Home

HLA Fusion Research User Manual v3_0

1. sscscccosssccsosssscscosssestcusvscuessscneussseseoussectenssseneusscneoussestensnss 111 View MEI Information with Quantiplex Beads cccsscccccsssccccesseccceeseccceeeecceeeesececsueceseeeceeseeeeeseuseceeaunesss 112 SESSION SUITUIM ARV ana LOSS a aba 114 Whatisthe SESSION SUMMA y penran ac 114 Example SESSION SUMMA Vii dd e 114 Creating and Managing Session Logs id 114 creating a Session LOR do ooo colacao 114 Mandgihne SESSION LO PS aducir acia lic a a 115 PANONE Session LO a Na A ere er eee ere 115 A O O 116 Usine the Reports Wind O Weiss aa ls 116 ACCESSING the Reports WINAOWs said 116 Select REDON TWIN 117 PRE TIMGIR COOL Ila DU asn idos aotearoa alent N 118 Session Sample eee Orea roo Or re AN T ne 119 VIEW PFIAL OF EXDOre REDOIMS io 120 EXOT IG DOM ariel acres O OOOO a 121 Accessing Reports from the My Favorite Menu ccccccsssscccceesecccesececceecceeaeseceseueceseeneceeseeeeesenecesaeneses 122 Removine Reports Tom iIVINF VO teni 122 REPO TO Sr A elec o 124 CUSTOMIZING Report APpe aran Cerco cia 124 HFR MAN v3 x x EN 00 Rev 0 8 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Creating Custom Data Export Templates 125 Creating CUSTOM REPO Sii A A A A E aes 126 Custom Molecular and Antibody Report SetUp cccoocccnconoccnnonaconnnnononnnonaconnnnnccnnonononnnonnrnnnonanonnnnnnonnnnnacnnnnnos 127 A A 128 Molecular TY DING Sample SUN iaa 128 A tibody Screening Sam
2. HFR MAN Vv3 x x EN 00 Rev 0 122 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX My Favorite 2 Select My Favorite gt Remove from My Add to My Favorite Remove from My Favorite y Combined Sample Generic Typing The report you selected in step 1 is no longer displayed at the bottom of the My Favorite menu HFR MAN Vv3 x x EN 00 Rev 0 123 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Report Tools Customizing Report Appearance Note You must be a supervisor level user in HLA Fusion and have Crystal Report Designer software installed on your computer to use this feature This feature allows you to format the appearance of HLA Fusion reports to meet your specific needs For example you can change font style size and color as well as the location of text and data fields on the report e HLA Fusion automatically launches the report designer if it is installed in the default directory c Program Files Business Objects BusinessObjects Enterprise 12 0 win32_x86 crw32 exe e Use Notepad to open the OneLambda Fusion Interface exe file located in c Program Files One Lambda HLAFusion IvpD Make sure that Crystal Report Designer path name is entered on the following line of this file see figure below lt add key ReportDesigner value C Program Files Business Objects BusinessObjects Enterprise 12 0 win32_x86 crw32 exe gt Editing OneLambda Fusion Int
3. Click the Show Navigator PE button if the Navigator tab normally displayed on the upper right side of the application window is not iz visible a9 Micro SSP_2009090814402 Micro SSP_200909081 2392 SS0 Once the Navigator tab is displayed you can move your cursor over it to KIR79 SKMCC 060206 109 Slide the Navigator panel open When the top of the Navigator window i 020206_KIR2_G3_1D379 is Blue it will remain open until you click any button or control or on various other active areas of the main screen Patient From any analysis window click the Patient button to display the Patient Donor Information Screen where you can enter or edit information related to a patient or donor and associate it with the current sample xi General Info HLA Tests Creatinine Tests ID 2 Name Bloodstone Henry T Enforce ISBT format for Patient Donor ID I Archived T Patient Donor Info A da pers PONENT Patient Donor Flag Don or A State Province al Blood Type lo A ae IN usa Fh PE Frat Nome Fey Postal Code 6320 ys A i NNE Middle Name Ik Region ee Last Name Bloodstone Phone 312 789 1765 a From Other Facility 7 Birthdate 12 27 2012 er a Facility Name ay 12 789 1765 Gender Mae Female UNK ca sii eres Fax 812 787 1444 Category Group Human Animal Donor Type g Email Address hbloodstone msn com l E SSN 091 00 1987 aoe Headine Publishes Include in Donor PR
4. From the Analysis window in Quadrant 2 click the Bead Info tab to display the allele specificity of the selected bead HFR MAN Vv3 x x EN 00 Rev 0 66 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX SSO Analysis window Quadrant 3 Sample Profile The Sample Profile displays each bead in the currently selected sample Each bar represents a bead in the sample sorted by bead number and its height represents the normalized reaction value for the selected bead in that sample Max Scale Quad 3 Sample Profile Red A positive reaction Blue A negative reaction Green The selected bead in quadrant 2 e The gray diamonds inside the histograms indicate the current cut off position Arrowheads identify the direction and position of cut off changes made to a bead e Click arrow buttons on the toolbar to select a sample bar and display the selected sample in Quadrant 3 e Alternatively you can also select a sample from under the Sample drop down list in the toolbar You can also select a sample by double clicking on a sample bar in the Bead Profile histogram Quad 2 The Magenta and the white or non colored bar on the right represent the raw data values for the positive and negative control beads of a LABType assay e X axis Beads in numeric order e Y axis Raw data value trimmed mean e Data points Bars represent the raw data value of a bead vs the sample reaction HFR MAN Vv3
5. Opening a SSO Analysis Session e Select the SSO Home page button or the SSO 59 toolbar button The SSO Home page is displayed Note Open worksheets and probe primer sheets to verify the accuracy of revision numbers these documents do not contain a revision number in their filename Notification that new or updated Opens the Catalog Opens the Update catalogs NMDP and Serology Management window Reference File window equivalent files may be available h LA Fusi n Buer 5 E IET Anay Dala Heporti Dela Sempe Paberiito Profile Utiss 37 5 Hep Ext i DASTANA Ow sh m Click here to 350 HLA Fusion YA N 7 pi open the 550 Product and Catalogs i Lc Navigator FT ikae imported RTT Sere i CI MYLA fuson 3 0 0 Tering E Click to open as the KIR Analysis Miro Postres Control 1000 r 3 j Configuration Screen Click the blue 250 Product Documents links to display Workshrai eae Tixi ome the selected ROLF LAB Type G50 KA Typrg Tes Lol a lana 2012 _ LABType 550 KOR Typing Tes Lot catalog worksheet or probe primer documents 511 Micro ssp 110 550 sh consensos Fusion Explorer ia dE anoa oe Oy User Mame Ah Server Name loco Database Mames FLEACH LO Resah Wer agn The SSO Home Page HFR MAN Vv3 x x EN 00 Rev 0 94 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Note HLA Fusion Research converts Luminex gen
6. Test Date Catalog Session Date Click the sign next to the product type you re interested in to display its individual sessions HFR MAN Vv3 x x EN 00 Rev 0 22 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX MicroSSP gt E A T A cc PR AA ARK AA Ay gt ss rE Group by Test Date 111742012 gt 9716 2012 442042012 E 042007152401 004 10329 ha i 042007 81012 01310 101051 4419 2012 8 30 2011 4 11 2011 2228 2011 Group by Session Date Navigator AS C Product TestDate c Catalog Session Date gt E 11 17 2011 86 0406workshop_B_lot 9_1D403 86 130907_L5M_13_WBC0006_1D53 86 0406workshop_DRB1_lot 10_1D405 O406workshop_C_lot 6 ID404 B6 20080116_PRA1_LOT11_ID42 86 06 28 05 John Hopkins LS2_009_2 248 06 28 05 John Hopkins LS1_009_1 86 042007lsm12_013lo_ID1051 86 042007L52401_004_1D329 B 02131_LSM12_011_01_ID3214 A 021308 LSM14 hna lot g ID69 FlowPR4_20111117170511_FL2HD FlowPR amp _20111117170441_FL1SP r EAA ata a If asession sample is listed in red this means the sample failed in batch analysis Click a sample name to display it in an analysis window HFR MAN Vv3 x x EN 00 Rev 0 The sessions displayed in blue are the ones that have not yet been Micro SSP_20100129124028 reviewed Once you review a session its color on the N
7. window Teenaa SQL N A window N Printers ee n Opens the Fusion Show Print Report preview dialog setup window for Report printer e General Configurations genera L printer Navigator search setup No Audit logging enabled No Audit Logging Status d URL s and directory Default Patient Donor Type Patient path setup O th Reference files auto download enabled No Auto Donor PRA Calculation Na pens the URL and file path setup Yes Stay Current Sample After Save or Confirm No Navigator Default Home Page Home Search One Lambda Product Documents Green if Criteria Nom Catalog Worksheet Worksheet E E Catalog ae cm 85 11 11x17 Probe Primer Datasheet Audit SSP1 01 002 07 January 2012 Micro SSP Alle S Logging is on The Fusion SSP1 03 003 07 January 2012 Micro SSP Allele S Red if it s off Explorer click any button to open the corresponding product Status gt A SSP1 05 002 15 January 2012 Micro SSP Allele S SSP1 07 003 10 January 2012 Micro SSP Allele S SSP1 11 002 08 January 2012 Micro SSP Allele S SSP1 13 002 09 January 2012 Micro SSP Allele S SSP1 14 002 09 January 2012 Micro SSP Allele S Note If the current page does not show updated information upon modification or downloads go back to the main Home page and then return to the product home page to see the changes This interface is
8. A Shift key Show hide the A trace R SetthecurrentlUBcodetoR______ T Shiftkey Show hide the T trace Insert deletion marker at current position B SetthecurrntilBcodetoB______ F Open the sequence find dialog D SetthecurrntilBcodetoD______ __ Show hide trace information H Setthe current IUB codetoH_ I Step back through the sequence primer layers HFR MAN v3 x x EN 00 Rev 0 44 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Accept Base Call You can individually accept the close base calls determined by HLA Fusion Research After you accept a base call you are moved to the next marked base position From the Analysis window e Click Accept Base button to accept the computer suggested base call and move to the next base When you click the Accept Base button Fusion Research highlights the mismatch in green on the EPG Quick Reports Name 9016 IMGT A 3 7 0 0 2012 01 12 Allele i Allele 2 Mis A 02 01 01 A 02 01 0 A 02 01 01 A 02 01 0 A 02 01 01 A 02 01 0 A 02 01 01 A 02 01 0 A 02 01 01 A 02 01 0 A 02 01 01 A 02 01 0 A 02 01 01 A 02 01 0 l 01 atO AS 0 Unlike a Full Report which opens a secondary Reports Menu a Quick Report see sample generates a more minimal report with sample name date EPG peaks and basic allele typing results Click the down arrows to select the Locus and Exon region s to be covered by the quick report and cl
9. Allele Specific HLA Class DNA Typing Tray A 03 Lot 003 SSP1 03 003 ws SSP 1 03 003 PRI selected catalog SSPR1 03 004 January 20 Micro SSP Allele Specific HLA Class DNA Typing Tray A 03 Lot 004 worksheet or SSP1 23 002 09 January 20 Micro SSP Allele Specific HLA Class DNA Typing Tray A 23 Lot 002 ssp1 23 002 WS SSP1 23 002 PRI probe primer SSPR1 23 003 January 20 Micro SSP Allele Specific HLA Class DNA Typing Tray A 23 Lot 003 SSPR1 23 003 SSPR1 23 003 PRI worksheets SSP1 24 002 09 January 20 Micro SSP Allele Specific HLA Class DNA Typing Tray A724 Lot 002 SSP1 24 002 WS SSP1 24 002 PRI SSPR1 24 003 January 20 Micro SSP Allele Specific HLA Class DNA Typing Tray A 24 Lot 003 SSP1 25 002 08 4 Note January 20 Micro SSP Allele Specific HLA Class DNA Typing Tray A 25 34 66 Lot 002 SSP1 25 002 WS SSP1 25 002 PRI Open worksheets and probe primer sheets to verify the accuracy of revision numbers these documents do not contain a revision number in their filename Click the Batch Entry button at the top left side of the screen Place a check Y mark next to Include Imported if you also want to bring in batches which have previously been imported HFR MAN Vv3 x x EN 00 Rev 0 76 O
10. Assign non coded allele pairs Assign a coded allele pair Assign serology equivalents Make manual assignments Remove assignments Save and confirm assignments HFR MAN Vv3 x x EN 00 Rev 0 92 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The Pairs Tab The Pairs Tab displays the possible allele pairs results that match the reaction pattern for the sample The pairs are suggested by the software e The list identifies the pairs and groups them by either full match pairs no false reactions or the number of false reactions Results with false reactions are listed with the false reacting bead well identified e The results display one allele pair per row DRE1 16 e Possible homozygous pairs are flagged in the Comment field pent pupae pesca cans E DRE1 16 DRB1 16 1 DRB1 16 DRB1 16 DRB1 16 Assign an Allele Pair from the Suggested List 1 Double click on an allele pair under the Possible Allele Pairs to assign it to the final pairs assignment area Alternatively you can click to highlight an allele pair on the list under the Pairs tab and click the v assign button next to the Assigned Allele Pairs title to add it to the final assignment area To remove an assignment select the assignment on the Assigned Allele Pairs list and click the X remove button DRB1 04 7 DRB1 04 3 9 DRB1 04 Double click DRBI 04 assig na Select an allele pair deja ando or pairs and cl
11. HML VO 2 HML V0 3 SCORE BmT ABDR Reaction Assignment Report export report including Sample ID and reaction string Thai Export Thai Export v3 Thai Export LABScreen UMC Utrecht Report KIR HML v 3 Report BML NMDP Code Report ABMDR CMDP Manzen LABType Manzen LABScreen LABScreen SA MFI LABScreen Australia MFI Summary and detailed reports LABType Australia Raw Data Export Maastricht Export NIH Export KIR Export LAT Export NKR Report HFR MAN Vv3 x x EN 00 Rev 0 135 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Statistical statistical or aggregate data for trending measurement monitoring etc Allele Group Frequency displays the frequency of allele groups based on the first two digits of an allele assignment for selected sessions or the database Allele Group Frequency Extended displays the frequency of allele groups based on NMDP code results or allelic level assignment for selected sessions or the database Bead Exclusion Report Bead numbers excluded from an analysis Cut off Adjustment Summary summary of all cut off changes made for selected sessions or based on a specific catalog file LABType Control Value Control values by exon for a given catalog Catalog Statistics Number of samples analyzed using a specific catalog Miscellaneous reports that do not fall into one of the above categories Database Information describes the usage of the cu
12. Research Software 3 0 FUSREPGRX Print Screen From any Analysis Screen click the Print Screen button to open a new window containing a screen shot of the entire Fusion screen display Click the Print button top left corner to send the screen shot directly to the printer To close this window click the Exit button or the Close button Magnify From any analysis window click the Magnify button to activate the magnifying glass and enlarge any section of the window Cross Loci Sample Rxn e Use the arrow keys on your computer keyboard to As 010103 Po increase or decrease the height and width of the aso10104 magnified area A 0102 HA e Click anywhere on the screen to deactivate the o Je magnifying glass Reports From any screen click the Reports button on the Fusion Toolbar to open the Reports Screen You can also click the Reports button located in the Fusion Explorer at the bottom left of the screen Peet Gewkiweg Moo 550 Specaity y Statetcat Mearianeos Me Paonta Tocs The type of available reports listed will depend on the product and nature of analysis you re conducting Please see the section on Reports for detailed information Required Carefully review af HLA Typing and data in af reports for accuracy HFR MAN Vv3 x x EN 00 Rev 0 29 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Show Navigator
13. Un Archive Files Archived catalog files display an A in the Status column when you view the catalog list and the check box for Show Archived Catalogs is selected Archived Catalogs check box A s RSSO1S4_003_07 LAST a M ja B RSSO1S4_004_02 Y Show Archived Catalogs Che Archive and unarchive catalog files Na LABScreen ae LABType Place a check mark here and YY click the Unarchive button to unarchive the catalog i The letter A indicates that the catalog has been Place a check mark here and F E archived click the Archive button to archive the catalog e IntheArchive Catalog window select the check boxes next to the catalogs you want to un archive and click Unarchive Viewing Catalog File Information You can view information about a catalog file and generate a report from the Catalog Information menu Catalog files displayed with an A in their Status column have been archived 1 From the Main Menu select Utilities gt Update Reference gt Catalog Management 2 Click a column header if you want to sort the catalog file list 3 Click Report to display a printable exportable report of the currently displayed catalog information HFR MAN Vv3 x x EN 00 Rev 0 181 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Deleting Catalog File Information You can delete a catalog file from the Catalog Management menu Catalog files display
14. e Number and types of files installed e g dll e Lab Information e g name and address of your lab e Analysis Configuration for each product e g low bead count for LABType 2 Choose to save the report preview it print it or export it to Excel HFR MAN v3 x x EN 00 Rev 0 197 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX FrmIQ HLA Fusion e n Fusion SQL Server SQL Server 2005 9 00 5000 00 SP4 Express Edition S MET M local FUSIONFUSION_BSeith MONE LAMBDA Typical IQ Report HFR MAN v3 x x EN 00 Rev 0 198
15. oP WN From the Main Menu select Manage Samples gt Manage Test List Use the pull down menu to select a test list and click Continue gt gt Add remove or move samples as desired Click Save to save the new test list Click Close to return to the Main Menu Exporting Test Lists Test lists can be exported for use outside of HLA Fusion only as a txt files 1 ONO OF WN From the Main Menu select Manage Samples gt Manage Test List Use the pull down menu to select a test list and click Continue gt gt Click the Export button to export test list details to a txt file If prompted to save the test list before export click Yes to save and continue Select a location to save the test list and enter a file name for it Click Save When prompted to create a Luminex Patient List input click No Click Close to close and return to the Main Menu HFR MAN v3 x x EN 00 Rev 0 147 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Patient Information HLA Fusion can store patient information and associate Sample IDs with patients and donors You can store all typing and screening information in one location for each patient Note Please verify all data you import as HLA Fusion performs minimal data validation upon import HFR MAN Vv3 x x EN 00 Rev 0 148 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Importing Patient Donor Lists After creating a Patient D
16. A A A 12 What is HLA Fusion Research rn da 12 README MGS aia e E E EE E 12 Peor mUa a EEA A A O EET 12 EAI CACO VISIO the Proet Iicn esucnaen avd conasemec ses demeciasacoetasessetaenncseasiieedeeeanteseviaest sana 13 technical ici 13 oo A a 14 PAV ACO Mann o adidas 15 Logging On To o A e o A T ee ee 15 Retrieving a Forgotten User Name Or Password cccssccccssccccsseccescecsececaececenececeneceeeneecausceseueceseueceseueceseeeesgnes 15 So OE o O E PRE 005 on A 16 A A E GEO E 16 le Peris S tarta 18 Character Lon recorro oral N os 18 o PP OE Eg e o E OA 19 Fusion Research Home Page nuera 19 Te NWE LON redactora oebtia 20 NAVE Stories iy liis 21 SA e OO A In 21 COUP DY POUM 21 E o A A A 22 Gj ge Uy e g DY Test Date nana 23 Ego oo E A o oo o nn nn e 23 Accessing HLA Fusion Research Software FUNCTIONS ccccccecsecescecceccecsescccscsseescesceaceeceessesaesaesaceaeeacasereasvaeeaeeaees 24 Man Ment ODIO Sn iva 24 ANVE DAA ee en CO ree E ee ee eee 24 BOS pc ect AA E ne 24 A en o o e 0 ee 25 Po e 0 o o a on Po ee e oen ee 25 Patent IO ad co 25 HFR MAN Vv3 x x EN 00 Rev 0 3 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX PTT VS assoc cca nba 26 A O 26 A A A na een 26 EU ears O SO 27 TOO par BUON Ss AAA 27 FIO VGH ULL OM e o a A A nian nie cats tnd nea tele alah ote td 28 LO AS UE A O E ETE 28 Pie PaO tons nana 28 Preview REDOC oonan r T a a a a A 28 A A oe 5 E E A enum baeeeeeeuen
17. FUSREPGRX Number of Allowable False Reactions If HLA Fusion cannot determine any results that exactly match the reaction pattern entered it analyzes the reaction assuming that there is one false reaction in the sample If a solution still cannot be found the system continues to search through additional false reactions until the number of allowable false reactions has been reached or a solution is found The false reaction setting allows you to set the number of allowable false reactions Minimum setting 0 Maximum setting 4 e Inthe False Rxn field click the up or down Sample Date arrow to change the number of allowable false iol E reactions Note Regardless of the maximum false reactions set here sample analysis stops at the first false reaction found Force One False Reaction When a sample has a result with no false reactions exact match result the Force 1 feature forces HLA Fusion to re analyze the reaction to allow for one possible false reaction in any well This feature is used to search for results for which one additional reaction can change the results 1 From the analysis window click the Force 1 button to force Fusion to analyze the sample with one false reaction Click the Reanalyze button to reset the analysis to the original results Click the Rxn Reset button to return the Rxn Pattern table to the default settings HFR MAN Vv3 x x EN 00 Rev 0 89 One Lambda User Manual HLA Fusion
18. IO CESTA CEIC ECOS IEA E SS CS ORO ZO Cc Ca MINI IN EC COS IE FE rn cae ema own IS IES UC IE _ 4 Low NIC Raw Value Antibody Sample Summary Window A Click the Export button to export the displayed data as an Excel file 5 Click the Close button at the upper right of the window to close and return to the main Reports window HFR MAN Vv3 x x EN 00 Rev 0 129 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX View Records The View Records feature presents typing results and analysis details for each sample selected Sample information is shown for one sample at a time From the View Records menu you can view screening and typing records individually Select data records using the Reports window 2 Click the View Records button 3 The Data Display screen opens Use the Arrow buttons to navigate through samples Data Display Sample ID 1 Local ID Test Pos 1 A1 Notes HLA Allele Pairs A 03 02 A 68 01 02 A 03 02 A 68 01 06 pg A 03 02 A 68 07 Pu A 03 02 A 68 11N mE A 03 02 A 68 16 08 A 03 02 A 68 17 Recognition S PC Bead Session ID Catalog ID Test Date 0407workshoprssoA_008_1D319 HLA Locus A RSSO1A_011_08 Operator Apr 04 2012 O More Test Allele Code Serology Code A 03 XX1 A 68 XX2 XX1 03 02 03 10 03 31 03 73 03 76 03 106 68 52 68 57 68 69 68 70 lormal NC Bead NC Raw 13 310000419616 Probe Speci
19. NMOP e Report displayed title sessions a P FF inchaite al recorde for campes Samples T Show selected samples Click to ele annada sapane v Locus Type Y Session hoc NM 7 Mex v weil ETET O filter sessions by _ L selected List of criteria sessions Filtered jen k by report Catalog ID type and and alleles input that match criteria alleles in the allele a a SST A lly review all HLA Typing and data in all reports for accuracy allele field Criteria to Select a tab refine report to view either data filters by session the displayed or sample sessions Select Report Type e Select a report from the report type menu options displayed at the top of the Reports window The list of sessions in the right pane of the Reports window is filtered to display only the ones related to the selected report type Patent Generic Typing MicroSSP SSO Generic Antibody Report Types Specialty Statistical Miscela HFR MAN v3 x x EN 00 Rev 0 117 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Refine Report Input If needed use the left panel of the Reports window to further filter the sessions you want to include in your report There are a number of criteria you can set 1 Entera Patient ID Session or Sample ID fields or browse for the information using the Browse LJ button Test Date E E 2 Adjust the date range Use the drop down calendars in the Session Date fields to
20. Session Name Catalog ID position Line Time Scale Cohamn Sample Cotumn Spec Sample Dautan AD Tracking Thres Patient Antibody Tracking window 2 Click the drop down arrow next to the Patient ID field to select from a list of patients stored in your Fusion database Or click Search and search by Patient ID First or Last name etc 3 The Molecular and Serological Typing fields are automatically filled with available data for the specified patient 4 Select the start and end date range from which you want to view sample antigen data for this patient click the drop down arrows in the date fields to display a calendar 5 You can select Secondary Ab IgG IgM C1Q All or enter one of your own This is a way to filter samples and it means that samples you want to bring up must have this secondary Ab Otherwise they will not be available when Find is clicked e Optional You can display the percentage of PRA from available donors in the system or from selected donor groups who match the computer assigned antibodies for the current sample HFR MAN Vv3 x x EN 00 Rev 0 159 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX 6 Click the Donor PRA button to bring up the following dialog box from which you can select donor groups or All Donors The Donor PRA calculation is displayed next to the Donor PRA button lolx Donor PRA Calculation All Donors Available Do
21. a a a 2571 i Eo oo 25472 5 A A A 25475 E Bata ala 25476 7 gt FJ IA Ue 1 Select the check boxes next to each sample you want to include in a report Select the check box next to a session ID to include all of its samples Deselect the check box of any sample or session you do not want to include in the report 2 Ifat least one sample has been selected for a session the Include cell for that session is highlighted with grey If all samples for a session are selected there is a check box in the Include In cell 3 Optional To view all the samples available or to view only the samples you have selected so far click the Samples tab and select or deselect the check box for Show selected samples 4 Alternatively you can right click on a session or sample and apply one of the following 08 09 2012 ConsenSys BSmith PROCESSED 08 09 2012 e Select All select all sessions and samples for inclusion in the report e Deselect All deselect all sessions and samples from inclusion in the report e Analysis Select specify the analysis product report type Micro SSP KIR ConsenSys Quantiples Beads etc HFR MAN Vv3 x x EN 00 Rev 0 119 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX To create a separate report for each selected sample select the check box next to 1 Sample per Report View Print or Export Reports e Once you have the report type and all t
22. e Optional Manually enter the donor typing in the Sero Typing field 11 Click the Data Table button to display a raw data table CSV file with the patient antigen signal over a period of time The table can be printed or exported a Y seamen A Antibody Tracking Information S X Patent infcmmation Patient ID 12346 Donor 1D pratierit l APO101 4 01 B 405 Cw 07 DRB1 01 Oe P0101 A 0102 8 1010 B3040 CV 202 CW 01010 a Molecular Typing Molacular Typing ORG1 3040 ORB1 0102 DRB3 339 DROI 9234 OR84 0101 0R84 0120 ORBS 2020 ORBS VE05 DAAD g sarn Typing Dala Type Raw Data pa Class Clase 152072009 1 HFR MAN Vv3 x x EN 00 Rev 0 4056 24 Saro Typing a AO ASSN AC3303 BM 142 Ma 1439 857 Oral 4 Oz a1 6011 oa 3292 97 anasa Patient Antigen Signal Data table 2323 28 a osa Emon cose B S ASOT A3007 AREMO A 1057 A A A66 Lil TUSSE gaT 38 3830 E 162 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Profile Management HLA Fusion tracks all changes to analysis data made by users and allows added data security with a two level analysis result confirmation Save and Confirm HLA Fusion also stores general laboratory information to be used on reports including multiple contract lab codes HFR MAN Vv3 x x EN 00 Rev 0 163 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX User Manag
23. iak Y default location is c MOLI NMDP code saved in c OLI Fusion data export NMDPExport nmdp_code_report_Micro Fusion data export NMDPExport select Save in SSP_20111222133904_SSPR1 C04_002_07 csv Excel File or simply left click the mouse button E 3 When you re done click the Lx button to remove the buttons from display Note The Rpt button retains the last selection you made direct text or Excel so it can be used as a shortcut unless you want to change your selection the next time you report XX code simply click the Rpt button HFR MAN Vv3 x x EN 00 Rev 0 97 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The following shows examples of each result BIOINFORMATICS NMDP ORG HLA RESOURCES SLARCH STRATILGES PUBUCATIONS EDUCATION POLICES Home gt HLA Ae leia Codes gt DHA Type Lookup Too Direct to NMDP HLA Resources DNA Type Lookup Tool HaploStats ES Microsoft Excel nmdp_code_report_Micro SSP_20111222133904_SSPR1 CO4_002_07 csv Update to NMDP allele code nomencisture 3 Eje Gat Yew Insert Format Toos Data Window Hep Adobe POF pea queston forhep P X oe ee PTPRE EET FOC BENE O AS amp locus Biannual Rare Abele Lists Locus Allele Codes Ga Cg Allele Code Lists C ORB C ORR Allele Code Mailing C DOAT C DOBI List 0401 04 33 04 35 04 3 04 38 04 39 04 40 04 4 1 04 42 04 43 04 44 04 45 04 46 04 4 104 48 0
24. 0 FUSREPGRX Inactivating Users Supervisors can inactivate users who are no longer using HLA Fusion User information is still stored in the database but the user is not able to log into the program 1 From the Main Menu select Profiles gt List User and select a user to edit 2 Clear the Active check box to deactivate the user 3 Click Save to save user information and return to the main menu or click Close to discard changes and return to the Main Menu without saving Note If a User ID is still associated with analysis records the User ID cannot be deleted HFR MAN Vv3 x x EN 00 Rev 0 167 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Lab Profile The Lab Profile menu displays the contact information for your lab network information used by HLA Fusion and NMDP contract lab codes Most of this information is entered during installation but can be updated at any time Only supervisors can change the Lab Profile From the Lab Profile menu you can e Edit the Lab Profile e Add edit and remove Lab Codes e Change the Network Path e Change the Email Server Name Lab Profile Information Screen Y HLA Fusion 0000000 One Lambda Inc Director or Contact Dr Emilia Johnson One Lambda Institute E mail email oli org A 21200 Oxnard Street Phone e18 555 1212 Oxnard Fax 818 555 1212 Postal Code 91361 Lab Co
25. 0 191 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Changing LABScreen Default Negative Serum Control Value Negative control sera can be adjusted or added for each product or lot You can change the trimmed mean fluorescence value for each bead individually 1 Select Utilities gt Antibody Product Configuration from the HLA Fusion main menu 2 Click Set Default Negative Value to open the Default Negative Serum Value screen Setting default negative serum value 5 Input User Default Neg Serum Control Value Se 3 Select a catalog file Catalog ID HLA Fusion 4 Select an existing Negative Serum value from the Catalog ID LS1A03 NC7_007_03 Select NS drop down Select NS Add New NS Name or Zee Select Add New NS Name from the pull down aE S menu to create a new negative serum 5 Type a name for the new negative serum into the Current NS field 6 Edit Default NS values for the desired beads in the right column Click the Save button to store the changes 8 Click the Close button Changing the LABScreen Mixed Product Configuration You can change LABScreen Mixed analysis positive and negative threshold settings for each product or lot The new cut off threshold values are used in every analysis session for that product or lot 1 From the LABScreen home page click Edit or select Utilities gt Antibody Product Configuration from the HLA Fusion main menu 2 Click Set Mixed
26. 29 2000 N hispanic 3202 Bio Court Orange FL 530 0534 32133 rmf3p1 com S12 230 1096 312 230 1096 312 230 1096 312 230 1095 EB Homes Terriana 0 Toula 3121 230 1096 607 Miami Hospital BONE MARROW Transplant AB Marrow DONOG rr rr Ti ADO BS7 DRIS DRS2 0P5 0P5 44715 Human Haigety Jimmy HJ Haigety 111 94 1212 11 222000 M caucasoid 701 Christian Brothers Eoad Bellflower CA NNU U514 91314 3 himen com 323 981 0916 325 345 1234 323 506 7771 714 556 1209 Verizon Corporation Juanna O Juanna 3235 345 1098 103 5t Michael Hospital MARROV Transplant 0 Tissue Patlentrrossrrrrrrrrrrrrrrcararrrrrra rr DO DE DES oro 44716 Human Shoemaker Cheryl 5 Shoemaker 111 135 1234 11 22 2002 F black 1705 Brothers Road Canyonville OR NNU U5S4 97417 sciimen com 541 8399 4467 541 839 6509 541 299 1096 541 760 1966 Juniper Creek Elizabeth 0 Elizabeth 3235 345 1098 103 5t Michael Hospital MARROW Transplant 0O Tissue EDO Error AT rr DR Hp eee 44717 Human Dublin Nikitta D Dublin 1111 13 1234 1172272004 F asian 345 Ashilly Court Canyonville OR NNU US4 97417 schmen com 541 839 4467 541 839 6509 541 299 1098 541 760 1986 Juniper Creek Elizabeth 0 Elizabeth 323 345 1098 103 5t Michael Hospital MARROW Transplant 0 Tissue EDO E rr rre heyy CU CUl DR DR DRS1 DRS2 DOF DO6 26198 Human Sharpitis Thomas T Sharpit is 023 168 0002 1717 195
27. 31 01 02 i F f TE E 2 4 31 01 03 The 31 01 04 ora E SS See et ee de A a gt 4 31 01 06 attern KOLOT E fa EE e 4 31 01 08 E Input and A 31 01 09 E al SS analysis asomo i o ea A 31 02 EA tables q _ e a en a ee a A 31 04 ET TE E El E Groups and iia ee AL al Rd tesi Condenses ISplays dl y pairs with allele See eo the same airs Group 1 frequent on both 4 a 31 xx At33 xXxX2 a ECN a N p XXl 31 01 31 02 31 04 31 05 31 06 31 09 31 11 31 JA31 A reaction A 31 01 02 A 33 01 01 G1 33 01 33 03 33 04 33 05 33 06 33 07 33 10 33 ff 433 A 31 01 02 A 33 03 01 61 k Pe pattern A 31 01 02 A 33 05 61 C 03 XX1 C 03 XX2 A Blank A33 A 31 02 A 33 01 01 G1 A Blank A A 31 02 A 33 03 01 61 C C A 31 02 A 33 05 61 C 03 XX6 C 15 12 C Cw4 A 31 04 A 33 01 01 61 C 04 XX7 0 04 xX8 C Cw8 A 31 04 A 33 03 01 61 Cw4 Cug x Click here A 31 06 A 33 01 01 G1 ST The Results A 31 06 A 33 03 01 61 31 01 01 to view A 31 06 A 33 05 G1 y A 31 01 02 A 33 01 02 area lll pf A 31 01 02 A 33 01 03 or add a 4 gt A 31 01 02 A 33 01 04 7 gel image Assigned Allele Pairs x v Assigned Allele Code Assigned Serology Ix v A 31 01 02 A 33 05 A 31 XX1 A 332XX2 A31 433 User Comment m System Comment Other Assignment Vv Passible Homozygous z O More Tests L Patient Assian Assign gt gt HFR MAN Vv3 x x EN 00 Rev 0 82 One Lambda User Manu
28. A eee select a different start and end date P mine ies Session Date 3 19 2012 4 2 2012 Click to filter sessions by selected criteria 3 Enter or browse for specific sample or session characteristics or status see below 4 Once you set criteria and click the Find button on the left panel of the Reports Sample session window the session list in the right panel eer oe uso of the window filters accordingly lepine ek characteristics O Yes No A as search criteria Analysis Data Exists Yes No Al Assignments Made O Yes No All Generic Ambiguity Exists U Yes No Al False Reaction Exists O Yes No Al LBSW Generated Yes 2 No NA HFR MAN Vv3 x x EN 00 Rev 0 118 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Session Sample Selection e Inthe Samples Sessions list click the sign next to any session to expand the display to show its samples View by Sessions or by Samples Session Y TestDate Product Type W Operz A session with some but not all RS502345 008 03 04 30 2013 ssn BSmith samples selected OL2000_DR_L16_1D756 03 14 2013 sso BSmith d 6202011CL0C10149521D459 06 20 2013 sso BSmith Sessions A session with all 4 3 12 QAP RSSO2345010_1D1147 04 03 2013 550 ESmith samples selected 2 12 2010 DRB1 Locus DZ 02 12 2013 ssn BSmi Ej El 25468 1 me e e 25469 2 Batch AoA 25470 3 Batch Sample l
29. Current Database ocal FUSION FUSION_BSmith NE LAMBDA After the session s have been successfully transferred to the target database Fusion will display this message Hove Sessions Sessions moved to target database successfully HFR MAN v3 x x EN 00 Rev 0 140 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Sample Management In HLA Fusion sample lists are an easy way to input a large list of Sample IDs and other sample information into the database for use in analysis sessions Sample lists may bein XLS CSV or TXT file format From the Sample List Import menu you can import sample lists or edit sample lists prior to importation Note Please verify all data you import as HLA Fusion performs minimal data validation upon import HFR MAN Vv3 x x EN 00 Rev 0 141 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Importing Sample Lists Sample lists are an easy way to input an extended list of Sample ID s and other sample information into the database for use in analysis sessions 1 From the Main Menu select Sample gt Import Sample List The Import Sample List window displays Import Sample List Screen Select Sample List to Import CA OLI FUSION data session Data Reference Files Sample ListiNew_Standard_Date_SDF_FormatFile List Format sam ple List csv Me Search Sample List i IT Remove from SamplelD ee as
30. EE adios A A A os 47 CONTIN S ae O 47 O O o e S 48 EXOn gt Pecitic summary PAN ici 48 Exon summary Pane RIGHt Click ORTA tii 49 EPG IP Mi e a a a OS 50 Allele Typing Result PING nia iaa 50 EPO Panel aiii ds 51 Edit Base Calls AAA Aa 51 Navigating the Alenment screen Spirit oie cllioa 51 Sample Aletas dt da dsc into de do tidad 52 Sample Base Call SCOPE AIS MINOW eenn nnne a Oa 52 Allele Para MENE A A A da 53 A A aaasecca mart osea aitadeunanseisceassasemeeaes 54 Starting SSO ANAIS N NN 54 Opening a SSO Analysis SESSION A nl cuneate denht dence doves 54 Displaying an SSO ANGIVSIS WINIO Wisin ia 58 FIISLORY AIMS riada 59 CONTeUrING SSO Data Analys SR ds 59 AN e A A A A O A N 59 GA DUI a 59 Minimum Positive CONTO sti 60 HFR MAN Vv3 x x EN 00 Rev 0 5 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX MINIMUnN BO Couso oa 60 Set Sure Reaction BO as 60 SSO Analysis WINDOW OVErVIE Wisin o E a a E 61 Wsing the SSO Data Analysis WIN IOWA a 61 SSO ANalVSis WINDOW Quadrant dea 61 A O E 61 Raco ale Pan ale oul fra Danna 62 tocat OE Ta ia 63 Patient sample Results VAD chr setccnt a hte datecat nsec e O 63 SSOANalVSIS WINDOW QUACK ant 2 xcicccee rect eter eee eie tein orice iS 64 BAG Pl ORNG ROO OS 64 RaW Data TO ea 65 Bedd IMO o A a PA EE ER A A 66 550 Analysis WINDOW Quadrant Smaise dia 67 Sample Pro A 67 VIEW De an ii E ual ab E E E EA TO 68 COMMER o a a A E E emotes dane eachaae 69 SSO ANAI
31. O Session Date Time DESC O Tray Status O Session Name By Patient ID o Sample ID By Session ID By Catalog ID Display Fields for Navigator E O Sessions O Session Name O Session Date O Test Date O Catalog CO Locus Type O Tray Status E O Test CO Sample Name CO Well Position O Patient ID CO Sample Date O Well Status Test Date r Session Date af 1 2013 ff 1 2013 Session Status E Catalog Type VONE LAMBDA 000 Whatever search settings you set here become the default search settings for HLA Fusion Research So if you re already in the analysis mode with a certain product only the sessions that fit the Find Criteria you ve set for that product will display You can choose to search by Patient ID Sample ID Session ID or Other Other allows you to provide multiple search criteria Test Date range Session Date range Session status and Catalog Type The Find dialog box also allows you to modify the Navigator session sort and display criteria Note The date range set here in the Session Date field is used as the default date range throughout the software such as in the Navigator and Reports windows Each time you change it and click Find the default changes for the rest of the application Group by Catalog Navigator Product List When you select the Catalog option sessions are displayed in alphanumeric order by catalog name Product
32. Place a check mark in the Edit Update check box at the bottom 3 left of the screen POSNE LAMBDA 0 bn Patient Donor Information 4 Edit patient donor information on either of the three tabbed forms which are part of this screen Fields marked with an asterisk are required Enforce ISBT for Click the Save button to store your changes 6 Click the Close button to return to the previous screen Associating a Patient Donor ID with Sample ID s A Sample ID cannot be associated with more than one patient or donor record but a patient or donor record can have more than one Sample ID associated with it From the HLA Fusion Main Menu select Patient Info gt Manage Patient 1 Select a Patient or Donor ID from the drop down ID box on the main Patient Donor Information screen Enforce SBT format for Patient Donor ID rin e Or click the Search Patient Donor button to locate the correct Patient or Donor ID 2 Click the HLA Tests tab at the top of the window HFR MAN Vv3 x x EN 00 Rev 0 152 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The HLA Tests screen opens E o Class II E DRB1 DRB3 DRB4 DRB5 Only digits BLANK Low and are accepted in serology fields Class Bw Cw DR DR 51 52 53 DQ DP NONE LAMBDA Patient Donor Information Screen HLA Tests Tab 3 Place a check mark next to Edit at the top of the scre
33. Select a format from the Save as type drop down list Excel Acrobat Word or Rich Text format Click the OK button By default the fileis saved inc OLI Fusion data report 4 You can also export a report by clicking the Export Report button on the main Reports page Accessing Reports from the My Favorite Menu The My Favorite menu is a convenient way for you to access and generate the reports you use most often You can make as many as 18 report types available from the My Favorite drop down including custom reports Adding to or deleting from the list is easy Adding Reports to My Favorite Make sure you have selected the report you want to add to My Favorite verify that its name is displayed in the Report Options section of the Reports window e Select My Favorite gt Add to My Favorite Add a new report to the My Favorites menu My Favorite Add to My Favorite Remove from My Favorite The current report name is added to your My Favorite menu When you want to generate this report just click on its name from the bottom portion of the My Favorite menu My Favorite Add to My Favorite Saved reports are Remove from My Favorite listed below this line and can be accessed Combined Sample Generic Typing Ls at any time Removing Reports from My Favorite 1 Select My Favorite and select the report you want to remove from the list of reports at the bottom of the menu The My Favorite menu closes
34. Summary section displays the system suggested results for the SSO locus groups where the alleles highlighted in yellow are positive match red highlighted are a mismatch and the remaining un highlighted ones are negative To make a manual assignment please follow the steps below The Allele Assignment panel lists the possible allele pair results for the selected SSO locus groups KIR Results Summary Allele Assignment Final Assignment Results KIR2DL1 0020101 KIR2DL1 007 Assign All b KIRZDL KIR DL1 001 KIR DL1 0040101 KIR2DL1 001 KIRZDL1 01102 K KIR2DL1 001 KIR2DL1 0040102 ana ak ie KIRZDL1 001 KIR2DL1 D0402 KIRZDL1 001 KIRZDL1 00403 Assign KIR2DL1 001 KIR2DL1 006 Selected KIR2DL1 001 KIR2DL1 007 KIR2DL1 001 KIR2DL1 01101 KIR2DL1 001 KIR2DL1 01102 WDS KIR2DL1 001 KIR2DL1 013N y KIR2DL1 0020101 KIR2DL1 0040101 KIR2DL1 0020101 KIR2DL1 0040102 Remove KIR2DL1 0020101 KIR2DL1 00402 KIR2DL1 0020101 KIR2DL1 00403 KIR2DL1 0020101 KIR2DL1 006 KIR2DL1 0020101 KIR2DL1 007 KIR3D51 KIR2DL1 0020101 KIRZDL1 01101 KIR2DL1 0020101 KIR2DL1701102 Positive Mismatch Negative Select an allele or several alleles by holding down the Ctrl Key on your keyboard from the Summary and click the Assign button to assign the SSO locus group in the Final Assignment panel To assign allele pairs select one or more pair results from the allele assignment panel and click Assign Click the Assign All button
35. Test Info tab to see the information for the current patient donor If more than one information card is displayed use the arrow buttons to navigate through the patient records 4 Click the Close L 1 button in the upper right corner to close and return to the Reports window Audit Trail Report You can view and print a report of user activity for the current database This data is only available if you have done the following e Set up and connect to an Audit Trail Log database see the HLA Fusion Database Utility User Manual e Enabled Audit Logging from the HLA Fusion default home page HFR MAN Vv3 x x EN 00 Rev 0 132 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Once you have completed the above and wish to view audit log data take the following steps On the home page click the Reports tab in the Fusion Explorer Or Select Reports on the Fusion Menu Bar at the top of the screen At the Reports screen select Miscellaneous gt Audit Trail Log The Audit Trail Log dialog box displays Audit Trail Log Screen Audit Trail Log HLA Fusion 0 0 0 0 0 0 0 Modules User actions Bob Smith y C Antibody Tracking Manage Patient C Sample Analysis C Analyze C Login C Retrieve C Batch Analysis C Manage Profile C Sample Summary C Create C Logout C Search Date from To O HLA Fusion O Manage Sample Update Reference O Delete O Other O Update 1 28 2012 y 5 23 20
36. These files can be moved anywhere for central access but to do so you must update the OneLambda Fusion Interface exe file to reflect the new location see figure above e When you open a report to customize it a backup copy is automatically created with the timestamp as the suffix of the report name This allows you to retrieve the original report format if needed 1 Select Reports gt Tools gt Customize Report HFR MAN Vv3 x x EN 00 Rev 0 124 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Use the Crystal Report Designer tools to modify the appearance of your report Once you have made changes to the report format save it Make sure you do not change the name of the report file Next time you run this report in HLA Fusion the report will have the appearance you last saved in Crystal Report Designer Creating Custom Data Export Templates 1 Select Tools gt Setup Data Export to customize report data export by setting up templates that determine the type of report data session sample patient results etc is exported when you select that template The Export Data Setup dialog box is displayed allowing you to select the name of the export template the fields to be included and the field order you want for the template Select check boxes on the left to select category and fields On the right side of the dialog box drag and drop the fields or hold the CTRL key down and press the Up Down
37. a report type containing the word Custom in its name for example Molecular Custom under the Generic Typing report type menu 2 Click the Setup button in the Report Option section of the window The Custom Query Report Setup window is displayed allowing you to customize report content by selecting from various categories and fields HFR MAN Vv3 x x EN 00 Rev 0 126 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Custom Query Report Setup M Lab Information IV Approved By IV Patient Info Z Sample ID Local ID IV BarCode IV Sample Session Info IV Saved Confirmed Info IV More Testing Needed IV False Rxns Ambiguity Exists M System Comments V User Comments Y Positive Beads Wells Summary Nomenclature Date M Cose Reaction Beads V NMDP Local code update date I Cutoff Summary SSO Graph V Gel Image SSP only JONE LAMBDA Molecular Custom report setup screen Custom Molecular and Antibody Report Setup 1 Enter a name or select one from the drop down list 2 Select the check box next to each field you want to include in this report Note To include all related fields you can click the Check All button to select all the fields in the category 3 Click the Save button to save the custom report setup you have just selected HFR MAN Vv3 x x EN 00 Rev 0 127 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Sample Summary The Sam
38. adds a colon If you select a catalog to import that is in the old allele format you are notified with a message Select the translation option you want to use before going to the next step Translate alleles Option Translate Allele E The catalog 151404 _ 002 _ 03 pou wart lo mpat was created using the old allele formal If pou wish the system will translate these alleles mto new allele format Please note that the old alleles which do not have matching new allele names wiil be kept and imported as is Do pou wish to translate so _ yem near 6 Click Yes or Yes All to translate the selected catalog files Note Catalog importation takes a bit longer when alleles are also translated HFR MAN v3 x x EN 00 Rev 0 173 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Latest Lot or Revision The results of your reference catalog update are FVE LAMBDA noted by Fusion at the bottom left of the Reference file processing completed 2 processed 0 skipped Reference File Manager window 6 Click the Close button to return to the previous Update Reference window Note Imported catalog files can be used without restarting Fusion Updating Catalog Files from the One Lambda Download Site Product catalog files are available on the One Lambda download site http download onelambda com 1 From the main or any of the product home pages click the Download link or from the main
39. deactivate and undo any edits you ve made to the EPG for this sample Fusion Research will ask you to reconfirm the new analysis before proceeding Comments Clicking the Comments button will open the Comments and Warnings wndow Any comments you add here will be saved with the sample HFR MAN Vv3 x x EN 00 Rev 0 43 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Note that the Comments and Warnings window becomes read only after the session is saved and the Confirmed gt button is pressed More Tests e More Tests Iw A check mark placed here indicates that you recommend that additional tests be performed on the sample The More Tests column for a sample on the Session Summary Screen will indicate True if a check mark is placed here Key List K Set current position to G T Set current position as unassigned Confirm the base call at the current position Place an insertion at the current position Place a deletion at the current position Move the cursor left one base Move the cursor to the previous marked position Move the cursor to the first sequenced base Move the cursor right one base After you click the Key List button a pop up window appears which displays a list of shortcut keys and key combinations which can speed up and simplify editing analysis and display navigation The following chart lists some of these keys move to the next unconfirmed position
40. into the Other Assignment field e Click the Assign V button and select one of two options 1 To assign just the possible allele code select Assign Possible Allele Code 2 Choose Assign All to bring the Possible Allele Code Serology or Assigned Allele Pairs assignment s into the Other Assignment field HFR MAN Vv3 x x EN 00 Rev 0 98 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX You can then choose to modify any of the copied code if desired e The entered allele is assigned and is included in reports that are run that include this sample e Itis not listed in any final assignment fields for this sample Possible Serology Field The serology equivalent field displays all serology equivalent suggestions for the sample based on the possible allele pairs When you select a displayed serology equivalent the allele pairs associated with it are displayed in the field below Note Make sure you have imported the current serology equivalent file through the Utilities menu If a zero 0 appears in the serology assignments this means you need to import the current serology equivalent file e Only one serology equivalent assignment for the sample can be made at a time Therefore a current serology assignment is replaced if you select and assign a different one Note If this is a multi loci test more than one locus can be assigned However for single locus tests only one locus can be assigned Possible
41. return to the Main Menu HFR MAN v3 x x EN 00 Rev 0 156 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Deleting Patient Donor Records Patient donor records can be deleted through the Manage Patient menu option 1 From the Main Menu select Patient Info gt Manage Patient Click the General Info tab Select a patient donor record Click Delete to delete the patient donor record from the Fusion database Click Save aoe wN Creating Patient Donor Lists The following is an example of a patient list that can be created and the guidelines for doing so The patient list must be formatted for import via a program like Excel or Notepad and saved as a Windows compatible CSV file The first field section must contain the names of the patient list fields each separated by commas Note Creating a new patient list can be made easier by first exporting an existing list into CSV format and using the fields in that to build your new list Patient List Field Names and Format PatientIDName CategoryGrp FamilyID FirstName MiddleName LastName Ssn Dob Gender Ethni city Address City State Region Country ZipCode Email Phone WkPhone Cellular Fax Emplo yer SpouseName SpouseBloodType EmergencyContact EmrgncyTel DCN HospitalName Division BloodType Disease RhHBloodType PatientDonorFlg Associated SamplelDs Associated DonorIDs HLA A HLA2 A HLA B HLA2 B HLA BW HLA2 BW HLA1_C HLA2_C HLAl1
42. select a new catalog from the list of available catalogs 4 Click the Analysis button The session on which you right clicked is now re analyzed with the catalog you ve selected HFR MAN Vv3 x x EN 00 Rev 0 105 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Sample Level Options Eb 12 19 2012 EE Mi Two menu options are displayed if you right click on an active perra sample in the Navigator remember to select the sample first l Side By Side Analysis with a left click agam E 12 16 2012 Related Records A Related Record is a record that is associated with the current sample by Patient ID or Sample ID Note This option is also available when you use the Related Records toolbar button El e Right click a sample from the Navigator and select Related Records to load all records related to the current sample into the Sample drop down list at the top center of the screen Sample ID s Navigation buttons e Use the sample navigation buttons to display the analysis of each related record one by one To go back to viewing the samples in the current sessions click the lt lt Summary link at the top of the window Side by Side Analysis Use this option to compare the current sample analysis with one previously conducted Note as option is also available when you use the Side By Side Analysis toolbar button E Catalog ID Micro SSP_20121226085334_SSPML02_003_07 SSPMLO2_003_
43. sending it to the printer HFR MAN v3 x x EN 00 Rev 0 74 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Micro SSP Analysis The Micro SSP analysis feature of HLA Fusion Research analyzes manually input reaction patterns as anew analysis session and can also continue the analysis of a previously unfinished session Each session consists of as many samples as you wish to analyze with the same catalog information It can also accept data from eGene and new samples can be added to an existing session Analysis results are based on catalog specifications NMDP code and serology code references that are provided with the software Micro SSP analysis uses NMDP cross codes Fusion Research suggests the allele pair assignments but the final assignment has to be made by the user The results can be saved in the database for further review by Lab Technicians and for final approval by the Lab Supervisor s HFR MAN Vv3 x x EN 00 Rev 0 75 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Start Micro SSP Analysis 1 Click the Micro SSP button on the Fusion Explorer the Micro SSP El icon on the Fusion Toolbar or select Analyze Data gt Micro SSP The Micro SSP Home page is displayed HLA Fusion Micro SSP Product and Catalog Active Catalogs Serology Equivalent 160 2012January 10 11 2012 Micro SSP Configuration Cross Code Enabled Code NMDP V3 No Active Demo
44. this quadrant is in the View Delta mode by clicking das the Save Layout la button o p After you exit Fusion and log in again your SSO sessions will display in Quadrant 3 in View Delta mode Comments You can add comments to the sample by typing in the Comment field at the bottom Double clicking in this text box invokes a new window to type comments in to Open Double click a larger in the User Comments Comments screen here field here User Comment System Comment SSO Analysis window Quadrant 4 SSO Results and Assignment panel Quadrant 4 displays the possible typing assignments for the current sample The left side the Summary shows possible allele pair assignments suggested by the software The alleles highlighted in yellow are a positive match The red ones are mismatches The un highlighted ones are negative HFR MAN v3 x x EN 00 Rev 0 69 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX KIR2DL1 001 KIR2DL1 0040101 KIR2DL1 001 KIR2DL1 0040102 KIR2DL1 001 KIR2DL1 00402 KIR2DL1 001 KIR2DL1 00403 KIR2DL1 001 KIR2DL1 006 KIR2DL1 001 KIR2DL1 007 KIR2DL1 001 KIR2DL1 01101 KIR2DL1001 KIR2DL1 01102 You must make assignments manually KIR2DL1 001 KIR2DL1 013N KIR2DL1 0020101 KIR2DL1 0040101 KIR2DL1 0020101 KIR2DL1 0040102 KIR2DL1 0020101 KIR2DL1 00402 KIR2DL1 0020101 KIR2DL1 00403 KIR2DL1 0020101 KIR2DL1 006 KIR2DL1 0020101 KIR
45. to add new catalog files to the database Note The catalog drop down list may not be immediately updated if you downloaded the catalogs during the current import session You may need to click the Home I button and then click the LABType button again to return to the import process If the CSV file specifies a template name only applies to CSV files from Luminex 2 2 and later and one of the available catalog files is associated with that template then that catalog file is automatically selected Note You can also select a different catalog file from the one the system has selected by using the drop down list in the Catalog ID field and selecting any catalog file listed If there is no template match the system then considers the closest bead match between the session and all available catalog files If only one catalog file is a close match it is automatically selected If there is more than one match a Catalog Validation screen is displayed with the best bead matches Catalog Validation HLA Fusion 4 Clicking the HLA Fusion siete Cin SR Close Telewest sera tanane Validation Resuts button also Suggested Catalogs Double click to select and continue means that you ane Ean sams aaa RSSOKIR_005_01 23 selection of this SOM O es Set catalog _ox_ ONE LAMBDA 0 00 ONE amena 000 Or you can double click a catalog file name on the list of other Suggested Catalogs liste
46. to assign all Positive SSO locus groups The selected allele s are displayed under the Final Assignment To remove any or all alleles from Final Assignment sections select them and click the Remove X button HFR MAN Vv3 x x EN 00 Rev 0 72 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Flagging a Sample for Further Testing This option flags a sample for further testing in the current analysis session and in reports created in HLA Fusion Research The More testing required flag is saved with the analysis lt 4 Inthe Analysis window select the More Test check box below the zi Assignments area LT Patient Assign Manual Assignments Manual assignments must be entered in standard format with each allele separated by two spaces _ Click to move allele into the final assignment box above Type allele name here in the manual assignment field Type the allele name in the text box below the Final Assignment section and click the Up Arrow L button The newly entered allele is moved into the Final Assignment field SSO Batch Analysis Batch analysis is carried out from the Session Summary screen When the session summary for a new session is activated a batch analysis is automatically run Batch analysis allows you to quickly analyze a session and save it for later review and final assignments You can graphically view samples during batch analysis but no final typing assignme
47. x x EN 00 Rev 0 67 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Magenta Positive i Control Bar colors display Raw Saa i Data e Positive control Magenta Value e Negative control W nite White Negative Control Beads Hover your mouse pointer over any sample Bead ID 033 Bead Count 106 The sample s details are displayed as shown Normal Value 103 Raw Data Tnmmed Mean 2931 33 Sample Cutoff 70 OLI Cutoff 70 here Postre Control 056 2833 26 You can expand the histogram by double clicking anywhere in the light blue area between the View Delta button and the Maximize O button To resize the histogram to its original size double click on the light blue panel again or click the Minimize L button View Delta To view the Delta data the difference between the signal generated and the cutoff point for each bead click the View Delta button DO TN M LO OM 09 0 09 0 OT NMM LO O MP 09 eme O OL OL LO OO 10 O 0 O O OO O o ocoooocoecoeooceoocoecoecoecoocecooocooocooc caa Quadrant 3 Delta View HFR MAN Vv3 x x EN 00 Rev 0 68 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX To go back to the normalized view click the same button which now says View Normal View Normal Would you prefer to make View Delta the default view so that it automatically displays each time you bring up a sample for analysis e Save the layout while
48. 0 F caucasoid 9701 Bicycle Lane Cystal Willane Ca SMM 134 91002 sharli vrahnon mnom 17141 9782 1098 t7141 978 1098 171491 978 1098 1714 209 7817 HFR MAN v3 x x EN 00 Rev 0 158 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Patient Antibody Tracking You can track antibody strength for each patient over a period of time The information tracked is taken from the typing data stored in their Patient Donor Info card and the antibody data in their analysis samples LABScreen Single Antigen and LABScreen Singles for the specified date range Take the following steps to display graphs and data that track a patient s antibody data Make sure you have patient and donor information entered into HLA Fusion If not you can import it from a patient list and or manually enter the data on the Test Info tab of the Patient Donor Info card Patient and donor records must be associated 1 Select Patient Info gt Ab Tracking The Patient Antibody Tracking window is displayed Patent iD founery Search Donor ID none lar Molecular r Typing zj sero Typing Date anyon te 4713 poner Clicking the Save mas button here saves any samples listed in this area for future analysis as samples within the chosen date range mole Sample Samp Ore Aday ey Wet v y gt tel e NC nal A rn ian Nes A nET a iden lows i PC IC Final Assignment
49. 07 Micro SSP_20121526085334_SSPML02_003_07 SSPMLO2_003_07 PONE LAMBDA 000 HFR MAN Vv3 x x EN 00 Rev 0 106 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX 1 Right click the sample and select Side by Side Analysis 2 Select a previous sample analysis from the displayed list to compare it to the current one The two analysis windows are then displayed in a comparison window Current Analysis Previous Analysis e Fach window can be resized and moved by dragging and dropping e Click the Side By Side Analysis toolbar button again to cancel the comparison display HFR MAN Vv3 x x EN 00 Rev 0 107 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Quantiplex Beads Quantiplex Beads data can be imported and used during LABScreen Analysis When imported with LABScreen sessions you can view SFI values in bead pop ups and raw data tables in the LABScreen analysis window HFR MAN Vv3 x x EN 00 Rev 0 108 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Entering and Using Quantiplex Bead Information You can select different Quantiplex Beads Sessions for use in LABScreen analysis Quantiplex Beads Sessions cannot be changed after they have been imported From the Main Menu you can e Enter Quantiplex Beads sessions e Select a Quantiplex Beads session for use in LABScreen Analysis e View Quantiplex Beads SFI values in LABScreen Ana
50. 1 8 AB DR IMAB 21D8 074 HFR MAN Vv3 x x EN 00 Rev 0 143 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Tab Delimited Format Fach field is separated by a tab This file lists in this order ShipmentLoc SampleIDName SampleType AB DR or AB DR TurnaroundTime 14 21 or 14AB 21DR DCN Fxample line 1 La 0201 1501 0 AB DR 14AB 21DR 074 SDF Format Each field is separated by commas This file lists in this order BoxSlot DonarID SampleType AB DR or AB DR Turnaround Time 14 21 or 14AB 21DR DonarCenter Example line 1120287 7867 8AB DR14 21074 Local Sample Patient ID Only This file is a Microsoft Excel file This file lists in this order Row 1 Column Title Local and Sample and Patient Column A LocalID Column B SampleIDName required Column C PatientIDName Column D Date A D LocalID Sample PatientID Date 1 20449 0235 14B DR14 8 10 1957 1 40449 0239 34B DR14 5 12 1958 1 2 3 1 30449 0238 54B DR14 2 10 1942 A 3 1 50449 0236 94B DR14 12 1 1960 Viewing and Editing Sample Information Sample information can be edited but associated Patient IDs cannot only new Patient IDs can be added 1 On the Main Menu select Sample gt Manage Sample Info HFR MAN Vv3 x x EN 00 Rev 0 144 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Manage Sample Window Use Filter to Search for Sample Information S
51. 13 y C Import Session C Product Configuration CO Export C Report Export C Manage Data C Report C Import C Report Run Epot Cos Use the drop down arrow to select the User for whom you want to see database actions Select the date range and options you want the report to include Click the List J button to see the report If you want to export the Audit Trail Report to Excel click the Export _t button HFR MAN Vv3 x x EN 00 Rev 0 133 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Report Types There are several report types available Although most report types are listed in this section please note that because new reports are sometimes added between updates to this user manual you may see more reports listed in the software Patient all patients in the Fusion database e Patient Summary Summary of both typing and antibody testing results associated with a Patient ID e Patient Typing for Batch typing summary report over different loci for a set of samples based on a selected session e Patient Custom you select the type of patient data to include for the selected samples Generic Typing typing data from analyzed LABT ype and Micro SSP samples e Molecular Custom you select the type of molecular data to include for a set of samples e Custom Typing Results by Sample you select the type of molecular data to include for selected samples e Allele Summary t
52. 2 2012 o z A a F Select Al Tasa asese A 0 conto tar Database ac 3 Select the patients from the list that you wish to copy by placing a check mark next to the Patient s ID in the Select column 4 Click the Browse button at the bottom of the screen to select the Target database where the patient record s will be copied If necessary click the Back button to return to the previous screen 5 Click to make a copy of the patient s records in the target database Note that copying a patient s records to another database leaves a copy of those records in the source database Moving a record deletes the specified record s in the source database and adds them to the Target database HLA Fusion allows you to create session log files of your selected analysis sessions which you can then print or archive 1 Provide all necessary session input information by using the drop down menus and search buttons on the left side of the Data window Once a session is selected its information is displayed on the right side of the window the Session Info pane where you can add information 2 Once you have all information you want to include in the log click Save Once you have displayed the session log you want use the Print Session Log Archive Active and Delete buttons at the bottom of the window to manage the log Note Samples can also be deleted individually without the need to delete an entire session The only except
53. 20 4 Set empty Patient ID to Sample W Auto Analysis Co 2 13828 LENIZE COSTA DOS REIS 12 17 2013 2 CE 3 13951 ARIANE SERPA DE SOUZA 04 18 2013 1100 1 Ae Tisscuunoeaenstaoawtas lonan mif INT as Rea anTomo cono stas foo Mn h se wen E Press the Delete key on your computer keyboard to delete the sample and prevent it from being imported as part of the session 6 When session and sample information has been verified click the Import button HFR MAN Vv3 x x EN 00 Rev 0 97 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Navigator The newly imported session is displayed in the Navigator tree at the me Pots TestDate Catalog Session Date top of the list If you had selected the Auto Analysis check box the session is imported as well as analyzed when you clicked the Import button it is now displayed on the Navigator as an analyzed session You can continue importing Luminex session files or you can click a session on the Navigator to start a batch analysis Note Once a CSV file has been imported it no longer displays on the Luminex session import list unless you select the Include Imported CSV check box at the top left of the screen Displaying an SSO Analysis Window 1 Open a SSO session 2 Click on a sample to display its analysis in the Analysis Window The SSO Analysis window is divided into four quadrants ac pan Local Oc Pasentsampte Resul
54. 2DL1 007 KIR2DL1 0020101 KIR2DL1 01101 KIR2DL1 0020101 KIR2DL1 01102 KIR2DL1 0020101 KIR2DL1 013N KIR2DL1 0020102 KIR2DL1 0040101 KIR2DL1 0020102 KIR2DL1 0040102 KIR2DL1 0020102 KIR2DL1 00402 KIR2DL1 0020102 KIR2DL1 00403 KIR2DL1 0020102 KIR2DL1 006 KIR2DL1 0020102 KIR2DL1 007 KIR2DL1 0020102 KIR2DL1 01101 The right side shows possible coded assignments HFR MAN Vv3 x x EN 00 Rev 0 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Analyze SSO Data From the Analysis window you can e View raw data e View reaction patterns e View bead and sample details e View results and make typing assignments The raw data table can be used to easily review raw data normalized data and cut off values The reaction pattern table can be used to compare reaction patterns Reaction specific pop ups display the probe details and reaction data for the selected sample and probe HFR MAN Vv3 x x EN 00 Rev 0 71 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Make Typing Assignments in SSO Analysis HLA Fusion Research provides computer suggested assignments Final typing assignments can only be made by the user You can save multiple SSO Typing assignments From the Analysis window you can assign typings and make manual assignments Typing Assignments The SSO results are displayed in Quadrant 4 of the Analysis window This quadrant is divided into three sections The
55. 4 49 04 50 04 51 04 52 04 53 04 Cc 04 01 04 33 04 35 04 37 04 38 04 39 04 40 04 41 04 43 04 44 04 45 04 46 04 47 04 48 04 49 04 50 04 51 04 52 04 53 04 54 04 Nomenclature Version You may request allele cc Blevews morte ls a New Code B 27 KxX1 A 27 1000 Source XX code saved as a spreadsheet csv file Micro 55P_20121010154702_55P11 _007_07 el 27 04 127 05 27 15 27 28 27 31 27 319 27 41 27 45 27 46 27 48 27 49 27 50 27 27 54 27 55 27 XX2 027 304 27 305 27 315 27 328 27 331 27 339 27 241 27 345 27 146 27 348 27 249 27 50 27 51 27 354 27 355 27 XX3 2704 27 205 27 215 27 128 27 31 27 39 27 41 97 185 27 146 27 248 27 249 27 250 27 51 2754 27 255 27 a AA 05 27 15 27 28 27 31 27 39 27 41 27 45 27 46 27 48 27 49 27 50 27 51 27 54 27 55 27 Pb zm XX code saved as a text txt file New Code xx1 0 11 01 11 02 11 03 11 07 11 12 11 21N 11 22 11 29 11 30 11 32 11 37 11 41 11 42 11 46 11 4 132 z A 9 103415 A 69 01 11 01 11 02 11 03 11 07 11 12 11 21N 11 22 11 29 11 30 11 32 11 37 11 41 11 42 11 46 11 47 1 A a a Other Assignment The Other Assignment field can be used to make a sample assignment that is not restricted to any format In addition you can highlight and add serology or allele pair or code assignments and add them to the field for modification You can make other code assignments one of two ways e Type an allele pair or allele code
56. 4_QC_407 10 11 2010 RSSO1B_014_04 04 07 2009 RSSO1B_014_06_QC_244 10 11 2010 RSSO1B_014_06 Patient Sample Results tab SSO Analysis window Quadrant 2 Bead Profile The Bead profile tab displays the histogram for the currently selected bead Each bar represents a sample and its height represents the normalized reaction value for the selected bead in that sample The red bar represents the currently selected sample Click the arrow buttons to navigate between beads and display the profile of the selected bead in Quadrant 2 Bead Profile HFR MAN v3 x x EN 00 Rev 0 64 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Alternatively you can select the bead from the Bead drop down choices Hover your cursor over any sample sample ID Name TER278 Raw Data 9 Well Position 14 F2 The sample details are displayed as shown here If you wish to exclude a bead from analysis you can select the check box for Exclude Click on the Reset button to reset the changed values back to default The following options are displayed to choose from Current Sample Current Bead to User Setting Current Sample All Beads to User Setting Raw Data Table Select the Raw Tab and the Raw Data Table displays all raw data and test details for the current sample HFR MAN Vv3 x x EN 00 Rev 0 65 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX To chan
57. 6 2 09 PM Microsoft Office Excel Comma Separ Select Luminex session S from the Select CSV a a ies El Quantiplextest101006_ID78 csv 10 10 2006 4 05PM Microsoft Office Excel Comma Separa Files List J Musc ay 3 Click the Open button el Homegroup 1 Computer E O O m The Quantiplex Beads Session Import screen File name ME CSV Files csv displays cnc Lo Date will be highlighted if regional settings do Nomenclature not match between the Session Catalog IMGT version current CSV file and Fusion Click to H browse g for CSV files Sg CSVFileName Luminex e CSV session files Quantiplex Beads Home Page button HFR MAN Vv3 x x EN 00 Rev 0 110 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Note A Session ID must be unique to the Fusion database If the Session ID already exists the software prompts you to rename the session It is also highly recommended that you do not use any special characters in this field since they may serve a specific purpose as field separators 4 On the Session Import Screen select a catalog file from the drop down list in the Catalog ID field Note If you need to import more catalogs click the Download link on the Quantiplex Beads Home Page The catalog drop down list may not be immediately updated if you downloaded the catalogs during the current import session In this case you may need to click the Home l button and then cl
58. A 91355 kdg lions net 662 234 1098 662 234 1095 662 234 1098 662 234 1098 Traveller s Insurance Kenneth amp Kenneth 662 234 1095 221 Henry Mayo Hospital AB Tissue Paltiellrrssrrrrsrrrrrsrerrrrrrrrrararrrasra pees CU CWo 0P4 36559 Human Prater FKatie P Prater 001 78 1009 7171949 F caucasoid 60 Prosper Road Irvine CA NT US4 91120 pkatiebmen com 714 760 1987 714 760 1987 714 760 1987 7114 760 1957 General Moters Jerry AB Jerry 714 760 1967 103 Irvine General BONE MARROW Transplant B MArron DONDE errrrrrrrrrsrrrrsrrrrrrrrrrrsraraaarar pores PRIO DRIO p DOe DO 35720 Human Quinn Gayle 06 Quinn 111 112 1212 5 25 1987 F black 120 Papa Road Anaheim Ci nnu USA 92017 gquinnkmen com 714 367 1022 714 367 1022 714 367 1022 714 367 1022 TY Mortgage Franklin 0 Franklin 714 367 1022 501 Anaheim Memorial Hospital BONE MARROW Transplant 45 BONE MARROW Patleltrrssrrrsrrrrrrrrrrsrirasaaraaaaaaa aa egy ep DROS rr 29817 Human Leopoldo Ramos LEO Leopoldo 102 00 1322 11 29 1949 hispanic 73 Joshua Street Fullerton C NNU US4 92357 lrdaol com 714 298 1045 714 295 1045 714 298 1045 714 296 1045 EB Homes Louisa 0 Louisa 714 2 25 1045 205 Fullerton Special Tissue o Tissue Patilllrrssrrrssrrrrsrrrrarsarrarararararr eel A B18 BTE Cw DRO DRS3 DRSe DP17 38533 Human Rivas Jose JV Rivas 331 00 1908 3
59. A I E Donor Group 7 Upda Patient Donor Information Screen Related Records A related record is a sample that is associated in some way with the current sample or patient From any analysis window click the Related Records button to load all records related to the current sample into the drop down list in the Sample ID field Use the sample navigation arrows to display the analysis of each related record one by one To exit from the related records mode click the lt lt Summary link next to the Sample ID field near the top center of the screen HFR MAN Vv3 x x EN 00 Rev 0 30 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Note This function can also be accessed by right clicking a sample in the Navigator See the product specific sections of this manual for more information about using this feature Side by Side Analysis From any analysis window click the Side by Side Analysis button to compare the current sample analysis with previous analysis sessions for the same Sample ID Select a previous sample analysis from the displayed list to compare to the current one The two analysis windows are then displayed together in a comparison window Fach window can be resized and moved by dragging and dropping Click again on the Side by Side Analysis button to cancel the comparison display Current Analysis Previous Analysis Note This func
60. Any of these analysis programs can also be opened by clicking on their Toolbar Icons or the tiles for each program at the bottom left of the screen in the Fusion Explorer For details see the individual product analysis sections in this user manual Reports When you select this menu item the Reports page is displayed allowing you to create reports of your analysis data HLA Fusion Research HFR MAN Vv3 x x EN 00 Rev 0 24 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Data ion Research When you select this menu item a Data wndowis displayed that allows you to manage delete archive activate and move sessions and samples map session alleles to the new NMDP nomenclature and view print log files of session data Sample Options under this menu item pertain to importing creating managing and exporting sample information This is also the menu to use for managing Luminex test lists and for creating sample work lists and plate designs Patient Info Options under this menu item pertain to importing patient and or donor lists and managing individual patient and or donor information le Patient Info Profile e H Import Patient List ma Manage Patient HFR MAN v3 x x EN 00 Rev 0 25 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Profile o Profile Utilities My Profile List User Lab Profile There are options und
61. DRB1 04 03 01 DRB1 04 03 03 By default cross coding is turned off so that allele pairs are condensed only within the same allele groups Bw4 Bw6 in Serology Bw4 Bwo is added to the serology results HFR MAN Vv3 x x EN 00 Rev 0 80 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Bw4 Bw6 in Serology NIMDP C Mo Code Serology has identified many pairs of HLA B alleles which appear to differ only at the Bw4 Bw6 region the two mutually exclusive serological epitopes e If you select this option Bw4 Bw6 is added to the serology results Cross Code Demog ap Info Demographic Information NMDP Code mpe Pabent Info Profile No Code Local Code F Grouping G Grouping The Demographic Information option allows you to organize alleles based on their frequency Cross Code Bw4 Bwe Common Jan 2012 v2 Based on the demographic selection you make HLA Fusion displays as many as three allele groups in the allele pairs list e Group 1 Frequent on both alleles e Group 2 Frequent on one or the other of the alleles only e Group 3 Frequent on neither allele Note If the Demographic Information option is not active it means you need to import an allele frequency input file See the topic Importing Allele Frequency Files which is located in the section Updating Allele Frequency files HFR MAN Vv3 x x EN 00 Rev 0 81 One Lambda User Manual HLA Fusion Research Sof
62. EPGRX Updating the Local Code File After a Local Code file has been created it must to be updated in HLA Fusion 1 From the main or any of the product home pages click the Download link or from the main menu select Utilities gt Update Reference gt Update Reference File The Update Reference File dialog box displays Update Reference File Local Code Update Reference File m Import Directory Directory Folder tree Local Code C Catalog C NED P Group GGroup Serology Equivalent Option M Import Local Code c Import Local Code AMERO Ready Select the Local Code option as shown above Use the import Directory Tree to locate and select the Local code file to be imported Click Import Local Code to import the selected file s Click Close to return to the Update Reference menu g Pp W N Updating P Group and G Group Files from the One Lambda Website The P Group and G Group files as published by IMGT can be downloaded from the One Lambda download site download onelambda com pub tray_info Windows HLA Fusion_Catalogs P_and_G Group 1 From the main or any of the product home pages click the Download link or from the main menu select Utilities gt Update Reference gt Update Reference File HFR MAN Vv3 x x EN 00 Rev 0 177 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The Update Reference File dialog box disp
63. FR MAN Vv3 x x EN 00 Rev 0 196 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Software Validation The HLA Fusion software has functionality to help with the validation process required by Labs Clinics and hospitals seeking to comply with GCP GLP and GMP Validation of the HLA Fusion software for your lab environment for regulatory or performance reasons can be automated by using the IQ Installation Qualification option from the Utilities gt Validation menu Your lab may choose to run these as a standard regulatory validation process to help troubleshoot issues or to provide information to prepare for a software upgrade IQ Installation Qualification The IQ process assists you with installation qualification of HLA Fusion software by providing a built in function Once the Installation qualification completes a results report is generated which you can save print or export to Excel Note If your IQ results concern you export them to an Excel file and e mail the file to OLI customer support 1 From the Main Menu select Utilities gt Validation gt IQ The validation test runs When it is complete a report is displayed with the following categories of data e Systems Information e g operating system e Environment e g directory path where the HLA Fusion program files are stored e URLs e g the URL for the catalog download site e Database Information e g name of the database
64. From the main or any of the product home pages click the Download link or from the main menu select Utilities gt Update Reference gt Update Reference File The Update Reference File dialog box displays Update Reference File xi HLA Fusion o n o Import Directory ie FL1HD01_010_00 a FL1HD01_011_01 SRecycle Bin FL1HD01_012 00 43a6f3854c 38dc8e4244a36d8bcd058 FL1HD02_010_00 Config Msi FL1HD02_011_00 File C Documents and Settings FLIHDO2_012_01 Ga Downloads FL1HDO3_010_00 director FL1HD03_011_01 y 7 FL1HD03_012_01 C Music FL1HD04_010_00 tree MSOCache FLIHD04_011_00 Catalogs f FL1HD04_012_01 rl FL1HD05_007_01 Ll data FL1HDO5_008_00 AppData FL1HDO5_009_01 g FL1HD05_010_ FL1HDO6_007_01 FL1HDO6_009_00 FL1HDO6_010_01 FL1HDO6 0117 FLIHD07_007_01 nd Catalog lt Catalog NMDP LocalCode PGroup GGroup Serology Equivalent Options Catalog Folder Last Update Date Aug02 2012 Go to OLI NINONELAMBDA 0 0 0 ol Ready HFR MAN Vv3 x x EN 00 Rev 0 171 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX If your serology information is outdated or you have not imported it yet a message like the one Shown below is displayed If you do not see this type of message go to the next step If you see the message click the OK button to open
65. Fusion Research Software 3 0 FUSREPGRX Note The online help can be accessed from anywhere within the HLA Fusion Research application when you press the F1 key Occasionally updates are made to the online help between releases of the HLA Fusion Research To ensure you have the most current help file you can either check the OLI download site download onelambda com pub tray_info Windows HLA_Fusion_Catalogs Document Or yOu can enable the auto download feature from the Fusion Research default home page pS Help Exit HLA Fusion Help HLA Fusion Video Tutorial Shift F1 HLA Fusion Feedback Product Update Notes Check for HLA Fusion Updates FAQs About HLA Fusion Exit When you select this menu item a dialog box displays that allows you either to select Yes to exit and close the HLA Fusion Research application or select No to keep the Current session open Toolbar Buttons HLA Fusion Research provides a toolbar displayed just below the Menu Bar with access to commonly used functions i it a Gh e im a e Note that some icons may not be available or enabled unless you re on an analysis screen e Some icons are only enabled in HLA Fusion Research while other icons are not enabled in the research version The table on the next page describes each toolbar button HFR MAN Vv3 x x EN 00 Rev 0 27 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Name or Function H
66. HFR MAN Vv3 x x EN 00 Rev 0 47 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Close Clicking the Close button exits you from ConsenSys application but not from Fusion Research Exon Specific Summary Pane Magenta color Exon sites indicates a mismatch sate n i TT A AS AACA e Numbers located at the top left corner indicate each exon site e A right pointing arrow indicates a forward sequence e The length of the line indicates the coverage of the sequence 3 2 A03 001 Right arrow direction indicates a forward sequence e A left pointing arrow indicates a reverse sequence and its length indicates the coverage of that sequence e The short magenta colored vertical bars indicate positions that require auditing These are polymorphic nucleotides sites that could change the final allele pair assignment e The long vertical bar indicates your current position within the EPG pane HFR MAN Vv3 x x EN 00 Rev 0 48 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Exon Summary Pane Right click Options Set Start Base Ignore all bases left in the 5 direction from the current cursor position this is effective only for the exon where the cursor is A placed This function is used to trim bases that are not interpretable All COCSCTTGATCGCASTGGSCTACGTGSACGAG ll a unique sequence polymorphism that exists will also be ignored and possibly resu
67. HLA Fusion Research Software 3 0 FUSREPGRX Starting a Combined Analysis Session Note If analyzing LabType data in combination with ConsenSys data make sure that the database linked to HLA Fusion Research matches the database used to analyze SSO data in HLA Fusion If the database names are different you will not be able to link SSO and SBT data Nomenclature updates between SSO and SBT analysis must also match 1 Click the ConsenSys home page button ConsenSys or the ConsenSys Toolbar W button to open the ConsenSys Home Page HLA Fusion ConsenSys Products and Reference Files Last Update Date 6 4 2012 Download Active reference files 9 Reference file Updates 0 ConsenSys Configuration Abl File Name Format Sample_Locus_Pnmer_Well_Other Locus Name Format A B Cw DRB1 DRB345 KIR DPB1 DPA1 DQB1 DGA1 MICA MICB A E cw DRB DRB34E KIR DPB1 DPA1 aa Ce ConsenSys Product Detail Nomenclature Date IMGT Version Download Date A ne is0 mea Crane fara CTA os we O o SS om mw oo SOS ConsenSys Home Page The ConsenSys Home Page displays important information concerning your ConsenSys products and reference files and the Ab1 File Name Format being used 2 Next click the Manual Entry button located at the top left corner of the screen Manual Entry HFR MAN v3 x x EN 00 Rev 0 38 One Lambda User Manual HLA Fusion Research Software 3 0 F
68. I Normal 1603 527 O SFI Raw 5580 458 Click the Raw button on the LABScreen analysis window to display the Raw Data table with SFI values 37 33 37 33 37 33 37 3 37 93 3 s33 37 33 37 93 37 3 37 9 37 33 37 33 37 33 37 93 37 33 E 9 37 3 11737 49 37 93 hrs 668 088 Qe 511 0516 11205 931 vee 110625 npa 11014874 pe 11437161 less 11603 527 wee 2022 973 8 8 8818 8 8 8 8 8 8 88 8 8 8 8 8 55 4 h 4 h 1 h 4 1 1 4 rr 1 4 1 4 Inc PC View MEI Information with Quantiplex Beads The Trimmed Mean Fluorescent Intensities MFI of test samples can be converted into Standard Fluorescent Intensity SFI units by using the linear standard curve obtained for the Quantiplex Beads read in parallel on the same machine 1 If Luminex CSV files have not already been loaded into Fusion click the small folder H icon located at the at the top left 2 Select Luminex session s from the Select CSV Files List 3 Click the Open button The Quantiplex Beads Session Import window displays 1 Place a check mark in the Select Quantiplex check box 2 Click the Quantiplex SFI button The Quantiplex MFI screen opens HFR MAN Vv3 x x EN 00 Rev 0 112 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX 6 O O HLA Fusion 0000o Catalog LXQNTPLX MOCK_001_01 24281 HLA Fusion plots the linear standard Curve of Quantiplex Beads using SFI y axis vs Trim
69. Libraries i dna 149 dr15 jpg Y Homegroup Computer amp c File name dna 149 dr15 jpg liepeg image jpg Cancel If you want to link this image to this sample click the Link Image 22 button e To zoom in click the button e To zoom out click the button e To turn the image click the Rotate button Click to close the Gel Viewer 85 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX To Unlink an image already associated with the current sample 1 Click the View Gel button 2 When the image is displayed in the Gel Image viewer click the Unlink button which now replaces the Link button Add Samples There are two methods that samples can be added and analyzed in a session 1 Click the Add New Sample button 2 Type a new Sample ID or Sample Name in the Sample ID field above the gel image e Data Reports Data Sample PatientInfo Profle Utilities Help Exit mS Sala 6 3 e 00 14 En 14 0 we Data Reports Data Sample Patent info Profle Utiles Help Ext 86324 Qda 42 Does 3 Select the Sample Date by clicking the Down Arrow Y in the Date field to the right of the A Sample ID field EEEE 4 And click the Analyze button t s 2 El 2 2 OR Today ua i Here s an alternate method to add existing samples for analysis in Micro SSP Sofa ai aa 45 1 Click the Sample Selection button to the night of the a iS i
70. Low Positive Threshold Changing Antibody Product Configuration TEO E HLA Fusion O i To globally change the antibody configuration for any product 1 Select Utilities gt Antibody Product Configuration gt Set Analysis Configuration 2 Select a Product type from the Product Type drop down Negative Sample Criteria Normal Value of First Bead lt O Display Graph Raw by Default Normal Value of Third Bead lt FM3D Conection Factor I Note that antibody configuration settings are OO Do Not Display Waring Messages different for each product O Swap Bead ff NC is higher than all Beads O Swap Bead if NC is high O Swap Bead F Low NC 3 Click the Save button to store your configuration settings You may also click the Reset to OLI button to restore the antibody configuration to the One Lambda default settings O Auto Accept All O Hide Tail Analysis Window PV ONE LAMBDA HFR MAN v3 x x EN 00 Rev 0 190 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Creating a Combined LABScreen Session Catalog To run a Class I and Class II combined LABScreen analysis session create a combined catalog to use for your session You must use a Class I catalog file and a Class II catalog file that have the same positive and negative control beads but do not have any other beads in common 1 Select Utilities gt Antibody Product Configuration from the HLA Fusion main menu 2 Click Create C
71. Patient Donor ID in the Patient or Donor ID field PatientDonor Info Patient or Donor ID m Ch 2 Click the Enter key on your keyboard Patent Donor Flag Donor St If you know only part of a patient or donor s information first name last name etc 1 From the Main Menu select Patient Info gt Manage Patient 2 Click the Browse L button which opens the Patient Donor List lt NONE gt ON E a Dee O anc b gt Se EEM Lien PN Y NO bah dy Patient Donor List 7 e S HLA Fusion 0000000 Patient 1D as Jones Family 1D Jones Sample ID Patient Donor Donor FistName Lany Active Archived Active LocalID Search de Active Archived pee ID Family ID First Name Last Name Patient Donor gt Ave lt NONE gt lt NONE gt lt NONE gt 3 Enter your search criteria i e patient or donor last name etc and click the Search button 4 Ifthe patient donor is located place a check mark in the box next to the patient donor 5 Click the Close button HFR MAN Vv3 x x EN 00 Rev 0 151 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Editing Patient Donor Records Note You must be a Supervisor in order to edit a patient donor record All patient donor information except patient donor ID can be edited 1 From the Main Menu select Patient Info gt Manage Patient 2 Entera Patient or Donor ID or search by using the steps outlined above 3
72. Product Configuration to open the LABScreen Mixed Configuration menu HFR MAN Vv3 x x EN 00 Rev 0 192 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX LABScreen Mixed Product configuration 3 Select a product catalog from the Catalog ID drop down list 4 Edit threshold values For LABScreen Mixed catalogs the threshold values can be set at the bead level Click Save to save the new values Click Close LONE LAMBDA NS File Import di NS File Import Importing NS Files ii HLA Fusion Import NS File M HLA Fusion 3 0 0 Testing NS File Import LS NC6_RevODRAFT csv Negative Serum NS files can be imported to be sl Catalog referenced during analysis f 1 From the Main Menu select Utilities gt Antibody Product Configuration gt NS File Import 2 Click the Browse L button to locate and select NS files m3 3 Click Import NS File pian When an NS file is successfully imported it EARO 006 LENCE is listed in Existing NS Files LSTADINCS_007 LSNC6 1 LS1A04 001 LSNCE1 4 Clickthe Close button to return to IO RO the Update Reference menu LS2PRA VONE LAMBDA HFR MAN Vv3 x x EN 00 Rev 0 193 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Choosing General Settings You can set a number of general system settings including printer defaults and URLs and Paths 1 Select Utilities gt Gene
73. Recg Site 45745 821R83 Specifiaty B 18 09 54 B 27 52 B 37 0L 01 04 02 07 410 13 427 B sage wee Case Pair Size 150 locus Type B Working with Gel Images e Ifyou have a gel image already linked to the current sample you can view it or unlink it OR e You can search for and link another gel image to the current sample HFR MAN Vv3 x x EN 00 Rev 0 84 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Here s how you can link a gel image to the current sample 1 Click the View Gel button at the bottom left of the gel image screen If no image is currently linked to this sample you ll see this message Gel Image does not Exist Click Yes to Browse for an Image Click the Yes button and Fusion opens the Select Gel Image screen Browse and select a new gel image Click the Open button Fusion opens the Gel Image window and displays the gel image you ve selected The window can be resized if needed Gel Image Viewer F Gel Image C OLI FUSION data session Data Reta a ES Zoom In To link the image to the current sample Click to rotate the gel image Zoom Out HFR MAN Vv3 x x EN 00 Rev 0 CL Gel Image does not Exist Click Yes to Browse for an Image e we Select Gel Image x JO sesrmaosse W J m0 Organize y New folder A wr Favorites Ma Es Documents al Music Pictures z Videos
74. Research Software 3 0 FUSREPGRX Micro SSP Combined Analysis The HLA Fusion software supports a combined analysis feature In a combined analysis the reactions from two tests of the same sample are combined together in a single analysis The previous test must either have the same Sample ID or be associated with the same Patient ID To combine results for a sample you need to start or continue a Micro SSP allele specific test and have a previously saved Micro SSP or LABType session to combine with it After combining sessions the possible typing assignments are displayed and the reaction pattern table changes to reflect the reaction pattern of both tests 1 Inthe analysis window click on the Analyze Combined button below the reaction pattern table The Combined Analysis window displays a list of previous sessions that have used the current sample and share the same Sample ID 15 x H Combined Analysis Current Sample ID 60231 Patient ID 11332 Session Combine Sample ID Hame Note For Combined Analysis the sample must be sawed 4 ap 2 Select the desired previous session s by selecting the associated Combine check box on the far left 3 Click the Analyze button at the bottom of the pop up window Note If you combine one sample in the previous nomenclature format with a sample in the newer nomenclature format the possible and assigned allele pairs and code will be displayed in the new format If
75. Research Software 3 0 FUSREPGRX Update Serology Equivalent and Catalog files To analyze SBT data first make sure that you have the most up to date serology and ConsenSys catalog files To update serology files 1 Click Utilities gt Update References gt Update Reference File 2 Select the Serology equivalent radio button 3 Choose the appropriate Sero equivalent file from the list on the right side of the screen a Ifaserology file does not appear in the window navigate to it by using the directory tree on the left 4 Select the appropriate serology file 5 Click the Import Serology button After successful serology file importation you should see this AO message 6 Click the OKL button to close the confirmation message 7 Click the Close button when you re done To update ConsenSys file catalogs 1 Go to Utilities gt Update References gt Update Reference File gt Select the ConsenSys radio button If the ConsenSys catalog file s are not listed navigate to it by using the directory tree on the left Select the ConsenSys catalog files to import Select Import ConsenSys button xi O The SBT reference is updated successfully After the catalog files have been successfully imported you should see the following message am Click the OK L _ button to dismiss the confirmation message Click the Close button when you re done HFR MAN Vv3 x x EN 00 Rev 0 3 One Lambda User Manual
76. Serology Serology Equivalent c p4 01 01 02 C 06 05 Related C 04 01 01 01 C 06 05 Allele C 04 01 01 03 C 06 05 Assign pairs C 04 01 01 04 C 06 05 button Assigned Serology Serological assignments Remove button 1 Double click a serology suggestion or highlight it and click the V assign button to copy it to the Assigned Serology field e Select the a serology equivalent and click the X remove button to remove it Or select and assign a different one to replace it HFR MAN v3 x x EN 00 Rev 0 99 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Translate non current nomenclature format only The Translate button is displayed if your alleles format is displayed with older nomenclature Clicking the button does the following e Displays all assigned except from the Other Assignment field and possible allele code pairs in the latest nomenclature format If a matching allele in the new format cannot be found the allele remains displayed in the old format e You can view and print this display but results cannot be saved or reported in this new nomenclature format e Togo back to the older allele format you can navigate to another sample and then return to this sample Adding Comments to Samples Comments you or Fusion adds to the Comments fields are displayed with the sample results in the current analysis session data look up and reporting functions in HLA Fusion 1 In the analy
77. Software 3 0 FUSREPGRX Take these steps if you need to adjust the screen text display size View Sort by Refresh qe Right click on the computer desktop Select the Screen Resolution option Paste shorbeut Windows 7 Screen Resolution window Soreen Resolution pne AE E TO E caradura e Dago ree Rehan I ero coronene nna EEEE Dais The Screen Resolution window displays me Dapley 1 LPI TLAA Y oe 5 Select the Make text and other items larger or stion Landscape lt Advanced tettrga smaller e Connect to a projector or press the A key and tap P yrs et os ore nens woe o mate What dsplay setos shove I choose 1 Select Smaller sized text Windows selecting smaller sized text 101 x Guy US All Control Panel Items Display 23 search Control Panel 2 File Edit View Tools Help Control Panel Home O Make it easier to read what s on your screen You can change the size of text and other items on your screen by choosing Adjust resolution one of these options To temporarily enlarge just part of the screen use the Adjust brightness Magnifier tool Calibrate color Change display settings Smaller 100 default Preview Connect to a projector Adjust ClearType text Set custom text size DPI Medium 125 En See also Personalization Devices and Printers Apply HFR MAN Vv3 x x EN 00 Rev 0 17 One Lambda User Manual HLA F
78. TGGASKGGCTCC AGAA AAG 5 r A MEX CACE AC 46 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Page Breaks Inserts page breaks to separate report data over many pages e Full Report Section Sample For either of these two data options your choices are to leave the sample section empty match the sample to the Summary and auditing Layers This section allow you to select up to four fields with the following data The electropherogram list by sequences Edit List and Mismatch List e Additional Information These extra fields located at the bottom left of the Report Menu allow you to insert supplementary information about the analysis After making your selections 1 Click the Report t button The Select File window opens Select a directory or folder location to save the report file 3 Inthe File Name field at the bottom left of the screen give the report a unique file name 4 Click the Save button The previous Reports Menu screen opens 5 Click the Done button to close Click the Update button at the bottom of the Reports Menu and Fusion Research will remember the format and criteria selections you ve made for use in future reports Save gt gt Clicking the Save gt gt button stores the results of your analysis to the database Confirm gt gt The Confirm gt gt button becomes visible only after you ve clicked the Save gt gt button
79. The graph is continually updated as you analyze the product over time e The cut off line represents the One Lambda default cut off value Patient Sample Results Tab The Patient Sample Results tab details all of the results for all the tests done on a Sample ID or Patient ID As results are saved for each locus either the serology result or the allele code for each loci U5X appears in this all loci section Rosorosaznsoe Click on any of the labeled Gray tabs along the top of the grid to sort C1 03 01 03 19103 22 the results in either ascending or descending order The direction of the small triangles A indicate how the results have been sorted Hover your mouse over any Possible Allele Code to see the entire allele code HFR MAN Vv3 x x EN 00 Rev 0 63 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX You can use your mouse to widen the grid or double click between the tabs to automatically increase the column width to accommodate all the data presented S02PB1_005_01_ 02 03 2012 RSSO2PB1_004 06_ RSSO2PB1 RSSO2PB1 004 03_ RSSO2PB1 RSSO2PB1 QC Rxn Rec site Locarac Patient Sample Results Lag ac Session Date 5 1 2009 y fio 9 2012 y Session ICAO EZ Lem A 02 XX2 G0221 12 10 2011 RSSO1A_006 12 10 2011 RSSO1A4_011_06 p O gt 02 01 02 01L 02 04 02 0 PA a aces el 08 01 2008 RSSO1B_013_07_QC_399 10 11 2010 RSSO1B_013_07 O a G0221 m j 04 07 2009 RSSO1B_014_0
80. USREPGRX When the dialog box for starting a ConsenSys Manual Entry session displays you ll notice that Fusion has already assigned a session name e The Analysis Session Name You can rename the session if you prefer Remember that the Session Name must be unique within Fusion Research i HLA Fusion 000009 Create New Session Tray Analyze Ab1 Ales Enter name of analysis session Test Date 14172013 ki TONE LAMBDA Start Manual Entry ConsenSys Analysis e The Test Date You may accept the current Test Date or select a different test date by clicking the Down Arrow and selecting another date from the pop up calendar 3 You have the choice of creating a new session tray or open existing sequencing samples To create a New Session Tray Click the Create New Session Tray button A new window is displayed to allow for subsequent session tray information 4 Enter all required information in the fields at the top of the window 5 Click the Start Analysis button at the bottom of this screen Session Tray Information Window balsas dar r z deciros Petare HFR MAN Vv3 x x EN 00 Rev 0 39 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The ConsenSys analysis window is displayed Adding an Ab1 File 1 From the Session Tray information window click the Add Ab1 File button at the bottom The file import window is displayed 2 Browse to th
81. User Manual HLA Fusion Software Research HLA Fusion Software v 3 0 2012 03 For Research Use Only Not For Use In Diagnostic Procedures 21001 Kittridge Street Canoga Park CA 91303 2801 Advancing Transplant Diagnostics Tel 818 702 0042 Fax 818 702 6904 www onelambda com HFR MAN v3 x x EN 00 Rev O One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX HLA Fusion Research ConsenSys and Micro SSP are Trademarks of One Lambda Inc Luminex is a registered Trademark of Luminex Corporation Windows is a registered Trademark of Microsoft Corporation Copyright 2012 One Lambda Inc All One Lambda software products are designed to assist personnel experienced in HLA analysis by suggesting typing results However any clinical or diagnostic results must be carefully reviewed by a person qualified in HLA typing to assure correctness This software may be used to aid in suggesting results but should not be used as the sole method for determining reportable results This software is meant as a laboratory aid not as a source of definitive results The software design does not mitigate hazards associated with the software The laboratory director or technologist trained in histocompatibility testing is required to review all data to detect any problems with the software HFR MAN Vv3 x x EN 00 Rev 0 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Table of Contents
82. VSIS WINDOW QUITA a a esha 69 5sO Results ANGASSIONINGNU pane as 69 Anane SSOID tarro aucuteeeass 71 Make Typing Assignments In SSO AN Sii A a 72 TY DING ASSENTE ES AS 72 Flagging a Sample tor Further Testa sai iia 73 Manta ASIN MEN Si tai dad is 73 590 Bate iAna SIS A as 73 SAVE ASSIS ISIN iia 74 COENA S SIS VAC INS dis 74 A O 74 Micro SSRPANAIVS S reie a A A A A ad 75 Start MIKO AAA e EP nn O E N 76 Contietire Micro SSP Data Ansi E AA 80 HFR MAN Vv3 x x EN 00 Rev 0 6 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX BAS SVN OCS ea aia 80 BWA BING Ii Selo A A A A 81 DEMOPrap iii INM OCM ION era 81 Usine the Micro SSP Analysis WING O Wisin 82 A A Ta 83 View WelDetallS seier A EE 84 WOKING WITH Galli on AA A 84 Add Sap id 86 o A A tet 87 Number of Allowable False Reactions cccccccccccsscsssseececceeseeesseeeccccesseeuesseeeeceesseeuasseesecesssauusaeeeseesessagggssss 89 Force One Pa lseiReC acia 89 MiTo SSP COMbINea ANAVI S durara ooo ooo a La a eadlece ccoo bares ion 90 Make Typing Assignments in Micro SSP Analysis cccccccssscccceesececeesececceeecceeaesececeunececseneceeseeecesauecesseneceesaneeeeten 92 ARGS PANGS NA 93 Assign an Allele Pair from the Suggested LISt cccccesccccesseccccessececeescceceeececeeeeceeseuscceseuecessunecesseneceesegeeeetas 93 THEMA Ta sta dia 94 Manual Allele Pair Assienment enine as 94 Possible Allele Codes icons 95 PINGS Code AS SIEN E
83. X Updating Allele Frequency Files Demographic Frequency You can modify allele frequency files before using them in analysis based on demographics 1 From the Main Menu select Utilities gt Update Reference gt Demographic Allele Frequency Allele frequency import Demographic Allele Frequency A E HLA Fusion 1 e Create and Update Demographic Allele Frequency Create Demographic Group Update Alleles and Frequency Delimiter TAB y IV Skip First Row Allele Column 7 4 01 01 01 09NM 4 Select the Update Alleles and Frequency option Click the Browse LJ button and locate the Allele Frequency file you want to update Double click on the file or click Open in the browser window Do any or all of the following to modify the file e Add delete alleles e Delete existing demographics aoe WN e Change the allele frequencies e Convert allele format Click Translate Alleles Click Update 8 Click Close HFR MAN Vv3 x x EN 00 Rev 0 185 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Managing CREG List Information You can modify existing CREG lists or create new ones for use in PRA and Single Antigen LABScreen FlowPRA LAT or LCT analysis Take the following steps to create or modify a CREG list 1 Select Utilities gt Update Reference gt CREG Information Management The CREG Management window displays CREG Management sc
84. Your Password is IN SONE LAMBDA 0 00 HFR MAN Vv3 x x EN 00 Rev 0 15 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX D Forgot UserName e E HLA Fusion If you forget your user name click the Forgot UserName link Lon None EEE enter your first and last name and select your lab role 2 Os supervisor or technician UserName 7 The system displays the user name matching the data you provide E JONELAMBDA 0 00 Key System Settings Screen Resolution HLA Fusion software requires a screen resolution of 1280 x 960 The software displays a message if your current resolution is less than the expected settings The minimum required screen resolution is 1260 960 HLA Fusion software will attemp to change the screen resolution to 1260 960 Te Do vou wish bo continue No Minimum Screen Resolution Note You can choose to suppress this message through the Edit link on the General Configurations section of the Home page You can select Yes to have the system attempt to make the adjustment It will continue to start the application even if it could not adjust the resolution Or you can select No and adjust it manually In addition if your computer is running the Microsoft Windows 7 operating system the text display setting must be set to Smaller 100 default HFR MAN Vv3 x x EN 00 Rev 0 16 One Lambda User Manual HLA Fusion Research
85. a Analysis The Global defaults for Micro SSP product configurations can be set at one of two places The Micro SSP Home Page The Utilities menu on the main HLA Fusion home screen In addition configurations can also be set from within the analysis window for the current Micro SSP sample by right clicking anywhere on the Micro SSP analysis window and a pop up list of configuration options will appear at the upper left corner of the analysis screen After an analysis has begun you ll need to right click in the light blue area just to the right of the Find Allele button to open the Micro SSP Configuration Menu Micro SSP Sample Level Configuration Menu Sample PatientInfo Profile Utilities Help Exit toca Coder A cet wal 6 E a We A Gd E amp lt lt summary BSmith i pL J 32012 JOJP IAPN eq Assign Code By default the system assigns NMDP codes to the alleles However the user can optionally change these codes to one of the following options No Code The results allele pairs assembled into a string with no formatted code are simply condensed without applying a coded format P Grouping Codes allele strings in P Grouping as published by IMGT G Grouping Codes allele strings in G Grouping as published by IMGT Local Code assigns user defined code definitions code used by your Lab for suggested code results Cross Code allows allele combinations that cross serological groups e g EAPW
86. a suggested LP assignment and may not be 100 accurate We suggest that you review these assignments and make appropriate changes to obtain the expected assignment A 4 Click the OKL button to acknowledge the cautionary message 9 Click Save to save your changes 6 Click Close to return to the Update Reference menu P and G Code Configuration for LABType P and G code definition downloads are similar to NMDP They can be imported from files or by using Auto Update You can use the LABType Analysis Configuration screen to cnn 3 _ choose which code you want to use for all your LABType sessions AN to be imported Code 5 NMDP Local Code Fi a G Group No Code Cross Code Enable Cross Code If you ve selected P or G code on the LAB Type Analysis Configuration screen you can re apply the code set or an updated code set to a particular session on the Session Summary screen by clicking the Apply P G Code button located at the bottom right of the screen HFR MAN Vv3 x x EN 00 Rev 0 189 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX TER Code No Code Local Code 6 Grouping You can also apply P or G grouping by clicking the Set Cross Code Config button during LABType analysis and selecting either Ewd Bw6 in Serology P or G grouping from the drop down list Demographic Information Minimum Positive Control Minimum Bead Count Set Sure Reaction Bead View QC
87. al HLA Fusion Research Software 3 0 FUSREPGRX Sample ID Bsmith019965 7127 2012 H G F E D C B A 01 02 Test Gel Pane The pane on the left side of the wndow displays each well of the SS A A A O test in rows that are intended to duplicate the test gel Each well is shown with a reaction button os When clicked or entered from the keyboard you can modify the s reaction for the selected well between the following settings s iii 07 e 8 positive reaction 08 e 1 negative reaction M S E e 0 no clear amplification wells with a 0 will be A TT excluded from analysis ww MN 1 1 1 1 1 1 Note If you right click in the black area of the test gel pane you can select a different order for the reactions when you click on a well 0 gt 1 gt 8 or 8 gt 1 gt 0 etc e After you analyze a tray you can no longer add any more sample information to that tray 0 gt 1 gt 8 e Ifthe sample has not been analyzed the right most ES button on the bottom of this pane is labeled Analyze 8 26 gt 4 gt 2 gt 1 gt 0 If an analysis already exists for the sample then the 2 gt 4 gt 8 button is labeled Re Analyze e This button is only enabled when a Sample ID has been entered If a Sample ID has not been entered when this button is clicked the Sample ID field is flagged with as being empty and no analysis is performed e If other than the first well reaction 1H i
88. an I dl 95 Manual Allele GOdEe ASSIONINGNIE ae E E E 96 WAKTOW RM Allele CodeS rasa a a Seattle alu ttacelitnba ts 96 OU ME ASSIS INO Es o a 98 A 99 Translate non current nomenclature format ONly ccccccnncccnnnnonnnocnnnnonanonnnnnonanoconnnonanocnnnnonanononnnonaninos 100 Addie Comments to samples a is 100 Flagging a Sample for Further Testing ia tapas 101 Printing the Current Analysis VWVINGOW sanre E E T A 101 PREVIEW OP PINE REDON US rnanan O E E 101 Assien Coded Results dat a cidesasdarncaeiee scenes rane 102 Save ASSISAMEnts asa 102 Cont ASSIS I IVCINES a id 102 VIGGO SSP SESSIGI SUMMA Mc sn 103 HFR MAN v3 x x EN 00 Rev 0 7 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Navigator Right Click Menu Options for Micro SSP cccccsseccccesscccceesececeesececceecceeeeseceseuecessegecessegeccesaueceeaenecss 105 SESSION Level OPUONS A Geren Uy aerate care A deel nein eee 105 Rea alvze With New Nomenclatire vemoss id 105 Sample Level Options ii a anion au 106 Related RECON Roco 106 A A A 106 Quantiplex BEIA y AE PP RR 108 Entering and Using Quantiplex Bead Informati0N ooocccncnnccnncnnncnnnonaconnnnnnonnnonaronnnnnronnonanonnnnnnonnnonaronnonanononnnnoss 109 Acquiring Quantiplex Beads Data nic A 109 Start LABScreen Analysis with Quantiplex Beads scsccsssssscssssssescousvectenssscneosssestossscneussscneoussessensssenenes 111 View SFI Information in LABScreen AnallySis
89. analysis window click the Confirm button located in the bottom right corner of the analysis window to confirm all analysis results You automatically move to the next sample to continue confirming results When you first return to a confirmed sample you see that the Confirm button is now shaded purple to let you know it has been previously confirmed HFR MAN Vv3 x x EN 00 Rev 0 102 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Micro SSP Session Summary The summary table can be launched by clicking on a session in the Navigation Tree on the far right of the screen It lists each sample in the session and any saved analysis results After opening a session e Double click a sample in the Summary Table to go directly to the analysis screen for that sample e Click on the Field Chooser bi button to the left of the table headings to display the Field Chooser Session Micro SSP_20111222095547 SSPMLO2_003 07 Catalog SSPMLO2_003_07 The Field gt Chooser Sample YI Patient sce omen E r button ESmith0015004 Analysis Date Analysis User Assigned Allele Code Assigned Allele Pairs Assigned Sero Bw Catalog Code Definition Comment Confirm Date Confirm User Excluded False Rxn Family ImgtVer Local ID Locus More High Resolution More Test NomenclatureDate Possible Allele Code In this window you can select or clear the check boxes next to column headings to in
90. anc Patient Donor Info Patient or Donor ID Fullerton CA USA 92357 NNW 714 298 1045 714 298 1045 714 298 1045 714 298 1045 Ir aol com 102 00 1322 KB Homes 11 29 1949 O Male Female Human Animal 203 Tissue Fullerton Special a patient or View or add patient donor relation codes l donor place a check mark After selecting here to edit the information Y Edit Update fields FONE LAMBDA 000 Tools to manage patient Converts assigned allele code and and donor information pairs to the new nomenclature format and stores this information in the Fusion database HFR MAN Vv3 x x EN 00 Rev 0 150 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX 2 Enter an ID in the Patient Donor field The ID can be alphanumeric contain letters and or numbers e Ordick the Browse L button which opens the Patient Donor List from which you can search and select a patient donor 3 Enter patient donor information as needed Fields with an asterisk are required A Click the Add New button to save the data and add the patient donor information to the Fusion database 5 Click the Close button to close and return to the main menu Lookup Patient Donor Records This option allows you to browse through records or search for specific ones If you know the Patient or Donor ID 1 Enter the
91. ange passwords for any user but they must have the user s old password Technicians can change only their own passwords From the Main Menu select Profile gt My Profile In the user profile click the Change Password button Enter the current and new passwords Bw NB Click the Save Password button to change the password Or click Close to close and return to the main menu without changing the password Resetting Passwords If a user loses or forgets their password HLA Fusion can reset the password The new password is the same as the user s user name Only Supervisors can reset a user s password 1 From the Main Menu select Profile gt List User and select a user 2 Intheuser profile click the Reset Password button 3 Click Close to return to the main menu Changing User Privileges Only Supervisors can modify a user s privilege level 1 From the main menu select Profile gt List User 2 Double click to the left of a user to open their profile 3 Inthe user profile select the check box next to either Manage Data or Update Reference Files or both to give the selected user privileges for those activities within the Fusion application 4 Place a check mark next to Can Email Report if you want to give a user that privilege You will need to supply an email address 5 Click Close to return to the Main Menu HFR MAN v3 x x EN 00 Rev 0 166 One Lambda User Manual HLA Fusion Research Software 3
92. anslating Associated Patient Donor Results to New Allele COJE occccccoonnnncccnnncnnnonanaciconanonononanacinnnannnos 154 Associatine Patient ana Donor Records 154 Associating a Donor with Donor PRA Result iii is 155 PrIntING Patient Donor RECOS errun iniciales ico iblc a 156 EXportine Patient DONOrFRecoO OS iaa 156 Archivine Patient Donor Records aa 156 Deletine Patient DONOr Records ii A a da 157 Creating Patient Donor Lists iia iio cda 157 PAtentAnUbo0 TRIO cis 159 Prone Mana semen traca land 163 User Management aa 164 Mewine the Usertistai as 165 POGINE NEW USES ui o ends 165 EIME Usen Pro les dt ale 165 Changing PASS WOAS a lo dao 166 Resettine PASS Words di is 166 Changine User POUM rod E bancae a 166 ACTIV atING USC ciar add ele densacautel 167 LATO POMS ech NO cag Matera eee 168 Edite ne Orc Wo PrO ae Menace ert ne no O A Pe ee 168 Managing aD COGS Se omine ana ota aleas Se ananacaeadelesoe atado iaa eo io 169 A A esenaaeets 170 Managing Catalog Reterence les eran lisa 171 Updating Catalog Files from a Local or Network DriV ooccccccnoccnnonaccnncnnncnnnnononnnonanonnnnnacnnnonaronnonanonnnonnoss 171 Updating Catalog Files from the One Lambda Download Site ooocccnccnccnnccnncnnnonanonnnnnaccnnnnaronnonanonnnonanos 174 Updating Molecular Typing Reference Files occcooocccnconocnnonnncnnnonaconnnnononnnnnncnnnonanonnonnnonnnnnaronnonanonnnnnnoos 175 HFR MAN v3 x x EN 00 Rev 0 10 O
93. anual HLA Fusion Research Software 3 0 FUSREPGRX EPG Pane The EPG pane is the visual representation of the sequencing reaction Here you can view the base call and edit any mismatched base calls in the EPG navigator Allele Pairs Filter List Not Applied Allele 1 Allele 2 Mis Differences Click and 0 drag to scroll fav02 03 02 avo2 104 0 Exon 3 fa o2 03 02 Aa 02 105 o Exon 3 up and axoz o3 02 Ja oz 110 o Exon 3 down the aroz o3 02 Aa 02 111 o Exon 3 Allele Pairs fawo2 03 02 a 02 114 o Exon 3 List ao2 03 02 aro2 117 o Exon 3 axoz o3 02 aro2 118 o Exon 3 ao2 03 02 aroz2 121 o Exon 3 faroz 03 02 aroz 180 o Exon 3 ao2 03 02 aroz2 131 o Exon 3 asoz o3 02 aroz 132 2 0 TO A pie Edit Base Calls Any base call can be edited The base assignment button is highlighted for the currently selected base More than one base can be selected at a time and the corresponding base code is displayed If no bases are highlighted an asterisk is displayed in the consensus sequence Assignment Buttons e Select a base and click one or more of the assignment buttons to change the base assignment Navigating the Alignment Screens The alignment screens were designed to give the end user all the tools necessary to e Analyze sequence data between samples e Ascertain quality e Check against IMGT HLA reference sequences for allele pairs e Check against all IMGT HLA a
94. are 3 0 FUSREPGRX Define the File Naming Convention With HLA Fusion Research you can define and specify the file naming rules to be used with Consensys 1 On the Fusion Research Menu Bar click Utilities gt Molecular Product Configuration gt Ab1 Filename Configuration The Ab1 Filename Configuration screen opens Ab1 Filename Configuration HLA Fusion Ab1 Filename Format sree ss 210 fre SIL wer I for El Example Sample_B_2F_A01_Other Locus Name Format a B Cw ORB1 DRB345 KR A B Cw DRB1 DRB345 KIR DPB1 DPai_ Dai Daai mca mcB DPB1 DPA1 Dasi Joaar MICA mice DOE When definingthe Ab1 and Locus file naming configurations remember that the Sample ID name must match between LABType and SBT sessions for combined analysis For example SampleName BLocus_ 2F Or SampleName_HLA B_2F Another Example TEF401 in a LABType session TEF401 DRB1_2F in a ConsenSys session Remember to only use an underscore _ in sample names No spaces or other special characters should be used 2 As you make changes to the Ab1 file configuration Fusion Ab1 Filename Format displays an example of what a Sample ID might look like using the new configuration CO Example Sample_AD1_E_2F Other 3 Click the Save button to retain your file naming rule i selections 36 HFR MAN v3 x x EN 00 Rev 0 One Lambda User Manual HLA Fusion
95. arrow keys to change the order Customize Report Export Data Te pu VONE LAMBDA 2 When you are done click the Save button The new template is added to available export templates from the Tools gt Export Data menu HFR MAN Vv3 x x EN 00 Rev 0 125 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Export Data Select template 3 When you are ready to export data first select all the sessions you want to include from the available list T Then select Tools gt Export Data and select one of the templates The Export Data dialog box is displayed Customize Report Setup Data Export Export 1 Test one Export Data file save location Export Data x OLI FUSION data export File name Fusion Data csv Save as type esv format csw Browse Folders Cancel Z 4 Select the format for the exported data XML CSV or Text The exported data file is saved by defaultin C OLI Fusion data export 5 Click the Save button Creating Custom Reports Certain report types allow you to customize the types of fields which are included or excluded Note For Molecular Custom reports you must make sure the Free 3 of 9 Extended font is installed on your computer otherwise the barcode will not be recognized If needed you can download this font for free at http www free barcode font com 1 To create a custom report select
96. at match the sample s reactions within the allowable number of false reactions Allele Code Assignment 1 Double click the possible allele code or select the suggested code and click the V assign button Select an allele code and click the X remove button to remove an allele code assignment HFR MAN Vv3 x x EN 00 Rev 0 95 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Manual Allele Code Assignment 1 Type an assignment into the text field just below Assigned Allele Code Make sure you type the assignment in correct allele code format e Newnomenclature format X X Where X locus type and code number e Previous nomenclature format X X Where X locus type and code number Otherwise the system does not accept it and prompts you to make corrections Note If you click on the Translate button to display alleles in the new nomenclature format you cannot enter a manual allele code unless you reanalyze the sample and alleles are again displaying in the previous nomenclature format Press the Enter key to move the allele code you typed in to the Assigned Allele Code field DRB1 07 JKZH DRB1L 07 JKZW DRB1 07 JKZH DRB1 07 JKZW Note If you have a homozygous result the assigned code can be edited in the Manual Allele Code field to show the homozygous coded results once Unknown Allele Codes Unknown allele codes are marked with XX followed by a
97. avigator list Micro SSP_20100129123728 changes to black Micro SSP_20090821115043 Micro SSP_20100129123533 Otherwise the use of this tool is the same as described above in Group Micro SSP_20090914130953 by Product When you select the Test Date group option sessions are displayed in chronological order by their test dates Otherwise the use of this tool is the same as described previously in Group by Catalog or Group by Product When you select the Session Date option sessions are displayed in order of their creation dates Click a session name to display the samples within this session and a session summary Otherwise the use of this tool is the same as described above in Group by Product Catalog or Test Date E avigator z f Product Test Date 23 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Accessing HLA Fusion Research Software Functions Main Menu Options You can access HLA Fusion Research functionality at any time from the Menu Bar which is displayed at the top of all HLA Fusion Research application windows Analyze Data Reports Data Sample PatientInfo Profile Utilities L4Bxpress Help Exit See the following sections for a list of the options available under each main menu item Analyze Data Fach option under this menu item is a molecular product for which you can import CSV files or manually enter reactions and analyze data HLA Fusion Resez
98. button or anywhere in the gray area to the left of the button to display the pop out Configuration Menu SSO Configuration Menu P Grouping G Grouping Minimum Positive Control Minimum Bead Count Set Sure Reaction Bead View OC Low Positive Threshold P Grouping Codes allele strings in P Grouping as published by IMGT G Grouping Codes allele strings in G Grouping as published by IMGT HFR MAN Vv3 x x EN 00 Rev 0 99 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Minimum Positive Control The default Minimum Positive Control value assigned by the system is 1000 If desired you can enter a new value into the Minimum Positive Control Value field If the positive control bead count for a sample is lower than the entered value a warning is displayed In sample analysis each sample is processed individually Results can be viewed adjusted and final typing assignments made Using batch analysis all samples are processed at once and no assignments or changes can be made during analysis You can continue the session to make adjustments and assignments Minimum Bead Count The default Minimum Bead Count Value assigned by the system is 100 If desired you can enter a new value in the Minimum Bead Count Value field A warning is displayed if the count for any bead in a test falls below the Minimum Bead Count threshold Set Sure Reaction Bead Selecting the Set Sure R
99. cates an accepted base e Hold down the Shift ts Key and use the Up and down arrow keys on your keyboard to change the size of the electropherogram e Right click an electropherogram to display a pop out menu with more options Note Press the letter Z while viewing the EPG to magnify the area where the position indicator is located HFR MAN Vv3 x x EN 00 Rev 0 49 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX EPG Panel Sample name i indicates forward Nucleotide position 4fa Combined forward amp reverse sequence Nucleotide signal intensity Nucleotide average signal intensity lt lt 9016 A 2R 8682 LS 3 2 A03 001 fa Sample name lt lt indicates reverse Allele Typing Result Pane Filter List Applied Allele 1 jAliele 2 A 29 02 01 01 A 69 02 A 29 02 07 ar69 01 JAS29 26 AS69202 A 29 02 02 _ Differences A AA Click and drag to scroll quickly Reference sequence for loci Forward sequence read Reverse sequence read EPG EPG Mis Indicates the number of nucleotides that have a mismatch in the sample sequence to the reference Differences rra 92 ey 3 Exon number where allele pair sequence differences are located with respect to allele pair on the top of the list lA 29 02 08 A 69 01 Possible Allele match for 1 and 2 HFR MAN v3 x x EN 00 Rev 0 50 One Lambda User M
100. ccccccssseecceceeesecceeeeeesecceseeeeeeceeseaeeeeeeeeeas 185 Managing GREG List Informatica 186 Changing Product Configuration SettingS cccccccsssccccsseccccseccesensececeesececsescceseeseceseeneceeseeceesseecessenecessenaeeetas 187 Changing Molecular Product Contursi 188 Pand G Code Configuration Tor LABTYDO ns 189 Changing Antibody Product Configuration ooccccconoccnconacnnnonanonnnnanonnnonaronnonanonnonononnnnnnrrnnonanonnananonnnnnnicnnnnas 190 Creating a Combined LABScreen Session Catalog cccccccsssecccessececceneccccescceceuseceeeeecceseesecessuecesseeceeseges 191 Changing LABScreen Default Negative Serum Control Value ccccoooccnncnncnnnonnnonnnonaconnnnnncnnonanonnnnanocnnonos 192 Changing the LABScreen Mixed Product Configuration ccccccsseccccssecccceesececeesececeeececeeesecessuecetseneceesenes 192 MP A E inns 193 Choosing General Setunesai as 194 nte DES titi 194 Setting HLA Fusion Default URLs and Directory Patbs coocccnccnoccnnonaconnncnacononononononaronnonanonnononcnnnonaronnonanonnss 195 ACTIVATING POS e Ted 196 SONNE Val IG ati waixss 28ansnianessareetiacesiqnnnedsyatsceeslmonadsausaecsestonewidaabeceaniannwuaasl races inane Agua beanephaneraaneednucestaansedgeabnces 197 Ciiastalation Qualcomm 197 HFR MAN v3 x x EN 00 Rev 0 11 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Introduction What is HLA Fusion Research HLA Fusion Researc
101. clude or exclude those columns from the Summary Table Selecting or clearing check boxes in this window instantly updates the Summary Table Note If you do not see a particular field available through the field chooser and you are sure it should be there go to C HLA Fusion temp and delete the file named SSP_Layout xml e Click on any column header of the Summary Table to sort the table by that column The small Up or Down v arrowin the column header indicates the sorting order up for Ascending and down for Descending e You can also click on a header and drag and drop it to change the column order HFR MAN Vv3 x x EN 00 Rev 0 103 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX xj e You can save any modifications you ve made to the layout by clicking the Yes button in the message box when it appears ES oe vou want to save the Layout Your changes are saved for all future Micro SSP session summaries on this same computer until further modifications are made and Saved E e Click the Export button located at the bottom of the screen to save the Summary Table on your computer or network default location is C OLI FUSION data report The file will be saved in the Excel spreadsheet XLS format Click the Print button to create a hard copy of the Summary Table Click the Preview button to view and or resize the Summary Table before printing amp Print Preview File View Tool
102. d Ponorlls ALA1 _ 4 HLZ A HLA1 B HLAZ2 E HLA1 Bu HLiz Ew HLA1 HLae C HLA1 DRE1 HLAs DRE1 HLAl DRE3 HLA2 DRE3 HLA1 DRE4 HLAZ _DRB4 HLA1 DRES HLi2 DRBS AHLA1 DQB1 HLiAz DQB1 HLA1 DQA1 HLi2 DQA1 HLA1i DPB1 HLAz DPB1 HLA1 DPA1 HLiA2 DPA1 HLA1 _ MICA HLAZ MICA HLA NICHE HLAz _ MICB HLA KIR Classl AbSpec ClassiII ibSpec MIC AbSpec Unacceptabled ntigens AcceptahbledAntigens Notes SHLAl A4 5HLA A SHALA1 6 SHLae 6 SHLAl Cw SHLae Cw SHLAL DR SHLA2 DE SHLAA DR345 SHLAZ DR345 5HLAl DO SHLAe DO 5HLAl DP SHLAZ _DP DonorType IncludeInDonorPRa 36450 Human Nee ly Jason Neely 021 09 2987 2 17 2001 4 caucasoid 560 Waiting Street Ci NU USA 91022 jneelyi yahoo com 213 567 0987 213 567 0987 213 567 0987 213 567 0997 MIT Research Evvonne AB Evvonne 215 509 0196 101 5t Judes s Hospital MARRON Transplant 0 BOME NARROU PACIENC ppp reece ere erect reece reece eee pees bo Bo6 00 DO DP 14 DP9 27614 Human Martinez Daniel DM Martine z 032 11 1954 9 12 1998 N hispanic 40 Driveland Road Fast Li CA NWN USA 90222 mdanielfaol net 324 489 1430 324 482 1430 324 459 1450 324 489 1450 Joba Juice Maria E Maria 324 469 1430 103 East Li Hospital MARRON Transplant O Marrow Patient prrrprrerrrrerrrrerrrrrrrrrerererrerer heyy bb gy DOB Doe DP 19 36557 Human Phannudet Keodone PE Phannudet 111 41 5452 12 50 2000 F oriental 1009 Special Road Valencia CA NUU US
103. d below HFR MAN Vv3 x x EN 00 Rev 0 96 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Click the Detail button and Fusion Research will display information about bead mismatches between the selected catalog and the CSV file Following catalog file validation the system may ask you if you would like to associate that template name with the specified catalog file If you click Yes to associate the two the system automatically selects this catalog file for all future imports of any CSV files that reference this template Catalog Template Association Select the check box if you don t want H L A F U 5 i O n i Fusion to continue asking if you want to associate templates and catalogs Do you want to associate the following template name and catalog Template R550281 _02 If you change your mind go to Catalog R550281_ 015 Utilities gt Catalog Template er A Association and place a check mark in the bottom left corner next to Y No Enable During CSV Import No MI ONELAMBDA 000 5 On the Sample Patient Details Table check to see if there are any samples that have been flagged as having a low positive control PC the rows of low PC samples are highlighted gray Take the following steps if you want to delete any of these samples Click in the border to the left of the Well position column to highlight the entire row for the sample Catalog ID RSSOKIR_004_04 NOM Imat January
104. d if you downloaded the catalogs during the same import session You may need to click the Home A button and then open Micro SSP again to return to the import process 3 Accept the session name in the Session field or modify it Enter a name in the Sample Name field HFR MAN Vv3 x x EN 00 Rev 0 77 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX If this is an existing sample name other fields such as the Patient ID and Ethnicity are populated with existing data You can also double click in the Sample Name field to display the Select Sample window from which you can select a sample D 6 Note Click the drop down arrow in the Sample Date field and select a date The analysis window for this session is displayed Enter an ID in the Patient ID field If this is an existing patient donor ID other fields such as the First Name Last Name and Ethnicity are pre populated with existing data You can also double click in the Patient ID field to display the Select Patient window from which you can search for and select a Patient ID Select Patient a 2 5 x HLA Fusion ee2020e288e Patient Domor Last Name Family ID SCs Name JO Select Patient ID Family ID FirstName Middle Name Last Name Pe osr smth Bob mth Tk fa se we oe e P F Smas smin eot a o eent Et a pama OA a pat If they are not already filled in you can enter th
105. d with more than one donor record and a donor ID can have more than one patient record associated with it 1 From the Main Menu select Patient Info gt Manage Patient HFR MAN Vv3 x x EN 00 Rev 0 154 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Select a patient donor record 3 Click Select the HLA Tests tab 4 Place a check mark next to Edit at the top of the screen to allow changes to be made to the record s 5 Click the Associate Donor IDs button 6 Inthe Patient Donor Sample gt x Association window which HLA Fusion 0060 206 opens highlight a Donor ID and click to add it to the Patient Donor Sample List Click to remove a highlighted Donor 1D from the list Click Save to store the data 8 Click OK to return to patient record 9 Click Close to return to the previous menu Associating a Donor with Donor PRA Results A Donor ID can be included in the calculation for Donor PRA percentage for the antigen products 1 From the Main Menu select Patient Info gt Manage Patient 2 Select a donor or create a new one 3 Make sure the Patient Donor field is set to Donor Located at the bottom right of the Patient Donor Information screen is the Donor Info section Select the Include in Donor PRA check box 5 Select the Donor Type from the drop down selection Donor Info Donor T Living related 6 Click the Browse Button LJ to open the a Iv Donor Gr
106. de s Lab Code Description 010 020 SSP One Lambda Distributor B Bob Smith Contact Email BSmith onelambda com Note The Lab information will be printed on HLA Fusion reports FONE LAMBDA E Editing the Lab Profile Laboratory information displays on most reports and includes contact information for your lab This information is initially entered during installation and can be edited any time from the Lab Profile menu Fields marked with an asterisk are required 1 From the main menu select Profile gt Lab Profile 2 Edit lab profile information 3 Click Save to save changes and return to the main menu or click Cancel to return to the main menu without saving any changes HFR MAN Vv3 x x EN 00 Rev 0 168 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Managing Lab Codes Lab codes are used on NMDP reports to identify contract labs Multiple lab codes may be entered and stored in HLA Fusion You can select the lab code you wish to use when creating an NMDP report Only the first three digits of a lab Code are used on NMDP reports lab code descriptions are not included on reports 1 a e wN From the main menu select Profile gt Lab Profile To add edit or delete Lab codes e Click Add Lab Code to add a new lab code Enter information into the new row e Highlight a lab code to be edited Click Edit Lab Code to edit the lab code Edit lab code information Highli
107. e Creating New Test Lists Test Lists must be created in the order in which the samples are to be analyzed 1 From the Main Menu select Samples gt Manage Test List Manage Test List Screen Create Edit Test List Select Test List Or Enter new Test List Name Delete List Test List Na Sample ID Local ID Patient ID Remove All 2 Typein a name for the new test list or select a previously created test list and press the Enter key on your keyboard 3 Search for samples to add to the test list using the search fields and click the Search button to view the search results 4 Highlight samples and click the Add button to add them to the test list HFR MAN Vv3 x x EN 00 Rev 0 146 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX O 6 Click the Save button to save the new test list Click the Close button exit this screen and return to the Main Menu Viewing and Editing Existing Test Lists Test Lists can be viewed or edited at any time 1 From the Main Menu select Manage Samples gt Manage Test List 2 Use the drop down list to select a test list and click Continue gt gt D 4 Click Close to return to the Main Menu Click Delete List to permanently delete the selected test list Deleting Existing Test Lists Deleting a test list removes the list from the database but the Sample IDs are not removed or changed in the database 1
108. e First Name and Last Name for the patient or donor in the appropriate fields Click the drop down arrows in the Ethnicity and Patient Donor fields to choose ethnicity for either Patient Donor or Both If you want to associate a gel image with the sample double click in the Gel Image field and browse to the location of the image you want to attach to the sample Fusion supports the BMP J PG BMP GIF PNG and TIF image formats However certain versions of the TIF format may not be supported by the Windows version used on your computer Select Gel Image Browser j File name ana 149 del S pa Ps HFR MAN v3 x x EN 00 Rev 0 78 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Repeat the above steps until you complete the batch information or until you want to save and complete the batch later Fach Micro SSP batch session can consist of as many samples as you wish to analyze with the same or with different catalog information Take one of the following actions once you are ready to stop creating the batch Click the Next gt button to open the Micro SSP analysis window Click the Save button to save the current batch information and return to it later Click New Batch to begin creation of an additional batch Click Close to exit the Batch Entry window HFR MAN Vv3 x x EN 00 Rev 0 79 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Configure Micro SSP Dat
109. e Greater Los Angeles Area call 818 702 0042 Contact us by e mail at techsupport onelambda com For system requirements see the HLA Fusion Research Installation Guide HFR MAN v3 x x EN 00 Rev 0 13 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Scope of This Manual This manual provides information on how to import raw data and then analyze it making adjustments in cut off values as necessary It is very important to recognize that the QC Quality Control data used with this program and the defaults set in this program are based on One Lambda s experience with the product in a tightly controlled research and development environment Thus a laboratory performing HLA typing in another environment may need to reset cutoff values to meet specific laboratory requirements From the Main Menu of HLA Fusion Research you can access the three major components of the program e Analyze Data e Manage Records e Manage Samples In addition you may also access the following features e Patient Information e Utilities e Help This manual helps you start using One Lambda s HLA Fusion Research It includes an overview of the system and then quickly takes you into the process of analyzing data See the HLA Fusion Research Installation Guide for installation instructions HFR MAN v3 x x EN 00 Rev 0 14 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Navigation This section de
110. e a all edits Insert quick report Click arrowsto madeto Comments Accept with EPG Save audit navigate through gpg Tforasample base call peaks and typing Nucleotide Caller the EPG gt ses dee leye ES navigate a aci m IMGT A 258 Comments E Full Report i Close _ samples pee mor is E ZEN i Close the Add or Display Select Clickto Nucleotide Marks sample Click to Opens window remove orhide navigate navigate position for more tests display a list the SSO confirmed between between l and of shortcut Reports assigned allele pairs loci LabTypeand mismatch key Menu alleles in the ConsenSys navigator combinations result pane Sample Navigator If several samples have been imported click the drop down arrow to select a specific sample for analysis Allele Filter For combined analysis if checked it will filter alleles based on SSO typing Unchecked it will give only SBT results consensvs Ah WARNING This will restore the allele filter for l 9016 The sample will be retested against the filtered allele list Please confirm this action SS When the check mark is in place the Allele Filter will retest the sample against the filtered allele list Remember that inserting a check mark will re analyze the sample and all the edits that you ve made will be deleted i For your protection Fusion Research will display a message asking you to Gers ets al user edits wil be deleted reconfirm your deci
111. e designed to assist personnel experienced in HLA analysis by suggesting typing results However results must be carefully reviewed by a person qualified in HLA typing to assure correctness This software may be used to aid in suggesting results but should not be used as the sole method for determining reportable results This software is meant as a laboratory aid not as a source of definitive results For the reliability of patient information stored in the database users must ensure that the identifier for each patient is unique and that each sample identifier is unique The storage capability of HLA Fusion Research is limited by the Microsoft SQL Server Desktop Engine or SQL Server 2008 The user must manually archive data HLA Fusion Research assumes that data for each required input is in a standard format that has not been modified The HLA Fusion Research analyzes a data file in one of the following formats ab1 file for ConsenSys csv file for SSO csv file for Micro SSP The data file name also known as a Session ID can be up to 100 characters long and includes the csv extension The data is generated based on original unmodified templates provided by One Lambda Inc The user is responsible for final assignments and must review all suggested results Technical Support For technical support or to report software problems contact your One Lambda representative From the United States call 800 822 8824 or from th
112. e folder on your computer containing the Ab1 data file s you want select the file and click Open The imported Ab1 data file s will be displayed on the right side of the Analysis window f gt ALGmAG lt gt gt ate Filter M Reanalyze _ Reanalyze Accept Save gt gt jm AP630 a a IMGT HLA B 27 y ore Tests I comments Comments Cad Quick Report HL al a Allele Pairs 1 1 1 pl 31 Filter List Not Applied SRGCMSTGGCCCYGACCGAGACCTGGGCBGGCTCCCACTYYATGASGYATTTCB E cY TGTCCYGGCCYGKCCGCGGRGAGCHCSSCT B O70201 B o70201 feeovozon seo7o202 20 AP630_B_2_F gt gt Beo70201 B 0704 10 A 873 C 2003 B 070201 8 070501 10 G 1888 T 1832 a AP a Note You can select and import more than one file at a time by holding down the CTRL key 3 Click the Start Analysis button to analyze the Ab1 files The ConsenSys Analysis window The main ConsenSys screen is divided into four general areas The EPG Navigator moveable An exon specific summary The EPG panel Allele Typing Result Pane PWN P COGOGEGOIGC CG GGATAGADCAGGAGGGD COGGAGT AT TGGGACEOGGREACACHGRAAGTGAREGCCCACTOALAGACT CRCOGAG GEACCIGGGGACDUCLGCGCGGC TACTACKAGCAGAGCGALGCOG i iil yi Um Mh Ah k O mm O WHI li 03 01 01 01 4 03 01 06 l HFR MAN Vv3 x x EN 00 Rev 0 40 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The EPG Navigator Deactivate and undo Click to Generat
113. eaction Bead option in the configuration menu displays a new window as shown below In this window you can force positive or negative bead ID values by typing in the box Force Sure Reaction t Forced Positive Bead ID eg 001 002 005 etc Forced Negative Bead ID eg 001 002 005 etc HFR MAN Vv3 x x EN 00 Rev 0 60 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX SSO Analysis Window Overview From the SSO Analysis window you can e View sample analysis results e Change histogram scaling e Add comments and mark samples for more testing e Print analysis information and reports For each sample in the current session you can view the test data adjust the cut off and assign a typing HLA Fusion Research analyzes a sample when you move to view that sample Any unviewed samples do not have analysis results when the session is saved To analyze an entire session all samples in the session must be viewed and typings assigned by the user Using the SSO Data Analysis window The Sample Analysis Screen provides detailed analysis information for each sample in the session You can review the typing assignments suggested by the program and to modify and accept the assignments HLA Fusion Research suggests possible typing results but the final assignment is made by the user Cut off adjustments made in the Analysis window are sample specific and affect only individual samples SSO Analysis w
114. earch Criteria Sample ID Category TurnAround Date Range Sample List i EF El y l Y 7 19 2012 V 3 13 2013 a y n Sample ID Category Turnaround Location Patient ID SS IA Ol Oe Sample may appear multiple times if it is associated with different sample list group 2 Use the filters to find samples and click the View Sample button Note Wildcards can be used in the Sample ID field to widen the results 3 Edit sample information e Double click on a Patient ID to open the Patient Donor Information screen and edit information for that patient donor Note You can rename a sample by modifying the name in the Sample ID field Sample ID s are listed alphanumerically with all ID s beginning with numbers listed first Click Save to save Or click Delete to delete the sample 5 Click Close to return to the Main Menu Note You cannot delete a sample which is part of a session that has already been analyzed HFR MAN Vv3 x x EN 00 Rev 0 145 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Test Lists A Test List is a list of Sample IDs that can be used repeatedly to automatically write the Sample IDs into a session analysis that can be read by Luminex It is a useful tool when you have a group of samples to be run on multiple tests With the Test List menu you can e Create new Test Lists e View and edit existing Test Lists e Delete Test Lists e Export Test Lists to a txt fil
115. ed tab 9 Select the check box for the antigen s you want to include in the tracking ferent o 0 gt bea Doser rre Molecular eia ii S snose n lO Sero gt ata Corset were o Date gt Sommi tere Dosor PRA Examples of the graphs that can be displayed with Ab Tracking Auto Scale E Set Min Scale Include Allele Options Set Max Scale skad ma available Set Time Scale Interval Days e OREY D405 if you Display Sample Date for Line Chart z ced Re right click Export Graph Line Time Scale on a gra ph Print Graph Sample nica y p at Spec Sample Dilution Include Antigen List 10 Select the formula to use for the graphs by clicking the drop down arrow in the Formula field Default versus Raw The formula can also be changed after the graphs are displayed if you want to compare the tracking with different formulas You can double click on a graph to expand it and there are right click options available from each graph see graphic above You can also use the expand contract buttons El at the upper right corners to expand the graphs e Optional You can add donor data if desired by using the drop down arrow next to the Donor ID field to select from a list of donors associated with the selected patient You can also create a new donor on the fly by typing a unique name into the Donor ID field and filling in the molecular and sero typing e Optional Enter a
116. ed with an A in their Status column have been archived 1 From the Main Menu select Utilities gt Update Reference gt Catalog Information Management Select the check box next to any catalog you want to delete 3 Click Delete to remove the catalog information Reporting Catalog File Information You can view and report information about a catalog file and generate a report from the Catalog Information menu 1 From the Main Menu select Utilities gt Update Reference gt Catalog Management 2 Click a column header if you want to sort the catalog file list gt Optional If you want a report in the old format select the check box next to Old Format report 3 Click Report to display a printable exportable report of the currently displayed catalog information Associating Product Catalog Files and Luminex Templates You can associate a catalog file with the Luminex template name used for a specific product HLA Fusion automatically associates catalog ID and template names the first time you run the analysis for the product After an association has been made HLA Fusion automatically selects the catalog file associated with the template used in the CSV file when you start analysis You can also manually add remove or change associations 1 To add or remove an association select Utilities gt Catalog Template Association 2 Add a New Association 3 Select a catalog file 4 Type in a new template name or clic
117. eetenee 29 RR E E eee so acienseedet dev ttesacneamereeoe 29 A E E O ta eneataiee Susie ernie tis a Do gat a a E 29 SNOW INAV IS Oi ete ee dete ia sath teaches Ai ia 30 A a 30 Related Recorra sala 30 Side by Side Analys si da 31 Product Data ASIS dd E aaeko uate can deceeyostae 32 Sample NVI ION dia 33 COSC SVS ANO VS IS dai ida acre 34 OVer view CONSENSYS ANGIVSIS id A E 35 Define the File Naming Convento 36 Update Serology Equivalent and Catalog filesS cooooocccncooncnnnonaconnonaronnnnnnonnnonaronnonarnnnonanonnnnnnconnonanonnos 37 Starting a Combined ANAIVSIS SESSION dada 38 Addine am ADL FIG a da 40 The CONSE SVS ANY SIS WINDOW prat dls 40 TRHEERGANGV Gat ad 41 Sample Navia Ait ose eee ina seed acre caged o o et a ES ee teu eee 41 FAN Tel eG ej 2 eerie a TE y Tera te Net me ene VE TEN oe E 41 CONTA Eterna nda 42 Nucleotide Calleri anal 42 Electropherogram Navigator ii Add 42 LAB TyDe ConsenSys Selec rara lina 42 HFR MAN v3 x x EN 00 Rev 0 4 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX BOC IN MIC tO Nata 43 Nucleotide position Mismatch Navi TO is 43 O O O uaseceP a ee eenee 43 COMME o dd 43 MOTE MES SN A T eee 44 aid ii lada 44 NA A O A ad er OER Oe TAR ee eR OTA 45 OLB el ea of 6 dcyremnenrts eee ert ene etre a tee OnOaT SNL REE E Se erent err eee rane Seeman te 45 PUNMIRED ORS taint acc nds 45 EIEE Pe sss nasty Inia O O A AAEE ET AATA AENEA TT 46 SAV Os T
118. ement From the Profile main menu you can e Add new users e Edit existing user profiles e Change passwords e Reset passwords e Archive users HLA Fusion uses two user levels for added security and control of typing and screening results A Supervisor can A Lab Technician can Modify all product configuration settings except to Modify all product configuration settings enable Auto Accept All and Computer Generated Serology for LABType and Micro SSP products Save and Confirm analysis results Analyze data and save analysis results Update reference files such as catalogs Only if authorized by the supervisor Update reference and NMDP codes files such as catalogs and NMDP codes Archive catalogs Archive catalogs Modify and delete session and sample Only if authorized by the supervisor Modify and delete data session and sample data Modify own amp other user accounts Modify own account only Change the Lab Profile Manage sample and patient information Types of User Privileges HFR MAN v3 x x EN 00 Rev 0 164 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Viewing the User List The List User option displays a list of all users currently in the database both active and retired You can look up and select user profiles 1 From the Main Menu select Profile gt List User 2 Typein a name and click Search to search for current users 3 4 Click Close to return to the ma
119. en to allow changes to be made to the record s Select a Patient or Donor ID 9 Click the Associate Sample IDs button In the Patient Donor Sample Association window highlight a Sample ID and click the arrowL2_ button to add it to the Patient Donor Sample List ClickL lt _ to remove a highlighted Sample ID from the list HFR MAN Vv3 x x EN 00 Rev 0 153 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Patient Donor Sample Association x HLA Fusion 0000000 Patient Donor ID TER25 Patient Donor Sample List TER117 NONE LAMBDA 7 Click OK to associate the Sample ID s and return to the patient record 8 Click the Close button or the Exit 4 button to return to the previous HLA Fusion menu Translating Associated Patient Donor Results to New Allele Code Patient or Donor results can be translated to update the allele code names to the new NMDP allele code format The new format will affect allele code and allele pairs assigned to the selected patient donor and will be stored in the Fusion database in the new format 1 On the HLA Fusion menu bar select Patient Info gt Manage Patient Select a patient donor record Click the Translate Alleles button Click the Save button to save your data Click the Close button or the Exit button to return to the previous window NP WN Associating Patient and Donor Records A Patient ID can be associate
120. er this menu item for creating and managing your own user profile lists of system users and privileges and lab information There is also an option for switching between the home page options depending on your system navigation preferences Utilities The options under this menu item pertain to importing catalog code and serology files configuring the molecular and products you analyze setting up your HLA Fusion Research system and system validation Update Reference File Catalog Information Management Utilities LaB press Heb Exit Demographic Allele Frequency Update Reference t CREG Information Management ESE 3 A lhl Set Default Negative Value Molecular Product Configuration Set Mixed Product Configuration Antibody Product Configuration Set Analysis Configuration Molecular Analysis Configuration Ab1 Filename Configuration NS File Import General Settings Help This menu item allows you to access the following HLA Fusion Research Software information e Online help which provides guidance in using HLA Fusion Research Software e Notification of updates and a description of new features in the latest HLA Fusion Research software e Dynamically updated Frequently Asked Questions FAQs about the HLA Fusion Research software e The build and version number of the HLA Fusion Research Software application you are currently using HFR MAN Vv3 x x EN 00 Rev 0 26 One Lambda User Manual HLA
121. erated CSV file data such as date and time to the local regional code if a regional code is specified in the CSV file A regional code cannot be specified for CSV files created with Luminex software version 2 2 or earlier If the first date field is highlighted yellow it indicates a regional code mismatch In this case it is recommended that you use the drop down selector in the second date field to choose the appropriate date taking into consideration regional date format differences To begin an SSO session do the following 1 Select a file from the list of CSV files to import or click the folder icon above the list to browse to SSO session files s on your system network If samples in a session have a positive control value below the minimum setting they are flagged so you can easily select and delete them from the session Previously imported CSV session files have a tan or light brown background 2 Placeacheck mark next to the CSV session file you want to open The SSO Session Import Screen opens Date may be highlighted Lists in yellow if regional settings previously do not match between Imported the current CSV file and Click to open the CSV files Catalog ID Session ID Fusion Research Import Patient Screen Luminex Session files Sets the Patient ID to be the same as the Sample ID Double click Place a check Lists the Double click Click to assign patient type here to open mark here Positive
122. erface exe Untitled Notepad AE File Edit Format View Help lt xml version 1 0 7 gt lt configquration gt lt contigsections gt lt section name exceptionManagement type Microsoft applicationelocks Exceptionmanagement ExceptionManagersectionHandler Microsoft applicationBlocks Excep tionmanagement gt lt configsectdons gt lt exceptionManagement mode 0n gt lt publisher assembly OneLambda Fusion Fusioncommon type OneLambda Fusion Fusioncommon ExceptionPublisher Filenames c FUSIONError log operatormall customerinquiryfonelambda com gt lt fexceptionmanagement gt lt appsettings gt lt add key Connectionstring value Data Source localJ SOQLMPRESS_2008 Initial Catalog FUSION_130_0616 Integrated securdty SSPI connection Timeout 300 gt lt add key MTPserver walue gt lt add key MTPUser value qjha oli com gt lt add key Defaultmailinfo value m1 gt lt add key Contact value Contact Name gt lt add key FusionGUiMode walue Crescent gt lt Optional value Nawigator gt lt RUO Wersion gt Productkey walue gt ReportPath value Ciy0LI FUSIONA rpt gt ReportDes1qner ey LUserDatabasemode value server standalone lt fappsettings gt lt contiguration gt e Please note that all the report files used in HLA Fusion are installed in the directory C OLI Fusion rpt and they all have the extension of rpt
123. es Revisions radio button in this section e Fusion updates the number of available recent catalog reference files for products when you select either by Latest Lot Latest Revision or the default listing of Latest Lot or Revision which includes both e Clicking the Select All button places a check mark in the Select Column for all product reference files e Clicking the Deselect All button clears all reference file selections e Click the Get Docs button to download all associated documents including worksheets probe primer sheets and data sheets 4 Using the file directory tree on the left choose the catalog files to be imported or click Select All to indicate all files that are listed Note To determine which catalog is the most recent one available HLA Fusion looks first at the lot number and then the revision number A updated lot number gets flagged as the most recent version of a catalog even if there is also an update to the revision number of the previous lot since you last downloaded catalogs 5 Click the Import button Note If you select Yes or Yes All the software will translate the old allele format into the latest format For the Molecular products LABType or Micro SSP the software will drop the old format allele completely if it does not find a matching allele in the new format list For Antibody products if the software does not find a matching allele in the new format it keeps the old format allele but
124. es you do not want to import Click the Import List button to import the selected sample lists Click Close to return to the Main Menu HFR MAN Vv3 x x EN 00 Rev 0 142 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Information Formats for Sample Lists The information inside a sample list that you import in to HLA Fusion must be in one of the following formats New packing list format This file gives the fields in this order Shipmentloc 1 13 SampleIDName 0198 0398 0 SampleType AB DR or AB DR TurnaroundTime 14 21 or 14AB 21DR DCN 3 digit Example line 1 13 0198 0398 0 AB DR 14AB 21DR 074 Packing list Old Standard X samples This file gives the fields in this order ShipmentLoc SampleIDName SampleType 1 2 3 and an X for AB DR samples DCN Example line 1 12 0287 7867 8 X 074 Old packing list format 11 for AB DR samples This file lists in this order ShipmentLoc SampleIDName SampleType 1 2 3 and an 11 for AB DR samples DCN Fxample line 1 15 0287 0779 2 11 074 Comma Delimited Format Fach field is separated by commas The use of quotes around a field is optional and is required only if the contents of the field use a comma which could confuse field separation This file lists in this order ShipmentLoc SampleIDName SampleType AB DR or AB DR TurnaroundTime 14 21 or 14AB 21DR DCN Example line jin ML 0287 7 66
125. et Oere C Sesen Samet Paentio o Session Co Catalog ID Catalog Type Vi Set vna Suda Comet Session Sel pratyeed Samos 2 data and Criteria add Corfrmed Samples comments Session Date 8 17 2008 4 372012 Exit the Manage Data F Goms A AY IE AS Deiete Gost Window Copy patient Move Translate Prints details Archive Restorean Delete data to sessions session about which the archived selected another toa alleles tests were selected session and record database different to the done by session Make it database new format whom etc available for use Manage Session Data Window e When you click the Translate Alleles button all final allele pairs and code for the selected sessions are converted to the new nomenclature format and stored in the database e When you click Move Sessions ere Sessions you can select another Fusion database into which the selected sessions are moved to Select Patient HLA Fusion e Clicking the Copy Patient button opens the Select Patient screen 1 Select a patient from the list displayed on the Select Patient screen 2 Click the OK button o E ONE LAMBDA 000 HFR MAN Vv3 x x EN 00 Rev 0 138 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The Copy Patients table opens E22237 5001206441 S 102 101712 1 LCT 1W30_021 LCT LCT_20120330110145_LCT 1w30_021_00 04 0
126. ficity 013 013 013 155 Q A 159 032 61 RN 65 013 75 VD 80 013 62E GK66 013 Positive Cont 013 111 E H 11 032 78 RIALR 8 013 013 013 013 149TA E 153 032 N 0 0 0 0 0 155 0 100 0 0 0 42 90 0 a icd dl A a bh Reports View Records Screen 4 Use the arrow buttons to navigate through samples 5 Click the View Analysis button to open the analysis window for the current sample The analysis window can be resized HFR MAN Vv3 x x EN 00 Rev 0 Rxn 1 1 1 1 1 8 1 8 1 1 1 8 8 1 A 02 243 A 11 43 A 24 82 A 02 81 124 A 23 36 A 24 A 01 07 A 02 185 A 24 12 A 02 38 A 11 01 01701 20 A 02 55 A 26 03 01 03 02 A 01 13 28 A 02 01 01 01 A 02 46 48 129 A 03 30 A Positive Control Exon 2 A 02 52 A 03 43 82 A 24 6 A 02 81 87 112 124 129 136 A 02 05 017 05 04 06 01 06 A 01 01 01 01701 31 01 33 A 01 51 A 02 55 A 03 24 A 02 03 01703 04 38 117 13 OSL A AA O A A a One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX View Analysis Display Sample If 10d berg Season ie 012606_1813_19 03659 MA Locus Single Aribieri Leal IDG Calalog ls L31404 AC6_001_02 Oparabor Tesi Pos 11003 Tesi Dabe 15 2000 C More Tesi Hotes HNG Raw 1 500 DAS AB GAL SAP W a 15144 a5 15 ru fiat i ru rut MARTE J A IA Click the Close button to close the wndow and return to the main Rep
127. g Session Logs With HLA Fusion Research you can create log files of your analysis sessions which you can then print or archive Creating a Session Log 1 On the HLA Fusion Research Menu Bar click Data The Data Management Screen opens 2 Provide all necessary session input information by using the drop down menus and search buttons on the left side of the Data window HFR MAN Vv3 x x EN 00 Rev 0 114 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The Data Management Screen Sorted Select Leve IV Select All Session Date Test Date Session Sample ID Session QuantiplexBeads Test v Sample ID Patient ID j Session Status Processed y Catalog Type QuantiplexBeads y Catalog ID LXQNTPLX_002_00 y Test Date y y Session Date 3 13 2013 3 14 2013 y Archived Active Active y Rese ma 3 Once a session is selected its information is displayed on the right side of the window where you can add information 4 Once you have all information you want to include in the log click Save Managing Session Logs 1 Onthe HLA Fusion Research Menu Bar click Data The Data Management Screen opens 1 Provide all necessary session input information by using the drop down menus and search buttons on the left side of the Data window in order to bring up the session you want 2 Once you ve displayed the session
128. ge the threshold value enter a new value in the Threshold field and press the Enter key on your keyboard Normalized bead values that fall within the specified threshold range of the cutoff for that bead are highlighted in yellow Click the Maximize I button to expand the Raw Data Table Click the button again to minimize it or double click anywhere in the light blue area between the threshold box and the Maximize Minimize button to expand the table Clicking on any column header will sort the raw data table by that column gosecescesseeseseces Pos PC NC OLI Sample cti SS ies ee ee amr Count c 30 10 54 057 3413 89 935 9 92 30 131 10 36 057 E 1992 15 15 144 410 78 2442 00 01 aa 2c ar anna The RAW table after double clicking on the header for the Rxn column 60 CO CO CO CO am an an od od ee ee RSH RS Slals s siris Bead Info Tab Bead Raw Bead Info Bead ID 016 Recg Site codon 204 208 KIR2DL4 00101 KIR2DL4 00102 KIR2DL4 0010301 KIR2DL4 0010302 KIR2DL4 00104 KIR2DL4 00105 KIR2DL4 00201 KIR2DL4 00202 KIR2DL4 003 KIR2DL4 004 KIR2DL4 00501 KIR2DL4 00601 KIR2DL4 00602 KIR2DL4 007 KIR2DL4 0080101 KIR2DL4 0080102 KIR2DL4 0080103 KIR2DL4 0060201 KIR2DL4 0080202 KIR2DL4 009 KIR2DL4 010 KIR2DL4 011
129. ght a lab code to be deleted Click Delete Lab Code to delete the lab code Click Save to save changes and return to the main menu or click Cancel to discard changes and return to the main menu without saving HFR MAN Vv3 x x EN 00 Rev 0 169 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Utilities HLA Fusion uses a variety of reference files for data analysis that need to be updated for new products lots and revisions You can also change many global product settings to customize analysis for your lab and you can modify default system settings to reflect your personal or network file system Warning Always use the latest reference files for analysis Otherwise analysis results may not be accurate HFR MAN Vv3 x x EN 00 Rev 0 170 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Managing Catalog Reference Files Catalog reference files contain all of the reaction specific information needed for analysis including the following e Bead and well specificities e QC information e Cut off values e Bead and primer information Fach new lot or revision of a product needs its own catalog file for analysis results to be accurate Updating Catalog Files from a Local or Network Drive Lab supervisors can input new catalog files for use in analysis when new products lots or updates become available Catalog files are also available on the One Lambda download site 1
130. graphic Allele Frequency Number of False Reaction 1 Bw4 Bw6 Information Micro SSP Product Documents SSP1 01 001 14 Nom Date Catalog Description Micro SSP Allele Specific HLA Class DNA Typing Tray f A 01 A 36 Lot 001 Last Updated Date 12 14 2012 NMDP Update 10 11 2012 Worksheet 85x11 Click to open the Catalog Management screen LN ON ON ONIN 000000909 A A ID ON LEA f A SSP1 01 001 WS Reference file Worksheet 11x17 Click to open the Update Reference Files screen Ma RN Click to open the Available Details Reference Updates screen catalogs display nomenclature dates and revision notes pdates Edit Click to edit the MicroSSP global settings SSP1 01 001 PRI SSP1 01 002 06 Micro SSP Allele Specific HLA Class DNA Typing Tray A 01 A 36 Lot 002 SSP1 01 002 WS SSP1 01 002 PRI SSPR1 01 003 SSP1A2 005 10 January 20 Micro SSP Allele Specific HLA Class DNA Typing Tray Micro SSP Allele Specific HLA Class DNA Typing Tray A 01 A 36 Lot 003 SSPR1 01 003 _ A 02 Lot 005 SSP1A2 005 WS SSPR1 01 003 PRI SSPIA2 005 PRI Click any link SSP1 03 002 08 January 20 Micro SSP Allele Specific HLA Class DNA Typing Tray A 03 Lot 002 SSP1 03 002 WS SSP1 03 002 PRI to display the SSP1 03 003 06 January 20 Micro SSP
131. gt HFR MAN Vv3 x x EN 00 Rev 0 120 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Report Viewer Toolbar Toolbar Button What it Does Export Report Exports reports in one of several available formats including Crystal Reports PDF and Microsoft Word Print Report Sends the current report directly to the printer Toggle Group Tree Opens a tree panel on the left side of the Report Viewer window which lists all the samples included in the current report Report Page Navigator If the report has multiple pages these buttons allow you to move to the first page the next page the previous page or the last page Find Text Clicking this button opens a text box which allows you to search and find text throughout the report Zoom Click the down arrow on this button to choose a zoom setting view an entire report page or view by the report page s width e To close the Report Viewer window click the Close button 4 in upper right corner of the viewer Export Report 1 Click the Export Report button when you want to export a report in one of several standard formats The Select Output Directory and Save Type dialog box is displayed Exported report destination file save as type screen x HFR MAN Vv3 x x EN 00 Rev 0 121 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Enter a name for the current exported report or browse for a report file to export 2
132. h is a companion to One Lambda s ConsenSys SSO and Micro SSP products This software runs in both stand alone on a single computer and in network environments The features of this software allow you to do the following e Import raw data e Manually enter reaction patterns e Analyze the raw data and review the results in graphical form e Easily update product information new product and lot information e Search for specific data and create standard or custom reports e Compare results to One Lambda quality control QC data README Files A README file is provided with each software update This file provides a list of significant changes to the software and also critical information that is not included in the user s manual Program Updates Note For best results always make sure you are using the latest version of HLA Fusion Research software You may obtain updates of HLA Fusion Research by request Please contact your One Lambda Inc representative for a copy of the software or see the Technical Support section for more contact information Product information updates catalog files etc for HLA Fusion Research are available through your One Lambda Inc representative or from the One Lambda website http download onelambda com HFR MAN Vv3 x x EN 00 Rev 0 12 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Limitations of the Program All One Lambda software products ar
133. he samples selected click View Report The report is displayed in a separate window the Report Viewer Example of a report viewed in the Report Viewer 6 vocr ee TO E ee M 1 2 6 gt 252 M K Main Report Smith s Custom Report LabName One Lambda Inc Lab Code Institute One Lambda Institute Street 21200 Oxnard Street Contact Dr Emilia Johnson Lab City Oxnard State Provin e CA Emai email oli org Region NSW Zip Postal Code 91361 Phone 818 555 1212 County USA Fax 818 555 1212 eee The Report Viewer contains Sample ID 25468 Local ID Sample Date TestDate Feb 12 2012 various toolbar buttons to Session ID 2 12 2010 DRB1 Locus DZ Catabg RSSO2B1_015_09 Locus DRBL Test Pos 1 allow you to export print and Luminex Luminex 100 15 23 AA navigate through your report Control Values Eron ABC 2916 Daal DaB DPAl DPB The functionality of these Exon3 BIC DQAI DQBL DPA DPB1 str i i buttons is described in the ali al following table Assigned Serology Sequence Test Reaction 181181118111181111118111111181188118111811111111818111111111111111188 m Close Reaction Beads Test Details Bead Allele Specificity 001 DRB1 01 01 0111 2003 0507 1921 2224 25 27 33N 36 4 1 45 DRB1 03 02 01 12 0205 01 05 0309 14 1727 2935 38 40 4 1 53 74 DRB1 04 01 0111 0903 01 03 1307 01 09 14 16 17 0719 2124 2 ts 2931 3335 3843 45 47 48 5457 61 64 6669 72 01 72 074 77 8 AAA DO UT E SO
134. here to see to corresponding Patient ID the Select toallowauto Control PC the current Sample screen analysis ofall valuesfor patient list Sample ID s session each can be edited samples sample upon import HFR MAN Vv3 x x EN 00 Rev 0 55 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The system assigns a Session ID the CSV filename automatically Optionally you can change the ID The ID can be alphanumeric containing letters and numbers and will be listed alphabetically with any other SSO session files in your database If a sample is already associated with a patient the Patient ID and any existing related patient information is displayed To add patient information do one of the following e To add data from the system double click in the Patient ID column of the Sample Patient Details table or click the Patient button on the toolbar The Import Patient window is displayed allowing you to import the patient information file e To manually add patient data type data directly into the patient related fields of the table e You can assign the Sample ID to empty Patient ID fields by selecting the check box for Set empty patient ID to Sample 3 Select a catalog file Your catalog file selection method varies depending on the CSV file and the catalog files you have previously imported for LABType If you need to import more catalogs click the Download link on the LABtype home page
135. ick gt a this button to send them to the final assignment area The Final Assignment area Click the X button to The Manual remove allele Entry Box pairs HFR MAN Vv3 x x EN 00 Rev 0 93 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The Match Tab This data grid displays the coded format of the actual allele pairings for the sample A Matched Reaction Pair is a pair of alleles or group of alleles with a reaction pattern that completely matches the reaction pattern of the current sample Hove your mouse pointer over an allele to see its code definition e This result differs from the Possible Allele Code results The Possible Allele Code condenses the results into a single code where possible e Hovering your cursor over a coded allele format displays its code definition Manual Allele Pair Assignment 1 Make sure you type the assignment in the correct allele code format e Newnomenclature format X H X 4 Where X locus type and code number e Previous nomenclature format X X where X locus type and code number lt p 04 DOB1 03 DOB1 O3 04 DOB1 OS 0081 03 04 DOB1 O3 al A manually entered assignment DEB1 07 01 01 01 DEB1 07 03 Type an assignment into the text box directly below the Assigned Allele Pairs list Press the Enter key on your keyboard to move the typed allele upwards and into the Assig
136. ick the OK button Place a check mark in the EPG check box if you want the EPG peaks included Full Reports Locus fimar A y Full Report Sample Match Summary v Empty Clicking the Full Report button layers narh ust z Electr ogram List v opens the Reports Menu A Empty M Additional Information m The Reports Menu allows you considerable flexibility in sorting summarizing and filtering the presentation of report data HFR MAN v3 x x EN 00 Rev 0 45 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Filters Sample Filter genotyping for all samples or for a specific sample Locus Display genotyping for all samples or for specific loci 1 e IMGT A IMGT B IMGT C or IMGT Cw e Sort by Sample Name Present genotyping results in alphabetical order by Sample Name OR Locus Genotyping results will be ordered by locus e Summary Options NMDP The Default Setting Brief Does not include the Summary or exons Differences Includes exon information e Audit Options Save Was the analysis saved Confirm Need info here e Mismatch Limits Here you can set the allowable mismatch limits from zero to Best Only Best 1 or Best 2 etc e Sample List or Table format Here you can specify if you want the report formatted as a sample list or as a table with or witho
137. ick the Quantiplex Beads button again to continue the import process 5 Place a check mark in the Select Quantiplex check box for all samples you want to import z Y 6 Click the Import button The sample s are imported for use in LABScreen analysis sessions Start LABScreen Analysis with Quantiplex Beads Quantiplex Beads values can be viewed only with LABScreen Sessions started after the Quantiplex Beads Session has been entered Start the import process for a LABScreen session with which you want to use Quantiplex Beads 1 From the LABScreen import window select a Quantiplex Beads sample from the Quantiplex Beads drop down list 2 Once you click Import for the LABScreen session the selected Quantiplex Beads sample is imported as well View SFI Information in LABScreen Analysis You can view Quantiplex Beads SFI values for each bead in the bead information pop up or the raw data table of a LABScreen session 1 Place your cursor over a bead reaction bar on the LABScreen Analysis Window to view the bead pop up with SFI values HFR MAN v3 x x EN 00 Rev 0 111 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Bead Count 174 Raw Data Trimmed Mean 221 53 Sample Negative NC Bead 37 93 Background Raw 170 Background NC Raw 48 Baseline Normalized Value 61 6 NBG Ratio 1 65 Threshold 1 Specificty MICA12 bi Er TY 012 d SF
138. ignment Window This window is useful when you re specifically looking to cross reference sequence data with an individual allele Use t or to switch between nucleotide and dots Allele Pairs Filter List Not Applied Allele 4 01 01 01 01 A 01 201 01 02N jas01 01 08 01 08 Analysis Workflow After you successfully imported your data 1 Audit the assigned nucleotides at every position making sure to audit the mismatched sites for the quality of sequence data ambiguity and polymorphism If changes are required use the nucleotide auditor to edit and accept audits Clicking the Tab button on the keyboard automatically accepts ots the base call 2 After all base calls are audited click the Save gt gt s gt button Click the Confirm lt gt button to save your sequence typing This will change the red box next to the sample name from red to green to indicate that the sample has been typed HFR MAN Vv3 x x EN 00 Rev 0 93 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX SSO Analysis The SSO Genotyping analysis feature of HLA Fusion Research analyzes three Luminex CSV output files as a new session and can continue the analysis of a previously unfinished session Starting SSO Analysis SSO analysis results are based on catalog specifications that are provided with the software You can analyze samples one at a time in order to view adjust and assign results for each one
139. in menu Double click to the left of a user entry to view the profile Adding New Users Supervisors can add new supervisor or technician level users Technicians cannot add new users Fields marked with an are required 1 Note From the Main Menu select Profile gt List User 2 Click Add User to add a new user 3 4 Enter new user information Select the Active check box under the Role field to activate the user account If this is a lab tech profile and you want to allow reference file update and or data management privileges for this user select the appropriate check boxes Click Save to save the new user information and return to the main menu or click Close to discard changes and return to the main menu without saving Editing User Profiles Supervisors can edit the user profile of any user Technicians can only edit their own profiles Fields marked with an asterisk are required 1 2 To edit your own profile select Profile gt My Profile To select from a list of users to edit select Profile gt List User and double click to the left of a user to select that profile Edit user information 4 Click Save to save user information and return to the Main Menu or Click Close to discard changes and return to the Main Menu without saving HFR MAN v3 x x EN 00 Rev 0 165 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Changing Passwords Supervisors can ch
140. indow Quadrant 1 QC Tab Quadrant 1 displays the QC data histogram for the currently selected bead in the QC tab Each bar represents a QC sample and its height represents the normalized reaction value for the selected bead in that sample ac Rxn Local QC Patient Sample Results Set Config One Lambda QC ID 001 Probe ID KP48 Max Scale Hover your cursor over any sample to display the sample details as shown here HFR MAN v3 x x EN 00 Rev 0 61 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX To change the histogram scale click inside the Max Scale box type in new limits and press the Enter key on your keyboard This changes the maximum scale for the histograms in quadrants 1 and 2 You can change the scale back to a new value the same way Reaction Patterns Tab In the Analysis window of Quadrant 1 click on the Rxn tab to display the Reaction Pattern Table Reaction Table Tab The Find Click to reset table to its Allele button original configuration 7 j The Lg maximize Allele Find Allele inina here la Ja n 5 y a 2 z m button ed Ls 2 eoms jx e KIR2D011 00301 El KraL 10030205 IzoLioozazor _ KraoLrooaozos KIRZDL1 0030209 y IR2DL1 a AS y KIRZDL1 0O30203 IR2DL1 EE 2 y Type all or part of an allele into the text box and click the Find Allele button to display that reaction pattern o
141. ion are LABType or Micro SSP samples that have been combined HLA Fusion allows you to move patient records 1 Select Patient ID as the Sorted Select Level top center of the main Manage Data Menu O TestDate Session Sample ID Patient ID HFR MAN Vv3 x x EN 00 Rev 0 139 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Sorted Select Leva 1 Select Al C Session Date f Session 0406workshop_B_lot 9 ID403 2 Click the Move Sessions button at the bottom of the screen om tn de La Pa j 5001206441 5001206442 3 S 14401 t O SBe2101 a E a E E a a E E a D0000000000 L The Database Login screen appears DB Login 1501 x HLA Fusion ES E Connect Using 3 Login using your Login Name and Password Current Database local FUSION FUSION _BSmith The Move Sessions screen opens HLA Fusi a usion gt The database which is listed is the database you are currently using SaL Sener To move session data to another database click the drop down arrow on the right side of the Database Name field and select the Target or Database Name EE destination database name Current Database local FUSIONWFUSION_BSmith j ONE LAMBDA HLA Fu sion 4 4 Click the OK button and Fusion begins the data transfer SQL Sever m Database Name My_Database r Moving Session 1 of 1
142. ize the table back to its original size double click in the same area again Type an allele into the Search by Allele field top left corner of the Rxn Table and click the Find Allele button to search and display the allele and its reaction pattern in the first row Double click on an allele name to bring that allele to the top of the table You can bring all of a certain allele group to the top by entering an allele group i e DRB1 07 Click on a gray tile to the left of an allele name to move all the beads with that reaction to the left Click the Rxn Reset button just above the Max button to reset the table to its original configuration When a column header along the top of the table is clicked the table is sorted by reaction criteria for that well or bead if combined with LABType The first click sorts in ascending order from top to bottom the second click sorts in descending order If you use the Analyze Combined button from the analysis window to analyze a LABType test and a Micro SSP test the Bead IDs from the LABType test are displayed in the Well ID row on the Rxn table These are recognizable by the bead ID followed by an underscore and a 0 Cross Loci Rxn Table column headers 23 3 4 12 7 a 4 Click on a gray tile to the left of an allele name to move all the beads with that reaction to the left HFR MAN Vv3 x x EN 00 Rev 0 88 One Lambda User Manual HLA Fusion Research Software 3 0
143. k Browse to select a Luminex template file Ixt format to associate with the filename Remove an Association Select a catalog file Select a template name and click Remove D HFR MAN v3 x x EN 00 Rev 0 182 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX To modify an Association 1 Select a catalog file 2 Edit existing template name s 3 Click Save to save changes 4 Click Close to return to the Main Menu Importing Allele Frequency Files Demographic Frequency You can import allele frequency files to use in analysis based on demographics 1 From the Main Menu select Utilities gt Update Reference gt Demographic Allele Frequency Allele frequency import Demographic Allele Frequency Update Alleles and Frequency Delimiter y IV Skip First Row Allele Column 7 Use Sero Equiv j lv Alele Test 1 A 01 01 01 01 A 01 01 01 02N A 01 01 02 A 01 01 03 A 01 01 04 ONE LAMBDA 2 Select the Create Demographic Group option 3 Click the Browse L button and locate Allele Frequency files 4 Click Import HFR MAN Vv3 x x EN 00 Rev 0 183 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX When an Allele Frequency file is successfully imported the groups it contains are listed in Demographic Group and Frequency in Database 5 Click Save Note If the header for the column of any allele frequency file you imp
144. l DRB1 HLA2 DRB 1 HLA1_DRB3 HLA2_DRB3 HLA1_DRB4 HLA2_DRB4 HLA1_DRB5 HLA2_DRB5 HLA1_DOB1 HLA2_DOB1 HLA 1_DOA1 HLA2_DOA1 HLA1_DPB1 HLA2_DPB1 HLA3 HLA1_DRB4 HLA2_DRB4 HLA1_DRB5 HLA2_DRB5 HLA 1_DOB1 HLA2_DOB1 HLA1_DOA1 HLA2_DOA1 HLA1_DPB1 HLA2_DPB1 HLA1_DPA1 HLA2_ DPA1 HLA1_MIC A HLA2_MICA HLA MICB HLA2_ MICB HLA_KIR ClassI_AbSpec ClassII_AbSpec MIC_AbSpec Unacc eptableAntigens AcceptableAntigens Notes SHLAI1_ A SHLA2_A SHLA1_B SHLA2_B SHLA1_Cw SHL A2_ Cw SHLA1_DR SHLA2 DR SHLA1 _DR345 SHLA2 DR345 SHLA1 DQ SHLA2 DQ SHLA1 DP SHLA2 DP D onorType IncludeInDonorPRA Subsequent lines must list the actual patient information alphanumerically can be letters and or numbers separated by commas If there is no information for the patient in a particular field that field still requires a comma as a placeholder Note For all manual serology entries the locus must precede the value For example for an A locus of value 23 you must enter A23 HFR MAN v3 x x EN 00 Rev 0 157 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Example Patient Donor List Patient ID CategoryGrp FamilyID FirstName MiddleNawe LastName 3an Dob Gender Ethnicity Address City State Region Cou try ZipCode Email Phone WkFHone Cellular Fax Employer SpouseWName SpouseBloodType EmergencyContact EmergencyTel DCH ospitalName Division BloodType Disease Rhblood Type PatientDonorFlg Associated SamplelDbs Associate
145. l Sample ID field Peles HLA Fusion 2 Select an existing HLA Fusion sample from the list of Available Samples Available Samples Available Samples e You can use the text box at the top as a search tool 3 Click the OK button at the bottom of this window to move the sample from the list of Available Samples to the Sample ID text box above the gel image viewer You may use the existing Sample Name gt or create a new one DRONE LAMBDA 000 HFR MAN Vv3 x x EN 00 Rev 0 86 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Select create a Sample Date 5 Click the Analyze button 6 When finished click the Close button or click the Exit X button to close the gel viewer Modify the Session Start Position For multi test trays you can skip tray positions to match your gel photos by clicking the Add New Sample button until the correct test start position is displayed Rxn Reaction Tab The reaction pattern table displays the positive reactions for each well or bead if combined with LABType x axis versus every allele y axis defined in the current catalog The Reaction Pattern Table is displayed in the right pane of the Micro SSP analysis window Double click anywhere in this The Max area to expand the table button Search by Allele to half the analysis window expands the reaction table a i Force 1 Ron Reset Rn Click to sort the table by the selected
146. lays Update Reference File P G Grouping Update Reference File xj HLA Fusion LXXXIII irectory Import Direct My Computer H E CA Directory __ an SDE Folder tree an P Group amp G Group C Catalog NMDP Local Code Serology Equivalent options Import NMDP CA Import P Group Auto Update Ready 2 Click the Import P Group button or the Import G Group buttons Updating Serology Equivalent File from One Lambda Website The Serology Equivalent file can be auto updated from the One Lambda download site http download onelambda com 3 From the main or any of the product home pages click the Download link or from the main menu select Utilities gt Update Reference gt Update Reference File HFR MAN Vv3 x x EN 00 Rev 0 178 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The Update Reference File dialog box displays Update Reference file Serology Equivalent gt Update Reference File 3 000000 HLA Fusion Directory Folder Tree Serology Equivalent inpor Serology Equivalent option _ Import Serology Auto Update Qu ta WH Last Update 201 1danuan AIP Apr 19 2012 C Galalos C NMOP LocalCode C Paap C Gap S TOOHELAMEDA eee B Ready Select the Serology Equivalent option 5 Click Auto Update to open the One Lambda Catalog Updates Selection window Select
147. lleles for the loci of interest Use the Ctrl key plus a Bracket key 3 or to navigate between the various alignments Sample alignment Sample Base Call Score alignment Allele pair alignment Reference allele alignment BONS HFR MAN Vv3 x x EN 00 Rev 0 51 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Sample Alignment _ CTT ACATCCGTG CCCG CCCG CCGCGGGG GAT CTW ACMTCCGTG CCCG CCCG CCGCGGGG _ CTT ACATCCGTG CCCG CCCG CCGCGGG6 _ CTT ACATCCGTG CCCG CCCG CCGCGGGG CC CGCT A CGCAGTG CC CGCT A CGCCGTG CC CECT A CGCHGTG CC CGCT A CGCCGTG Four samples were imported into this session This sample alignment displays four sequences which correspond to the four different samples On this screen use t or to display nucleotide vs dots Sample Base Call Score Alignment Generally the first 20 50 bp of a sequence read will be poor the next 200 400 bases will have an improved quality sequence before gradually deteriorating again at the opposite end ORAR IA A A AA co A 3 1 SITO DOOR Di ENE a Sa R at A E it Ae e ed II A AAR MIC ay loas El A Misa A Morisas Mesan PP Plena i ee laran PA Mismos Mis eee 191 8 Miss rah ere rs eee EU A eras Merci l EEEE TRE VRS ERGOT EA SEDA AE This figure shows an example of poor quality data at 5 and 3 end with improved quality data in the center B e efl
148. log you want use the Archive Unarchive and Delete buttons at the bottom of the window to manage the Session Log Printing Session Logs 1 Onthe HLA Fusion Research Menu Bar click Data The Data Management Screen opens 1 Provide all necessary session input information by using the drop down menus and search buttons on the left side of the Data window in order to bring up the session you want 2 Once you have displayed the session log you want use the Print Session Log button at the bottom of the window to print a copy of the Session Log HFR MAN Vv3 x x EN 00 Rev 0 115 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Reports HLA Fusion Research provides different report formats in which to output your analysis data and results From the Reports menu you can do the following Create print and export reports for analysis data for all supported products Create custom reports for which you determine content type Create reports for electronic submission such as NMDP HML reports Store as many as 18 reports in a My Favorites list for convenient access Modify the appearance of any report such as fonts formatting and background colors supervisors only Note To view reports your computer must have some form of printer driver installed If you do not have a printer driver installed you can download a free copy of PDF Distiller from Adobe com or the Microsoft Office Document Image Writer fr
149. lt in more alleles assigned Set End Base Ignore all bases right in the 3 direction from the current oc Reanalyze EPG cursor position this is effective only for the exon where the cursor is placed This function is used to trim bases that are not interpretable All ll I Mt unique sequence polymorphism that exists will also be ignored and i possibly results in more alleles assigned 2 More sensitivity Less Sensitivity Forces a reanalysis of an EPG after reducing the detection limit This function is very effective for improving the base call accuracy of data with high background More Sensitivity Forces a reanalysis of an EPG after increasing the detection limit This function is very effective for improving base call accuracy of data with low signal Reanalyze EPG Re analze EPG and discard all edits made Deactivate EPG Remove the EPG from the analysis completely Useful to ignore poor quality extension data The Reference Sequence displays a magenta highlight around bases that differ between the reference and consensus sequences These bases need to be individually viewed and accepted or edited e Blue highlights between the reference and consensus sequences indicate the location of manually edited bases The ConsenSys Sequence is the combined consensus between both the forward and reverse primers It displays any manually edited bases e AGreen highlight on a base in the Consensus Sequence indi
150. lysis Acquiring Quantiplex Beads Data 1 Select the Quantiplex Beads Feunwexsets Hutton from the home page panel or the Quantiplex Beads button on the Fusion toolbar The Quantiplex Beads Home page is displayed Click to open the Click to open the Update Catalog Manager Reference file window HLA Fusion Click links to Quantiplex Product and Catalogs display selected Last Update Date 12 3 2012 catalog Active Catalogs 2 worksheet or probe primer Product Documents documents Catalog _Catalog Description Click to open the Available Update Reference window LXQNTPLX 001 01 QuantiplexTM Beads Lot 001 LXQNTPLX 002 00 QuantiplexTM Beads Lot 002 Note If you are not using the default Fusion user interface the data and links shown on the right side of the window are not displayed HFR MAN Vv3 x x EN 00 Rev 0 109 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX T Include Imported 2 If Luminex CSV files have not already been loaded into Fusion click the small folder L icon located at the at the top left Note Open worksheets and probe primer sheets to verify the accuracy of revision numbers these documents do not contain a revision number in their filename x Qe E cata gt sesion Data Reference is Quni seres A Organize New folder il os 2 Name Date modified Type q g E MESFQC csv 10 9 200
151. med Mean x axis both plotted on a log scale If you select more than one sample Fusion plots the average values ONE LAMBDA HFR MAN Vv3 x x EN 00 Rev 0 113 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Session Summary and Logs What is the Session Summary The session summary table presents a pre analysis of the results It lists each sample in the session and their saved analysis results This option allows you to quickly analyze a session in HLA Fusion Research and save it for later review and final assignments You can graphically view samples during batch analysis but no final typing assignments are made The summary table can simply be launched by clicking on a session in the Navigation tree Note You can return to a session summary from the Analysis Window any time by clicking the lt lt Summary link at the top of the HLA Fusion Research toolbar next to the Sample Session ID Example Session Summary The figure below displays the session summary displayed by clicking on a session The summary table displays the analysis results for each sample in the selected session Session ID CongenSys_20120003 105026 Semples 3 s Session inNam ABT File Name SBT inngt Ne Deke Imgt Hom Match farmgred Aledo Pes Assigned Allele Code Allele Code Debrabon rn 7 SAFER 8 aiaa aln Session Summary Screen ConsenSys Creating and Managin
152. menu select Utilities gt Update Reference gt Update Reference File The Update Reference File dialog box displays 2 Click Auto Update to open the One Lambda Catalog Updates Selection window 3 Select the check box next to the files you want to import Click the plus or minus signs on the file directory tree to locate the catalog files for each product You can also click Select All or Deselect All to select or clear all the check boxes at once A Click the Import button to import the selected catalog files Reference File import progress Importing to DB 70 complete 5 When the confirmation dialog box displays the importation results click OK 6 Click the Close button Imported catalog files can be used without restarting Fusion Note You can also click Go to OLI click the links for the products and catalog files you want to import and follow the download instructions If Auto Update does not respond verify your network connectivity and that the URL you set for One Lambda in Utilities gt URLs amp Paths is correct HFR MAN Vv3 x x EN 00 Rev 0 174 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Updating Molecular Typing Reference Files Reference files contain allele code and serology equivalent information used in analysis It is important to update them regularly for accurate allele code and serology assignments From the Update Reference menu you can download the neces
153. n O RSS01E47_001_03 LABType A B C January 2011 33 0 January 2011 nomenclature update based on IMGT HLA database vers I EF Rssotes7 002 01 LABType ABC Januar 2011 330 January 201 nomenclature update based on MGTIHLA database vers rsso1s1003 05 LABType B January 2010 2 28 0 January 2010 nomenclature update based on IMGT HLA database vers I Fla Rssorst_cos c2 LABType e denuar 2010 2280 January 2010 nomenclature update based on IMGTIHLA database vers fla rsso1S1 004 04 LABType B July 2010 3 1 0 July 2010 nomenclature update based on IMGT HLA database version I A RSso1s1_004 06 LABType B January 2011 3 3 0 January 2011 nomenclature update based on IMGT HLA database vers RSSO1S1_005_00 LABType B January 2011 3 3 0 Newlot Based on January 2011 IMGT HLA database version 3 3 0 a I l E L fossors ooo LaTe fe january 2010 2280 any 2010 nomenciature update based on IMGTIHLA database vers Ki gt Show Archived Catalogs I Check Al LONE LAMBDA 2 Select the S select check box for the catalog files you want to archive and click the Archive button Archive Catalog 3 When a pop up message displays Data Saved click OK 4 Click Close to return to the main menu Note version HFR MAN Vv3 x x EN 00 Rev 0 When you import a new version of a catalog file the system auto archives the previous 180 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX
154. ne Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The Micro SSP Batch Entry window is displayed Select locus to filter catalog list Sample Name field Patient ID Field Batch Name Micro SP_20111215142100 Existing Batches Samal 4 Batch Date 6 18 2012 fi2 15 2012 Patient y a q my Ku Go to the Browse for rta new h Save the current owse fo Start a new batc Sitalvsis ccre n MicroSSP files batch information Fusion assigns a Batch Name automatically But you can change it Note A batch must be unique to the Fusion database for each product type If it already exists the software prompts you to rename the batch It is highly recommended that you do not use any special characters in this field since they may serve a specific purpose as field separators Use the Browse button at the bottom of the window to search for and import one or more Micro SSP files csv or follow the steps below 1 Use the drop down menu in the Locus Filter field to select a locus by which to filter the catalog listing This will limit the catalog list in the next field to only those catalogs that include the selected locus 2 Usethe drop down menu in the Catalog field to select a catalog file Note If you need to import more catalogs click the Download link on the Micro SSP Home Page for instructions on how to add new catalog files to the database The catalog drop down list may not be immediately update
155. ne Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Updating NMDP Codes from a Local or Network rive ccccccsssccccessececceseccceescceceusececeuececseeceeseesesetsuneses 175 Updating NMDP Files from the NMDP Website ccccsssecccceseccccesececeesececeeneceeseesecessusecesseneceeseeesetseaesss 176 Creatine a Be otc Gere od les rs ee te eee eee em ne ae ee ene ee eae Tene eee 176 Updating the Local Code FIG cosa id lia 177 Updating P Group and G Group Files from the One Lambda Website occcocccccnccnnnnccnnnnccnnnaccnonanononanononaso 177 Updating Serology Equivalent File from One Lambda Website cccoocccnnncnconoccnonacinonacanonacnnonacnnonccnonarononaso 178 Catalog Management and Information cescccccsseccecessccecseseccceenecceseusececsuecessueecceseesecessunecessegceesensesessuaeses 180 ATEO CIOE S a ciciio 180 e 181 VIEWING Catalog File IMT ORM atl OM rada 181 Deleting Catalog File INFOrMation cccccccesscccccseccccessececeesececcenececeeesecesaeececeenecessensecessunecessenecesseeesetsuneess 182 Reportine Catalog File Informaticas 182 Associating Product Catalog Files and Luminex Templates ooccccconccnnnonaccnnonaconnonanonnnonaconnonaronnonanonnnnnnoos 182 Importing Allele Frequency Files Demographic Frequency cccccoooccccnncnnnccnnnnonanaconnnononoconnnonanonnnnanonanonnnos 183 Updating Allele Frequency Files Demographic FreQuency csss
156. ne an HLA typing To begin a ConsenSys analysis session you build a session using Sample IDs or Ab1 files This information can be saved as a Plate Record for later use You can also analyze Ab1 files directly Base mismatches or close base calls are flagged by the software and must be resolved by the user From the Analysis window you can e View the electropherogram EPG results e Add sample comments e Flaga sample for more testing e Accept edit or audit base calls e Compare sequence data against IMGI HLA reference sequences and the EPG interpretation algorithm to automatically assign HLA alleles that match your data e Utilize tools to audit manually edit compare and report HLA allele assignments e Improve SSO results significantly with the combined analysis feature using SBT data Analysis Objectives e Audit all polymorphic bases and confirm all base assignments e Audit and edit all mismatches and heterozygous bases to obtain the best matched sequences for heterozygous alleles e Evaluate and confirm final allele assignments Note Before beginning make sure you have the most up to date serology On the Fusion Research Menu Bar click Utilities gt Update Reference gt Update Reference File Select Update Serology Equivalent and click the Import Serology button Also make sure you have updated the ConsenSys reference files HFR MAN v3 x x EN 00 Rev 0 35 One Lambda User Manual HLA Fusion Research Softw
157. ned Allele Pairs text box HFR MAN Vv3 x x EN 00 Rev 0 94 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Possible Allele Codes The Possible Allele Code field displays the possible coded results for all results that fully match the sample The type of code used is dependent on your configuration selection NMDP code default local code user defined or no code Possible Allele Code Possible EE allele code MILL 07 JEZW DRB1 07 JKZW s Allele code JKZW 07 01 07 03 07 04 07 05 07 06 07 07 07 0807 0907 10N 07 1 definition 4 Assigned Allele Code Assigned allele code DRB1 07 JK2ZW DEB1 07 JKZW m e The possible coded result is listed at the top section of the field The code definition is listed below it e Ifthere are no codes for a particular suggestion then the suggestion is listed with XX meaning the code is undefined For multiple XX suggestions each suggestion is numbered as XX1 XX2 etc to distinguish one from the other e The allele codes displayed in the Possible Allele Code field are condensed by Fusion based on suggestions from the list of possible allele pairs displayed under the Pairs tab e The allele code is based on the current NMDP code or local code installed in the system By default the system assigns the NMDP codes to the alleles You can optionally change these codes to either No Code Local Code or Cross Code e No Solution is listed if there are no results th
158. nor Groups Selected Donor Groups 123 123 ABC ABC CBA Add Remove Cancel OK Aa Donor Group Selection 7 Click the Find button to display a list of samples for this patient that are within the specified date range Find Patient List Patient ID cd86 x Molecular Typing Sero A3 A11 B51 B13 Cw4 Cw12 DR4 DR15 DQ1 Dat Typing Date 1905 2008 w To 19 05 2009 El Formula Baseline include Sample Date sample Index sample D Final Assignment 25 08 2008 1 CD86L 2 Negative E 01 08 2008 2 CDBEM Negative 9 15 09 2008 3 CDEENGI 423 424 576 E 29 03 2008 4 CD86P 2 423 B61 A24 B76 B48 B7 A 06710 2008 CD86 QC A23 561 424 45 B7576 fm 1670 2008 6 CD86R 1 423 424 661 B76 B48 25 08 2008 f CD8SL 2 DO m 0109 2008 E CD86M DG Note To add final assignments to a sample double click in the Final Assignment column for the sample to display the analysis window and add the assignment Also only samples with a date can be included in this tracking If the Sample Date column is empty for a sample click on the empty Sample Date cell and use the pull down date finder to add a date 8 Select the check box in the Include column for the sample s you want to include in the Ab tracking graphs and data HFR MAN Vv3 x x EN 00 Rev 0 160 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The graphs are displayed to display a specific type of graph click on the associat
159. nts are made From the Session Summary you can e Runa Batch analysis for a session e View the Batch Analysis Summary Chart HFR MAN Vv3 x x EN 00 Rev 0 73 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Save Assignments Lab Technicians and Supervisors can save analysis results for further review and approval Until approved samples are marked as Ready In the Analysis window click the Save gt gt button to save analysis results and move to the next sample Prior to confirming a sample can be re saved if needed Confirm Assignments When an analysis has been saved Lab Supervisors can review and confirm the analysis results Confirmed samples are marked as Approved The Confirm button is grayed out when you view a saved but as yet un confirmed sample The Confirm button becomes purple Lem when you view a sample which has been confirmed by the Lab Supervisor Samples may be reconfirmed From the Analysis window click Confirm gt gt to confirm analysis results and move to the next sample Note The application records two levels of analysis reviews Save and Confirm For re saved and reconfirmed analysis only the last user to save or confirm is recorded Print Screen Print Screen prints the entire currently displayed analysis screen From the Analysis window Menu Bar click the Print Screen button A print preview screen is displayed in a new window if you wish to examine the image before
160. numeric value in the User defined cut off field If you want to track the antibody signal strength with or without the cut off applied select or deselect the check box next to User defined cut off HFR MAN Vv3 x x EN 00 Rev 0 161 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX e Optional Select the check box next to Track DSA to track donor specific antigens If this is selected and there are donor specific antigens that are not tested with OLI product kits these are listed Various other Ab tracking graphs are available by clicking any of these tabs DIH Il 3 3 Donor ID 86 Donor ID drop down list Typing Select to track donor specific antigens A mm Mame 3LS1 404LOT 210305 3LS1 ADALOT 210305 3L51 404LOT 20313 3L51404LOT 20325 3L31 A04L0T 2 0329 3LSIAO04LOT 20335 3LS2401LOT 6_1D306 3L52401LOT 6_1D306 A3 A24 B51 B60 Cw4 Cw12 DR4 DR11 DQ1 DQ3 a Select to include Class Il tracking List antigens Catalog ID we 2 Include Y Antigen A Not Tested eae LS1404_002_00 45 E 7 Dat lv test kits LS1404_002_00 46 Das LS1404_002_00 36 include Allele Ls1404_002 00 39 M DRA DRB1 0404 L51404_002_00 x DRBH D0402 LS2401_006_00 45 4 DREM1 0403 LS2401_006_00 46 Include Antigen meini np ns f hd rie CT no gt MT EA Donor Antibody Information e Optional Select the DQA DPA check box to include these in Class IT tracking
161. ode T Enable Cross Code Demographic none y Edit ie h Tl Bw4 Bw6 Information T Computer Assigned Serology Min Positive Control Min Bead Count Min Bead Failure Threshold 7 Close Bead Rxn Threshold T Display Popup message for Low Bead Count Low Positive Control T Allow Auto Accept All I Save Force 1 Pairs Resa to Ou sae PV ONE LAMBDA 000 MINE LAMBDA LABType and Micro SSP Configuration settings 3 Change configuration values as needed e Save Force 1 Pairs stores force 1 pairs in the database during analysis The Force 1 pairs are also displayed in reports that contain this information e Allow Auto Accept All can only be selected by someone with Supervisor user privileges and allows you to select a button on LABType session summary to accept the batch analysis results for all samples e Computer Assigned Serology can only be selected by someone with Supervisor user privileges and automatically populates LABType and Micro SSP analysis serology assignment fields as well as stores results in the database If this is selected a warning message displays as a reminder that the assignments are estimates and should not be accepted without verification HFR MAN Vv3 x x EN 00 Rev 0 188 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Serology auto assignment warning This option enables auto assignment of Serology which is
162. ogical URL http download onelambda com pub Aray_info Windows HLA_Fusion_Catalogs m NMDP URL http bioinformatics nmdp org HLA Allele_Codes Allele_Code_Lists Allele_Code_List_in_Numerical_Order aspx m NMDP Download URL http bioinformatics nmdp org HLA numeric v3 zip m HLA Fusion Software Download Update URL http download onelambda com pubAray_info Windows HLA_Fusion_Catalogs Update ia One Lambda Inc Documents Download URL http Awww onelambda com Source pdffiles land One Lambda Inc P G Groups Download URL ONE LAMBDA ONE LAMBDA URL s Tab Paths Tab Enter a URL and verify that it s correct by clicking the Browse Len button 4 For paths use the Browse button to locate the directory you want to use for the specified purpose i e where you want to store reports when they are generated 5 Click the SaveL Button to store your preferences Activating Products The Products Selection option on the Utilities menu allows you to activate or de activate the various OLI analysis products that may be used with HLA Fusion 1 From the Main Menu select Utilities gt Products Selection HLA Fusion o Please select the product s Antibody e I ou e How PRL e Note Please select at least one product Select Activate products 2 Select or clear the check box next to the product s you wish to activate or de activate 3 Click the OK button H
163. om Microsoft com In addition you can print and export these reports directly from an analysis or batch summary screen Using the Reports Window The following sections describe how to create save and print a report containing your analysis data Here are the main steps you should take to create a report from this window 1 Select a report type 2 As needed select criteria to refine the report data such as the date range 3 4 Select the sessions or samples to include in the report Select the View Report or the Export Report button Accessing the Reports Window Access the Reports window in one of two ways On the home page click the Reports button in the Fusion Explorer Or click Pererts on the Fusion menu bar HFR MAN v3 x x EN 00 Rev 0 116 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The Reports window is displayed with a list of any sessions that fall within the date range based on the session date range set in the Find dialog box If no session are displayed try modifying the date range Set the Shortcuts Create a order and to other separate sort criteria Fusion To close Report for report menu the reports for each columns options window sample View Report pace Geek Type Moois AC Ad ee mi customize types export or LSE NE ES alt email a Date range Esport Report Email Report Customize Renon report for pc Panel Summary
164. ombined Products to open the Combined Products menu Combine LABScreen catalog files ClassID NcBeadID PcBeadID AddedDate gt ClassID NcBeadID PcBeadID oo fooz 4 2 2012 10 30 07 LS1A04NC10_007_02 002 4 2 2012 10 31 01 LS2A01NC11_008_06 002 14 2 2012 10 30 39 LS2A01NC11_009_03 ju fo fo 4 2 2012 10 30 13 L LS1A03 NC7_007_03 002 41212012 10 30 28 LS2PRANC10_012_06 002 42 2012 10 30 21 ILSTADANC11_007_02 I 1002 4 2 2012 10 30 50 LS1A04NC10_006_05 lo0o2 4 2 2012 10 29 48 LS2PRANC8_012_05 i foon 002 4 2 2012 10 30 21 LSIPRANC8_013_05 1002 14 2 2012 10 30 39 LSIPRANC10_014_03 002 14 2 2012 10 30 24 LS1A02NC7_008_02 002 14 2 2012 10 30 13 ILS2PRANC9_013_03 002 4 2 2012 10 30 26 LS1PRANC10_015_00 1002 4 2 2012 10 30 26 LSIPRANC6_012_03 1002 4 2 2012 10 30 15 ILS2PRANC8_011_03 002 4 2 2012 10 30 50 LSTPRANC7_011_02 001 002 4 2 2012 10 30 44 SPPRANCR 013 02 lone 141212012 10 20 37 b Da New Catalog ID VONE LAMBDA 3 Select the first product catalog to be combined and click Select the second product catalog to combine and click The new catalog file name appears at the bottom of the selection menu 9 Click Save to save the new combined catalog file for use in LABScreen analysis e Optional Click Clear to reset the selections and start over 6 Click the Close button to exit HFR MAN Vv3 x x EN 00 Rev
165. ome Button returns you to the Fusion Home Page Find Wherever you are in Fusion clicking the Home I button Print Report Preview Report Find l Clicking the Find button opens the Search Screen where you can search by Patient ID Sample ID Session ID or by Other criteria Magnify The Search Screen also allows you to modify the Navigator Show Navigator Patient Information Print Report Related Records From any analysis window you can click the Print Report button to display a list of the reports that you can print The Side by Side Analysis reports you see listed are specific to the product you are currently analyzing a Micro SSP If you have set a default printer for your system configured through Utilities gt Printer Setup the selected report is sent SBT ConsenSys directly to the specified printer m Otherwise a dialog box is displayed from which you can select a SSO KIR printer Preview Report From any Analysis Screen click the Preview Report button to display a list of reports you can investigate before printing The reports listed are specific to the product you re currently analyzing The reports are displayed in a preview window e Usethe Print and Export buttons in the preview window to output the report in the selected format e Click the Close x button at the upper right of the screen to exit the preview window HFR MAN v3 x x EN 00 Rev 0 28 One Lambda User Manual HLA Fusion
166. onor List you can import the information into HLA Fusion 1 From the Main Menu select Patient Info gt Import Patient List The Import Patient window displays Import Patient f El HLA Fusion 00 009 EE Import Local Patient ID TER256 Category Grp FamilyID JERMAINE Hitllerous First Name Middle Name Jossie Gender Ethnicity hispanic Address City 3097 Runnin Japan 07 77 1002 06 54 4548 901 11 1098 11 70 9112 1111 39 0001 111 00 1998 091 00 1987 Human nn Human Human 708 Josephin Note HFR MAN v3 x x EN 00 Rev 0 034 21 3344 Faukla 111 13 4545 111 11 0999 77712008 1600 Pennysl i Cransto Ebute 042 07 1443 237 03 0551 801 Kingswa 2405 Lions G New Yo Flagste 047 32 3335 67 Queens C lowa Ci 11600 Nevada Arsenal 108 Christ Ro 1111 45 1777 111 23 4511 12 2 2005 Import Patient Window If needed click the Browse L button to locate the patient list Select the check box in the Import column for each patient you want to import You may also click Select All to import an entire patient list or Deselect All to remove all check marks from from the Import column Click the Import button to import the selected patients Click the Close button to return to the main menu The HLA Fusion system check
167. ort is empty the entire column is not imported into Fusion regardless of any other data it contains If columns are duplicated Fusion gives you an error message and does not import the allele frequency file The data contained in the Allele Frequency file may look similar to this graphic A D Official Name Japan Caucasian oli2 is 2 A 0101 0 2 0 1 0 2 3 A 010101 0 2 0 02 0 2 4 A 01010101 0 2 0 003 0 2 5 A 02D1 10 9 2 5 A 02010101 10 9 56 7 A7020106 0 01 3 8 A 020107 0 01 4 9 A 020110 0 01 A 10 A 020301 0 02 0 02 11 A 020302 0 01 0 01 12 A 020601 10 4 10 4 13 A 020602 0 01 14 A 0207 2 4 3 4 15 A 0210 0 1 0 1 16 A 0215N 0 01 17 A 0218 0 02 0 02 18 A 0228 0 02 0 02 15 A 0242 0 01 20 A 0251 0 01 0 01 21 A 0253N 0 01 0 01 22 A 0259 0 01 23 A 0270 0 01 0 01 24 A 0271 0 01 0 01 25 A 0272 0 01 26 A 0301 0 8 0 8 27 A 03010101 0 8 0 8 28 A 0302 0 02 0 02 29 A 1101 8 1 8 1 30 A 110101 8 1 31 A 1102 0 1 32 A 110201 0 1 0 1 0 1 33 A 24020101 35 6 35 6 35 6 34 A 24021 35 6 35 6 35 6 35 A 2404 0 02 0 02 0 02 36 A 2408 0 02 0 02 0 02 37 A 2420 0 02 0 02 0 02 38 A 2425 0 01 0 01 0 01 39 A 2443 0 01 0 01 40 A 2601 3 3 9 8 41 A 260101 9 8 9 8 42 A 2602 2 2 2 2 43 A 2603 2 1 2 1 44 A 2604 0 01 45 A 2605 0 02 46 A 2606 0 02 47 A 2611N HFR MAN Vv3 x x EN 00 Rev 0 184 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGR
168. orts window Patient Info You can view patient records associated with selected samples by clicking on the Patient Info tab Patient information can also be viewed by Patient ID using the Patient look up function of the Patient Management menu From the Patient Info menu you can view Patient Donor records To view patient information you must select a sample s You can view but not edit the displayed information 1 Select sessions or samples from the Reports window that have an associated Patient Donor ID 2 Click the Patient Info button The Patient Donor information screen is displayed HFR MAN Vv3 x x EN 00 Rev 0 131 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Patient Information Screen General Info HLA Test Result PatientDonor Info PatientiDonor ID 1 Family ID Farggot First Name Bizabeth Last Name Farggotti Middle Name y Birthdate 13 30 2012 SSN 111 00 1998 Gender Male 2 Female UNK Ethnicity Caucasian CategonGp Address 7109 Washington Street City Washington Region SSW State Province DC Postal Code 20019 2 Human Animal Country USA Phone 201 345 0198 Email Address Test Test org Mobile 201 345 4333 Employer Beckman Instruments Work 201 340 2134 Fax 201 341 0777 Donor Center ID 795 Renal UR Division KIDNEY Transplant B HospitalName SEVERANCE Hospital Spouse Info Spouse Name Joasson Emergency Contact Info Name Jon bebe r 3 Click the
169. oup Selection screen and choose the o acido appropriate donor group s Donor Group m 7 Click the OK button to return to the Patient Donor Information screen HFR MAN v3 x x EN 00 Rev 0 199 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Printing Patient Donor Records HLA Fusion prints both Record Management tabs regardless of which tab is currently being viewed PWN E From the Main Menu select Patient Info gt Manage Patient Select a patient donor record Click Print to print Click Close to return to the Main Menu Exporting Patient Donor Records Patient donor records can be exported individually to a CSV file The file has the same format as a Patient List 1 Dop e w N From the Main Menu select Patient Info gt Manage Patient Select a patient donor record Click Export to export Select a location to save the CSV file to and enter a file name Click Save Click Close to return to the Main Menu Archiving Patient Donor Records Archived patient donor records are not available for reporting or associating You can still view archived records and reactivate them by clearing the archive check box L From the HLA Fusion Menu bar select Patient Info gt Manage Patient 2 Click the General Info tab 3 4 From the Patient Donor List window select Archive from the drop down Active Archive Select a patient donor record list Click Save to save Click Close to
170. ple SUMMA Va erat Oem cedehsdaaun Weanaddah oaott Wewmcecobt Ave 129 VEW REC ONG id 130 Patient INTO cid 131 o o arsenate 132 RODOREDA de a E 134 DataManagcemen tcron eae etree entnean ann sae eat a MRE arn REN Orr Oe Tey Cnt Tere Nee ee d 137 SESSION Mano te Meana A Ads 138 Manage Session Data WINdOW lili oran 138 sample Management da 141 aay ee saci aycsts amplis in e o de o e o ol 142 Information Formats tor Sample LISts iii A ii 143 Na dd An o A atone 143 PACKING IIS Old Standard cx samples iia A 143 Old packine list format 11 for AB DR Simples id 143 ComimasDelmitecd Forma taste ono e certo tenes ln ee aces lc 143 Tab DellMiteo Fo Mati A deetuts eetake 144 SDF FOLMa Coe A re 144 Local Sample Patient ID ONV A E A a taemniaiedies 144 Viewing and Editing Sample Information ari AA a ae Aa 144 TESE UA AAA IA E A ETN 146 Creatine NEW TeSt EIS iSu ias 146 Viewing and Editing Existing Test Listas ib 147 Deletine Existing TESIS as 147 EXPO UNE TE CU Rias 147 Panel IOMA ON eare E a sade tetas 148 Mportine Paten DONOr Listenin A a 149 HFR MAN v3 x x EN 00 Rev 0 9 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Managing Patient Donor RECORGS acia coo 150 Adding New Patient Donor Records 150 Lokum Paten DONO RECO Said ii cn 151 Editine Patient Donor Records ata 152 Associating a Patient Donor ID with Sample ID S ccccnnnnnnnnnnnancncncnonanononononononononanananccnnnnnnnnnononononononnnaanans 152 Tr
171. ple Summary feature lists multiple samples and their typing results e Select samples using the Reports window e Click the Sample Summary button The Sample Summary window is displayed it contains two tabs Molecular and Antibody Sample Summary window BESHIB E70 BEL ew t2 0560 C ARE 06324 Molecular Typing Sample Summary Selected antigen typing records are displayed on the Molecular tab of the Sample Summary screen You can view typing information in a condensed format as well as display more details for any sample 1 Select samples using the Reports window 2 Click the Sample Summary button The default tab is Molecular 3 Select an option from the Select Type of Data to Display drop down list The window displayed depends on the option selected Reports Sample Summary Screen Aare T Sujpiitad Mala Par Porcbla Phan bp inais Lasa rad Alda Podras aba E HHDP Other Code oma topos cum 4 Click the Export button to export the displayed data as an Excel file HFR MAN Vv3 x x EN 00 Rev 0 128 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX e Or click the DNA button to export molecular specificities as an Excel file 5 Click the Close L41 button at the upper right corner of the window to close and return to the Reports window Antibody Screening Sample Summary Any selected antibody screening records are displayed on the Antibod
172. r E the Print Report button to display a list of reports you can O E preview or print for the current sample Allele Code Allele Summary The drop down report menus are identical whether you are Molecular Typing Summary previewing Or printing a report Custom SSP Report SSP Report Note You cannot create a new Molecular Custom report directly from the analysis screen The only custom reports available from the analysis window are ones you previously created through the reports window HFR MAN Vv3 x x EN 00 Rev 0 101 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Assign Coded Results Use the Assign button to designate and save all unambiguous possible coded results those results for which there is only one coded result Save Assignments Lab Technicians and Supervisors can save analysis results for further review and approval Saved samples are available for confirmation by a lab supervisor only e From the analysis window click the Save button located in the bottom right corner of the analysis window to save the analysis results e Fusion will automatically move to the next sample e Samples must be saved in order to associate any user created comments in the database or reports For confirmation a supervisor needs to access the sample for which you saved the assignments Confirm Assignments Lab Supervisors can confirm analysis results Samples are marked as Confirmed e From the
173. r of the application window to Slide the Navigator into view The Fusion Navigator f Product Test Date C Catalog Session Date When the top of the Navigator window is Blue it will remain open until you click any button or control or on various other active areas of the main screen HFR MAN Vv3 x x EN 00 Rev 0 20 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Navigator Tree Using the Navigator tree you can easily move between analysis sessions and samples Note Double click on a session or click the sign to the left of the catalog date or product module to display the list of sessions Results Grouping The sessions and samples displayed though the Navigator tool can be sorted by various criteria e Product type e Catalog Session Name e Test Date e Session Date The default is to group by Product See the next few sections for details about these different display options Group by Product The Navigator displays imported sessions for each product type based on the date range and other criteria set in the Find option To set or adjust the default search settings for HLA Fusion Research do the following HLA Fusion Resi 1 Click the Find button on the Fusion Toolbar HFR MAN Vv3 x x EN 00 Rev 0 21 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX This will open the Search Criteria screen AE Sort Navigator a Sessions
174. r patterns beginning in the first row of the table To Sort beads by reactivity for the allele click on the gray area on the left of the allele name The positive reactions will be moved to the left of the table Click on the Rxn Reset button to reset the table to the original configuration Double click either in the light blue area between the Find Allele and Maximize Minimize button or click the Max Min O button and the reaction table will be expanded To bring the table back to its original size double click either area or button again Click on any column header to Sort the table by well position Positive reactions are listed above the blue line and negative reactions below HFR MAN Vv3 x x EN 00 Rev 0 62 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Local QC Tab The Local QC tab displays a histogram of the reaction profile for the current bead against all samples this user has ever run for the same product same lot revision and over a specified date range ac Rxn Rec Site Local QC patient Sample Results session Date fiz 1 2011 fio 9 2012 1005 One Lambda cut off line Sample GO268 Session RSSO1A_006 Vell Position G2 NommalValue 47 Local QC Tab Fach Green bar represents a QC sample and its height represents the normalized reaction value This serves as a user created QC graph e Hover your cursor over any sample and the sample details are displayed e
175. ral Settings from the HLA Fusion main menu The General Settings dialog box is displayed Enable Audit Trail Logging F Enable Auto Download of Reference Files F Default Patient Donor Type Patient ELISA Reader Se al Pot COMI Auto Donor PRA Calculation E _ Stay Current Sample After Save or Confirm T Defaut Home Page Y Secondary Ab pm PONE LAMBDA Fusion General Settings 2 Usethe drop down menus or select check boxes to make your selections on this dialog box 3 When you have made all of your selections click Save Printer Defaults From the Printer Setup tab on the General Settings dialog box you can select settings such as default printer and paper size which will be in place when you print reports or do a print screen 1 Select Utilities gt General Settings and click the Printer Setup tab HFR MAN Vv3 x x EN 00 Rev 0 194 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX HLA Fusion General Setting Printer Setup URLs Paths Print Screen Show print preview dialog Yes No Default printer Select one Paper size Select one Print Report Show print report dialog Yes No Default printer Select one Paper size Select one DN E Printer Setup 2 Select from the following options for both the Print Screen and Print Report panels of the dialog box e Ifyou want to see a print preview or print repor
176. reen CREG Management xj HLA Fusion 0000000 CREG Type fou New CREG Type Group Name Group Det il icon A254 A26 824 6 picas A23 A30 A31 A32 4 A33 A74 Pic A1 136A80 443 023 4 A24 4 A3 411 BES E57 4 858 4 835 6 853 4 851 4 852 4 878 6 862 6 863 4 875 6 876 6 877 4 871 6 872 6 849 4 B50 6 812 6 B37 4 Pre B37 4 827 4 B47 4 813 4 87 6 B41 6 842 6 B46 6 B48 6 873 6 881 6 860 6 861 6 854 6 856 6 B55 6 sc B8 6 B39 6 B87 5 864 6 B85 6 818 6 B38 4 B594 rc B13 4 B44 4 B45 6 B49 4 B50 6 860 6 861 6 841 6 848 6 B82 6 e LETS pe w 4 a NONE LAMBDA 2 Select an existing CREG group from the CREG Type drop down list or Enter a name for a new group in the New CREG Type field Do one of the following e Enter new or modify existing information in the Group Name and or Group Detail fields and click Save e Highlight a row of existing group information and click Delete Group 3 When you have completed CREG group creation or modification click Close Note Please verify your data before saving and please do not mix alleles with the older nomenclature format with alleles in the newer format within the same CREG table HFR MAN Vv3 x x EN 00 Rev 0 186 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Changing Product Configuration Settings Changes to product analysis settings apply only to samples not previou
177. rrent database Batch Data File Summary a log of the status of all the sessions run in the system NMDP Code list of NMDP codes and their allele definition Serological Equivalent list of alleles and their serological equivalent definitions Typing Query database search report that lists the samples found for a selected allele NMDP Report Export Audit Trail Log a log with all specified activity for a selected users in the current Fusion database My Favorite any of the above reports saved in a favorites list Reports listed depend on what you have stored under this menu HFR MAN v3 x x EN 00 Rev 0 136 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Data Management When you select Data on the Fusion menu bar a window is displayed that allows you to manage session files as well as create log files of session data From this menu you can delete archive activate and move sessions to a different database You can also map the alleles in a session to the new nomenclature format HFR MAN Vv3 x x EN 00 Rev 0 137 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Session Management To manage your data at the session level use the Data option from the HLA Fusion main menu When you select the Data main menu the Manage Data window is displayed Select patient records to archive or delete Sort Select display options Sate Sees Lave l Select Al Sesen Date T
178. s ao maja a O 100 M4 gt MIGO Sample Y Fatent Catalog BSmithOO15004 BSmith00 F Click and drag up to zoom in or downto zoom out Page lof2 In the print preview window the page view slider on the left displays icons for each page of the report O Click on a page representation left side to display that page in the preview window on the right HFR MAN Vv3 x x EN 00 Rev 0 104 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Navigator Right Click Menu Options for Micro SSP HLA Fusion provides special menu options which are available when you right click on either a session or a sample in the Fusion Research Navigator Session Level Options There is a special session level menu that displays if you right click on an active session in the Navigator select the session first with a left click which allows you to reanalyze with new nomenclature Product Test Date Catalog Session Date 1076 GAB py E 12 22 2012 ening Nen setrsicataog TTHIGEEAT a F IBe LE SP Eiei a a Tet a T E 12 20 20 BB Micro SSP_20111220114141 mE HLA Fusion Reanalyze with New Nomenclature This feature allows the session to be reanalyzed using a new or co EA zi updated catalog o ETTI 1 After right clicking on a session the Select New Product screen opens 2 Rename the session 3 Click the drop down arrow Yin the New Catalog ID field and
179. s set to zero 0 a message displays allowing you to see system suggested reaction information to help you decide if you want to analyze the non amp well with a positive or a negative score If more than one well is set to zero the message does not display but the suggested reaction information can still be viewed HFR MAN v3 x x EN 00 Rev 0 83 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX E To see the possible reactions if the well was positive or l negative click Yes and scroll down the Possible Allele SS e Pairs list to the headings Neg Reaction and Pos Reaction No If neither type of result can be suggested the headingis No Solution and it will not be followed by any results Possible Allele Fairs L Meg Reaction ef IEEE 0081 0606 DUOBLIGOS Fae 4F D081 0 010 4 DOB1 030103 Fis DOBI O205 DOBL OZOS Fae LF DOB17061402 DOB1T041402 Fis Headings to look 0081 0323 DOBL OJZS FEF JE n DOB170 0202 DOBITOOZ02 Fa for when viewing 1061030202 D061 030204 FW possible non amp D061 0 0204 DOB1 030204 Fis 1061 0504 008170504 Fae JG well results DQ61 0314 DOBLTOJLA Mae 26 10610514 058170390504 FHS i 0061030504 DQB11030504 TMi A Pos Reaction View Well Details You can view comprehensive details about the current sample by hovering your cursor over a well in the test gel area of the analysis window View Well Details with your mouse over a well Well Position 4H
180. s the patient donor lists you attempt to import to verify that all characters contained in the data are supported by Fusion If your list contains unsupported characters a message is displayed to let you know and the list is not imported Newly imported patient records display alleles in the new nomenclature format Existing patient records display alleles with the existing allele format 149 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Managing Patient Donor Records The Patient Donor Management menu allows you to manage one record at a time From the Patient Donor Management menu you can e Add new patient donor records e Search existing patient donor records e Edit patient donor records e Associate patient donor IDs with Sample IDs e Associate patient and donor records e Assign a donor to the Donor PRA e Print export and archive patient records Adding New Patient Donor Records You can add patient information using the Patient Donor Information menu This is the best option for adding a small number of patient records 1 From the Main Menu select Patient Info gt gt Manage Patient Click to display a list of patients donors in the Fusion database which you can search through by using numerous criteria Patient Donor Information General Info HLA Tests Creatinine Tests Transplant History ffreatme History Crossmatch Resuk 7 Enforce ISBT format for Patient B
181. s the samples within the current session Selecting a sample from this list in the Sample ID field makes the selected sample active in the analysis window Alternatively you can use the Forward and Back Arrow 4 lt li buttons to select different samples At the top of the main analysis window click the word lt lt Summary to return to the Summary Screen for the current session HFR MAN Vv3 x x EN 00 Rev 0 33 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX ConsenSys Analysis HLA Fusion Research ConsenSys Analysis uses sequence based typing techniques SBT to analyze sequence data and to determine an HLA typing The software aligns sequence data generated by an ABI sequencer with IMGT HLA data and assigns allele typing based on sequence similarity The software also normalizes the electropherogram EPG so peaks are uniform in height this enables the quick and clear detection of polymorphic SNPs and the correct HLA type is automatically identified in most cases Through the sequence navigator the end user is guided through all sequence mismatches which require auditing Auditing each nucleotide mismatch will refine the final assigned allele typing HFR MAN Vv3 x x EN 00 Rev 0 34 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Overview ConsenSys Analysis HLA Fusion Research analysis uses sequence based typing techniques SBT to analyze sequence data and determi
182. sary files e NMDP codes e Local codes e Serology Equivalent files Updating NMDP Codes from a Local or Network drive The National Marrow Donor Program NMDP provides a list of allele codes that can be used in molecular typing analysis If you have a current list stored on your local or network drive use this procedure to import it so HLA Fusion can access it The most current NMDP code file is available on the NMDP download site 1 From the main or any of the product home pages click the Download link or from the main menu select Utilities gt Update Reference gt Update Reference File The Update Reference File dialog box displays Update Reference File m Import Directory Folder Directory tree 2 Select the NMDP option MIES O CaS one Gow eam Import NMDP Information impon nor ao ips on last Ps Version Update Date 4 13 2012 Last Download Date 4 13 2012 Go to NMDP download and update DOE Ready Updating NMDP Code HFR MAN Vv3 x x EN 00 Rev 0 175 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX 3 Navigate to the NMDP file on a local or network drive using the Import Directory tree A Click the Import NMDP button to import the selected file O Click the Close button to return to the Update Reference menu Updating NMDP Files from the NMDP Website Follow this procedure to import the NMDP lis
183. scribes the various ways to access the HLA Fusion Research software functions as well as how to use the Navigator tool to access and move between sessions and samples Logging On To Fusion Research A Double click the HLA Fusion Research icon on your computer desktop You can also open the program by clicking Start gt All Programs gt One Lambda gt HLA Fusion Research The Security Login dialog box is displayed a x HLA Fusion User Nome Passwords FF Forgot User Name Forgot Password SQL Server 2005 Express Edition 2 Click the Log In button to open the program Dninbnee focal FUSION FUSION_3 0 Research Version 3 0 0 13925 Created on 5 24 2012 Used 5 300 MB of 6144 MB DB size Regional Settings Client English United States DB Server us_english SGL_Latin1_General_CP1_CI_AS 1 Enter your User Name and Password NONE LAMBDA Note The Database field displays the database to which you are currently connected Retrieving a Forgotten User Name or Password If you forget your HLA Fusion Research password click the Forgot Password link and answer the two security questions you were asked when you set up your user profile The password is displayed when the questions are answered correctly lol xi HLA Fusion 000 1 usero E terme Security Questions What is the last name of your best childhood friend A What is the name of the city you were born cd
184. sequential number The numbers are reset to 1 for each sample and locus When you see unknown codes you should first make certain you have imported the latest NMDP file If you have the latest code file and are still seeing XX codes you can store these unknowns for later submission to the NMDP in a txt file named nmdp_code_ report txt By default the text file is stored inc OLI Fusion data NMDPExport but the location can be changed by modifying the Interface path see the section Setting HLA Fusion Default URLs and Directory Paths Code information is appended to the end of this text file as it is added the newest additions are at the bottom 1 From the Possible Allele Code area select the XX code to enable the NMDP Code Report button at the bottom of the screen HFR MAN Vv3 x x EN 00 Rev 0 96 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Possible Allele Code Select XX code here j 13 i e UE C 08 28 7 C 12 28 C 15 25 to enable the NMDP report button here Click the X button to cancel 2 Right clickthe Report button and choose one of the following To send the unknown code information to NMDP select Direct Request NMDP Save in text file e To add the unknown code information to a text file Save in Excel File default location is c MOLI Fusion data NMDPExport select Save in text file e To add the unknown code information to an Excel file
185. sion to use the Allele Filter with the sample E EEANN HFR MAN v3 x x EN 00 Rev 0 41 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Confirm Filter The Confirm Filter will either display or hide the confirmed allele pairs in the result pane Nucleotide Caller Use the Nucleotide Caller to audit sequences that need modification by selecting the appropriate nucleotide e Click the Plus Ku button to place an insertion marker e Click the Minus amp button to insert a deletion marker Electropherogram Navigator Move to the Move to the beginning of end of the the sample sample Move to the Move to the previous next nucleotide nucleotide Use this drop down control to switch between LABType and ConsenSys analysis HFR MAN Vv3 x x EN 00 Rev 0 42 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Loci Navigation Click the drop down arrow to navigate between different loci including IMGT A IMGT B IMGT C and IMGT Cw Nucleotide position Mismatch Navigator The number displayed indicates the currently selected nucleotide as displayed on the electropherogram EPG pane Use the drop down to navigate to a critical mismatch with a highlighted allele pair Reanalyze i M Please note all user edits will be deleted hd Do you want to continue A A Clicking the Reanalyze button will perform a new analysis on the sample but it will
186. sis window type sample comments into the Sample Comments field located just below the Assignments area Or double click in the User Comments field to open a larger writing space lol Your own Comments 255 characters maximum F Possible Homozygous Possible cross locus reactivity on Well 1G Comments Er entered by HLA Fusion Comments are only saved after you click the Save button HFR MAN Vv3 x x EN 00 Rev 0 100 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Flagging a Sample for Further Testing You can indicate the need for further testing of a sample by selecting the More Tests check box followed by clicking the Save gt gt button The More Tests indication is displayed in results data look up and reports for the sample e In the analysis window click the More Tests check box located below the Assignments area Printing the Current Analysis Window The Print Screen button prints the currently displayed analysis window e From the analysis window click the Print Screen button on the toolbar to print the Current analysis screen Preview or Print Reports You can view preview a Micro SSP report for the current sample by using the Preview Report and or Print Report buttons on the HLA Fusion toolbar Reports Data Sample Patent info Profle Ltt Fa At Ad 2 Patient Summary Patient Typing for Batch Patent Custom In the analysis window click the Preview Report button o
187. sly analyzed Previously analyzed samples must be re analyzed for the changes to be applied From the Product Configuration menu you can Change Micro SSP product configuration Change Ab1 filename configuration for SBT analysis Change product settings for LABScreen Mixed analysis Change antibody screening analysis settings Change default negative serum values for LABScreen analysis HFR MAN Vv3 x x EN 00 Rev 0 187 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Changing Molecular Product Configuration Changes to LABType and Micro SSP analysis settings apply only to samples that have not yet been saved or confirmed To change analysis settings for previously saved or confirmed samples you must change the settings from the product analysis window and re analyze the sample 1 From the LABType or Micro SSP home page click Edit or select Utilities gt Molecular Product Configuration gt Molecular Analysis Configuration from the HLA Fusion main menu 2 Select either LABType or Micro SSP from the Product Type drop down menu LABType Analysis Configuration i h Hic SSP Anaha Configuration HLA Fusion HLA Fusion Product Type lABTe x Momss NMDP Local Code CP Group CG Group C No Code Code F UD C Local Code C Poe Grp C Ma Cio Cinta Code Enable Crome Cocke Dervograghas Ten E cee tae i Bedi Ber information E Tompi Pepe Sepsis Cross C
188. t ALLL HFR MAN v3 x x EN 00 Rev 0 Four samples were imported into this session This alignment reflects the integrity of the peak shape the background and the separation from neighboring peaks Winters High BCS value good quality Red Low BCS value poor quality Use t or to switch between nucleotide and dots 92 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Allele Pair Alignment The Allele Pair Alignment Window displays the alignment for the allele pairs that correspond to the sample being analyzed This window will aid the end user when auditing sequence data In this window the end user can narrow down which allele of the allele pairs is positive for the nucleotide that was sequenced You can view the sequence of both allele pairs together or individually by turning Allele 1 or Allele 2 on and off Allele Pairs Filter List Not Applied HRD Mis Differences A 02 01 14 A 02 01 19 E A 02 01 14 A 02 01 22 E A 02 01 14 A 02 01 23 See A 02 01 14 A 02 01 24 ee A 02 01 14 A 02 01 26 Ss A 02 01 14 A 02 01 27 2 If an allele header is highlighted green then the allele is being aligned in the EPG window If you click on Allele1 or Allele2 you will be turning off the sequence and the header will change color from green to red Use or to switch between nucleotide and dots Reference Allele Alignment The sequence of each allele is aligned in the Allele Al
189. t dialog each time you print make sure the Yes option is selected Otherwise select No e Ifyou do not want to select a printer each time you print select the default printer and paper size from the drop down menus Note This default printer configuration may be overwritten by the specific page properties of certain reports 3 Click Save Setting HLA Fusion Default URLs and Directory Paths The URLs amp Paths option under the General Settings menu allows you to set the default URLs for OLI and NMDP websites to download reference and catalog files and product updates This option also allows you to set the directory path where HLA Fusion by default stores catalogs session batch files reports etc Modifying URLs or paths ahead of time allows you to avoid having to browse for files each time you need them 1 Click Edit on the right side of the General Configuration panel of the HLA Fusion default home page or select Utilities gt General Settings from the HLA Fusion main menu 2 Select the URLs tab or the Paths tab HFR MAN Vv3 x x EN 00 Rev 0 195 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX e Fusiones HLA Fusion 000000 LS http Awww OneLambda com lua One Lambda Inc Catalog Files URL http download onelambda com pubAray_info Windows HLA_Fusion_Catalogs al One Lambda Inc Web Services URL http Inquiryform onelambda com oli_wsvc labdata asmx m One Lambda Inc Serol
190. t from the NMDP website 1 Click the Download link or from the main menu select Utilities gt Update Reference gt Update Reference File 2 The Update Reference File dialog box displays Note Select the NMDP option Catalog NMDP LocalCode Click Auto Update which automatically imports the current NMDP file for use with HLA Fusion Or click Go to NMDP and follow the instructions for downloading an NMDP file from the website If Auto Update does not respond verify your network connectivity and that the URL you set for NMDP in Utilities gt URLs amp Paths is correct Creating a Local Code File Local code files are created by individual labs local codes are created to make ambiguous typing assignments easier to store and read For example ambiguities such as B 1501 1501N 1502 can be condensed with a code to B 15AB for simpler record keeping 1 yA 3 A Copy the local code template from the HLA Fusion CD to a local drive Use a text editor to edit the template and add code definitions Follow the example format using a Tab to separate each field and a slash to separate multiple values within a field letter code lt tab gt numeric allele extension to which the code applies Save the file as local_code txt See the next section Updating the Local Code File to import the file HFR MAN v3 x x EN 00 Rev 0 176 One Lambda User Manual HLA Fusion Research Software 3 0 FUSR
191. te Local ID I Use Sample ID as Patient ID T Create Test Luminex List on Import Import All M Apply Current Date Sample List Details Import Order Location Sample Local ID Category Turnaround DCN PatientID Date Test List Name z M 7 1 70509 2113 9AB DR14 21028 4 4 2012 Mg 1 80509 2111 3AB DR14 21028 4 4 2012 mg 1 90509 2106 3AB DR14 21028 4 4 2012 M 10 1100509 2103 0AB DR14 21028 4 4 2012 M 11 1110493 1296 0AB DR14 21028 4 4 2012 M 12 O 1 10449 0234 4AB DR14 21042 4 4 2012 M 13 O 1 20449 0235 1AB DR14 21042 4 4 2012 M 14 O 1 30449 0238 5AB DR14 21042 4 4 2012 M 15 O 1 40449 0239 3AB DR14 21042 4 4 2012 vV 16 O 1 50449 0236 9AB DR14 21042 4 4 2012 M 17 O 1 60449 0237 7AB DR14 21042 4 4 2012 M 18 0 1 70509 2113 9AB DR14 21028 4 4 2012 M 19 O 1 80509 2111 3AB DR14 21028 4 4 2012 M 20 0 1 90509 2106 3AB DR14 21028 4 4 2012 M 21 0 1100509 2103 0AB DR14 21028 4 4 2012 Y 22 O 1110493 1296 0AB DR14 21028 4 4 2012 x Note Sample ID limited to 50 characters Additional characters would be truncated upon import 2 Click the Search Sample List button 3 Browse for the sample list to be imported and click the Open button Type a name in the List ID field and if necessary select a Lab code or Contact ID from the drop down list 5 Confirm sample information and edit if needed e This symbol indicates that the Patient ID already exists in the Fusion database Click to clear the check boxes of any sampl
192. the Serology Import dialog box Serology equivalent file notice Serology Information The Serology information does not exist in the database Please import most recent Serology 2 Make sure the Catalog option button is selected 3 Click the Auto Update button only enabled if you re connected to the Internet The Reference File Manager screen opens Reference File Manager po By x Y he WV ee LUMI 20000008 Select Product i a E FlowPRA Filename f Revision Nomenclature IMGT RevisionNotes FL1HD10_007_00 FL1HD10 FL2SP_011_00 FL2SP Product LABScreen LABType LAT The number LOT of catalogs a MicroSSP currently in Quantiplex your Fusion Y database Peaca Ciegos io Gee Updated 8 i IS 7 Update Previously Downloaded Documents revised catalogs available for p lt SG download Lists all Available catalogs which are available catalogs not in your Fusion database Show these products In the Show these products section bottom left use O In Fusion DB the radio buttons to easily determine which catalog Updates Revisions O All Catal reference files have been updated and decide which ones you d like to import into your HLA Fusion database HFR MAN Vv3 x x EN 00 Rev 0 172 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX The Latest Lot or Revision drop down is only enabled if you select the Updat
193. the check box next to all files you want to import Click Import Serology to import the selected files Catalog files are ready for use without restarting HLA Fusion 8 After the confirmation dialog box displays import results click Ok 9 Click the Close button Note If Auto Update does not respond verify your network connectivity and that the URL you set for Serological in Utilities gt URLs Paths is correct HFR MAN Vv3 x x EN 00 Rev 0 179 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Catalog Management and Information Archive Catalogs You can archive catalog files that are no longer used The catalog information still exists in the database but is not included in the list of available catalog files for analysis Catalog files can also be restored for use in analysis 1 From the Main Menu select Utilities gt Update Reference gt Catalog Information Management Catalog Management xj HLA Fusion Oo _ S Status CataloglD CatalogType LocusType NOMDate IMGT Catalog Notes a PUJA RSSO1A_011_03 LABType A January 2010 2 28 0 January 2010 nomenclature update based on IMGT HLA database vers Lija fasson fuse A 3 0 uly 2010 nomenclature update based on INGTIHLA database version ul RSSO1A_011_08 LABType A January 2011 33 0 January 2011 nomenclature update based on IMGT HLA database vers I Am RSSO1A_012_01 LABT
194. the default when you first login to HLA Fusion Research but you can change it Fusion Setup ici xj HLA Fusion 000 0 00 General Setting Printer Setup URLs Paths Enable Audit Trail Logging I Enable Auto Update Notification for Reference Files and Software Auto Donor PRA Calculation 7 Stay Current Sample After Save or Confirm J Default Patient Donor Type Patient y ELISA Reader Serial Port com y On the HLA Fusion Research Menu Bar click Utilities gt General Settings and select the General Setting tab ONE LAMBDA HFR MAN Vv3 x x EN 00 Rev 0 19 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX To go to home page for one of the products listed in the bottom left area of the page the Fusion Research Explorer click the appropriate button in this area as in this example for SSO Or click the KIR SSO button on the Toolbar as shown here Or click the ConsenSys Home Page button in the Fusion Research Explorer You can also click the ConsenSys aka SBT 2 button which is located on the HLA Fusion Research Toolbar at the top of the screen Note Migrated and upgraded databases also use this same interface The Navigator If the Navigator tab is not already displayed on the right of the application window click the Show Navigator toolbar button to activate the Navigator function Otherwise move your cursor over the Navigator tab on the right borde
195. the sample with the previous nomenclature format contains an allele that is not included in the new nomenclature that older allele is dropped To rerun the combined analysis click the Reanalyze Combined button e Ifthe nomenclature dates between the current one and the one s being combined with it conflict then the session s you selected is highlighted Red HFR MAN Vv3 x x EN 00 Rev 0 90 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX If you click the Analyze button and there is a conflict on nomenclature dates a warning message is displayed that gives you the option of continuing or canceling the combined analysis The nomenclature of the sample test you selected to combine with the current one will be used if you continue Note Notice that the Analyze Combined button in the analysis window changes to Reanalyze Combined button This is an indication that the selected sessions have been combined If sessions are combined a note is added to the system comments box HFR MAN Vv3 x x EN 00 Rev 0 91 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Make Typing Assignments in Micro SSP Analysis HLA Fusion provides computer suggested allele pairs and coded assignments Final typing assignments can only be made by you or your supervisor From the analysis window you can do the following Switch between code formats Apply Bw4 Bw6 to serology results Apply frequency filters
196. tion can also be accessed by right clicking a sample in the Navigator HFR MAN v3 x x EN 00 Rev 0 31 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Product Data Analysis Click any of the Product Data Analysis buttons to display the product home page import a session file manually enter a session or select from the Navigator list of already imported sessions for that product Ore cot IT a LET LET a p Remember that you can also access any product by clicking on it in the HLA Fusion Explorer at the bottom right of the screen or by clicking on Analyze Data on the Fusion Menu Bar Fusion Explorer Analyze Data Drop Down HLA Fusion Research Analyze Data Reports Dat HFR MAN v3 x x EN 00 Rev 0 32 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Sample Navigation The Sample Navigation tools only accessible from the analysis windows give you access to all the samples in the current session You can select a different sample within the same session either by selecting from the drop down list in the Sample ID field or by clicking the forward back arrow buttons to the right First Previous Next Last Sample ID Sample Sample Sample Sample RS5OKIR_004 04 RS5OKIR_004 04 Current Tii PD 05 24 79 002 RSSOKIR_004 04 Sample i RSSOKIR 04 M RSSOKIR 004 04 RSSOKIR 004 04 RSSOKIR O04 04 Clicking on the drop down Z arrow display
197. ts One Lambda Go 6097 Probe IME 013 Y Y E g 2 Y F TIKIFZOLI Abo 351 RIA AH TUN IRSA PO ROH O RL ORAI ARZON FOLIO HRZ 15001 IPSC 100301 RIFA TADO RIP TOS RIFLE OI PL TOGA KIRA 19001 RDL 10000207 ill KILL TO IRL TOA FIFI TUDI IRL TUS ia IRIG KRALO ORJOL TOO KIEL 1001 KRADLI 0030207 KIFLAOL TOOT RAOL i KIRCH 1001 KIA TODS KRADLI Kine 10020710 i KIRZOL 1001 KRADLI 0031 IATA TUDI FRA 17008 RAH 15001 Ro 1005 cri e Se ae a ee q TT a m Ji ORI TOLA FHEA Sao save cosmo HFR MAN Vv3 x x EN 00 Rev 0 98 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Select a sample from this list to make the sample active in the Analysis window Alternatively you can use the arrow buttons to navigate between the samples Sample Navigation buttons K db pi E nm vega e Click any column header among the sample list to sort the table by that column e Click the arrow buttons to display the samples according to the sorting criteria Histograms Double click on a sample histogram in quadrant 2 to make that sample active The color of the selected sample histogram in quadrant 2 will change to red and the selected sample profile will be displayed in quadrant 3 Configuring SSO Data Analysis The Configuration Menu allows you to define certain parameters for the analysis Click on the Set Config set Cont
198. tware 3 0 FUSREPGRX Using the Micro SSP Analysis Window The analysis window displays detailed analysis information for each sample in the session You can review the allele assignments suggested by the program modify and accept the assignments HLA Fusion suggests possible typing results but you must make the final assignment Any adjustments made in the analysis window are sample specific and affect only the current sample From the Analysis Window you can do the following e Use the test gel pane to change reactions and sample row positions e Change the allowable number of false reactions e Force one false reaction e View and print sample analysis results e Add comments and mark for more testing You can return to a session summary from the analysis wndow any time by clicking the lt lt Summary link from the HLA Fusion toolbar next to the Sample ID Micro SSP Analysis screen Sample ID 1216 11 07 i1 672012 y Findallele False 13 Force 1 Rxn Reset y N z A Rxn Max 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 39 bo D 9c 9B 9A 10H 106 10F 102 10D 10c 108 104A 11H 116 11F 112 11D 11C 11B 11A 12H cross Loci eds eed am ss s Sample Rxn 0 0 D f T T Se A A ee
199. usion Research Software 3 0 FUSREPGRX File Permissions All HLA Fusion Research users must have read and write permissions to the following directories and files OneLambda Fusion Interface exe config ReportMap xml e c OLI Fusion and all the sub directories and the files in these directories Character Length If you are using SQL Server 2000 and encounter a report or results that require more than 8000 characters of data you must update to SQL Server 2005 HFR MAN Vv3 x x EN 00 Rev 0 18 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX User Interface Fusion Research Home Pages Opens the Catalog Opens the Opens the Analysis Management window Reference File Product Selection window HLA Fusion Research Analyze Data Reports Data Sample PatientInfo Profile Utilities L amp Bxpress fi SEQ SEN AE z Notification that TM lt Products and Catalogs g Last Update Date 5 24 2012 is Oe di catalogs NMDP LABType LABScreen Reference file Updates 0 and Serology MicroSSP 139 equivalent files are available Fusion Database Opens the Fusion SQL focalAFUSION 2005 Express Edition Database FUSION_3 0 Research Used 5 300 MB of 6144 MB DB size Opens the User List Settings us_englishSQL_Latin1_General_CP1_CI_AS Version 3 0 0 13925 Created on 5 24 2012 printer setup Audt Log SQL N A Database N A Used N A
200. ut alleles listed Output Format Text Creates a file saved in a text txt format Excel Outputs the full report as a spreadsheet in the xls format XML Formats the report in the Extensible Markup Language known more simply as XML HFR MAN Vv3 x x EN 00 Rev 0 Sample Full Report as a text file File Edit Format View Help Created Aug 09 2013 09 48 06 Sample 1073 SBT Reference IMGT A 3 7 0 0 2013 01 12 No allele pairs in the reference library are compatible with all the observed sequences Please view the mismatch report for more information SBT Layer 939 bases between Exon 2 1 and Exon 5 117 Mean BCS 69 Pass 1073_A_2F_8678_B03_003 Pass 1073_A_2R_8682Mix_B03_003 Pass 1073_A_3F_8701MIX_B03_003 Pass 1073_A_3R_8705_B03_003 Pass 1073_A_4F_15672MIX_B03_003 Pass 1073_A_4R_14488MIX_B03_003 Pass 1073_A_5F_14437_B03_003 1073_A_5R_16333Mix_B03_003 GCTCCCACTCCATGAGGTATT TCTWCACM TCCGTGTCCCGGCCC GGCC GC GGGGAGCCCCGCTTCATCGCCG TGGGCTACGTGGAC GACAC GCAGTTCGTGCGGT TCGACAGC GAC GCC GC GAGC CAGARGATGGAGCC GC GGG CGCCGTGGATAGAGCAGGAGGGGCC GGAGTAT TGGGACC RGRASACAC GGAATRTGAAGGCCCACTCACAGA CTGACCGAGC GAACC TGGGGACCC TGC GC GGC TAC TACAACCAGAGC GAGGAC GGT TCTCACACCATCCAGA KGATGTATGGCTGC GAC GT GGGGCC GGAC GGGC GCTTCC TCC GC GGGTACCRGCAGGAC GC YTACGACGGCA AGGATTACATCGCCCTGAAC GAGGACC TGC GCTCT TGGACC GC GGC GGACATGGCRGCTCAGATCACCMAGC GAGRC GGYCCATGMGGC GGAGCA GAGGGCC GGTGCG
201. well reactions eD ac Crosstoci Sample Rxn__ Awovorey f Search by A 01 01 02 A 01 01 03 reaction A 01 01 04 pattern A201 01 05 A 01 01 06 A 01 01 07 Bead ID s for LabType tests used in combined analysis with the current Micro SSP sample Default configuration e Wells beads if it s a combined analysis with LABType are sorted by sample reaction e The Well ID depends on the row and location of the sample in the test gel pane e The current sample appears in a Blue font just below the cross loci row e Positive alleles are listed below the sample row and are highlighted Yellow e Cross loci wells are identified with the pound sign e Salmon background shading indicates a false positive e Green background shading indicates a false negative HFR MAN Vv3 x x EN 00 Rev 0 87 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Working with the Reaction Rxn Tab Positive reactions are displayed as an X on the table blue for the current sample and black for the remainder PC NC and excluded beads are displayed as 0 on the table If you want to expand the table to full window size click the button To minimize it again click thel button Double click in the gray and light blue area just above the table see graphic between the Find Allele and Max buttons to expand the table to half the analysis window To s
202. y tab of the Sample Summary screen You can view screening information in a condensed format as well as display more details for any sample 1 Select samples using the Reports window 2 Click the Sample Summary button 3 Click the Antibody tab Sample Surenar y Molecular Antibody e A e e ke ee ee ee eS O oe a E IE 0 2 O BI IE E Law NC Raw Val O CN I iran Pos 180 OT ere DO CIC rom ssara mem _lremnm Poin 4 Ilan NC Rew Vain nea O Joss Jenaro mem rama Po 4 a O Joss jean mem Jeanne poss 4 O na Jens 0 10 000 errar eg 10 Now NC Ron Vaan D ECT IZA ETICA omen Pos n NN I E S S E A SS a NN IZA r NEC E EE IE EI FE Zi CS E ii Ti Ju 10 090 NCO e 19 YT IS O VE A inde td Vito AL MN II INN ECO CCOO IESO VES IS IO WE A ind td cee MONO ION IN ECH COS INN MES IS AA for ARA TA Y elos a f NC Dead has a Flaw Vaks highee than al TT o jr ra Traje 7 O e Jena a ra 7 TT e e Ja ro AO TT o rrr JA po E e MO O ETICA IC Pose II E E O Jos Jer 10 000 E O Jess Jus 10 000 O E O Jess usan 0 00 STR S 7 DES 7 MUS IE TA A AE a DUO CIC ETA A A A a O Joss Jenaro 0 E ns 2 Jos Jere rsa 19 m0e9_ owwencae Pos 72 id Low NC Faw Val TT a fr 0 PARA pos 30 OBRA E 7 Lom Bros Coat TI on Jen 000 SARAEA pos J estaran Lom Bess Court Lo NC Rae Val TI on Jenna 0 000 SANS por 82 Lom Bess Coat Tone MO IO ETICA ESE aso SS Ca ON
203. ype A January 2011 3 3 0 January 2011 nomenclature update based on IMGT HLA database vers AA RSSO1A_12R_00 LABType A January 2011 3 3 0 New lot Based on January 2011 IMGT HLA database version 3 3 0 a LIE Rssove 073 07 Labios e January 2010 2280 January 2010 nomenclature update based on IMGTIHLA database vers JA RSSO1B_014_04 LABType B January 2010 2 28 0 January 2010 nomenclature update based on IMGT HLA database vers I JA rssorezo1a07 LAsType B July 2010 310 uly 2010 nomenclature update based on IMGTIHLA database version i RSSO1B_014_11 LABType E January 2011 3 3 0 January 2011 nomenclature update based on IMGT HLA database vers LIC Rssove o76 01 LasType e January2011 330 January 201 nomenclature update based on MGTIHLA database vers ul RSSO1B_13A_04 LABType B January 2010 2 28 0 January 2010 nomenclature update based on IMGT HLA database vers I Fla RSSO1C_009_03 LABType E January 2010 2 28 0 January 2010 nomenclature update based on IMGT HLA database vers I A RSSO1C_009 05 LABType July 2010 3 1 0 July 2010 nomenclature update based on IMGT HLA database version I Rss01C 009 07 uabype c danua 2011 330 January 2011 nomenclature update based on INGT HLA database vers A ul RSSO1C_010_01 LABType C January 2011 330 January 2011 nomenclature update based on IMGT HLA database vers I ICa rssoreaooor LABType ABC uuy20to 310 uy 2010 nomenclature update based on IMGTIHLA database versio
204. yping report of possible allele pairs and assigned allele code results for a set of samples e Allele Code typing report of possible allele codes and assigned allele code results for a set of samples e Molecular Typing Summary typing report of the possible allele code assigned allele code assigned allele pairs assigned serology and other assignments for a set of samples e Combined Sample Generic Typing Combines samples from other sessions into one report Micro SSP data from analyzed Micro SSP samples e Custom SSP Report User selectable data fields based on Micro SSP analysis e SSP Report detailed typing report for Micro SSP tests that may be customized SSO data from analyzed SSO samples e KIR Summary Table Generic Antibody antibody data from analyzed LABScreen FlowPRA LAT or LCT samples e Antibody Custom User may customize a report for antibody data for a set of samples e Antibody Screening ID antibody data report that is fixed in format e Antibody Screening Results summary table for a selected set of samples which includes the overall final results made PRA other assignments and comments HFR MAN v3 x x EN 00 Rev 0 134 One Lambda User Manual HLA Fusion Research Software 3 0 FUSREPGRX Specialty reports created for a specialized purpose for specific users Antibody Reaction summary table of computer specificity assignments based on reaction scores LBSW LBSW v3

HLA Fusion Research User Manual v3_0

Contents

Download Pdf Manuals

Related Search

Related Contents