Genotyping Insulin HphI Polymorph
Contents
1. Equipment ABI PRISM 7700 Sequence Detection System Applied Biosystems Primers and Probes PCR primers and TaqMan probes synthesized by Biotechnology Core Facility Scientific Resources Program NCID CDC and are listed in the following table NOTE All TaqMan Probes are synthesized with a dark quencher QSY7 Primers Probes Orientation Disease Association Nucleotide Sequence Fluorescent Label INSPR FW primer Forward N A 5 ctgggctcgtgaagcatgt 3 None INSPR REV primer Reverse N A 5 gcaggaggcgcatcca 3 None INSPB A probe Sense Associated 5 ccctgcctgtcacccagatcactg 3 5 end TET INSPB T probe Sense Not Associated 5 ccctgcctgtctcccagatcactg 3 5 end FAM Procedure A Control DNA preparation Two controls a homozygous and homozygous are amplified from their respective genomic DNA with each run The genotypes of these controls were verified by DNA sequence analysis and Sequence Specific Oligonucleotide PCR They are separately stored in sterile 2 ml microcentirfuge tubes in a concentration of 25 ng ul B Polymerase Chain Reaction PCR Protocol NOTE Preparations for amplification should be performed in designated Pre amplification area of the laboratory 1 Record the ID of the samples to be typed and assign an internal ID number to each sample 2 Label the Optical 96 well reaction plate appropriately and place it into a MicroAmp 96 Well base 3 Place the plate base and a 1 5 ml microcentrifuge t2. Reference Ranges Normal Values The role of the insulin region in type diabetes has been identified by various laboratories using association studies This region named IDDM2 has several polymorphisms as well as a variable nucleotide repeat VNTR in the 5 upstream region The 23 Hph I polymorphism has been shown to segregate with the class I VNTR which has been implicated in disease susceptibility Additionally Halminen et al has found in the Finnish population that the Hph I polymorphism appears to be associated with type 1 diabetics especially in the absence of the DR4 susceptibility haplotype There are only three possible genotypes in the test population so far i e homozygous AA homozygous TT and heterozygous AT thus we obtain a yes no answer for each genotype Critical Call Results Panic Values Not applicable Specimen storage and Handling during testing The blood specimens are received by the laboratory in 50 ml Falcon tubes partially processed up to the cell lysis stage see Appendix A At this stage the specimens can be stored at room temperature for 18 months Fully processed DNA can be stored at 209C indefinitely Prior to testing DNA can be thawed at room temperature for 10 30 minutes 16 Alternative methods for performing test or storing specimens if test system fails The test presented here is the simplest method available When a test fails it generally falls into one of the reasons
3. Export Results from the Alleluia Discrimination document This will create an Excel document with the results displayed in a table form Proofread and save the results in the sample database N U A 22 Appendix E Detection of the Insulin Gene 23 Hph I Polymorphism using Sequence Specific Oligonucleotides SSO Materials QIAGEN HotStarTaq Master Mix Kit QIAGEN Inc Valencia CA MicroAmp Reaction Tubes with Caps Part No N801 0540 Applied Biosystems Foster City CA MicroAmp Bases Part No N801 0531 Applied Biosystems Foster City CA MicroAmp Trays Part No N801 0541 Applied Biosystems Foster City CA FinePoint Aerosol Resistant Tips Rainin Emeryville CAPCR primers synthesized by Biotechnology Core Facility Scientific Resources Program NCID CDC and listed in the table below Primer Name Orientation Genotype Nucleotide Sequence _ NSFWD forward N A tecaggacaggetgcatcag INS REV A reverse HphI cagaaggacagtgatctggga INS REV T reverse Hph I cagaaggacagtgatctgget Deionized water Ultra pure Agarose Gibco BRL Rockville MD 1X TBE buffer made from 10X TBE Low DNA Mass Ladder Catalog No 10068 013 Gibco BRL Rockville MD Gel Loading Dye Orange G Ficoll 400 EDTA Sigma St Luis MO Ethidium Bromide Ameresco Solon OH Equipment Rainin Pipettors Rainin Emeryville CA GeneAmp PCR System 9700 thermal cycler Part No N805 0001 Applied Biosystems Foster City CA Electrophoresis uni
4. INS REV A or INS REV T variable 0 4 pM final conc Sample DNA variable 100 400 ng Deionized water enough to bring the total reaction volume to 25 ul Total Volume 25ul For the negative control instead of Sample DNA add the same amount of deionized water 4 Cap all PCR tubes shake each tube briefly on the Vortexer and spin down in the microcentifuge 5 6 7 Put the tubes on a MicroAmp tray and place them into the thermal cycler sample block Program the GeneAmp PCR System 9700 thermal cycler for amplification with HotStarTag DNA Polymerase as follows consult the GeneAmp PCR System 9700 User s Manual for additional information on programming and operation of the thermal cycler 1 Initial Activation Step 10 min at 95 C 2 3 step cycling 45 sec at 95 C 1 min at 63 C 1 min at 72 C Repeat 30 times 30 cycles 3 Final Extension 7 min at 72 C 4 Hold program forever at 4 C Run the program The program runs for approximately 1 6 hours Gel Electrophoresis to Visualize PCR products 1 Prepare a 2 agarose gel of the desired size using ultra pure agarose and x TBE as follows weigh the appropriate amount of agarose and place it in a flask of a volume at least 1 5 times larger than the final volume of the agarose gel solution being prepared Add the appropriate volume of 1x TBE to the agarose to get the right concentration Cover the flask with plastic wrap and poke a hole for ventilation Place the flask
5. amplification product that can be visually identified by gel electrophoresis Thus for homozygous TT and homozygous AA genotypes only one of the two reactions will give a successful amplification while for heterozygous genotypes both reactions will be successful The ABI 7700 allelic discrimination assay will be used as the primary assay for insulin genotyping however the SSO PCR assay will be used in cases where it can resolve discrepancies 2 Safety Precautions Standard safety precautions should be observed including wearing safety glasses lab coats and gloves during the preparation of blood specimens Follow Universal Precautions when handling all blood and blood products Vaccination for hepatitis B is strongly encouraged Laboratory items exposed to blood or blood products should be disposed of or decontaminated in compliance with guidelines from the Office of Health and Safety CDC The following chemicals are used in this genotyping process Ethidium Bromide EtBr Ethidium Bromide is used to visualize double stranded DNA that has been separated by size on an agarose acrylamide gel matrix The EtBr intercolates into double stranded DNA and will 3 fluoresce when visualized on a UV transilluminator EtBr is a potential carcinogen and extreme caution should be taken when working with this chemical Observe all safety precautions such as wearing a lab coat fresh gloves and protective eyewcar HiDi Formamide HiD
6. deionized water Primers PCR primers synthesized by Biotechnology Core Facility Scientific Resources Program NCID CDC are listed in the following table FAM AmeloF primer 5 FAM ccctgggctctgtaaagaatagtg 3 AmeloR primer 5 atcagagcttaaactgggaagctg 3 FAM THOIR primer 5 FAM gtgggctaaaagctcccgattat 3 TOIF primer 5 attcaaagggtatctgggctctgg 3 Eguipment Geneamp PCR System 9700 Applied Biosystems Foster City CA ABI PRISM 377 DNA seguencer Applied Biosystems Rainin pipettors Rainin Emeryville CA Stratalinker 2400 UV Crosslinker Stratagene La Jolla CA Vortex Genie Diagger Lincolnshire IL Heating block Computer and software for analysis with GeneScan and Genotyper Software Applied Biosystems Labeling Label all reagents and aliguots of reagents with the reagent name concentration date prepared and appropriate expiration date Labels are created using computer label making system Label View Pro and Eltron printer Reagent Preparation 10X TBE for sequencing Final concentration g L 890 mM Tris Base Trizma Base 108g 890 mM Boric Acid 55g 20 mM Disodium EDTA 744g Add deionized water to a final volume of 1000 mL mix thoroughly and filter through lt 0 45mm membrane Store at room temperature and do not use if precipitate forms For 1X TBE for seguencing dilute 150mL of the 10X TBE stock and bring the volume up to 1 5 L 18 PCR Amplification 1 Record ID of samples to be typed and assign
7. for appropriate amounts of reagents see table after section E A Cell Lysis Gye te Add appropriate cell volume to a 50 ml Falcon tube Spin in a centrifuge at 2 000xg for 5 minutes Remove the supernatant leaving behind the white pellet and a small volume of liquid Vortex each tube to resuspend cells Add appropriate volume of the Cell Lysis Solution to the cells and pipette up and down to lyse the cells Incubation is usually not required however if cell clumps are visible incubate at 37 C until the solution is homogenous and no clumps are detected NOTE The samples are stable in the cell lysis solution for at least 18 months at room temperature B RNase Treatment 1 2 Add appropriate volume of RNaseA Solution to the cell lysate solutions in the Falcon tubes Mix by inverting the tube 25 times and then incubate at 379C for 60 minutes D Protein Precipitation 1 2r 3 4 Cool samples at room temperature Add appropriate volume of the Protein Precipitation Solution to the cell lysate solutions Vortex for 20 seconds Centrifuge at 2 000xg for 12 minutes The precipitated proteins should form a tight dark brown pellet If the protein pellet is not tight repeat step 3 followed by incubation on ice for 5 minutes and then repeat step 4 E DNA Precipitation 1 2 U GON Pour the supernatant containing the DNA leaving the protein pellet behind into a clean 50 ml tube containing appropria
8. Hph I polymorphism ABI PRISM 7700 Sequence Detection assay a b If the Control DNA failed to amplify repeat the test If there is still no amplification try new reagents If a given unknown specimen failed to amplify repeat the test in the next available run If it failed to amplify again re isolate the DNA using the stored blood sample and repeat the test If all samples including the controls fail to amplify it is likely due to one of the following reasons 1 incorrect thermal cycle program 2 interruption during the PCR run i e power outage which will be registered in the history record of the instrument or 3 an error in the PCR reaction mixture or 4 an error in the data analysis such as not selecting none for the quencher in the Sample Type Pellet when using a dark quencher If any of the three control DNA samples give unexpected genotypes the entire assay including specimen preparation amplification and detection should be repeated Insulin gene 23 Hph I polymorphism SSO genotyping a b If the Control DNA failed to amplify repeat the test If there is still no amplification try new reagents If a given unknown specimen failed to amplify repeat the test in the next available run If it failed to amplify again re isolate the DNA using the stored blood sample and repeat the test If all samples including the controls fail to amplify it is likely due to one of the following reasons 1 inco
9. allelic discrimination assay that has been developed for the ABI PRISM 7700 Seguence Detection instrument This assay utilizes two probes one with seguence complementary to the T polymorphism referred to as since it has been shown to be associated with type 1 diabetes and one with sequence complementary to the A polymorphism referred to as since it is not associated with type 1 diabetes These probes will only bind to an individual s DNA when there is an exact match at the 23 polymorphism During the PCR amplification process the Tag Polymerase enzyme will encounter the bound probe and displace and destroy the probe This process releases a bound fluorescent molecule that is then detectable by the ABI PRISM 7700 Sequence Detector Each of the two probes has a unique fluorescent reporter molecule indicating the state of the polymorphism on each of the individual s two chromosome 11s The second assay to detect the 23 polymorphism is a sequence specific oligonucletide SSO PCR based assay Two PCR primers are developed which are complementary to either the A or T polymorphism at the 3 end such that each primer will only recognize one of the two possible variants at the 23 polymorphism Each SSO primer is paired with a common forward primer to produce an amplified product For each specimen two PCR reactions are set up one for each primer set Only the reactions that find complementary sequence in the individual s DNA will give an
10. in a microwave oven and heat until all the agarose goes into solution ATTENTION Since the flask becomes hot in the microwave use appropriate protection when handling it Take the flask out and visually inspect the solution to make sure that all the agarose has dissolved If the viscous agarose is still visible return the flask into the microwave and heat for a few more seconds Repeat if necessary Take out the flask from the microwave and set aside to cool to approximately 609C or until it can be handled comfortably While the agarose mixture is cooling prepare a casting tray with the appropriate combs to give the desired number of wells There should be one 1 well for each sample and one 1 additional well per row of wells for a marker DNA ladder Pour cooled agarose gel mixture into the tray and leave gel to polymerize for at least 30 minutes Remove all combs and place the gel into an electrophoresis unit with enough 1x TBE buffer to cover 24 8 Combine 4 1 of the Low DNA Mass Ladder with 3 1 of loading dye and pipette into the first well Do this for each row of wells 9 Combine 4 1 of each sample and 3 1 of loading dye and pipette into designated wells 10 Start electrophoresis and run on 80 volts for 30 45 minutes 11 Stain the gel in a staining solution 20 1 Ethidium Bromide per 1L of 1 x TBE for 5 minutes and then de stain it in 1 x TBE for 10 minutes 12 Place the gel into the UV transilluminator of the Alphalm
11. mentioned in item 10 If the instrument fails during a run the test must be repeated using remaining DNA which has been stored at 49C short term or 209C long term 17 Test Result Reporting Systems Protocol for reporting critical calls If applicable Each allele is reported according to standard HLA nomenclature Anthony Nolan Web site www anthonynolan com Results are proof read and entered into a common database and given to the 18 supervisor for review After review of raw data the supervisor forwards the final report to the Molecular Biology Branch Chief and EHLS division director for final approval The approved report is forwarded to reguestor Critical calls are not applicable Transfer or Referral of Specimens Procedures for Specimen Accountability and Tracking Standard record keeping means including the use of Excel and or Access database software should be used to track specimens It is recommended that records be maintained for 2 years including related QC data and that duplicate records be kept in electronic or hard copy format Only numerical identifiers will be available e g Patient Participant ID numbers 10 References 10 11 12 13 14 Eisenbarth G S Type I diabetes mellitus A chronic autoimmune disease Review 81 refs New England Journal of Medicine 314 1360 8 1986 LaPorte R amp Cruickshanks K in Diabetes in America eds MI H amp RF H NIH publication no 85 1
12. 468 National Diabetes Data Group 1985 Juvenile Diabetes Foundation International www jdf org publications diabetesfacts html 1999 Todd J A From genome to aetiology in a multifactorial disease type diabetes Bioessays 21 164 74 1998 She J X amp Marron M P Genetic susceptibility factors in type 1 diabetes linkage disequilibrium and functional analyses Curr Opin Immunol 10 682 9 1998 Lucassen A M ef al Susceptibility to insulin dependent diabetes mellitus maps to a 4 1 kb segment of DNA spanning the insulin gene and associated VNTR Nature Genetics 4 305 10 1993 Owerbach D amp Gabbay K H Localization of a type I diabetes susceptibility locus to the variable tandem repeat region flanking the insulin gene Diabetes 42 1708 14 1993 Bell G I Horita S amp Karam J H A polymorphic locus near the human insulin gene is associated with insulin dependent diabetes mellitus Diabetes 33 176 83 1984 Bain S C ef al Insulin gene region encoded susceptibility to type diabetes is not restricted to HLA DR4 positive individuals Nature Genetics 2 212 5 1992 Davies J L et al A genome wide search for human type diabetes susceptibility genes Nature 371 130 6 1994 Julier C et al Multiple DNA variant association analysis application to the insulin gene region in type I diabetes American Journal of Human Genetics 55 1247 54 1994 Undlien D E et al Insulin gene region encoded su
13. AmpFISTR Green I PCR Amplification Kit catalog 402902 Applied Biosystems Foster City CA AmpF STR Green I PCR Amplification Kit User s Manual catalog 402944 Applied Biosystems Performance Optimized Polymer 4 POP 4 catalog 402838 Applied Biosystems MicroAmp 8 Strip Reaction Tubes 0 2ml catalog N801 0580 Applied Biosystems MicroAmp Caps 8 caps strip catalog N801 0535 Applied Biosystems MicroAmp 96 Well Tray Retainer catalog 403081 Applied Biosystems 0 5ml Genetic Analyzer sample tubes and septum catalog 401957 and 401956 Applied Biosystems Rainin pipette tips Rainin Emeryville CA 1 5ml microfuge tubes Marsh Biomedical Products Rochester NY 1xTE 10mM Tris HCl 0 1mM EDTA pH 8 0 Hi Di formamide catalog 4311320 Applied Biosystems GeneScan 350 ROX Internal Lane Size Standard catalog 401735 Applied Biosystems Foster City CA 10x Genetic Analyzer Buffer with EDTA catalog 402824 Applied Biosystems Performance Optimized Polymer 4 POP 4 Applied Biosystems Equipment GeneAmp PCR System 9700 Applied Biosystems Foster City CA ABI PRISM 310 DNA sequencer Applied Biosystems Rainin pipettors Rainin Emeryville CA Stratalinker 2400 UV Crosslinker Stratagene La Jolla CA Vortex Genie Daigger Lincolnshire IL Heating block Computer and software for analysis with GeneScan and Genotyper Software Applied Biosystems Labeling Label all reagents and aliquots of reagents with the reagent n
14. Persons using assistive technology may not be able to fully access information in this file For assistance e mail niddk cr imsweb com Include the Web site and filename in your message Detection of the Insulin Gene Hph I Polymorphism using Seguence Specific Oligonucleotides SSO Table of Contents Page number Summary of Test Principle and Clinical Relevance Safety Precautions Computerization Data System Management Specimen collection Storage and Handling Procedures Procedures for Microscopic Examination Criteria for Specimen Rejection Preparation of Reagents Calibrators standards Controls and All Other Materials Equipment and Instrumentation Reagents Reagent preparation Standards Controls Equipment and materials Instrumentation 7 Calibration and Calibration verification Procedures 8 Procedure Operating Instructions Calculations Interpretation of Results a Procedure b Calculations c Interpretation of Results 9 Reportable Range of Results 10 Quality Control QC Procedures Quality Control Principles Preparation of Quality Control Materials 11 Remedial Action if Calibration or QC Systems fail to meet acceptable criteria 12 Limitation of Method Interfering Substances and Conditions 13 Reference Ranges Normal Values 14 Critical Call Results 15 Specimen Storage and Handling During Testing 16 Alternate Methods for Performing Test or Storing Specimens if Test System Fails 17 Test Result Reporting System Proto
15. Systems contains the Red Blood Cell Lysis Solution RBC Lysis Solution Cell Lysis Solution RNase Solution Proteins Precipitation Solution and DNA Hybridization Solution All reagents except the RNase solution are stable at room temperature until the expiration date indicated by the manufacturer The RNase Solution is stable at 4 C until the expiration date The AmpF STR Green I PCR Amplification Kit is stored at 4 C until the manufacture s expiration date Check the expiration date before each use and discard the kit after the expiration date The HiDi Formamide is aliquoted into separate tubes and stored at 20 C QIAGEN HotStarTaq Master Mix This reagent should be stored at 20 C and is stable until the expiration date indicated by the manufacturer TaqMan Universal PCR Mastermix This reagent should be stored at 4 C and is stable until the expiration date indicated by the manufacturer PCR primers and probes synthesized by Biotechnology Core Facility Scientific Resources Program NCID CDC Primers should be stored at 20 C and labeled probes should be stored at 4 C Preparation of Reagents See Appendix A B and C Standards This is a qualitative assay and calibration standards are not used See Part 7 Controls For the AmpF STR Green J Human Identification Assay a positive control of a previously genotyped DNA and a negative no template control control are tested with each PCR amplification run With each
16. agents NOTE prepare all reagents and aliquots in a designated Reagent Area and record the date reagents were opened Purification Protocol NOTE use universal precautions when working with blood and perform all steps in a biological safety cabinet to avoid contamination or exposure to biological agents within the blood Record the ID of samples to be extracted and assign a temporary ID number to each for example 1 10 Label all processing tubes and columns with the temporary ID number A Cell Lysis 1 Label 50 ml Falcon tubes appropriately and fill each with 30 ml of Red Blood Cell Lysis solution RBC 2 Add 10 ml of whole blood to the appropriately labeled Falcon tube containing the RBC lysis solution Invert the tubes to mix and incubate for 10 minutes at room temperature Invert the tubes at least once during incubation Spin in a centrifuge at 2 000xg for 10 minutes Remove the supernatant leaving behind the white pellet and approximately 200 400 ul of liguid Vortex each tube to resuspend cells Add 10 ml of the Cell Lysis Solution to the cells and pipette up and down to lyse the cells Incubation is usually not required however if cell clumps are visible incubate at 37 C until the solution is homogenous and no clumps are detected NOTE the samples are stable in the cell lysis solution for at least 18 months at room temperature U E e B RNase Treatement 1 Add 50 ul RNaseA Solution to the cell lysate solut
17. ager 2200 Documentation System photograph the gel and record the results Interpretation of Results The genotype of each sample can be determined by the presence seen as a band on the gel or absence of amplicons after PCR with a given pair of primers The gel should have the following banding pattern for the three genotypes 25 Genotype Primer Pairs Homozygous A Homozygous T Heterozygous INS FWD INS REV A Band No band Band INS FWD INS REV T No band Band Band
18. ame concentration date prepared and appropriate expiration date Labels are created using computer label making system Label View Pro and Eltron printer Procedures A PCR Amplification 1 Record the ID of the samples to be typed and assign an internal ID number to each sample 2 Label all processing MicroAmp 8 Strip Reaction Tubes 0 2 ml with the internal ID number and place them into a MicroAmp 96 Well Tray Retainer There should be a tube for the samples positive control and negative control 3 Place the MicroAmp tubes Tray and a 1 5 ml microcentrifuge tube into the Stratalinker Stratagene and UV crosslink twice at 120 joules 1200 on LED display to sterilize the tubes Remove the tubes from the Stratalinker 4 Prepare a master mix of the following composition in a 1 5 ml microcentrifuge tube all reagents are supplied in the AmpFISTR Green I PCR Amplification Kit number of samples x 10 5 ul of AmpF STR PCR reaction Mix number of samples x 0 5 ul of AmpliTag Gold DNA Polymerase number of samples x 5 5 ul of AmpFISTR Green I Primer number of samples x 9 9 ul of deionized water 5 Mix by vortexing 6 Dispense 24 ul of the master mix into each of the MicroAmp Reaction Tubes 16 7 Into each of the tubes containing the master mix pipet 1 ul of genomic DNA 25 ng 8 To the designated Positive Control tube add 1 ul 25ng of Control DNA and to designated Negative Control tube add 1 ul of 1xTE buffer NOTE the final volume
19. an internal ID number to each sample 2 Label all processing MicroAmp 8 Strip Reaction Tubes 0 2ml tubes with the internal ID number and place them into a MicroAmp 96 Well Tray Retainer There will be a positive and negative control tube as well 3 Place the MicroAmp tubes Tray and a 1 5ml microcentrifuge tube into the Stratalinker Stratagene and UV crosslink twice at 120 joules 1200 on LED display to sterilize the tubes prior to use to avoid contamination 4 Make a master mix of the following contents in a 1 5ml microcentrifuge tube of samples x 12 5 ul of HotStarTag Master Mix of samples x 1 0 ul of FAM AmeloF primer 3 6 pM ul ff of samples x 1 0 ul of AmeloR primer 3 6 pM ul of samples x 1 0 ul of THOIF primer 8 pM yl of samples x 1 0 ul of FAM THOIR primer 8 pM yl of samples x 7 5 ul of water 5 Mix by Vortexing 6 Dispence 24 ul of the master mix into each of the MicroAmp Reaction Tubes 7 To each of the tubes containing master mix pipet 1ul of Genomic DNA at a concentration of 25 ng ml 8 For the Positive Control tube add 11 of the selected control to the tube and for the Negative control tube add 1 ul of water Note The final volume for the PCR is 25 ul 9 Place the MicroAmp Caps on the tubes and seal tightly 10 Place the Tubes in the thermal cycler Geneamp PCR System 9700 and program the following conditions into the machine and start the run under the reaction volume of 25ml refer to the Genea
20. col for Reporting Critical Calls if applicable 18 Transfer or Referral of Specimens Procedures for Specimen Accountability Se E J bo de W IN IN rh o jae op Is IND ISO XO ISO S OD 3 IVI IID IDV ION ID ID O B IB IB BB and Tracking 10 19 References 11 20 Appendix A Puregene Method for DNA Isolation from Whole Blood and Cell Culture for PCR using the Puregene Genomic DNA Isolation Kit 12 21 Appendix B Human Identification with Short Tandem Repeat Loci using the AmpF STR Green I PCR Amplification Kit 16 22 Appendix C Identification of the Amelogenin and THOI Markers 18 23 Appendix D Detection of the Insulin Gene 23 Hph I Polymorphism using the ABI PRISM 7700 Sequence Detection System 21 24 Appendix E Detection of the Insulin Gene 23 Hph I Polymorphism using sequence Specific Oligonucleotides SSO 23 1 Summary of Test Principle and Clinical Relevance Type 1 diabetes mellitus is a chronic autoimmune disease that involves a T cell mediated destruction of the pancreatic beta cells the body s sole source for insulin This disorder is the most common chronic disease among children and young adults Complications include kidney failure blindness amputations nerve damage as well as an increased risk for heart attacks and strokes Type 1 diabetes has been shown to involve a genetic component and an enviro
21. documentation system any vendor Incubator any vendor Vortex Genie Daigger Lincolnshire IL Heating block any vendor Balance any vendor PipetAid Drummond Daigger Lincolnshire IL Dispensette III volume dispenser for reagents Daigger Lincolnshire IL Micropipettors any vendor Micropipettes with filter aerosol tips any vendor Sterile individually wrapped transfer pipettes any vendor 50 ml Falcon tubes any vendor MicroAmp 8 Strip Reaction Tubes 0 2 ml Applied Biosystems MicroAmp Caps 8 caps strip Applied Biosystems MicroAmp Reaction tubes with caps tube trays and bases Applied Biosystems Foster City CA MicroAmp 96 Well Tray Retainer Applied Biosystems Racks for centrifuge tubes and blood tubes any vendor 0 5 ml Genetic Analyzer sample tubes and septa Applied Biosystems 1 5 ml microfuge tubes any vendor Deionized water Ultra pure agarose Gibco BRL Rockville MD GeneScan 350 ROX Internal Lane Size Standard Applied Biosystems Foster City CA Hi Di formamide Applied Biosystems ABI PRISM 7700 Sequence Detection System Applied Biosystems TaqMan Universal PCR Mater Mix Applied Biosystems Foster City CA 10 X TBE Buffer any vendor 10x Genetic Analyzer Buffer with EDTA Applied Biosystems 1xTE 10mM Tris HCl 0 1mM EDTA pH 8 0 any vendor DNA ladder any vendor Gel loading dye any vendor Ethidium Bromide any vendor 70 ethanol any vendor 100 isopropanol any ven
22. dor Glass flasks any vendor Nitrile gloves any vendor Disposable towels and tissues any vendor Disposable bench top covers any vendor Boekel Orbital Rocker Boekel Scientific Inc Feasterville PA Instrumentation The GeneAmp PCR System 9700 is an automated thermal cycler with interchangeable sample blocks used to carry out PCR amplification reactions Methods instructions that specify how the instrument should heat or cool samples in a PCR thermal profile are programmed and stored in the instrument software The GeneAmp PCR System 9700 offers greater speed oil free operation lower reaction volumes and cycle time reproducibility The Perkin Elmer ABI Prism 310 and 3100 Genetic Analyzers can be used for both fragment analysis as well as for sequencing applications All instruments utilize electrophoresis laser excitation and detection via a charged coupled device CCD camera which provides simultaneous detection of all four colors from a single sample run The ABI PRISM 7700 Sequence Detection System contains a built in 96 well thermal cycler To induce fluorescence during PCR laser light is distributed to the 96 wells via a multiplexed array of optical fibers The resulting fluorescent emission returns via the fibers and is directed to a spectrograph with a charge coupled device CCD camera Calibration and Calibration Verification Procedures The GeneAmp 9700 thermal cycler the ABI PRISM 7700 Sequenc
23. e Detection System and the ABI Prism 310 and 3100 Genetic analyzers are pre calibrated by the respective manufacturer and annual preventive maintenance is preformed by the manufacturer s authorized service representative This PCR based genotyping assay is a qualitative test There are only three possible genotypes in the test population i e homozygous AA homozygous TT and heterozygous AT thus we obtain a yes no answer for each genotype If the three in house controls fail to yield correct results in a run then the test is repeated see section 11 Procedure Operating Instructions Calculations Interpretation of Results a b Procedure See Appendix A B and C for DNA extraction amplification and detection Calculations This is a gualitative assay and calculation is not used See item 7 for details Interpretation of results AmpF STR Green I Human Identification Assay The AmpF STR Green I PCR Amplification Kit amplifies the THO1 TPOX CSF1PO short tandem repeat loci In addition the primers included in the AmpF STR Green I Primer set amplify the Amelogenin locus which can be used for gender determination The amplification products are run on an ABI PRISM instrument and the collected multicolor fluorescent data is analyzed using GeneScan Analysis Software The Genotyper Software converts fragment sizes to genotypes which can then be uploaded into a database Identification of Amelogenin and THO1 Markers This PCR based meth
24. ed in the AmpF STR Green I PCR Amplification Kit at a set concentration The control DNA is stored at 49C in a designated Reagent Preparation Area and the Allelic Ladder is stored at 49C in an Amplification Detection Area of the laboratory where amplified DNA is in use Identification of Amelogenin and THO1 Markers An in house control DNA of a known genotype and an in house allelic ladder are prepared at a set concentration The in house control DNA is stored at 20C in a clean laboratory and the in house allelic ladder is stored at 4C in a dirty laboratory where amplified DNA is in use For the insulin gene 23 Hph I Polymorphism SSO detection assay in house control DNA samples with known genotypes homozygous AA homozygous TT and heterozygous AT serve as both positive and negative controls for the PCR reaction 200 ng of each DNA sample is used for the controls with every PCR reaction Control DNA is labeled with a unigue identification number and the date prepared DNA is stored at 20 C For the insulin gene 23 Hph I Polymorphism ABI PRISM 7700 Sequence Detection assay in house control DNA samples with known genotypes homozygous AA homozygous TT and heterozygous AT are used as positive controls for each PCR reaction 50 ng of each DNA sample is used for the controls Control DNA is labeled with a unique identification number and the date prepared DNA is stored at 20 C No template Controls are used as negative con
25. er to a Microsoft Access database created to store all raw data generated in the GoKinD study Only authorized personnel from the Molecular Biology Branch as determined by the supervisor have access to this database Analyzed genotype results are recorded by the analyst in a Microsoft Access database located on CDC s LAN and only authorized personnel from the Molecular Biology Branch as determined by the supervisor have access to the data 4 Specimen Collection Storage and Handling Procedures Criteria for Specimen Rejection a Specimen collection Whole blood obtained with EDTA as an anticoagulant may be used All 10 ml of the venous blood collected will be processed for DNA Specimen storage Blood samples which have been processed by the Puregene method through the cell lysis step see Appendix A can be stored at room temperature for up to eighteen months Extracted DNA can also be stored at 20EC indefinitely until assayed Freeze Thaw effect Repeated freeze thaws may cause slight fragmentation of DNA However the size DNA targeted for amplification is very small lt 400bp and there is no documented deleterious effect of freeze thaw on this test Procedures For Microscopic Examination Criteria for Rejection of Inadequately prepared slides Not applicable for this procedure Preparation of Reagents Calibrators standards Controls and All Other Materials a Reagents The Puregene DNA Isolation Kit Gentra
26. es 15 sec at 95 C 1 min at 60 Perform analysis according to the user s manual Plate Read Data Collection Allelic Discrimination Create an Allelic Discrimination plate document Refer to the ABI PRISM 7700 Sequence Detection System User s Manual for details Perform a Post PCR Plate Read Perform analysis according to the user s manual D Genotype Determination 1 Open the Real Time plate document containing the collected data Perform analysis according to the user s manual and examine the mulitcomponent results The homozygous controls will have an increase of fluorescence of TET relative to FAM and the homozaygous controls will have an increase in fluorescence of FAM relative to TET No significant increase in fluorescence should be observed in the no template controls After insuring that all the control results are correct inspect the multicomponent results of individual unknown specimens Open the Allelic Discrimination plate document containing the Plate Read data Perform analysis according to the user s manual Open Allelic Discrimination from the Analysis menu Examine the allelic calls made for the controls and make sure that they have been called correctly If here are any samples or controls that are not clustered with the other samples and controls of the same genotype on the graph go back to the Real Time plate document and examine the mutlicomponent results to make you judgment 5
27. fication of Amelogenin and THO1 Markers is considered out of control if 1 The electropherogram for the fragment analysis contains less than 2 or greater than 4 peaks 2 The GeneScan 350 ROX Internal Lane standard does not show up on the electropherogram or 3 The signal is too weak on the electropherogram If the run is declared out of control the fragment analysis should be repeated If the run is out of control again the PCR as well as the fragment analysis is repeated The Insulin gene 23 Hph I Polymorphism ABI PRISM 7700 Seguence Detection Assay is considered out of control if 1 No template controls are assigned a genotype by allelic discrimination or if they display and increase in fluorescence intensity in either reporter dye 2 Positive control homozyougs replicas of either allele fail to show an increase in emission intensity of the reporter dye specifically associated with each allele relative to the no template controls The insulin gene 23 Hph I Polymorphism SSO Detection Assay is considered out of control if 1 No amplified DNA can be detected from the PCR amplification product 2 Nny of the in house control DNA amplification products give unexpected genotypes If the assay is declared out of control the experiment is invalidated and repeated Preparation of controls For the AmpF STR Green I human identification assay Control DNA of a known Genotype and a Green I Allelic Ladder are suppli
28. i Formamide is used in small amounts within the laboratory to resuspend DNA for automated sequencing also found in Template Suppression Reagent Formamide is a teratogen which can affect fetal development Always exhibit extreme caution while in contact with formamide and observe all safety precautions such as wearing a lab coat fresh gloves and protective eyewear Note women who are or plan to become pregnant should not work with formamide due to its adverse effects on fetal development Performance Optimized Polymer 4 POP 4 This polymer is used within the automated seguencers and acts as medium through which DNA samples are transported through capillaries This polymer contains high amounts of urea which is a potential mutagen and has been shown to have reproductive and tumorigenic effects Observe all safety precautions such as lab coat fresh gloves and protective eyewcar Acrylamide Acrylamide is used to pour the large sequencing gel used on the Applied Biosystems 377 Genetic analyzer Acrylamide is a poison neurotoxin irritant carcinogen and possible teratogen The effects of this chemical are cumulative so always use it with the upmost caution Observe all safety precautions such as lab coat fresh gloves and protective eyewear Computerization Data System Management Integrity of specimen data generated by this method is maintained by proofreading all transcribed data by the analyst All data is copied to a CD R for transf
29. identification run the control DNA and a Green I Allelic Ladder is always tested For the insulin gene 23 Hph I Polymorphism SSO Detection Assay and ABI PRISM 7700 Assay in house control DNA samples of known genotypes are used as controls for each of the possible genotypes homozygous homozygous and heterozygous No template reactions are used as negative control Identification of Amelogenin and THO1 Markers An in house control DNA of a known genotype and an in house allelic ladder are prepared at a set concentration The in house control DNA is stored at 20C in a clean laboratory and the in house allelic ladder is stored at 4C in a dirty laboratory where amplified DNA is in use Equipment and Materials AmpF STR Green I PCR Amplification Kit Applied Biosystems Foster City CA AmpF STR Green I PCR Amplification Kit User s Manual Applied Biosystems Performance Optimized Polymer 4 POP 4 Applied Biosystems Puregene DNA Isolation Kit Gentra Systrems Minneapolis MN Glycogen Gentra Systems Minneapolis MN Qiagen Sigma centrifuge Qiagen Inc Chatsworth CA Stratalinker UV Crosslinker 2400 Stratagene La Jolla CA GeneAmp PCR System 9700 thermal cycler Applied Biosystems Foster City CA ABI PRISM 310 Genetic Analyzer Applied Biosystems Computer and software for analysis with GeneScan and Genotyper Software Applied Biosystems Electrophoresis unit with power supply any vendor Gel
30. ions in the Falcon tubes 2 Mix by inverting the tube 25 times and then incubate at 37 C for 15 60 minutes 12 C Protein Precipitation 1 Cool samples at room temperature 2 Add 3 33 ml of the Protein Precipitation Solution to the cell lysate solutions 3 Vortex for 20 seconds 4 Centrifuge at 2 000xg for 11 minutes The precipitated proteins should form a tight dark brown pellet If the protein pellet is diffuse repeat step 3 followed by incubation on ice for 5 minutes and then repeat step 4 D DNA Precipitation 1 Pour the supernatant containing the DNA leaving the protein pellet behind into a clean 50 ml tube containing 10 ml of 100 isopropanol 2 Add 16 7 ul of glycogen solution per 10 ml of isopropanol to increase the DNA yield Mix the sample by inverting the tubes gently 50 times until the white threads of DNA form a visible clump Centrifuge at 2 000xg for 4 minutes Pour off supernatant and drain the tubes on a clean absorbent paper Add 10 ml of 70 ethanol and invert the tubes several times to wash the pellet Centrifuge at 2000xg for 2 minute Carefully pour off the ethanol Allow to air dry for 10 15 minutes U SO ON YD E DNA Hydration 1 Add 1 ml DNA Hydration Solution 2 Rehydrate DNA by incubating at 65 C for 1 hour and rock for seven days on Boekle orbital rocker at room temperature 3 For storage samples may be centrifuged briefly and then transferred to a 1 5 ml tube Store the DNA samp
31. les at 4 C or at 20 C for long term storage Puregene Method for DNA Isolation from Cell Culture for PCR Using the Puregene Genomic DNA Isolation Kit Materials Puregene DNA Extraction Kit catalog ff D 50K Gentra Systems Minneapolis 70 ethanol 100 isopropanol 50 ml Falcon centrifuge tubes Ranin pipette tips with filters Rainin Instrument Co Emeryville CA Sterile individually wrapped transfer pipettes Racks for centrifuge tubes and blood tubes bleach after each use Equipment PipetAid Drummond Daigger Lincolnshire Qiagen Sigma centrifuge Sigma Co St Louis Dispensett HI volume dispenser for reagents Daigger Lincolnshire IL Boekel Orbital Rocker Boekel Scientific Inc Labeling Label all reagents and aliquots of reagents with the reagent name concentration date prepared and appropriate expiration date Labels are created using a computer label making system Label View Pro and an Eltron printer Preparation of reagents NOTE prepare all reagents and aliquots in clean lab and record the date reagents were opened 13 Purification Protocol Record the ID of samples to be extracted and assign a temporary ID number to each for example 1 10 Label all processing tubes and columns with the temporary ID number NOTE use universal precautions when working with blood and perform all steps in a biological safety cabinet to avoid contamination or exposure to biological agents within the blood NOTE
32. mide GneScan 350 ROX mixture into 0 5 ml Genetic Analyzer tubes Add 1 0 ul of the AmpFI STR Green I PCR Product or 1 0 ul of AmpF STR Green I Allelic Ladder per tube and mix by pipetting up and down Seal each tube with a septum Denature each sample at 95 C for 3 minutes and chill the tubes for another 3 minutes in an ice water bath Place the tubes in the sampler tray of the 310 Genetic Analyzer and start the Genescan run Data Analysis Analyze the data using the Genotyper Software and input all data into the database 17 Appendix C Identification of the Amelogenin sex and THO1 Markers with the Short Tandem Repeat Loci This method will be used as Quality Control for indivduals who are not part of a Trio Materials HotStarTaq Master Mix Kit catalog 203443 Qiagen Valencia CA MicroAmp 8 Strip Reaction Tubes 0 2ml catalog N801 0580 Applied Biosystems MicroAmp Caps 8 caps strip catalog N801 0535 Applied Biosystems MicroAMp 96 Well Tray Retainer catalog 403081 Applied Biosystems Rainin pipet tips Rainin Emeryville CA 1 5ml microfuge tubes Marsh Biomedical Products Rochester NY 10X TBE Trizma Base Boric Acid EDTA for Seguencing GeneScan 350 ROX Internal Lane Size Standard catalog 401735 Applied Biosystems Hi Di Formamide catalog 4311320 Applied Biosystems blue dextran EDTA loading dye Appled Biosystems Long Ranger Singel Packs catalog 50691 FMC BioProducts Rockland ME Beakers
33. mp PCR System 9700 Users Manual for details 1 Cycle at 959C for 10min 27 Cycles at 94 C for 45sec 60 C for 45sec 72 C for Imin 1 Cycle at 60 C 45min Hold at 4 C store the amplified products protected from light at 2 6 C for short periods and at 15 C to 25 C for longer periods GeneScan using the 377 DNA Sequencer A Gel Preparation and casting using the Long Ranger Singel Pack i Gel Preparation 1 Assemble glass plates and spacers in the cassette following the method described in the ABI PRISM 377 DNA Sequencer Users Manual 2 Have the Long Ranger Singel pack at room temperature 3 Remove the BLACK clip and mix the contents of the compartments by hand thoroughly but gently for 1 minute 4 Place the pack on an orbital shaker for 5 minutes at medium speed 5 Mix by hand thoroughly but gently for 1 minute 6 Place the pack on an orbital shaker for 5 minutes at medium speed NOTE Do not over mix This may interfere with the polymerization of the gel ii Gel Casting NOTE The following steps must be completed without delay 1 Remove only the RED clip and mix the contents of the compartment well by hand for 1 minute 2 Remove the WHITE clip to expose the filter to gel solution 3 Hold the pack so the contents drain into the filter end Fold the pack in half at the indicated line 4 Hold the pack with the cut mark at the top and cut the corner within the space marked CUT To avoid introducing bubble
34. nmental component Thus an environmental trigger in a susceptible genetic background results in type 1 diabetes development This genetic component is the earliest predictor of type 1 diabetes and may eventually allow prediction in the prenatal phase leading to early prevention and or treatment The genes that are known to play a role in the genetic susceptibility include those in the Human Leukocyte Antigen HLA complex on chromosome 6p21 and the insulin gene on chromosome 1 1p15 The role of the insulin region in type diabetes has been identified by various laboratories using association studies amp This region named IDDM2 has several polymorphisms as well as a variable nucleotide repeat VNTR in the 5 upstream region 4 The Hph I 23 polymorphism has been shown to segregate with the class I VNTR which has been implicated in disease susceptibility Additionally Halminen et al has found in the Finnish population that the Hph I polymorphism appears to be associated with type 1 diabetics especially in the absence of the DR4 susceptibility haplotype This study will allow confirmation of these results as well as provide a comprehensive study of the role of the insulin gene in type 1 diabetes Moreover it will allow us to identify the minor risk factors in diabetes by controlling for the major genetic risk factors Two assays have been developed by this laboratory to detect the 23 Hph I polymorphism The first assay involves an
35. ntrols should have a significant increase in emission intensity of the reporter dye present on the probe specific to each allele relative to the no template controls c Homozygous test samples should have a similar increase in emission intensity of the respective reporter dye relative to the no template controls Heterozygous test samples 10 should display a significant increase in emission of both reporter dyes relative to the no template controls Reportable Range of Results Not applicable see item 7 for details Ouality Control OC Procedures a Ouality Control Principles The type I diabetes genotyping method described in this protocol has been well established in the Division of Environmental Health and Laboratory Sciences These methods have proven to be accurate precise and reliable Reliability of all test results should be monitored by routinely using multiple controls The AmpF STR Green I human identification assay is considered out of control if 1 The electropherogram for the fragment analysis contains less than 4 or more than 8 peaks 2 The GeneScan 350 ROX Internal Lane standard does not appear on the electropherogram 3 The signal is too weak on the electropherogram If the run is declared out of control the fragment analysis should be repeated If the run is out of control again the PCR as well as the fragment analysis is invalidated and repeated The assay for the Iden
36. od amplifies the Amelogenin locus and the THO1 short tandem repeat loci These markers are used for guality control purposes for samples that are not trios Insulin gene 23 Hph I Polymorphism SSO Detection Assay For each sample two sets of primers are used for PCR amplification Each set amplifies only one of the two variants of the 23 Hph I site The genotype of each sample can be determined by the presence seen as a band on an agarose gel or absence of the 231 base pair amplified DNA fragment with either given set of primers Insulin gene 23 Hph I Polymorphism Detection using the ABI PRISM 7700 Sequence Detection System The two alleles of the single nucleotide polymorphism at the 23 Hph site are designated as allele I and 2 A1 amp A2 Data collected by the instrument is then analyzed according to the specifications in the user s manual The analyzes samples will be genotyped as Al for samples homozygous for that allele A2 for samples homozygous for the other and Al and A2 for heterozygous samples The genotypes can be confirmed by examining the Real Time data collected The data is viewed in the multicomponent view where emission intensity is plotted over time Distinct spectral patterns are produced by each of the control reactions a spectral pattern of the no template controls will have little or no increase in emission intensity of either one of the reporter dyes TET and FAM b spectral pattern of the homozygous co
37. of the reaction is 25 ul 9 Place the MicroAmp Caps on the tubes and seal tightly 10 Place the tubes into the thermal cycler 11 Program the GeneAmp PCR System 9700 thermal cycler as follows refer to the Geneamp PCR System 9700 Users Manual for details 1 Cycle 11 min at 959C 27 Cycles 1 min at 94 C 1 min at 59 C 1 min at 729C 1 Cycle 45 min at 60 C Hold at 259C Store amplified products away from light at 2 6 C for short periods and at 209C for longer periods Sample Preparation for the Genescan run using the 310 Genetic Analyzer Following the instructions in the ABI PRISM 310 Genetic Analyzer User s Manual clean the machine and prepare the 310 Genetic Analyzer for running Genescan using Performance Optimized Polymer 4 POP 4 Open a new Genescan sample sheet in the 310 Data Collection Software Fill in the sample names and mark the red box as the standard Save the sample sheet Open up a new injection list and select and open the sample sheet that was just created and select Genescan 350 ROX as the internal lane standard Using the following formulas calculate the needed amounts of Hi Di formamide and GeneScan 350 ROX Internal Lane Standard and combine then into a 1 5 ml microcentrifuge tube when determining the number of samples include the positive and negative controls Number of samples 2 x 24 ul of Hi Di formamide Number of samples 2 x 1 0 ul of genescan 350 ROX size standard Aliquot 25 ul of the Hi Di forma
38. or the GeneScan run by combining 1 5 ul of the PCR product and 1 0 ul of GeneScan Rox 350 with 5 ul of a 5 1 ratio of Hi Di formamide and blue dextran EDTA loading dye for example 5ml of the Hi Di formamide combined with 1ml of the blue dextran EDTA loading dye Vortex the samples and centrifuge briefly Denature the samples by heating the samples at 95 5 C for 2 minutes Ice the samples immediately for 2 minutes and keep on ice until ready to use Stop the PRE RUN when the temperature reaches 50 C and rinse out the top of the gel with 1XTBE buffer Load 1 8 ml of the denatured samples on the gel The odd lanes should be loaded first then run in for 1 minute before the even lanes are loaded Cancel the PRE RUN and change the module to the GS Run 36A 2400 module and start the run The run will take 2 5 hours Analyze the Results using the GeneScan Analysis and Genotyper Software 20 Appendix D Detection of the Insulin Gene 23 Hph I Polymorphism Using the ABI PRISM 7700 Seguence Detection System Materials TaqMan Universal PCR Mater Mix P N 4304437 Applied Biosystems Foster City CA On the kit mark both the date it was received and opened Micro Amp Optical 96 well reaction plate P N N801 0560 Applied Biosystems Micro Amp Optical Caps P N N801 0935 Applied Biosystems MicroAmp Bases P N N801 0531 Applied Biosystems FinePoint Aerosol Resistant Tips Rainin Emeryville CA Microcentrifuge tubes any vendor
39. rrect thermal cycle program 2 interruption during the PCR run i e power outage which will be registered in the history record of the instrument or 3 an error in the PCR reaction mixture If any of the three control DNA samples give unexpected genotypes the entire assay including specimen preparation amplification and detection should be repeated 12 13 14 15 Limitations of Method interfering substances and conditions This method is not labor intensive as compared to other non automated methods using restriction endonuclease digestions Due to the high analytical sensitivity of the tests extreme care should be taken to preserve the purity of the kit reagents amplification mixtures and samples All reagents should be closely monitored for purity The following guidelines should be followed It is imperative that the work flow in the laboratory proceeds in a uni directional manner beginning in the Reagent Preparation Area and moving to the Specimen Preparation Area and then to the Amplification Detection Area to avoid contamination Supplies and eguipment must be dedicated to each activity and not moved between areas Gloves must be worn in each area and taken off before leaving the area All sample tubes should be opened and closed carefully to avoid reagent or sample splashes Positive displacement pipettes or air displacement pipettors with filter plugged tips should be used Tips should be changed after each use
40. s cut a large enough hole in the pouch to allow steady flow of the solution through the filter into a beaker 5 Avoid introducing air into solution after mixing Cast gel and insert comb according to your standard procedure 19 6 7 Once the gel is polymerized 30 minutes place paper towels soaked in electrophoresis buffer over the ends of the plates and then cover with plastic wrap This will prevent moisture loss as the polymerization process continues Allow 2 hours for complete gel polymerization B Preparing for Electrophoresis 1 2 Remove the comb wash the plates and load the comb as described in the ABI PRISM 377 DNA Sequencer Users Manual Prepare a sufficient quantity of electrophoresis buffer to fill both anodal and cathodal chambers by diluting 10X TBE stock for sequencing with deionizd water to 1X Mount the gel cassette onto the sequencing apparatus and prepare the gel for the sequence run according to the 377 DNA Sequencers Users Manuals instructions Open a new GeneScan sample sheet in the 377 96 Data Collection Software and input sample names to be run on the gel Save the sample sheet and open a new GeneScan sample run in the 377 96 Data Collection Software and open the new sample sheet that was just created in the previous step To assure plates and gel are clean perform a plate check using the Plate Check module Pre warm the acrylamide gel by running the GS PR 36A 2400 module Prepare the samples f
41. sceptibility to IDDM maps upstream of the insulin gene Diabetes 44 620 5 1995 Halminen M ef al Effect of polymorphism in the insulin gene region on IDDM susceptibility and insulin secretion The Childhood Diabetes in Finland DiMe Study Group see comments European Journal of Clinical Investigation 26 847 52 1996 Bennett S T et al Susceptibility to human type 1 diabetes at IDDM2 is determined by tandem repeat variation at the insulin gene minisatellite locus see comments Nature Genetics 9 284 92 1995 11 Appendix A Puregene Method for DNA Isolation from Whole Blood for PCR Using the Puregene Genomic DNA Isolation Kit Materials Puregene DNA Extraction Kit catalog D 50K Gentra Systems Minneapolis 70 ethanol 100 isopropanol 50 ml Falcon centrifuge FinePoint Aerosol Resistant Tips Rainin Instrument Co Emeryville Sterile individually wrapped transfer Racks for centrifuge tubes and blood tubes bleach after each use Equipment PipetAid Drummond Daigger Lincolnshire Qiagen Sigma centrifuge Sigma Co St Louis Dispensett III volume dispenser for reagents Daigger Lincolnshire IL Boekel Orbital Rocker Boekle Scientific Inc Feasterville PA Labeling Label all reagents and aliquots of reagents with the reagent name concentration date prepared and appropriate expiration date Labels are created using a computer label making system Label View Pro and an Eltron printer Preparation of re
42. t Owl Separation System Portsmouth NH PowerPac 300 power supply Catalog No 165 5052 165 5053 BioRad Hercules CA Alphalmager 2200 Documentation System Alpha Innotech San Leandro GA Micro centrifuge Daigger Linconshire IL Vortexer Genie Daigger Linconshire IL Glass flask Incubator or water bath at 37 C Balance Nitrile Gloves Labeling Label all reagents and aliquots of reagents with the reagent name concentration preparation date and expiration date Labels can be hand written or created using Label View Pro software Teklynx Milwaukee WC for more permanent labels Reagent specifications Primers used for PCR must be diluted with deionized water to a concentration of 50 pM l using sterile techniques and stored at 4 C 23 Procedure A Polymerase Chain Reaction PCR Protocol NOTE Preparations for amplification should be performed in designated Pre amplification area of the laboratory 1 Determined the number of Macomb PCR tubes needed and label them appropriately There should be two 2 PCR tubes for each sample and one 1 PCR tube for a negative control 2 Place the labeled PCR tubes in the Strata linker and UV crosslink on the auto crosslink setting to 3 prevent contamination Remove the tubes from the Strata linker Place tubes on a MicroAmp tube base and add the following to each tube Volume HotStarTaq Master Mix 12 1 INS FWD primer variable 0 4 pM final conc
43. te volume of 100 isopropanol Add 16 7 ul of glycogen solution per 10 ml of isopropanol to increase the DNA yield Mix the sample by inverting the tubes gently 50 times until the white threads of DNA form a visible clump Centrifuge at 2 000xg for 20 minutes Pour off supernatant and drain the tubes on a clean absorbent paper Add appropriate volume of 70 ethanol and invert the tubes several times to wash the pellet Centrifuge at 2 000xg for 12 minutes Carefully pour off the ethanol Allow to air dry for 10 15 minutes E DNA Hydration 1 an 3 Add appropriate volume of DNA Hydration Solution Rehydrate DNA by incubating at 65 C for 1 hour and place on Boekel orbital rocker for 7 days at room temperature For storage samples may be centrifuged briefly and then transferred to an appropriate tube Store the DNA samples at 4 C or at 20 C for long term storage 14 Number Cells 100 0 5 1 0 3 5 30 50 60 90 100 10 000 Million Million Million Million Million Cell Lysis 0 06 0 15 0 6 6 0 10 15 ml Rnase A 0 50 0 75 3 0 30 50 70 ul Protein 0 02 0 033 0 20 2 0 3 3 5 0 Precipitation ml 100 0 06 0 15 0 6 6 0 10 15 Isopropanol ml 70 Ethanol 0 06 0 15 0 6 6 0 10 15 ml DNA 10 10 60 500 750 1000 Hydration ul 15 Appendix B Human Identification with Short Tandem Repeat Loci using the AmpF STR Green I PCR Amplification Kit Materials
44. trols with each test 11 Remedial Action if calibration or QC systems fail to meet acceptable criteria There are several potential possibilities in a failed test and the analyst and the supervisor must use their scientific knowledge in solving the problems As with any test procedure good laboratory practices are essential for the proper performance of the assays AmpF STR Green I human identification a b If less than 4 or more than 8 peaks appear on the electropherogram repeat the fragment analysis If the fragment analysis appears to be the same repeat the test starting from PCR amplification If the GeneScan 350 ROX Internal Lane standard does not appear on the electropherogram repeat the fragment analysis If there is no low green signal compared to the internal lane standard on the electropherogram check the concentration of the DNA and then repeat the experiment Identification of the Amelogenin and THO1 Markers a b d If less than 2 or more than 4 peaks appear on the electropherogram repeat the fragment analysis If the fragment analysis appears to be the same repeat the experiment from the beginning If the GeneScan 350 ROX Internal Lane standard does not show up on the electropherogram repeat the fragment analysis If there is no low blue signal compared to the internal lane standard on the electropherogram check the concentration of the DNA again and repeat the experiment Insulin gene 23
45. ube into the Stratalinker Stratagene and UV crosslink twice at 120 joules 1200 on LED display to sterilize the tubes prior to use 4 Make a master mix of the following content multiply the volumes by the number of samples plus controls and add approximately 10 for pipetting losses ATTN There is a total of 24 controls 8 replicates of the two homozygous controls and 8 no template controls Ingredients Working stock conc Final concentration Vol 1l 25 ul reaction PCR master mix 1 0X 12 5 ul INSPR FW primer 25 pM ul 1 0 uM 1 0 ul INSPR REV primer 25 pM ul 1 0 uM 1 0 ul INSPB A probe 5 pM ul 0 2 uM 1 0 pl INSPB T probe 5 pM ul 0 2 uM 1 0 pl Water 5 5 ul 21 5 Mix by vortexing 6 Dispense 24 ul of the master mix into those wells of the plate that will be used 7 To the wells designated for controls add 1 ul of genomic DNA of the controls to the master mix 8 To the wells designated for no template controls add 1 ul of distilled water 9 To the wells designated for samples add 1 ul of the appropriate genomic DNA 10 Cover the wells with MicroAmp Caps and seal tightly 11 Place the Plate in the ABI PRISM 7700 Seguence Detector C PCR data collection Real Time data collection Create a Real Time plate document Refer to the ABI PRISM 7700 Sequence Detection System User s Manual for details Perform a Real Time run under the following Thermal Cycler conditions l cycle 10 min at 50 C l cycle 10 min at 95 40 cycl
Download Pdf Manuals
Related Search