m AE RR ii 0 sets GRE YA ff Iho Mn 8 2030 0 m 0 OCOOO000Fh 0 He 000 OO00Fh h h opopp OOnt nag ae i Fig 32 Open file for all information of LD measurement SNP10 distance xls in example file folder of LD2SNPing is used as an example A D and D values B f and value C Q and p values D Chi square P value and likelihood ratio P value Note The likelihood ratio P value is dependent on the number of randomization and it shows minor variation for likelihood ratio P value at different times Please see the formula in the Appendix at the end of the user manual Figs A D belongs to one WordPad file which is saved for output LD measure data It is readable by WordPad and Microsoft Word Here is the example of WordPad opening For Microsoft Word the letter size needs to less than 9 Animation 37 Updated 2009 05 07 LD SNPing User Manual 4 3 5 9 Save and open image file for output LD measure data and graph The LD2SNPing provides the output for the LD graph such as Fig 33 The steps to save and re open the LD plot are demonstrated in Fig 33B and Fig 33C respect
24. SNPing User Manual 4 3 6 3 5 Return to 2D LD plot At anywhere users can return to the first screen for 2D LD visualization by clicking the Show 2D as indicated by arrow in Fig 44 FA LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP File Analysis Graph Show 2D Show3D Help fe bee eee A eee pee Series Chee a ard 1 dod Fig 44 Return to 2D LD plot Clicking the arrow 1 in Figs 44A 44B 44C and 44D can return to the original 2D LD plot as indicated by arrow 2 Animationi 48 Updated 2009 05 07 LD SNPing User Manual 4 3 7 LD in 3D visualization 4 3 7 1 The difference between 2 D and 3 D plotting 1 The distance indicated by arrow is presented to the diagonal line with white patch in proportion to its height 2 Although the absolute values for all the SNP may not be able to read in 3 D plotting the 3 D plotting provides the brief and clear view between the SNPs with the high and low values without checking the gradient color scale as provided in 2 D plotting 4 3 7 2 Performing 3D LD and changing the parameters in 3D LD plot LD 2SNPing use Java 3D coded on the program construction In Fig 45 the steps for performing 3D LD and changing the parameters in 3D LD plot are shown Fig 45 Performing 3D LD and changing the parameters in 3D LD plot From step 1 to step 7 users can visualize the 3D LD plot change the parameter for left and right side of pink p
25. cted region is black background subsequently Once clicking the arrow 4 the result is shown in E to represent the scope with narrow down manner Users may return to the original plot by clicking the arrow 5 restore scope as indicated by blue arrow line Animation 30 Updated 2009 05 07 LD SNPing User Manual 4 3 5 4 Visualization of parameter changing of 2D LD plot In Fig 24 the parameter changing for drawing the 2D LD plot is presented Left and right LD measures are changed and successfully re drawn Many parameters are accepted to change as needed Contri Select Scope Restore Scope Select Left LD Measure _ Show Distance _ Select Scope Restore Scope Select Left LD Measure Chi square P value Likelihood ratio P value Chi square P value Likelihood ratio P value Fig 24 Visualization of parameter changing of 2D LD plot SNP10 distance xls in example file folder of LD2SNPing is used as an example A The parameters in 2D LD plot Arrows 1 and 2 indicate the vertical D and horizontal logP axes respectively Both of them are the pull down windows for selection Once selection users can click the repaint arrow 3 to view the re drawn plot B Demonstration of parameter changing of 2D LD plot Arrows 1 and 2 indicate the changing of D to D r to p respectively After clicking the repaint arrow 3 the new 2D LD plot is shown Animation
26. e show distance and clicking the arrow 2 repaint users will see the result as shown in Fig 22B B Clicking the arrow 1 to re select the show distance and clicking the arrow 2 users will see the result as shown in Fig 22A Both A and B are interchangeable Animation 29 Updated 2009 05 07 LD SNPing User Manual 4 3 5 3 Scope selection from large to small area of 2D LD plot Scope control is designed to narrow down the SNP number for LD analysis if the huge SNP data is evaluated As shown in Fig 23 users can zoom in to select SNP within small region and it is reversible Contri C Show Distance Select Scope w 1 Contri C Show Distance Decide Select Scope Contri C Show Distance Decide Select Scope Contri C Show Distance 4 Decide Select Scope i Contri _ Show Distance Decide Select Scope Restore Scope A Fig 23 Scope selection from large to small area of 2D LD plot This function is similar to zoom in 2D LD plots e g SNP10 distance xls in example file folder of LD2SNPing in right side are the results for the control panels A E in parallel respectively A Clicking the arrow 1 users can start to test the function of scope selection B C Both of B and C are clicked at the corner for selected region as indicated to arrow 2 and arrow 3 for SNP8 vs SNP5 and SNP7 vs SNP3 respectively Then the range from SNP max to min is selected D The sele
27. e example 1s2247603 automatically provides similar SNP ID retrieval Fig 14 later FS LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP File Search Help 2 Sy cm em E H matra Example rs2247603 Population ID Class Total Sample Ema Allele Minor Allele Genotypes AJA 0 031 A 0 088 G 0 912 AJG 0 113 GiG 0 856 AJA 0 000 A 0 032 G 0 968 0 065 GiG 0 935 WA 0 042 A 0 083 0 817 G 0 083 GiG 0 875 JA 0 000 4 0 000 1 000 AJG 0 000 GiG 1 000 WA 0 083 A 0 229 0 771 G 0 292 GiG 0 625 2 htpiww nebinbkn nih coweSN Prenp_ref ccitrs 1 7884306 Sample Ascertainment Genotype Detail NEW Alleles St Population TAk tda ehroit Source AJA AMG G amp G HWP A ssS324695045 PDOR O Cslobal l s 0 083 0 917 0 752 0042 0 958 O IEE ss4ee2o7306 Pl 134 0 113 0 856 0005 0 088 0 912 O A O O ATI D 0 065 0 935 1 000 0 032 0 968 o y O AFE 1 48 i 0083 0 75 0025 0 083 oO 91F o rrr eee HIF il 36 1 000 1 000 Eo e n EFA 45 0625 0 771 DI EEE O Fig 9 rsID input and output for LDSNPing and dbSNP of NCBI A In LD2SNPing the input procedures to retrieve the individual SNP rsID e g rs17884306 ss48297306 are indicated from arrow 1 to arrow 5 The arrow 4 indicates the pull down window for ssID selection The corresponding RFLP enzyme is the same for any ssID because they share the same rsID The arrow 5 indicates the SNP genotype frequency for avai
28. e input In order to find output data from the gene related information e g BRCA2 and BRCAI for Fig 11 and Fig 12 respectively LD2SNPing can provide the tagSNP information through the HapMap http hapmap jst go jp hapmappopulations html As demonstrated in Fig 11 and Fig 12 our proposed LD2SNPing completely agrees with the tagSNP information provided by HapMap because LD2SNPing is designed to retrieve this information on line Clicking each RFLP data box leads to the RFLP enzyme information as shown in Fig 10 fo LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP File Search Help 2 6S il BB eh Om n E 4 Input Gene offical symb BRCA2 i ed x Example BRCA2 rs9943888 RFLP rs11571662 RFLP 31 31800k 31810k OG Entrez genes J0 tag SNP Picker tSNPs_PairwiseTagge Fig 11 Result of gene name BRCA2 input using LD2SNPing vs HapMap A The input data format shows the SNP nos SNP rsID and their corresponding RFLP data in LDSNPing The procedures to retrieve the tagSNP picker of HapMap Four populations such as CEU CHB JPT and YRI are provided for selection as indicated by arrow 3 as shown by red box in B from gene name input are indicated from arrow 1 to arrow 5 http www hapmap org The CEU population is selected for the example with minor allele frequency MAF cut off 0 2 In arrow 6 the original rsID
29. ed 2009 05 07 LD SNPing User Manual 4 3 LD available functions LD available functions included 4 File input 5 Sample file and 6 Multiple rsID ssID information browsers for LD calculation visualization Here we firstly introduce how to use these different inputs separately and briefly Then we show their detailed common LD calculation and 2 D visualization graph analysis and LD in 3 D visualization They are described in detail as follows 4 3 1 File input for LD calculation visualization LD2SNPing accepts four kinds of input file formats such as Excel xls and cvs Word doc and NotePad txt as shown in Figs 1 2 and 3 respectively To start the file input function users can select any interested files with SNP genotypes Fig 14 Although the LD2SNPing can perform the LD function for several SNPs existed in different chromosomes it is not the scope of LD definition In other words several SNPs in the same chromosome with their corresponding SNP genotypes are necessary to perform LD calculation due to the definition of LD In Fig 14 LD2SNPing provides several files for examples in default as marked in 1 for users to familiar with the possible acceptable formats for xls cvs doc and txt as marked in 2 and 4 Alternatively users can select their own file to perform this function by clicking the pull down window as marked in 3 Ea LD2SA Ping Linkage Dasequalubrium plotter and RFLP mining for tag SN
30. eps to perform grid graph analysis in LD2SNPing are shown in Fig 40 The LD information from grid graph is in consistence with text data Fig 41 ra LD2SN Ping Linkage Disequilibrium plotter and RFLP mining for tag SNP File Analysis Graph Show 2D Show 3D Help gt Grid Graph a eoon Dg pmm fey AA Pie3DChart Select SNP 2 wy SNP 1 Setect LD Measure F5 anean 0 0 SNP1 vs SNP 1 SNP1 vs SNP4 Fig 40 Grid graph view SNP10 distance xls in example file folder of LD2SNPing is used as an example Clicking the arrow 1 to select the function of grid graph and then clicking the pull down window to select the reference SNP e g SNP1 indicated by arrow 2 to perform the pair wised comparison to other SNPs SNP1 vs SNP1 shows the highest D value pull down selection indicated by arrow 3 Animation Figs 40 and 41 in an animation ES SNP10 dastance wE 4538 G gt RACY Oat Sau amp aK TT Measure Data LD Messure D valve Fig 41 Consistence for the LD information between A grid graph and B text data Animation Figs 40 and 41 in an animation 45 Updated 2009 05 07 LD SNPing User Manual 4 3 6 3 3 Analysis graph function Bar graph The steps to perform save and open the bar graph analysis in LD2SNPing are shown in Fig 42 LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP Analysis Graph Show 2D Show 3D Help Grid Graph Lk Bar Graph 1
31. equilibrium plotter and RFLP mining for tag SNP File Analysis Graph Show 2D Show 3D Help Contri Show Distance A B C Select Scope C D Restore Scope Select Left LD Measure Fig 21 Eight functions in control panel of 2D LD plot Data source SNP10 distance xls in example file folder of LDSNPing A Option to show or hide the distance B Scope selection of the 2D LD plot C Restore the action of scope selection by B D Pull down selection of the left vertebrate axis LD measure E Pull down selection of the right horizontal axis LD measure F Select the block number to be numbers of colors G Color selection by user defined colors H Repaint the 2D LD profile 28 Updated 2009 05 07 LD SNPing User Manual 4 3 5 2 Showing omitting the distance between SNPs In the Fig 22 LD2SNPing demonstrates that distance between SNPs is optional to show or hide The distance value shown in SNPn is the distance between SNPn to zero point Contri iv Show Distance _ Select Scope a 1 Restore Scope _ Show Distance C Select Scope bi Restore Scope Select Left LD Measure Select Right LD Measure Fig 22 Distances between SNPs are able to be visualized or omit If the input data contain distance between SNPs e g SNP10 distance xls in example file folder of LD2SNPing users can chose to show A or omit B it A Clicking the arrow 1 to un select th
32. file formats such as Excel xls and cvs Word doc and NotePad txt in Fig 1 Fig 2 and Fig 3 respectively The first row for each file is for SNP name user can type any names The second row for each file is for distance optional More example files are available from example file folder of LD2SNPing described later in Fig 15 It is available in the subfolder under the program file folder of LD2SNPing 3 1 1 XLS and CVS Formats In Fig 1 LD2SNPing accepts some input formats e g xls and cvs The SNP ID name and the distance between them are optionally input if necessary The distance value shown in SNPn is the distance between SNPn to zero point A SNP genotype is composed of two alleles the generally format of A G C or T but N represents the missing data iS SO oe a AQO EO IAD BHO MED MA ee eee IE EIA oe ee ee ee 2 s J 21 Kil iy 4p 200 E EE 12 B Z U E E I Ss gt 38 G I pD E F G SNP2 SNP3 SNP4 SNPS gt SNP ID name optional 22 50 112 Distance between SNPs TE AA optional Cr AA CT AG pt i ia GG OC AA Sl BEE ERD WAO AD eto IAD BAO RED HAN Seea REFE Se eE ERE Fig 1 Input data of XLS and CVS formats A The input data format shows the SNP names distances and genotypes This file is available from example file folder of LD2SNPing e g test01 xls described later in Fig 15 Users can view these files by inputting file B File without SNP
33. g QIS ci O vi 3 N 5 O an Reference cluster ID 11571316 Frequency HapMap i 4 17 gia 3 mele olj S c 2 a yi 3 a 5 Oan Fig 16 Search rsID input type First users have to input the required SNP numbers at the top window arrows 1 and 2 After clicking Enter arrow 3 the system generates the same box numbers for SNP ID inputs Input the rsID e g rs11571315 rs733618 rs5742909 and rs11571316 select the population by pull down window arrow 5 Users are able to select the HapMap arrow 6 simulation arrow 7 or all containing both HapMap and simulation arrow 8 The SNP information is retrieved by clicking the Find box one by one arrow 9 Then the SNP frequency information appears Once completing the SNP ID inputting users can click Run LD at the bottom window arrow 7 to show the LD relationship between these inputting SNPs rs or ss are all acceptable B The finished SNP ID input in the example of HapMap CEU data source from HapMap The brief output is shown in Fig 18 Similar detail result is shown in Fig 21 22 Updated 2009 05 07 LD SNPing User Manual The function for multiple rsID ssID information browsers for LD calculation visualization in LD2SNPing is in direct manner Fig 16 In contrast the multiple rsID ssID information browsers for LD calculation visualization in Haploview are in indirect manner as shown in
34. idual SNP information from NCBI LD SNPing provides the rsID input to retrieve the individual SNP information from dbSNP of NCBI on line Fig 5 Therefore the SNP information for all population existed in current version of dbSNP is provided The ssID for corresponding rsID is selective using pull down window LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP File Search Help IE aonan Example rs2247603 f m Ks 0 031 G 0 912 G 0 113 posh GiG 0 856 MA 0 000 CAUC1 G 0 968 0 065 NCBI GIG 0 935 NA 0 042 0 083 G 0 917 4G 0 083 NCBI GiG 0 875 N A 0 000 4 0 000 G 1 000 0 000 NCBI GiG 1 000 MA 0 083 PAC1 G 0 771 41G 0 292 NCBI GIG 0 625 Fig 5 rsID Input The input procedures to retrieve the individual SNP rsID e g ID Class Total Sample Major Allele Minor Allele a a a me he 088 rs17884306 are indicated from arrow 1 to arrow 5 The arrow 4 indicates the pull down window for ssID selection Subsequently the SNP genotype information for selected ssID is provided as indicated by arrow 5 The arrow 6 indicates the function for SNP RFLP enzyme information by clicking if necessary HWP P value of Hardy Weinberg Equilibrium Animation 10 Updated 2009 05 07 LD SNPing User Manual 3 3 2 Retrieval of genotype frequency of different populations for multiple SNPs from NCBI Alternatively users may need to retrieve several interested SNPs from NCBI using rs
35. isualization between LD2SNPing and LDA is compared as shown in Fig 35 Their 2D LD plotting is completely matched Because the formula of calculating LD related information of LD2SNPing is derived from help system of LDA the values for all LD related information are confirmed to be the same for each other LD SNPing GB LOZ Ping Linkage Disequilibrium plotier and r x F CADocuments and Settings kailin amp Hiitest bank wei XRCC test txt fae Analysts Graph Show 20 Show 30 Help file Edit Process Help M 03 lt D lt 07 0 7 lt D lt 10 Pairwise Linkage Disquillbnum Measures of D SNP1 SNP2 SNPS SNP4 e Fig 35 Comparison of LDSNPing vs LDA Test file source XRCC test csv D7 D in the example file folder of LD2SNPing 40 Updated 2009 05 07 LD SNPing User Manual 4 3 5 12 Comparison of LD plotting between Haploview and LD SNPing The visualization between LD2SNPing and Haploview is compared as shown in Fig 36 Their 2D LD plotting is completely matched Two example files are used to demonstrate the successful LD plotting LD SNPing Hapoview nam plotter and R mine Color adjusted 2 3 4 SNP1 SNP2 SNP3 SNP4 Haploview original 9 10 Color adjusted Fig 36 Comparison of LD SNPing vs Haploview Color adjusted plot is our manually modified according to the color gradient in LD2SNPing The number in the box of Haploview is the percentage of D value Test file sources A XRCC tes
36. ively A LOZSHPing Linkare Diseguilibrinm plotter and EELE mining for tas SHE File Analysis Graph Show 2D Show 30 Help Save as _ example eo Fe cA File name SNP10 distance 2D File type JPG Images iF RHE WAM FRAVARHE A R T JAH O 42 p Px pr gt gt X9 mr FED E CAProgram Files LD2SNPing example 2B Ah A eek BRA Bea ce FROME SHP10 distance 2D jpg Windows BE AIMRRAE Wi explain doc F LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SHP El Gene _BTD xls File Anatysis Graph Show2D Show 30 Help E Gene_tatxds La El Gene_tp53 xls 3 EA hol 44 EHSNP10 xls Contri hal SNP10 distance 2D j SNP 10 distance xls SNP10 distance text txt EH snp30 xds Al testO1 xls Wi test02 doc E test03 txt E test4 csv Wi User Manual doc QO Heyl AP inaae xRus Fig 33 Output graph information for saving and opening file SNP10 distance xls in example file folder of LD2SNPing is used as an example A Clicking the output LD graph leads to the save function B Users are able to change the file location C Users can re open the graph by clicking the file under file manager of computer Animationi 38 Updated 2009 05 07 LD SNPing User Manual 4 3 5 10 Comparison of LD plotting between JLIN and LD SNPing The performance and accuracy for LD2SNPing are demonstrated by comparing to three common LD softwares such as JLIN Fig 34
37. ively The current version of LD2SNPing accepts 10 SNPs for maximal visualization A The 2D LD plot is the same as in Fig 15 10 SNPs in brackets 1 Fig 49A are SNPs 2 4 6 10 14 16 17 18 20 and 21 which is the same SNPs to bracket 4 Fig 49B B Clicking the arrow can change the color C Clicking the arrow 1 can change the selection of block number The white arrow head is moved to right and the select SNP is changed to SNP10 SNP31 10 SNPs in brackets 2 Fig 49A are SNPs 10 14 16 17 18 20 21 27 29 and 31 which are the same SNPs to bracket 4 Fig 49C Animat 53 Updated 2009 05 07 LD SNPing User Manual 5 Help Anytime user can find the help before and after LD plotting Fig 50 E LD2SNPing Link e Disequilibrium plotter and RFLP mining for tag SNP File Search Help Behe 2 enm a lo ie _ Show Distance Select Scope Fig 50 Help before and after LD analysis A Before and B after LD analysis Help function is performed by clicking the help box as indicated by arrow lines B It provides extra function to show SNP information for LD plotting such as missing data MAF genotype source 54 Updated 2009 05 07 LD SNPing User Manual 6 Appendix anf Pe o tout oni a PaB Pab Pa _ Total PB P Table 1 Formula for linkage disequilibrium measurement ref 1 Symbol formula P P P P D The difference in proportions
38. kage Disequilibrium plotter and RFLP mining for tag SNP File Search Help N select somo sw SNP2 SNP3 snes SNPS sus SNP7 SNPB supe NP10 SP11 supra SP13 NO1 AA T cc CT cc cT NN TT GG AT AA cc mT CY Sample1 NO2 cr cc cc cc tr wm GG AA NO3 wy NN cr cc cr co GG AT E ce TT cc TT NO4 LAJ cc TT NN cc GG GG TT cc TT f j NO5 NN cc cr cc GG AT Sample2 NO6 Tr cel Era ice oc TT NO7 TA ica ken Ee GG i NO8 miech mic GG NO9 w cc cr cc GG A Sample3 NO10 Cr eg ner GG NO11 cr 1 ee fcc tee T cT Sample4 NO13 TT cT 2 NO14 TT CT f NO15 TT cT TT NO16 TT cT Sample5 NO17 TT CT BESSSESESESESSESES 4 y The Sample 4 use Gene BTD y x The sb 4 has no distance and rsid C h ara cte ri sti cs of sample file it has 34 locus and 89 sample that show LD Graph File Analysis Graph Show 2D Show 3D Help Select Scope Select Left LD Measure p z Select Right LD Measure 20 Updated 2009 05 07 LD SNPing User Manual Ff LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP File Analysis Graph Show 2D Show 3D Help Population Genotype Data ara Missing Data ERE P value Unknown File i es 314 o i Yes osse Noo oo SNPs Unknown Fileinput foo00 Yes Jooo Nee Unknown fFieinpt fo385 No 0 383 enpa fnmo fien o es o 000 SNPo Unknown Fieinpt
39. lable population which is on line retrieved from dbSNP in NCBI see data source The arrow 6 indicates the function for SNP RFLP enzyme information by clicking and its result is shown in Fig 10 B SNP information from dbSNP of NCBI 14 Updated 2009 05 07 LD SNPing User Manual FA Result 1s17884306 RFLP rsID rs 17884306 rs9534275 sequence TGTTGCCCAGGCTGGAGTGGAGTGGC AIG TGATCTTGGCTTACTGCAGCCTTTG Allele Recognition Sequence Commercial Availibility CwAAH C ATG aal z h P U U UOO E O A et CATS ves SoA Hin CATON ves o BA iB ICATG nt BoA HpyCHaICATO S fn BoA HspO2MICATG ves o SA a CATG RGCB a REBASE Commdata Microsoft Internet Explorer SF CHE WAV PHRBA IAT NAH Or4 Bae Om zan O 2 I L Bo o E pare neb comes tinction Google G YBO S ED Ar GAR Puram 2 mM Swe REBASE home page REBASE Suppliers 07 4 2008 Suppliers for CviAlT Suppliers Buffer Reaction Temperature New England Biolabs NEB 4 Green 25 Fig 10 SNP RFLP enzyme information A Output of SNP RFLP enzyme mining information Result of arrow 6 in Fig 9 B On line link to external source REBASE for commercial available SNP RFLP enzyme in the example of CviAll by click the first line in A Animation 15 Updated 2009 05 07 LD SNPing User Manual 4 2 2 Gene input to find rsID data of tagSNP and RFLP enzyme mining On line retrieval of tagSNP in HapMap by HUGO gene nam
40. ly the LD analysis for these selected SNPs is able to perform by Haploview Examples for selected rsIDs are followed rs11571315 rs733618 rs5742909 and rs11571316 2 Updated 2009 05 07 LD SNPing User Manual The patterns of 2D LD plot for LD2SNPing in the example of HapMap CEU and Haploview are completely matched as shown in Fig 18A and Fig 18B respectively A LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP File Analysis Graph Show 2D Show 3D Help Bee fe Contrl L Show Distance C Select Scope Restore Scope a EHR 7 aa E i E n Z O A Select Left LD Measure Select Right LD Measure O aWa soha DOON LH Tataia a File Display LD Plot Analysis Help Haplotypes Check Markers Tagger 1811571315 1511571316 135742909 Low D de N w L1 rs11571315 rs11571315 rs11571315 rs733618 rs733618 rs11571316 L2 rs733618 rs11571316 rs5742909 rs11571316 rs5742909 rs5742909 Cihi Dist 43 188 T int 18 37 Cllow 0 48 0 85 0 38 0 36 0 06 0 42 Fig 18 Comparison of four rsID input and its 2D LD plot in LD2SNPing vs Haploview Four rsID is rs11571315 rs733618 rs5742909 and rs11571316 which is belonging to CTLA4 gene located at chromosome 2 A and B are the 2D LD plots for LD2SNPing Fig 16 and Haploview Fig 17 respectively The D for all pair wised SNPs in Haploview is 1 The for L
41. me information for SNP genotype is implemented Software user manual and video tutorial can be downloaded freely in http bio kuas edu tw LD2SNPing Many animations were provided in the end of each figure legend to help the user to practice the example 4 Updated 2009 05 07 LD SNPing User Manual 2 Installation LD2SNPing is implemented with java code and supported with three dimensional display The system needs the Java Runtime Environment JRE and Java 3D to implement and maintain the system works The Java 3D have been packaged in LD2SNPing If your computer does not support any JRE software you need to download the software in Sun s website http www sun com of JRE Please see the following description for installation Many animations were provided in the end of each figure legend to help the user to practice the example 2 1 System Requirements Programming language Java Runtime Environment JRE needs to be installed Compute system The software using in Pentium4 CPU system 256M RAM and 15M of disk space 2 2 Installing Java 2 2 1 Installing JRE JRE is implementation of Java Application software by the sun LD2SNPing is coded in Java and users can download JRE accurate to operate Users can download the latest version of JRE installed on their computers form http www sun com 2 2 2 Installing Java 3D Java 3D is implementation of a Java three dimensional Application software by the sun LD2SNPing ca
42. n show three dimensional in graphics In order to complete the presentation of graphics the Java 3D have been packaged in LD2SNPing Java 3D needs the environment in DirectX or OpenGL LD2SNPing also needs to use software of Microsoft developed by a standard DirectX If users are unable to implement the LD SNPing programs it is necessary to install the update version in http www microsoft com windows directx detault aspx 2 3 Installing LD SNPing Before the implementation users have to make sure the Java platform application environment has been set correctly The latest version of the LD2SNPing LD2SNPing V2 0 exe can be downloaded from the http bio kuas edu tw LD2SNPing and it is set 5 Updated 2009 05 07 LD SNPing User Manual up step by step with instruction This software is developed and used in the Windows operating system LD2SNPing V2 0 exe can run in any Windows platform but 3D computing needs greater demand for memory function memory requirements proposed in more than 256 M RAM Animation Please click the box to demonstrate Most functions need the internet on line to retrieve all the necessary information except the LD calculation using file input 6 Updated 2009 05 07 LD SNPing User Manual 3 Input Format Before introducing the function of LD2SNPing we firstly list some acceptable input formats such as file gene name and rsID as follows 3 1 File input LD2SNPing accepts four kinds of input
43. name or distance is acceptable in LD SNPing e g SNP10 xls The SNP name is given in the order of SNP1 to SNPn from left to right side in default i e columns A B C D E F G H I and J are set to SNP1 2 3 4 5 6 7 8 9 and 10 respectively 7 Updated 2009 05 07 LD SNPing User Manual 3 1 2 DOC Format In Fig 2 LD2SNPing accepts input format in doc file File without SNP name or distance is acceptable in LD2SNPing The SNP name is given in the order of SNP1 to SNPn from left to right side in default gt Hima SNP ID name optional Pe _ op 112 gt Distance between Tc SNPs optional Fig 2 Input data of Word format The input data format shows the SNP names distances and genotypes This file test02 doc is available from example file folder of LD2SNPing Fig 15 If user install the LD2 SNPing in C then the path to get the example file is followed C Program Files LD2SNPing example 3 1 3 TXT Format In Fig 3 LD2SNPing accepts input format in txt file File without SNP name or distance is acceptable in LD2SNPing The SNP name is given in the order of SNP1 to SNPn from left to right side in default B 402 254 SNP ID name SRA KE BAO KAN HBG optional SNP1 SNP2 SNP3 k 2 50 12 Distance between an cI mn SNPs optional AG CT TT GG TT TT AA ce TT Fig 3 Input data of Txt format The input data format shows the SNP names distances and genoty
44. nce and rsid g of sample file PBEESSESSESSESEEESEESE ithas 34 locus and 89 sample that show LD Graph Fig 7 Sample input type Sample format from the HapMap gene BTD dataset The column without SNP label in the first row is ignored by default The procedures to show the sample file are indicated from arrow 1 to arrow 2 Animation 12 Updated 2009 05 07 LD SNPing User Manual 4 Function of LD SNPing Performing the RunLD2SNPing exe users will enter the main screen of the LD SNPing system program Fig 8 Most functions need the internet on line to retrieve all the necessary information except the LD calculation using file input 4 1 Brief review for the function of LD SNPing Six functions were provided including three LD free functions and three LD available functions as follows LD free functions 1 Single rsID information browser and RFLP enzyme mining On line retrieval of individual SNP information among different populations from NCBI 2 Gene input to find rsID data of tagSNP and RFLP enzyme mining On line retrieval of tagSNP in HapMap by HUGO gene name input 3 RFLP enzyme mining tool using rsID input RFLP enzymes are provided for SNP genotype using rsID input LD available functions 4 File input for LD calculation visualization Formats such as Excel xls and cvs Word doc and NotePad txt 5 Sample file input for the tutorial of LD calculation visualization
45. pes This file test03 txt is available from example file folder of LD2SNPing described later in Fig 15 8 Updated 2009 05 07 LD SNPing User Manual 3 2 Gene input In Fig 4 LD2SNPing accepts gene name HUGO Human Genome Organization input to provide the tagSNP from on line retrieval to the HapMap Therefore the retrieval data are always the most updated as the same as the current version of HapMap HapMap Data Rel 23a phaseII Mar08 on NCBI B36 assembly dbSNP b126 http www hapmap org Ff LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP File Search Help dl oh Oe Input Gene offical symb BRCA2 4 CEU Example BRCA2 1s9534275 Data rs9534275 RFLP rs9943888 Data rs9943888 RFLP 1s11571579 Data 1811571579 RFLP rs206146 Data rs206146 RFLP rs206077 Data rs206077 RFLP 1s573014 Data rs573014 RFLP mers oao aoa OO ec O nr ee OOO osne O Fig 4 Input of gene name The input data format shows the SNP nos SNP rsID and their amie eT corresponding RFLP data The procedures to retrieve the HapMap tagSNP from gene name input e g BRCA2 are indicated from arrow 1 to arrow 5 In arrow 4 the original rsID information in dbSNP of NCBI and its SNP RFLP enzyme information are provided by clicking the box HapMap website http www hapmap org Animationi 9 Updated 2009 05 07 LD SNPing User Manual 3 3 rsID input 3 3 1 Retrieval of the indiv
46. provided for personal preferences zoom in zoom out rotation Fig 47 Zoom in Zoom out and rotation of 3D LD plot This file is available from example file folder of LD2SNPing e g test01 xls Mouse moving under consistent pressing the left bottom of mouse can rotate the orientation of 3D LD plot Rolling the wheel of the mouse also provides the zoom in and zoom out function Animation 51 Updated 2009 05 07 LD SNPing User Manual 4 3 7 5 Changing color for 3D LD plot Six colors are available for selection in 3D LD plotting as shown in Fig 48 Fig 48 Changing color for 3D LD plot Clicking anyone of the select color box indicated by A to F in left side allows the users to change the 3D color This 2D LD plot is drawn using sample file 2 of LD2SNPing No distance information in original data set in the sample file 2 and therefore the diagonal line with white patch is flat Animation 52 Updated 2009 05 07 LD SNPing User Manual 4 3 7 6 Selection of block number for 3D LD plot The current version of LD2SNPing accepts 10 SNPs for maximal visualization In the Fig 49 SNP2 SNP21 and SNP10 SNP31 are screened out the non SNP variant Only the SNPs are provided Select SNP are SNP2 SNP21 Steti SNP are SNP 10 SHP91 Fig 49 Selecting 10 SNPs for 3D LD plot For some nucleotide variants less than 1 not belong to the SNP are not shown in both 2D LD Fig 15 and 3D LD plots Fig 49 respect
47. re Data a iv Output LD graph m Exit i i Save as C example File name SNP1 O distance text Filetype WordPad formate Fig 31 Output information for saving file SNP10 distance xls in example file folder of LD2SNPing is used as an example A Clicking the output LD measure Data users are able to download and save all the text data B The location for saving file is changeable if needed Animation 36 Updated 2009 05 07 LD SNPing User Manual 4 3 5 8 Open text file for output LD measure data In Fig 32 all text data for LD related information are re opened and demonstrated o D ai Oda tteace tbe sct tect Word Pa 4S AGRE DRC OAL FSO H BAHI Mo amp Le th a Lata wkk TOT Tefen Data Roo LO bBiceasure DO waeloe ETP 1 Sry Pot SHF O D 7 SHF Oo SIPS LS ee O11 SFA Le ea 1 3c SHEFES Le pesa E MSS Ls D 1 35 oes et 3 LS ee O11 Le D D O LD wMessure DO walie SHEF co TP oS SMEA r A n a a a Ree LO Wess r wahie SPF 1 cI 1 ITP Oo 140 PJP S G 1 65 ITP O O IPS Ls aa O O m1 O 165 m1 araa On O Domon W LDO Messure Delta walue i oo m m in Ww m h ji nal ITF 1 ITP ITS IPT ITS F OO BOOORRER OOHNOOO Nun a m ji Hm m LDO tests I oreo PTE 1 W a th Le re A A O m1 Se 1 Le ee 25 1A Le ee N Se O 1 S30 e
48. rsion NCBI B36 assembly dbSNP b126 17 Updated 2009 05 07 LD SNPing User Manual 4 2 3 RFLP enzyme mining tool using rsID input RFLP enzymes are provided for SNP genotype using rsID input It is designed to provide RFLP enzyme information for SNP genotype before LD analysis In the LD2SNPing restriction enzymes information for interested SNP e g 189534275 is provided as shown in Fig 13 The restriction enzyme information is downloaded from REBASE The implement of SNP RFLP is similar to our previous publication SNP RFLPing http bio kuas edu tw snp rflp EJ Result RFLP Eels rsID fs9534275 SNP RFLP enzyme information 2 sequence 1 FA Result RFLP rsID 1rs9534275 rs9534275 SNP RFLP enzyme information _ sequence CAAGTAACTTASAAAATGCTTTTATGT AIC CCTAGTGCTATATACCCCAAGAACA Recognition Sequence Commercial Availibility aa omc yes Ei _ASpIGHT OTAC spiz Asp 16H Allele GTAC sp ISHI GTAC GTAC ___ceoP7ai_____ GTAC ___cspel___ G TAC ia GATAC Ri oac HB omc Frio rl eS an E C C ae a ad a JA D A Hpi OTAC Fig 13 Input rsID to search RFLP enzyme data The protocol is listed from arrows 1 to 3 68 different of restriction enzymes are provided for the RFLP enzyme mining of rs9534275 using LD2SNPing Similar explanation is also shown in Fig 10 Only some of the enzymes are listed here due to limited space 18 Updat
49. t csv D7 for vertical horizontal axis for LDoSNPing and XRCC test ped amp XRCC test info for Haploview in the example file folder of LDeSNPing B 1OSNP OS standard format csv for LDs2SNPing and 10SNP OS standard format ped and 10SNP OS standard format info for Haploview in the example file folder of LD2SNPing White color in color adjusted plot is the same pattern as the gray color in LDoSNPing 41 Updated 2009 05 07 LD SNPing User Manual 4 3 6 Graph analysis related functions in 2D LD plot In addition to LD analysis and visualization LD2SNPing also provides the some alternative function for LD analysis The brief review for five graph analysis related functions in 2D LD plot is mentioned below 4 3 6 1 Brief review for five graph analysis related functions in 2D LD plot Since the function of the control panel 1s introduced above we focus on the function with icons as shown in Fig 37 They are described in detail later after Fig 38 B LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP File AnatysisGraph Show 2D Show 3D Help T _ Select Scope Restore Scope Select Left LD Measure Fig 37 Five graph analysis related functions in 2D LD plot SNP10 distance xls in example file folder of LD2SNPing is used as an example A Close the file B Show pie chart C Show bar graph D Show 2D LD plot E Show 3D LD plot 42 Updated 2009 05 07 LD SNPing User Manual
50. tes P value of Hardy Weinberg equilibrium Animation 21 Updated 2009 05 07 LD SNPing User Manual 4 3 3 Multiple rsID ssID information browsers for LD calculation visualization Genotype frequency of different populations for multiple SNPs is retrieved from NCBI on line Therefore the SNP information for all population exited in current version of dbSNP is provided Five SNP rsID with available genotype raw data of HapMap Fig 16 are demonstrated to perform LD visualization in Fig 18A ra LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP File Search Help LD F Reference cluster ID cae TEET Was Frequency HapMap E Simulation Reference cluster ID 733618 Frequency HapMap J Simulation Reference cluster ID 5742909 Frequency m HapMap C Simulation Reference cluster ID 11571316 Frequency m HapMap E Simulation File Search Help BALIRE How many SNPs the user wants to use to calculate pairwise LD Run LD N Ww 2 Reference cluster ID 11571315 Frequency HapMap 9 bi ow m a a 3 2 5 Oan Reference cluster ID 733618 Frequency HapMap m Flg IBIN alg i Silo 1 EA m o a 3 E a 5 oan Reference cluster ID 5742000 Frequency HapMap I4 l 4 g amp z S N g 2 KI
51. ulation which is on line retrieved from dbSNP of NCBI Each SNP genotype frequency is retrieved one by one by clicking the find box Each SNP rsID or ssID for each input window is editable Once finished please click the find box again to update the search Animation 11 Updated 2009 05 07 LD SNPing User Manual 3 4 Sample file input LD2SNPing provides four standard sample files Fig 7 for user to familiar with the acceptable file format Figs 1 3 and to test it In sample 4 it is a real gene dataset downloaded from the HapMap site http hapmap jst go jp hapmappopulations html The characteristics of the sample file are provided Actually LD2SNPing accepts the genotype format in the form of NN N_N and N N N is one of the nucleotides not shown gt LD2SNPing Linkage Disequilibrium plotter and RFLP mining for tag SNP ENN W IRN N 1 m ae Select Sample f ce f T cc 11 cc TT cc TT cc TT ce ar cc tr cc TT cc TT cc TT cc ar cc tT cc TT NN e j ar cc 11 A D GG GG AT GG GG TT GG GG AT Sample2 GG GG IT NN GG TT GG GG TT ee GG GG AT NO10 GG GG AT NO11 GG GG AT woe GG GG AT ciiis NO13 GG GG Tr 2 NO14 GG GG TT NO15 GG GG TT NO16 GG GG AT cc TT SampleS NO17 GG GG AT cc TT a oan a 4 n a ae eee _ The Sample 4 use Gene BTD a X Start i Characteristics The sample 4 has no dista
52. ultiple rsID ssID information browsers for LD calculation visualization P 22 4 3 4 rsID and ssID searching for SNP frequency information P 25 4 3 5 LD calculation and 2D visualization P 28 4 3 5 1 Eight functions in control panel of 2D LD plot P 28 4 3 5 2 Showing omitting the distance between SNPs P 29 4 3 5 3 Scope selection from large to small area of 2D LD plot P 30 4 3 5 4 Visualization of parameter changing of 2D LD plot P 31 4 3 5 5 Color setting for 2D LD display graphics P 32 4 3 5 6 LD measure text data for all SNPs P 35 2 Updated 2009 05 07 LD SNPing User Manual 4 3 5 7 Save text file for output LD measure data P 36 4 3 5 8 Open text file for output LD measure data P 37 4 3 5 9 Save and open image file for output LD measure data and graph P 38 4 3 5 10 Comparison of LD plotting between JLIN and LD2SNPing P 39 4 3 5 11 Comparison of LD plotting between LDA and LD SNPing P 40 4 3 5 12 Comparison of LD plotting between Haploview and LD2SNPing P 41 4 3 6 Graph analysis related functions in 2D LD plot P 42 4 3 6 1 Brief review for five graph analysis related functions in 2D LD plot P 42 4 3 6 2 Close file P 43 4 3 6 3 Analysis graph P 44 4 3 6 3 1 Brief review for all functions in analysis graph P 44 4 3 6 3 2 Analysis graph function Grid graph P 45 4 3 6 3 3 Analysis graph function Bar graph P
53. ushpin and change the color of 3D LD plot Animation 49 Updated 2009 05 07 LD SNPing User Manual 4 3 7 3 Representative view of 3D LD plot The relationship of visualization between 2D LD and 3D LD plots is described in Fig 46 The distance between SNPs is visualized to both 2D LD and 3D LD plots if the distance information is available in SNP data set The height of the diagonal line in 3D LD plot is in proportion to its distance between SNPs in reference to the first SNP distance a SNP2 SNP3 SNP4 Fig 46 Comparison of visualization between 2D LD and 3D LD This file is available from example file folder of LD2SNPing e g test01 xls A and B are the visualization for 2D LD and 3D LD respectively The distance indicated by arrow is presented to the diagonal line with white patch in proportion to its height The scales for left and right LD measure are changeable as mentioned in 2D LD plot Broken arrow line in A indicates the lower D value for SNP3 vs SNP1 In consistence it is clear that no mountain appears in SNP3 vs SNP1 B Please see Fig 47 for detail modification steps Animation 50 Updated 2009 05 07 LD SNPing User Manual 4 3 7 4 Zoom in zoom out and rotation of 3D LD plot LD2SNPing can rotate the orientation of 3D LD plot as well as zoom in and zoom out Fig 47 In order to avoid out of memory it provides maximal 10 SNPs for 3D LD visualization Six different graphic screens are
Download Pdf Manuals
Related Search