Home
D2.2 – Workflow Software Analysis and Comparison
Contents
1. Webflow Designer II Integral Characteristics ActiveWebflow Professional Designer Characteristics can t score ISO IEC 9126 weak good strong assess result Functionality 60 40 3 6 Reliability 75 25 4 5 Usability 25 62 5 12 5 4 75 Efficiency 67 33 2 68 Maintainability 20 20 60 1 2 Portability 40 60 1 6 WP2 Business workflow technology analysis and comparison VISP Consortium Page 161 of 239 D2 2 Workflow Software Analysis and Comparison II Pie Charts Functionality Reliability Usability 0 0 25 13 0 25 40 60 75 62 Efficiency Maintainability Portability 0 20 0 3 40 0 67 60 20 60 0 0 Figure 6 3 Pie charts for ActiveWebflow Designer s characteristics BizTalk Server I Functionality Principal Functions F1 Modelling process definition Fct Function name Function implementation no F1 1 Process chart definition process Process charts can be defined in two different ways thread either with Visio and the appropriate set of diagram tools or with Visual Studio 2005 The Visio additional toolbox is designed for Business Modellers and it offers a high view of the process with basic flow Activity Junction parallel activity Loop Visual Studio designer is designed for developers This is where the process designed in Visio will be implemented definitions of Ports Send Receive activities Exceptions The
2. Figure3 17 Sample process model implemented with Verve WP2 Business workflow technology analysis and comparison VISP Consortium Page 47 of 239 D2 2 Workflow Software Analysis and Comparison SAP R 3 Workflow SAP is the main player in the market of ERP systems Its R 3 software suite includes an integrated workflow component called SAP R 3 Workflow SAP97 that have been evaluated independently of the rest of R 3 The evaluation here is based on release 4 6 of the product which is a current release as of the beginning of 2002 The sample process introduced in Figure 3 10 implemented with SAP R 3 Workflow is shown in Figure 3 18 Ep Start Condition ia gt I ont B E H Join Loe Y Q Until BE End Figure3 18 Sample process model implemented with SAP R 3 Workflow The presentations in 3 2 1 and 3 2 2 give examples about the current methodology and the current experience for the evaluation of workflow products and their qualities The evaluations are performed related to the functional patterns which are supported by the products Graphical representations of common workflow scheme are trying to give knowledge about the quality of the software tools The products are presented in a descriptive way From user s point of view it is not evident the advantages and disadvantages of the evaluated tools The criteria which are used have academic nature related to the workflow pat
3. 0005 104 Figure 4 21 SAP NetWeaver Exchange structure 2 0 0 0 cececeecec ee eeeeeeeeeaeeeeeeneneeaes 110 Figure 4 22 SAP NetWeaver Exchange structure ceceececeeeneee eee eeeneeeeneeeeaenens 110 Figure 4 23 The workflow engine s architecture 20 0 0 cece cece ec eeeneee eee eceneeeeaeneeaeeaes 111 WP2 Business workflow technology analysis and comparison VISP Consortium Page 9 of 239 D2 2 Workflow Software Analysis and Comparison Figure 4 24 The workflow engine s application ececeeeecee sent eneeeeeeaeeaeeneees 113 Figure 4 25 YAWL Specifications sion ratei reer a Eeer O Na Ta ee EAER P REAA EERIE 114 Figure 4 26 YAWC Engine sonerennianed i a a n a e a aerat aS 115 Feuted 27 YAWEEOHOD sissdisdendane atkaaddsuastavsleseted AA AE A ocd saad AETAT RA 116 Figure 5 1 Quality in the life cycle sssssseeseesesserrrersrssssrrerrrrersrssserrreene 121 Figure 5 2 Software product quality sssssssssreessssssrrreersrsssserreerreeessss 123 Figure 5 3 Relationship between different types of quality ccccccccsccrccrseesss 123 Figure 6 1 Pie charts for Active BPEL Engine s characteristics sceeeseeeeeeeee cee 153 Figure 6 2 Pie charts for ActiveWebflow Standard s characteristics eeeee sees 157 Figure 6 3 Pie charts for ActiveWebflow Designer s characteristics s eceeeeeeeeees 161 Figure 6 4 Pie charts for Biztalk Server s c
4. Workflow Software Analysis and Comparison 4 8 Enhydra JawE Introduction Enhydra JaWE Java Workflow Editor is an open source graphical Java workflow system that allows the user to create manage and review process definitions workflows using a visual tool It lets users create workflow process definitions and store and reuse them later JaWE has been developed fully according to WfMC specifications supporting XPDL XML Process Definition Language as its native file format and LDAP connections Thus it can be used to edit view any XPDL file that conforms to WfMC specifications The final XPDL file produced from using this tool can be interpreted at runtime by a workflow engine Enhydra Shark Because of involving the WfMC proposed package concept JaWE divides itself into two logical parts Package Level and Process Level As will be explained in detail below the Package level manages entities and attributes within the Package while Process level manages entities and attributes within Workflow Process Definition JaWE is a tool for Process Definition modelling The final output of this process modelling is a XPDL output file which can be interpreted at runtime by the workflow engine s JaWE accomplished three main goals e Graphical representation of process definition e Export of process definitions to XPDL e Import of any valid XPDL and its graphical representation A workflow process definition generated by JaWE is capab
5. F5 Integration with other workflow engines Supported standards It is not applicable F6 Administration and monitoring It is not applicable BPMN is not an executable format Functional Auxiliary Functions FA1 Statistics FA1 1 Number of users One user FA1 2 Number of processes not applicable FA1 3 User rights not applicable FA1 4 Process Information Process Modeler allows exporting out of the model information into the Microsoft Word environment FA2 HELP Functionalities Validation Function WP2 Business workflow technology analysis and comparison VISP Consortium Page 206 of 239 D2 2 Workflow Software Analysis and Comparison II Integral Characteristics Process Modeler Characteristics weak good strong can t score ISO IEC 9126 assess result Functionality 20 80 3 6 Reliability 100 4 Usability 25 50 25 4 Efficiency 33 67 1 32 Maintainability 100 2 Portability 60 40 3 6 III Pie Charts Functionality Reliability Usability 0 0 0 ne 25 0 25 TA 100 ERER Efficiency Maintainability Portability 0 100 0 GBWeak BGood OStrong OCan t assess Figure 6 16 Pie charts for Process Modeler for Microsoft Visio s characteristics SAP NetWeaver Exchange Infrastructure I Functionality Principal Functions F1 Modelling process definition F1 1 Process chart definition pro
6. Filenet 3 9 Fujitsu s i Flow 3 10 IBM s holosofx tool 3 11 Intalio 3 12 Lombardi 3 13 Oakgrove s reactor 3 14 Oracle s integration platform 3 15 Q Link 3 16 SAP s NetWeaver 3 17 Savvion 3 18 Seebeyond 3 19 Sonic s orchestration server 3 20 Staffware 3 21 Ultimus 3 22 Versata 3 23 WebMethod s process modelling 3 24 e Tool catalogs http www telelogic com corp http dmoz org Computers Software W orkflow Products http java source net open source workflow engines The survey of products available for the domain of workflow modelling specification and execution describe a huge amount of products It is difficult for a common user to make appropriate decisions about his choice for taking and working with appropriate software tool The problem of evaluation and assessing this class of software has been attack from different point of views In the next paragraph a comparative analysis is given about the current state of evaluation of workflow products and software tools 3 2 Current Experience in Evaluation of Workflow Software Products 3 2 1 Comparisons And Assessments Of Workflow Software Products And Tools The workflow management systems or business process management systems developed in the late 1980s enable the automated coordination of activities data and resources This WP2 Business workflow technology analysis and comparison
7. Links simulation probability type F2 6 General conditions simulation validation run simulation The BPEL Designer is able to validate the workflow definition either on demand or as a prerequisite of the compilation and deployment process The BPEL Console supports debugging flow visualization and monitoring of BPEL instances F3 Execution workflow engine F3 1 Processes Deployment The BPEL Designer creates a jar archive from the initialization repositories BPEL and WSDL specification of the workflow F3 2 Management of distributed A BPEL workflow can invoke other BPEL workflows workflows utilizing their WSDL interface Distributed transactions are not supported F3 3 Application Server BPEL Server runs either within JBoss or Compatibility WebLogic application servers The exhaustive version runs only within Oracle AS F3 4 File formats The workflow itself is compiled into Java code BPEL and WSDL descriptions are included in the Jjar archive BPEL Console administers several workflow specific attributes F3 5 Transaction mechanisms BPEL Server supports the BPEL 1 1 transaction mechanisms the Utilizing proprietary Java WP2 Business workflow technology analysis and comparison VISP Consortium Page 203 of 239 D2 2 Workflow Software Analysis and Comparison Business Delegate Mechanism BPEL workflows can be integrated into distributed
8. Pools and Message Flows WSDL files are generated for the diagram itself and for all pools which represent the abstract or private processes The WSDL is not generated in two cases e The pool has attached WSDL WP2 Business workflow technology analysis and comparison VISP Consortium Page 79 of 239 D2 2 Workflow Software Analysis and Comparison e The pool represents the abstract process which does not contain any Web services consumer processes In other words a pool which does not contain any elements except lanes and does not have incoming message flows other than reply for outgoing message flows Category Together Designer 2006 is a modelling tool Interfaces As a modelling tool Together Designer 2006 does not support any of the interfaces identified in the WfMC reference model Instead it exports abstract BPEL 1 1 specification that can be refined utilizing a BPEL modelling tool 4 6 Cape Clear 6 5 Workflow software overview Cape Clear 6 5 is the latest version of the Product suite dedicated to Service Oriented Architecture SOA This company has been founded in 1999 by IONA senior executives and released the latest version in December 2005 Cape Clear 6 5 s Description Cape Clear 6 5 is comprised of five tightly integrated components Figure 4 7 Figure 4 7 Cape Clear 6 5 s Structure Service Enablement Innovative tooling to expose critical business functionality and data so that it can
9. Transaction mechanisms Supported communication protocol Users roles User interface technologies client application type proprietary heavy weight user clients or general purpose light weight browsers Possibilities for collaboration with other workflow engines standards Life cycle management Supervising capabilities Process status Flexibility to workflow participants Support of model validation and run time simulation if applicable Peculiarities of the process deployment if applicable Distributed workflow support if applicable Integration with Web Application Servers if applicable Description of the suite of software files needed for the workflow execution Free text description How to define different categories of users if applicable How the workflow engine operates with client applications needs of special client software Possibility to operate with different workflow standards Possibility to manage the time schedule for modelling simulation and execution functionalities What kind of services monitoring active processes alarm queue Failures Access rights Functional Auxiliary Functions Function Fct no Function name Function Implementation category Number of users Description if applicable om _STATISTICS FA1 1 WP2 Business workflow technology analysis and comparison VISP Consortium Page 138 of 239 D2 2 Workflow Software Analysis and Com
10. VISP Consortium Page 33 of 239 D2 2 Workflow Software Analysis and Comparison coordination is formalized in a workflow model specified at the build time stage Georgakopoulos et al 1995 The problem of evaluation of the quality of the software product covering different functionalities of workflow management system is currently attacked by the research and technological community An attempt for obtaining practical and useful results in the product assessment is currently made in BPEL UniS These attempts prove the importance of finding practical solutions for the evaluation of software products in this hot topic workflow management The architecture of workflow management systems can be separated in a development environment modelling with build time component and an execution environment run time engine component zur Muehlen 2004 Both these two general components of the software tools for workflow management are considered below An evaluation of several software products has been done in Haller et al 2005 This work is essential because it illustrates the current practice the maturity and the usefulness of the applied methodology for comparison of the workflow software product Thus it can be proved that the problem of evaluation of workflow product is not a trivial technological problem Even the results obtained from such a comparison cannot give benefits for direct utilization from user point of view For this pr
11. WP2 Business workflow technology analysis and comparison VISP Consortium Page 85 of 239 D2 2 Workflow Software Analysis and Comparison Transition Information Workflow Participant Declaration Workflow Application Declaration Workflow Relevant Data System amp Environmental Data Resource Repository or Organizational Model Data Types and Expressions All of these entities are maintained by JaWE except System amp Environmental Data JaWE gives two logical parts of application as said in the previous text There are Package level and Process level Package level manages entities and attributes within Package while Process level manages entities and attributes within Workflow Process Definition According to this separation Tutorial is organized in the way to explain these two parts of JaWE according to Wf MC Usage of entities and attributes ee Bom Bel Se Ti D 98 eOnseore Ja WE Inemal Representation Import Export of XML representation Figure 4 9 Concept of the Process Definition Interchange Package level A view of Package level is shown in Figure 4 10 WP2 Business workflow technology analysis and comparison VISP Consortium Page 86 of 239 D2 2 Workflow Software Analysis and Comparison At the package level the user is allowed to choose among several XPDL views such as graphical text and xpdl view which represent the XPDL as it will be saved into file Graph
12. Business workflow technology analysis and comparison VISP Consortium Page 126 of 239 D2 2 Workflow Software Analysis and Comparison how many software composition elements appear in the source code statements the number of branches in the control graph data flow and state transition representations External metrics Overview External metrics apply quality metrics of the software product derived from measurements of the run time behaviour of the system in which the software product is a part The measurements are performed by testing running and monitoring the executable software of the system The evaluation of the software quality of the product begins with the definition of static metrics addressing issues of the product application area e business objectives related to the implementation of the software product e exploitation issues of the product e management of the product application in a specified organisational and technical environment External metrics for the product quality is provided by users evaluators testers and developers contributing to the quality in use evaluation if they are able to evaluate the software product quality during testing and operational tasks Relationship between external and internal metrics When the software quality requirements are defined the software quality characteristics or sub characteristics which contribute to the quality requirements are classified Then the
13. F2 Simulation debug Not applicable F3 Execution workflow engine F3 1 Processes Deployment Organization model creation by means of Java initialization repositories Organization Editor JOE graphicToXML tool and people assignment to the roles Process model creation or import from xpd file in the Process model database Process validation and simulation All the elements of both models can be changed in the runtime without server restart F3 2 Management of distributed _ v 3 0 Distributed workflow support supported workflows v 2 52 Distributed workflow possible for Lotus Notes lusers only There are some limitations for example in synchronisation between distributed workflows F3 3 Application Server v 3 0 Every WAS supporting J2EE may be used Compatibility F3 4 File formats v 2 52 IBM Lotus Domino server installed nsf notes WP2 Business workflow technology analysis and comparison VISP Consortium Page 184 of 239 D2 2 Workflow Software Analysis and Comparison storage fascility files for the workflow engine v 3 0 As above OR Java files and xml F3 5 Transaction mechanisms v 2 52 Uses native Lotus Notes mechanisms v 3 0 Own built in F3 6 Supported communication INRPC TCP SMTP protocol F3 7 Users roles Role assignment in the Organization model database system roles ACL are assigned by administrator by means of Administrative too
14. In Chapter 3 it has been performed an overview of different methodologies applied for the evaluation of the software products The goal of this chapter is to motivate a common methodology which can be applied for the comparison of relatively different workflow software products Particularly the interested set of products for the VISP project are those software suits which concern the modelling specification and execution of activities related to workflow management processes Despite the particular domain of application these software products respect common requirements needed from various program products Taking into account the overview in Chapter 3 of the available and used approaches for evaluation of software products this development is targeting a minimization of the subjective influences which the experts can introduce by choosing their own evaluation scheme and by grouping a corresponding set of criteria Taking into account the overview of the recommended criteria for software evaluation this work tries to find a common basis to assess the prospective products which can be used for the developments in the VISP project The overview in chapter 3 demonstrates that there are several approaches in applying methodologies for assessment of software products 3 3 1 3 3 5 Particular attention is done for those methodologies which address information systems and products which commonly operate in global network environment and Inter
15. Simulation and Debugging Simulate process execution using sample data Set breakpoints step through or run the process Remotely debug a process running on the server Process Deployment Deployment wizards guide the user to provide endpoint references for services used in the designed process A process deployment descriptor provides error free techniques for binding your services Process is automatically deployed to the appropriate server location within a package that contains all required files In ActiveWebflow one can build two kinds of business processes Abstract and Executable The following Figure 4 4 shows that one can start the process either by using WSDL files in existence or by building an abstract BPEL process first and then create the WSDL files for it WP2 Business workflow technology analysis and comparison VISP Consortium Page 74 of 239 D2 2 Workflow Software Analysis and Comparison Define your services WSDL PortTypes interfaces poan WEDL Maen your messages Tee Process Figure 4 4 Creating processes Interfaces according to Workflow Reference Model 4 5 Interface1 ActiveWebflow Designer provides interfaces at key process definition points e Create new BPEL activities via drag n drop from business operations defined in Web Services Description Language WSDL files e Generate BPEL specific WSDL extensions for Partner Link Types e Generate
16. Study Privately as Get A Job Career Started Begin My Career Attend University Study Privately Ka B gt gt lt m Read A Bool Knowledge Gained Feel Smarter Attend University Decorate Atomic Task Begin My C a x Join Decorator Split Decorator O NoJoin Or Join NoSplit C Or Split Enroll Do Sub And Join Xor Join And Split Xor Split North East gt South Select a number of net elements to manipulate Done Figure 4 27 YAWL Editor What is the YAWL Worklet Service The Worklet Dynamic Process Selection Service for YAWL provides the ability to substitute a workitem in a YAWL process with a dynamically selected worklet a discrete YAWL process that acts as a sub net for the workitem and so handles one specific task in a larger composite process activity An extensible repertoire or catalogue of worklets is maintained Each time the service is invoked for a workitem a choice is made from the repertoire based on the data within the workitem using a set of rules to determine the most appropriate substitution The workitem is checked out of the YAWL engine and then the selected worklet is launched as a separate case The data inputs of the original workitem are mapped to the inputs of the worklet When the worklet has completed its output data is mapped back to the origi
17. The importance of Workflow Automation is presented in Chapter 2 In Chapter 3 are presented suits for Workflow Automation A kind of evaluations of workflow software products based on workflow pattern is described in Chapter 3 Here are presented sets of evaluation criteria used for assessment of software products which unfortunately do not cover the versatile characteristics of the workflow software but they are found as a state of the art cases available now As the list of the available software includes more than 134 products which have a different stage of maturity and application in Chapter 4 it is described the architecture interfaces supported standards of the 19 most developed now and appropriate for VISP project Workflow software products These products are included in a so called short list and tested by the consortium members As unfortunately the evaluation criteria used for the software products presented in Chapter 3 do not cover the versatile characteristics of the workflow software in Chapter 5 it is proposed another methodology WP2 Business workflow technology analysis and comparison VISP Consortium Page 12 of 239 D2 2 Workflow Software Analysis and Comparison for evaluation which applies the standard ISO IEC 9126 for the quality of software products A template for the evaluation of the workflow software products by the VISP partners based on ISO IEC 9126 requirements is developed here The results from th
18. WP2 Business workflow technology analysis and comparison VISP Consortium Page 46 of 239 D2 2 Workflow Software Analysis and Comparison MQSeries Workflow MQSeries Workflow IBM99 is the successor of IBM s major workflow offering FlowMark FlowMark was one of the first workflow products that were independent from document management and imaging services It has been renamed to MQSeries Workflow after a move from the proprietary middleware to middleware based on the MQSeries product The evaluation here is based on version 3 1 Figure 3 16 shows the sample process introduced in Figure 3 10 implemented as an MOQSeries Workflow process model Activity Block PS gm PN O 0 Q V Ya Vl A E pes a sa E Pa N AN bB Figure3 16 Sample process model implemented with MQSeries Workflow Verve Verve Ver00 is a relative newcomer to the workflow market as it made its debut in 1998 In late 2000 it was acquired by Versata and renamed Versata Integration Server VIS The evaluation here is based on version 2 0 of the product What makes it an interesting workflow product is that it has been designed from the ground up as an embeddable workflow engine i e a workflow engine that can be embedded in other applications rather than used as a stand alone product The sample process introduced in Figure 3 10 implemented with Verve is shown in figure 3 17 A Activity C aN T Q Activity D O CDRS End
19. ZIN Information Society Technologies Project no FP6 027178 VISP Virtual ISP Instrument STREP Thematic Priority IST FP6 D2 2 Workflow Software Analysis and Comparison Due date of deliverable 28 February 2006 Actual submission date 27 March 2006 Start date of project 1 November 2005 Duration 32 months Editor Todor Stoilov ICCS Contributors Benoit Gaillard Valtech Boriana Vachova ICCS Dana Petcu WUT Daniel Pop WUT Elena Ivanova ICCS Elisaveta Trichkova ICCS Florin Fortis WUT Francesco Fornasari Metaware Klaus Peter Eckert FhI Fokus Krasimir Trichkov ICCS Krasimira Stoilova ICCS Krzysztof Samp UAM Martin Tsenov ICCS Moritz Riisch FhI Fokus Rafal Renk UAM Simeon Cvetanov ICCS Todor Stoilov CCS Yuri Glickmann FhI Fokus Revision 1 0 Project co funded by the European Commission within the Sixth Framework Programme 2002 2006 Dissemination Level PU Public X PP Restricted to other programme participants including the Commission Services RE Restricted to a group specified by the consortium including the Commission Services CO Confidential only for members of the Consortium including the Commission Services D2 2 Workflow Software Analysis and Comparison Audience This document is public and is intended to the following audience e VISP partners e WP03 WP10 members to carry o
20. 20 2 8 III Pie Charts Functionality Reliability Usability 0 0 25 12 0 25 40 75 63 Efficiency Maintainability Portability 0 0 20 a j 20 0 ETA 20 20 OWeak BGood OStrong OCan t assess Figure 6 10 Pie charts for EnterpricseXtention s characteristics WP2 Business workflow technology analysis and comparison VISP Consortium Page 186 of 239 D2 2 Workflow Software Analysis and Comparison Principal Functions F1 Modelling process definition Using Taverna s Workbench F2 Simulation debug Freefluo I Functionality Fct no Function name Function implementation F2 1 Objects definition simulation arrival profile access data process simulationto construct complex The simulation can be done only using the Taverna workflow system The Taverna Workbench allows users simulations from components located on both remote and local machines run these workflows on their own data and visualize the results F2 2 Process initialization service time profile Inecessary resources available resources child INot applicable F2 3 Event description simulation event lobject simulation arrival generation definition of INot applicable F2 4 Junction description and lor x or symbol simulation outflow INot applicable F2 5 Links probability type simulation Not applicable F2 6 General conditions sim
21. Information Systems Vol 24 8 1999 Aalst et al 2000 W M P van der Aalst A H M ter Hofstede B Kiepuszewski and A P Barros Advanced Workflow Patterns In O Etzion and P Scheuermann editors 7th International Conference on Cooperative Information Systems CoopIS 2000 volume 1901 of Lecture Notes in Computer Science pages 18 29 Springer Verlag Berlin 2000 Aalst and Hee 2002 W M P van der Aalst K M van Hee Workflow Management Models Methods and Systems MIT press Cambridge MA 2002 Aalst et al 2002 W M P van der Aalst M Dumas A H M ter Hofstede and P Wohed Pattern Based Analysis of BPML and WSCI QUT Technical report FIT TR 2002 05 Queensland University of Technology Brisbane 2002 Aalst et al 2003 W M P van der Aalst A H M ter Hofstede B Kiepuszewski and P Barros Workflow patterns Distributed and Parallel Databases 14 1 5 51 2003 Ader 2004 Ader M Workflow and Business Process Management Comparative Study 2004 Andrews 2003 Andrews T F Curbera H Dholakia Y Goland J Klein F Leymann K Liu D Roller D Smith S Thatte I Trickovic and S Weerawarana Business Process Execution Language for Web Services Version 1 1 2003 Technical report Accessed at http xml coverpages org BPELv11 May052003Final pdf Axis Apache Axis project available at http ws apache org axis Belyk and Feist 2002 Belyk D and D Feist 2002 Software Evaluation Criter
22. Interface 4 Cape Clear 6 5 supports workflow collaboration as the process is seen as a web service it can be re used by any of other workflow systems supporting web services Moreover it s very easy to design an orchestration with the graphical process designers starting from the WSDL of collaborated workflows Each partner can be identified by a given color in the diagram which helps a lot for readability Interface 5 Monitoring business process can be done by the web application provided by Cape Clear Orchestration manager The access to the application is secured by a login password It gives a lot of information about processes running processes instances The server itself provides support for JMX and SNMP It also provides a web based application for the server administration Cape Clear Manager for stats platform information web services administration etc Additional interfaces Cape Clear provides support for long running transactions by de re hydrating the process instances The status of running workflows can be stored in database to save memory and then brought back in the engine for execution Cape Clear only supports Oracle SQL server or any JDBC aware databases Cape Clear 6 5 also provides a support of UDDI It is possible to retrieve a WSDL file by requesting a UDDI directory using a contextual tool i e a search engine The following diagram excepted from a Cape Clear webminar illustrates the possibilities
23. The workflow software products have been evaluated and compared between each other for the appropriate functional category Modelling tools conform to other standards BPMN UML than workflow orchestration tools They are included in additional category Thus three different comparisons have been applied relating to the functional category of the product Appropriate diagrams are designed These diagrams demonstrate the advantages of a chosen product in comparison with its corresponding functional peers Following this decomposition scheme and giving importance to the functional quality of the products the assessment of the products are performed for four groups of products presented in the table below WP2 Business workflow technology analysis and comparison VISP Consortium Page 216 of 239 D2 2 Workflow Software Analysis and Comparison Table 6 1 General workflow functionality decomposition of the products Categories Workflow Software Products Modelling Tools Borland Together Designer Process Modeler UML Modelling Tools Workflow Editors ActiveWebflow Designer Cape Clear con cern enterprise Xtention Enhydra JaWE JBoss jBPM ObjectWeb BONITA OpenWFE Oracle BPEL Process Manager SAP NetWeaver Exchange Infrastructure YAWL Workflow Engines ActiveBPEL Engine ActiveWebflow Standard Biztalk Server Cape Clear con cern Enhydra Shark enterprise Xtention Freefluo JBoss jBPM ObjectWeb BONITA
24. appropriate external metrics and acceptable levels of the metrics are specified to appropriate quantitative values If the criteria achieves these values this validate that the software meets the user requirements Then the internal quality attributes of the software are specified by means to achieve the required external quality characteristics Appropriate internal metrics and acceptable levels are specified which quantify the internal quality characteristics that the software has to meet as internal quality during its development Quality in use metrics Quality in use metrics assesses the extent to which a product meets the requirements of specified user group by means to achieve specified goals of effectiveness productivity and satisfaction in an application context of the users The assessment of the quality in use validates the software quality in specific user task scenarios Quality in use is the user s view of the quality for the system applying the software The quality in use is measured in terms of the results when the software is used rather than properties of the software itself The quality in use represents the integral effect of the software quality in a practical user application The relationship of quality in use criteria to the software quality characteristics depends on the type of user e the quality in use for the end user is mainly a result of functionality reliability usability
25. either until or for an amount of time can be defined in months days hours F1 4 Flowline Flow lines cannot be parameterized They only define a possible path for the business process F1 5 Definition of organizational units The scope activity is a good way to define sub process You can then define events handlers and Fault handlers for the sub WP2 Business workflow technology analysis and comparison VISP Consortium Page 168 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation process However it is not possible to reuse a defined scope F1 6 Junctions Flow controls are the following Switch case and otherwise this is used to perform an if else if control First the switch activity must be dragged in the process window It defines by default a Case activity and an Otherwise activity One can specify as many case activities as one wants The evaluation is made for every Case statement until one return true then the sequence of activities defined in case statement is processed If no evaluation statement returns true then the sequence of activities in the Otherwise node is processed F2 Simulation debug F2 1 Objects definition simulation Cape Clear 6 5 does not provide Debugging arrival profile access data support However it is possible to change the sim
26. have for placing this information on the Net Frequently the answer is that the information is placed to advertise or support a particular point of view Authority Does the product have some reputable organization or expert behind it Does the producer have standing in the field Are sources of information stated Is the information verifiable Can the producer be contacted for clarification or to be informed of new information Currency How frequently is the product is updated or is it a static product Are dates of update stated and do these correspond to the information in the product Does the organization hosting the product appear to have a commitment to ongoing maintenance and stability of the product WP2 Business workflow technology analysis and comparison VISP Consortium Page 49 of 239 D2 2 Workflow Software Analysis and Comparison Uniqueness Is the information for this product available in other forms for example other sites WWW print CD ROM What advantages does this particular product have If the product information is derived from another format for example print does it have all the features of the original Have extra features been added Does it complement another resource for instance by providing updates to a print source Links made to other resources If the value of the product lies in its links to other resources are the links kept up to date and made to appropriate products Are the links ma
27. transitions between activities and the conditions that enable or disable them during workflow execution JaWE has three types of transition simple self routed and circular F1 2 Process description major minor At package level user can choose among several XPDL views graphical text and xpdl view which represents the XPDL as it will be saved into file Graphical view of package level is divided into some parts Left side of the main window shows Package Hierarchy Tree Root of the tree is main package and branches are imported external packages If these external packages have their own external packages they are shown in the tree too Since all packages have unique IDs circular references are allowed though tree expansion will stop on package which is displayed before Right side of the main window displays workflow processes defined in package which is selected on the hierarchy tree Processes are presented only symbolic with not so many information about process and with no graphical layout of process elements activities and transitions Double click on any process will open workflow editing window Process level The actions represented by buttons are applied to the currently selected package within the package hierarchy tree Other parts of Package level are title bar menus few toolbars status bar and tabs for selecting package view The second part of JaWE is Process level which is some kind of
28. two activities with an arrow Figure 3 1 In MQ Workflow this construct is achieved by connecting two activities with a control connector Figure 3 2 Pattern 2 Parallel split This pattern defines a point in a process which is split into several threads of control all executed in parallel and whereas the order in which they are processed is not defined In i Flow this pattern can be achieved by using the AND Node as shown in Figure 3 3 In MQ Workflow this construct is achieved by having multiple outgoing control connectors from one activity if the control connectors do not contain transition conditions they are by default all enabled which means that all branches will be activated Figure 3 4 In MQ Workflow no explicit control flow nodes exist instead control flow constructs are implemented using transition conditions on the control connectors arrows WP2 Business workflow technology analysis and comparison VISP Consortium Page 37 of 239 D2 2 Workflow Software Analysis and Comparison Administrators Administrators Action 1 requestF orQuote Figure3 1 Workflow Pattern 1 Sequence in i Flow mw _ a a a a Request for Quote Quote Figure3 2 Workflow Pattern 1 Sequence in MQ Workflow Pattern 3 Synchronization A point where multiple parallel sub processes converge into one thread whereas each incoming branch is executed only once In i Flow the AND node is used to merge any number of incomin
29. 0 0 m j 60 GWeak m Good O Strong O Can t assess Figure 6 13 Pie charts for BONITA s characteristics WP2 Business workflow technology analysis and comparison VISP Consortium Page 199 of 239 D2 2 Workflow Software Analysis and Comparison Principal Functions F1 Modelling process definition OpenWFE I Functionality Fct no Function name Function implementation F1 1 Process chart definition OpenWFE has its own Process Definition Language process thread stored as XML structure OpenWFE gives possibility to define business process in three manner e directly by editing XML files e using visual builder through web browser Droflo application e using visual builder running as Eclipse plug in F1 2 Process description major Each process in OpenWFE is defined in different XML minor file in stored in workflow definitions dir It is possible to define processes and subprocesses using process definition and subprocess tags It is possible to include definitions of processes from other files To define the whole business process a designer has to e define participants e create workflow definition describing the flow of the information between participants e create stores usually one per participant e create users and give them rights to launch the flow edit parameters proceed and delegate workitems F1 3 Event initial result triggering process thread event re
30. 3 12 3 13 3 14 3 15 3 16 3 17 3 18 3 19 3 20 3 21 3 22 3 23 3 24 3 25 3 26 3 27 3 28 3 29 3 30 3 31 3 32 3 33 3 34 3 35 http wfmc org http wfmc org standards model htm http www wfmc org standards docs TC 1025_10_xpdl_102502 pdf http www jcp org en jsr detail id 207 http www bpmi org http ebxml org specs ebBPSS pdf http www bpmi org http www 128 ibm com developerworks library specification ws bpel http www 128 ibm com developerworks webservices library ws bpelj http www omg org docs formal 00 05 02 pdf http www uml org http www rosettanet org RosettaNet Public PublicHomePage http www oasis open org committees tc_home php wg_abbrev ubl http en wikipedia org wiki Workflow http en wikipedia org wiki W orkflow http www manageability org blog stuff workflow_in_java view http www gripopprocessen nl index php id 35 amp no_cache 1 http java source net open source workflow engines http e docs bea com wlintegration v2_1 interm bpmhome htm http www camot usa com http www dralasoft com products workflow http www filenet com http www fsw fujitsu com products InterstageSuite BPM overview html http www 128 ibm com developerworks ibm library i holo http www intalio com products index html http www lombardisoftware com http oakgrovesystems com http www oracle com index html http www qlinktech com http www sap com so
31. 3 3 5 General Software Evaluation Criteria 0 0 0 eeeceeesecescceeeecececeeeeceeeceseceeeeeeeceseeeseeess 55 3A CONCIUSIONS aeinn anun a ea a Eaa EEEE A a RE AS 60 4 Survey of Software Products Supporting Workflow Management ee 61 AT Active BPEL Engines 0 c scccccccctscsevesssanscceseecocnseshsuaecdeiesagnevonsnoacessrsecnetesasbotecdserotanens 66 AD ActiveWebilow M Standard eriseeria tecen n eei aa aaie en eaae 67 4 3 ActiveWebflow Professional Designer esesseeesesseseesesressresresresressrssrerressessesseee 71 4A Biztalk Serye brenan reee esate sncse divas gacee Ateors aces E E EAE 74 4 5 Borland Together Designer 2006 00 ec eeceeecceseceseceeseeeseceseeesceceeeceseceeeeceneeeeeeseeess 77 A 6 Cape Clear 6 Jaon sea edecs deceeoepisastacsndcgersichgy a E Aa ob EEEE aiiai 79 ATs LG Ons Cerny EE TR cess EE E oe Sov ons tote E ETE O E 82 4 8 Enhydra Jaw E erori a i eee EE R bbs seta yos R ia aE i e 84 4 9 Enhydra Shark Java Open Source XPDL Workflow seseceeesereeeeeerrererrersssn 88 4 10 Enterprise Xtention sisanra E E E E E a 91 N OE EE a LOA E E E E EEN E E teas 93 4 12 JIBOSSJBPM iis nnr r e a N A NE A ET 96 41S ObjectWeb BONITA oireina ra E E E a E E E 99 414 Open WFE caninu annasa a a EEE aa E ana E E EEA R 102 4 15 Oracle BPEL Process Manage lt isvesctcadazexbs ndst sortaa ea re EN aE e E ete 103 4 16 ITP Commerce Process Modeler for Microsoft Visio s es 107 4 17 SAP NetW
32. An example of a graph is given in Figure 4 16 All these three files are enclosed in a Process Archive par file The code It s just all the Java code that will implement your tasks defined in the jPDL file and make you go forward on your graph The graph editor enables you to choose which class is going to implement a Task or a transition just by right clicking This is possible due to interfaces defined in jBPM that classes must implement for instance ActionHandler Building application on top of Java systems makes it very easy to integrate and deploying over J2EE gives a lot of possibilities in terms of interactivity with the outside world web services for instance As some transactions can take a lot of time for example waiting for a client interaction or shipping task jBPM stores the definition the execution instance of a definition and the logging in a database jBPM supports the main database systems such as MsSQL MySql Oracle Default database used is hqsldb Hypersonic as it can run in an in memory mode WP2 Business workflow technology analysis and comparison VISP Consortium Page 97 of 239 D2 2 Workflow Software Analysis and Comparison that does not write anything on disk and whose schema is always fresh as it s rebuilded every time it s deployed One more interesting thing is the integration of Hibernate 3 0 This means that hibernate is responsible for the conversions betwee
33. BPEL specific WSDL extensions for message properties and property aliases Interface2 ActiveWebflow Designer generates a bpel file from the created diagram and generates wsdl file for the diagram itself 4 4 Biztalk Server Workflow software overview BizTalk Server is an Integration Server product used to connect different applications systems or business processes within an organization or between organizations Itis also used to aggregate services to build a Service Oriented Architecture SOA Category of the software product BizTalk 2006 provides a full environment for modelling and processing orchestration processes This environment relies on other Microsoft products such as Visio for the process modelling Supported interfaces Interface 1 It is possible to import BPEL definitions in BizTalk Server 2006 It provides full support to XLANG Microsoft business process definition language WP2 Business workflow technology analysis and comparison VISP Consortium Page 75 of 239 D2 2 Workflow Software Analysis and Comparison Interface 2 Clients can be of various kinds Net client any client aware of Web Service if the business process is deployed as such mail clients Interface 3 BizTalk provides a suite of adapters to integrate various application types Net applications SAP MSMQ Oracle Applications PeopleSoft Interface 4 A process deployed on BizTalk can be part of a collaboration workf
34. Page 18 of 239 D2 2 Workflow Software Analysis and Comparison Commercial Workflow Systems CARNOT Versata lt i Netsca BEA PI Pavone Domino Workflow NCR ProcessiT Exotica 1 III C FlowMak MQSeries Workflow IBM WebSWF COpenPM_ C_Flowjet_ CRaminFlow gt Changengine SNI WorkParty Recognition Int COSA Ley COSA Digital Objectflow Oracle Workflow DEC LinkWorks Forte Conductor AltaVista Proc Flow Beyond BeyondMail Banyan BeyondMail Fujitsu Flow 4Cinterst BPM a am am a Fujitsu Regatta j Z 5 Teamware Flow JCALS WANG Workflow BlueCross BlueShield Lucent Mosaix Visualinfo DST AWD ImagePlus FMS FAF FileNet WorkFlo Visual WorkFlo _ Panagon WorkFlo f FileNet Ensemble Action Coordinator C Ee ActionWorkflow ActionWorks Metro Xerox InConcert TIB inConcert IABG ProMinanD Office cientific Workflow Systems Orica Officetalk Zero 1980 1985 1990 1995 2000 Figure 2 1 History of Office Automation and Workflow Systems Copied from zur Muehlen 2004 WP2 Business workflow technology analysis and comparison VISP Consortium Page 19 of 239 D2 2 Workflow Software Analysis and Comparison languages such as BPEL4WS WSFL XLANG WSCTI and BPML Development with respect to web services composition languages have been mainl
35. Receive activity the second marks a time out event which is trigger after a given time Control Switch Case Otherwise all three to implement a TIf Then Elself Else structure While and Wait Fault Throw throws an error Catch catch faults and CatchAll catch faults not previously caught Terminate terminates the process instance Other Assign Copy Assign is a combination of Copy activities to handle local variables values Sequence Empty Scope defines a sub process F1 2 Process description major minor Processes can be of two types e Invoke receive and reply messages this can be achieved in two ways either drags and drops an external operation from the partner link container into the designer panel or drags and drops the appropriate activity in the diagram and chooses the correct parameters e Handling data this is done with the assign Activity It s possible to assign a local variable from an expression literal data incoming messages Inside the same assign activity can be processes multiple copies F1 3 Event initial result triggering process thread event result correlation Events are defined in the Event view of the process designer Events can be of two types e OnMessage the diagram process defined in the event handler is processed when the defined message is triggered This can be used when a user wants to cancel the current task e OnAlarm an alarm is armed
36. Software Analysis and Comparison F2 Simulation debug F2 1 F2 6 Not Applicable F2 7 DEBUGGING Workflows may be run in debugging mode In this mode the activities assume some additional intermediate states Note that the associated state transitions are neither recorded nor distributed as state change events Wf MOPEN supports the debug mode it has been designed to run the workflow in a way that resembles the normal execution as closely as possible The debug mode is not a simulation It can best be compared to running a program in a debugger i e the workflow is really executed There are however predefined break points and the invocation of tools may be simulated instead of actually performed Breakpoints are applied to monitoring effects on state changes exceptions and deadlines F3 Execution workflow engine F3 1 Processes Deployment initialization repositories The WfMCore workflow engine component is capable of managing an unlimited number of process definitions at a time When a new process definition file is imported all currently managed descriptions with the same package id as the imported package regardless of the process name are removed from the process definition directory before adding any new process definition Replacing a process definition with another version or removing a process definition does not affect running processes Once created a process remains inseparably associated with the p
37. WP2 Business workflow technology analysis and comparison VISP Consortium Page 193 of 239 D2 2 Workflow Software Analysis and Comparison 20 0 j 40 0 40 50 50 20 0 II Pie Charts Functionality Reliability Usability 25 25 13 25 50 43 Efficiency Maintainability Portability Principal Functions 20 20 20 0 40 40 GWeak BGood OStrong O Can t assess Figure 6 12 Pie charts for JBossjBPM s characteristics ObjectWeb BONITA I Functionality F1 Modelling process definition Fct Function Function implementation no name F1 1 Process chart Terminology in BONITA definition A process is a set of activities In BONITA the term project is also process thread used An activity is an atomic unit of work In BONITA activities are also termed Nodes A transition is a dependency expressing an order constraint between two activities In BONITA transitions are also termed Edges A property is a workflow unit of data commonly known as workflow relevant data A hook is a user defined logic adding automatic behaviour to activities nodes A mapper is a unit of work allowing dynamically roles resolution at workflow instantiation time A performer assignment is a unit of work adding additional activity assignment rules at run time F1 2 Process Process WP2 Business workflow technology analysis and comparison VISP Consortium Page 194
38. YAWL engine deals with control flow and data but not explicitly with users In addition the engine abstracts from differences between users applications organizations etc To achieve this the YAWL system leverages principles from service oriented architectures external entities either offer services or require services In a traditional workflow management system the engine takes care of the What When How and By whom In YAWL the engine takes care of the What and When while the YAWL services take care of the How and By whom By separating these concerns it is possible to implement a highly efficient engine while allowing for customized functionality It should be noted that the architecture of YAWL is similar to the architecture envisioned in the context of web service composition languages like BPEL4WS WSCTI BPML etc However these languages typically only WP2 Business workflow technology analysis and comparison VISP Consortium Page 213 of 239 D2 2 Workflow Software Analysis and Comparison Fct Function name Function implementation no consider control routing and data transformations while YAWL is not limited to these aspects and addresses issues such as work distribution and management F1 6 Junctions The YAWL supports AND OR XOR splits and joins of tasks F2 Simulation debug F2 1 Objects definition
39. advertise or support a particular point of view Authority Does the resource have some reputable organization or expert behind it Does the author have standing in the field Are sources of information stated Is the information verifiable Can the author be contacted for clarification or to be informed of new information Uniqueness Is the information in this resource available in other forms for example other sites print CD ROM What advantages does this particular resource have If the resource is derived from another format for example print does it have all the features of the original Have extra features been added Does it complement another resource for instance by providing updates to a print source Links made to other resources If the value of the site lies in its links to other resources are the links kept up to date and made to appropriate resources Are the links made in such a way that it is clear that an external site is being referred to There are potential copyright issues with sites that for instance enclose an external link in frames so that the source of the information is unclear Quality of writing Is the text well written While hypertext linking and multimedia are important elements of the Web the bulk of the information content on the Web still lies in text and quality of writing is important for the content to be communicated clearly Graphic and multimedia design Is the resource interesting to look
40. an appropriate set of functions for specified tasks and user objectives Weak O Good O Strong v Not applicable can t assess O Comments BPEL 1 1 implementation with strong extensions 2 Accuracy the capability of the software to provide the right or agreed results or effects Weak O Good O Strong v Not applicable can t assess O Comments Correct BPEL 1 1 implementation 3 Interoperability the capability of the software to interact with one or more specified systems Weak O Good Y Strong O Not applicable can t assess O Comments Further evaluation necessary 4 Security the capability of the software to protect information and data so that unauthorized persons or systems cannot read or modify them and authorized persons or systems are not denied access to them Weak O Good O Strong O Not applicable can t assess Comments 5 Compliance the capability of the software to adhere to application related standards conventions or regulations in laws and similar prescriptions Weak O Good Y Strong O Not applicable can t assess O Comments Compliant to BPEL 1 1 WSDL 1 1 but with proprietary extensions By making a relative assessment of this software product the vector evaluation for the category functionality is FUNCTIONALITY 2 from 5 strong 2 from 5 good 1 of 5 can t assess or these evaluation findings can be expressed in percentage in vector form as FUNCTIONALITY 0 wea
41. and and deviation from workflow exchange formats standards Functionality to model complex workflows Supported user interfaces lightweight browsers or heavy user clients Workflow execution tools support and deviation from workflow standards needed technical environment Required software product application servers WP2 Business workflow technology analysis and comparison VISP Consortium Page 136 of 239 D2 2 Workflow Software Analysis and Comparison Cat Function Fct Function name Function implementation no category no supported communication protocols transaction mechanism bindings i Functionality Implementation of Functions Principal Functions Function Function name Function implementation category Modelling Process chart Explanations how the process chart are process definition process configured as a network of processes definition thread free text if applicable Process description Presentation of the functionality of the major minor processes objects and their attributes free text if applicable Event initial result Presentation of the functionality of event triggering process categories free text if applicable thread event result correlation Flowline Presentation and functionalities of flow lines free text if applicable Definition of Presentation and functionality of organizational units organizational units and how they relate to the processes chart f
42. application is deployed on a suitable platform For instance lyou can interact with the application with a HTML browser if your application is available on a Web Application Server You can also use heavyweight clients with Swing lor whatever client you want as long as your application as the appropriate connector to interact with WP2 Business workflow technology analysis and comparison VISP Consortium Page 191 of 239 D2 2 Workflow Software Analysis and Comparison F5 Integration with other workflow engines Supported standards F5 1 Possibilities for jBPM has been developed to run jPDL process charts collaboration with other Though it is possible to run BEPL process diagrams That is workflow engines possible by adding a plugin It is important to say that standards IBEPL will be soon executed in native in the upcoming releases of jBPM F6 Administration and monitoring F6 1 Life cycle Time scheduling is available via a Scheduler component Imanagement provided A timer that is specified on a node is not executed after the node is left Both the transition and the action are optional When a timer timer is executed the following events occur inl sequence e an event is fired of type timer e if an action is specified the action is executed e if a transition is specified a signal will be sent to resume execution over the given transition Every timer must have a unique
43. are provided if necessary Directions are clear and easy to follow The links to other pages within the site are helpful and appropriate Internal and external links are working properly no dead ends no incorrect links etc Use of multimedia e Each graphic audio file video file etc serves a clear purpose e The graphics animations sounds clips etc make a significant contribution to the site Browser compatibility site is equally effective with a variety of browsers such as Netscape and Internet Explorer Content Presentation WP2 Business workflow technology analysis and comparison VISP Consortium Page 55 of 239 D2 2 Workflow Software Analysis and Comparison There is sufficient information to make the site worth visiting The information is clearly labeled and organized The same basic format is used consistently throughout site Information is easy to find no more than three clicks for example Lists of links are well organized and easy to use Currency e The date of last revision is clearly labeled Date last revised e Out dated material has been removed Availability of further information e A working link is provided to a contact person or address for further information e Links to other useful Web sites are provided 3 3 5 General Software Evaluation Criteria General requirements for evaluation of software without respect of the software nature has been summarized in EC founded proje
44. be reused in new composite applications Server Enterprise class configuration based service mediation capabilities such as transformation and routing to ensure loosely coupled flexible applications Support for multi protocol messaging and routing Deploy Cape Clear Server to various applications servers or standalone Supports the latest security standards like WS Security and SAML Orchestrator Framework and tooling for orchestrating services into automated WP2 Business workflow technology analysis and comparison VISP Consortium Page 80 of 239 D2 2 Workflow Software Analysis and Comparison business processes Cape Clear Orchestrator includes a graphical Eclipse based framework for designing and constructing workflows and service orchestrations using BPEL 1 1 Long running business processes are supported through automatic data persistence and message correlation A browser based console offers detailed management and monitoring of deployed processes Studio Unified LEclipse based environment supporting the end to end Se of SOA based applications Cape Clear Studio incorporates an integrated environment to test your services and processes In addition JUnit is bundled with Studio for off line automated testing Configure and manage servers within Cape Clear Studio One click package and deploy and hot re deploy of services to the Cape Clear runtime is provided Remote deployment is also fully sup
45. but the subproject was stopped Currently it is not possible to exchange process model with other PDLs Interface 2 There are three implementations of worksession interface RMI REST and SOAP The REST interface can be accessed by python application using the Pyya python library NET applications using the library written in C can be compiled as a DLL Perl application using the OpenWFE Perl module Interface 3 The administration tool is available through the web interface The chosen user can monitor the workflow and participants stores change the work items delegates work items to other participants of the workflow The user can also look at the history of the workflow process Additional interfaces By default OpenWFE stores all data in files It is possible to store whole xml files in database or LDAP There are currently 2 implementations of a Workitem Store one that keeps items in files and one that store them in a relational database system MySQL and PostgreSQL for instance or any SQL 92 compliant DB The Participant Map is by default an XML file but it can easily be implemented as an LDAP directory 4 15 Oracle BPEL Process Manager Introduction Oracle BPEL Process Manager implements the BPEL4WS specification version 1 1 4 14 together with a series of extensions that are partially related to the upcoming BPEL specification version 2 0 4 15 As depicted in Figure 4 20 4 16 it consists of four build
46. drop elements to a BPMN diagram and set after that their properties in a special window Together supports BPMN with some minor changes related to mapping BPMN to BPEL Together provides support for the most frequently needed diagrams and notations defined by the UML 1 4 It supports the following UML diagrams e Component diagram e Use case diagram e Deployment diagram e Activity diagram e Sequence diagram e Collaboration diagram WP2 Business workflow technology analysis and comparison VISP Consortium Page 165 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation e Statechart diagram e Class diagram includes packages Together also provides support for the most frequently notations defined by the UML 2 0 and supports the following diagrams e Activity e Class e Component e Deployment e State Machine e Composite structure e Use case e Interaction Sequence and Communication Diagrams F2 Simulation debug F2 1 Objects definition simulation arrival profile Borland Together Designer 2006 access data simulation process provides a special view for the F2 2 Process initialization service time profile BMPN validation After the necessary resources available resources child validation the tool creates a list of diagram problems with information about F2 3 Event description simula
47. editing window This part of JaWE is used for graphical representation of process definition and for defining attributes of entities on that level WP2 Business workflow technology analysis and comparison VISP Consortium Page 177 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation When selected Graph view the main portion of workflow editing window takes working area Here user insert visible objects and adjust them First thing drawn must be a participant When at least one participant is made visible user can insert other elements These elements are activities and transitions e Atomic activities Generic Subflow activity Block activity e Route activity Route activity does not implement any action It is used for synchronization and conditional branching so it shares common attributes with generic JaWE has three types of transition simple self routed and circular F1 3 Event initial result triggering process thread event result correlation Workflow process consists of a number of workflow activities e Atomic activities Generic Majority of activities are atomic Generic Activity in which case they are the smallest units of work although even atomic activity may produce more than one work item for its performer or may invoke more than one application e Subflow activity Subflow is another activity type It implements a c
48. from a specified region The enabling of the task that will perform the cancellation may or may not depend on the tokens within the region to be canceled In any case the moment this task executes all tokens in this region are removed This notation allows for various cancellation patterns F1 3 Event initial result triggering process thread event result correlation The YAWL Engine performs the following steps 1 loads a YAWL workflow specification 2 launches a YAWL specification 3 checks out available work items 4 submits creates suspend a checked out workitem The input condition is the entry point of each process A process can be triggered by a client user or web service or by another running task either via static binding or dynamic binding worklet The data is exchanged between tasks using data elements variables defined in both tasks In order to exchange data between two tasks they have to define variables having the same name and the same data type declared as input input amp output type on one task and output input amp output type on another task F1 4 Flowline The process flow is determined at run time The graphical modelling tool generates the static structure of the interactions between tasks It is possible to modify dynamically the flow line at runtime based on some selection condition evaluation by using worklets F1 5 Definition of organizational units The
49. in terms of interfaces Figure 4 8 Supported standards Conformity to standards and exchange formats a Cape Clear 6 5 provides a full support to BPEL 1 1 specification Activities such as Invoking receiving compensation event handling flow controls are WP2 Business workflow technology analysis and comparison VISP Consortium Page 82 of 239 D2 2 Workflow Software Analysis and Comparison available in the process designer tool It supports also WS ReliableMessaging for transport reliability and recovery b Workflow execution tools support and deviation from workflow standards Technical environment is needed Required software product application servers supported communication protocols transaction mechanism bindings Applications can be deployed on jBOSS recommended by the vendor Tomcat Weblogic Websphere Jonas The communication protocols supported are summarized in Figure 4 8 SOAP and non SOAP messaging over HTTP S S FTP SMTP e mail WS ReliableMessaging WS RM File drop JMS bundled JMS server and WebSphere MQ JMX SNMP Security Msg Processing _ Hosted WS Transformations BPEL Interceptors Service Logic External Logic deplo Figure 4 8 Cape Clear 6 5 Interfaces 4 7 Con Cern Workflow software overview Con cern is a workflow engine based on an extended case handling approach 4 6 Workflow software description There are three
50. integral software quality of the product The two next sections provide e an evaluation of the functional characteristics of the products by means to identify their application classes supported standards and availability for business implementations e evaluation and appraise the products by giving scores of the software quality of the products following a methodology for multicriteria evaluation and comparisons 6 2 Functional Evaluation Of Characteristics Of Short List Products Description The functional evaluation of the short list products in alphabetical order is presented bellow The analysis is based on the assessments provided by the partners The evaluations are divided into six general criteria related to the main software quality categories functionality reliability usability efficiency maintainability and portability In this multicriteria evaluation scheme of this stage of the VISP developments the consortium gave preferences on the functional peculiarities of the products This particular weighted choice is explained with the needs of the VISP consortium to have possibility to model and to manage different web services which are targeted by the project Thus the results of the functional evaluation are provided in this chapter and the companion evaluations towards the other five criteria are provided in the annex The evaluations of the functionalities of the products have qualitative nature They explain and summary the s
51. is the Project interface can be used against a running process The Bonita system is composed of two main components or sub systems The Bonita Modelling Component The Bonita Execution Component Bonita Modelling Components Terminology A process is a set of activities In BONITA the term project is also used An activity is an atomic unit of work In BONITA activities are also termed Nodes A transition is a dependency expressing an order constraint between two activities In BONITA transitions are also termed Edges A property is a workflow unit of data commonly known as workflow relevant data A hook is a user defined logic adding automatic behaviour to activities nodes A mapper is a unit of work allowing dynamically roles resolution at workflow instantiation time A performer assignment is a unit of work adding additional activity assignment rules at run time The Workflow Modelling Component GraphEditor allows the user to represent and visualize workflow processes This tool allows the user to create and edit workflow processes using the graphical user interface Figure 4 18 Workflow processes are constructed by chaining basic functional units called Activities which can be defined and edited by the GraphEditor tool Attributes of these activities such as activity type activity description activity deadline activity role etc can be modified by the user Activities such as these can be connected using
52. logs for each bpr file for errors and warnings WP2 Business workflow technology analysis and comparison VISP Consortium Page 70 of 239 D2 2 Workflow Software Analysis and Comparison e Lists of all deployed processes with selection filters e Detailed version information including the ability to modify specific data based on the version state e g status effective and expiration dates e Detailed information regarding other artifacts deployed with process e WSDL files deployed in the BPR e Global Partner definition files deployed to the server Process Status The Process Status console pages allow to view and manage information associated with individual process instances These pages provide the ability to sort and filter the information in ways that make easier to deal with only the most relevant process information For running and completed processes the designer can use the consoles to perform the following tasks e Suspend Resume and Terminate executing processes e View the process execution state graphically hierarchically and textually e Examine the content and status of process variables activities and links For the persistent queues that allow for the re hydration of processes on server startup one can inspect the values of e Alarms events that will execute at a specific time as specified by executing processes e Receives the result of a BPEL activity or Event Handler specifying that a message is exp
53. lt 5 amp yt gt ae f x gt 5 amp y gt 7 B c KOR GSR CAND x lt 5 y lt 1 Y gt 7 x lt 5 amp y lt 7 x Ce des Le a Workflow A Workflow B Workflow C ay Figure3 9 Design patterns for the multi choice Pattern 8 Multi merge Pattern 9 Discriminator Pattern 10 Arbitrary Cycles Pattern 11 Implicit Termination Pattern 12 Multiple Instances without Synchronization Pattern 13 Multiple Instances with a Priori Design Time Knowledge Pattern 14 Multiple Instances with a Priori Runtime Knowledge Pattern 15 Multiple Instances without a Priori Runtime Knowledge Pattern 16 Deferred Choice Pattern 17 Interleaved Parallel Routing Pattern 18 Milestone Pattern 19 Cancel Activity Pattern 20 Cancel Case The workflow patterns correspond to routing constructs encountered when modelling and analyzing workflows by software products of workflow management systems However several patterns are difficult to realize using many of the workflow management systems available today Thus the pattern functionality can be into account when compare son and evaluation is performed for software workflow products The products can be checked for the presence of sequential parallel conditional and iterative routing In Aalst et al 2002 a comparison of the functionality of 15 workflow management systems using the workflow patterns as evaluation criteria is performed The evaluated products are
54. name Example of timer definition lt timer name reminder duedate 3 business hours repeat 10 business minutes transition time out transition gt lt action class the remainder action class name gt lt timer gt In this example the Action class will be executed every 10 business minutes and for 3 business hours Note that this component comes with a specific notation lt quantity gt business lt unit gt Where lt quantity gt is a piece of text that is parsable with Double parseDouble quantity lt unit gt is one of second seconds minute minutes hour hours day days week weeks month months year years And adding the optional indication business means that only business hours should be taken into account for this duration Without the indication business the duration will be interpreted as an absolute time period A timer on a task will be cancelled when the task is ended completed However it can be changed by using the cancel event attribute to task assign or task start F6 2 Supervising jBPM comes with a administration web application capabilities Process status F6 3 Flexibility to workflow Access rights participants WP2 Business workflow technology analysis and comparison VISP Consortium Page 192 of 239 D2 2 Workflow Software Analysis and Comparison F7 Other Exception handling The exception handling mechanism of jBPM only applies to java exceptions Graph execu
55. of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation description major minor Bonita supports both cooperative and administrative workflows processes These processes are mapped on three Bonita types Cooperative flexible workflow process allowing definition and execution operations just after the process is created Model workflow process which contains the workflow definition logic These projects can be instantiated by users Instance workflow process representing a specific execution of a workflow model The status of a workflow process can be controlled at definition or runtime by the workflow process administrator s Two possible statuses are allowed for a workflow process Active the workflow process could be modified or executed This is the default status for a cooperative model or instance process Hidden the process is not yet available Operations like execution cancel or termination of cooperatives and instances projects are not allowed as well as model instantiation This is the status mode which allows models modifications after those ones were instantiated Life Cycle of Process BONITA has a very simple process life cycle A process is initial one it has been created As soon as the process is in this state it can be controlled using both User API amp Project API The User API allows monitoring the execution of the process
56. order to enable flexible and highly configurable applications zur Muehlen 2004 In Jablonski et al 1996 it has been defined seven fields as the conceptual ancestors of workflow management technology office automation database management e mail document management software process management business process modelling and enterprise modelling and architecture The focus of office automation research was to reduce the complexity of the user s interface to the office information system control the flow of information and enhance the overall efficiency of the office Ellis and Nutt 1980 An overview of the historical development of office automation systems and workflow technology is given in figure 2 1 zur Muehlen 2004 While the research interest in office automation increases since middle of the 1980 the commercial exploitation of workflow technology began between 1983 and 1985 It was fostered by advances in imaging and document management technology on the one side and enhanced e mail systems that extended traditional point to point mail routing with a predefined process map on the other side From this first generation of workflow systems only few vendors are still active while the majority of the early players have been restructured through mergers and acquisitions or dropped out of the market altogether zur Muehlen 2004 The fundamental understanding of workflow management and workflow management systems
57. perform the times scheduling between the processes coordinate software applications manage the paper flow documentation within an organization This system origins since 1970s when the organization were paper based Later the workflow management moves to modern computers and IT systems As a way of bridging the gap between the two paper based and paperless WP2 Business workflow technology analysis and comparison VISP Consortium Page 28 of 239 D2 2 Workflow Software Analysis and Comparison technologies significant effort is being put into defining workflow patterns that can be used to compare and contrast different workflow engines across both of these domains Workflow systems are defined as systems that help organizations to specify execute monitor and coordinate the flow of work cases within a distributed office environment 3 1 3 1 http en wikipedia org wiki WorkflowThe Workflow diagrams rely on the use of standardized graphical notations to describe workflow structures where Business Process Modelling Notation is an example of this system The system contains two basic components e The first component is the workflow modelling component sometimes called the specification module or the build time system which enables administrations and analysts to define process and activities analyze and simulate them and assign them to people e The second component is the workflow execution component sometimes calle
58. process model starts process instances creates activities and changes statuses for activities marked as done by users 6699 The engine is implemented as an agent in Lotus Notes database It runs every n minute the default setting is 5 minutes interval and searches for activities that are ready to process by the engine A separate element of the engine is Access Flow module to update access control list of the documents involved in the processes User Interface for accessing activities is implemented for Lotus Notes Clients and contains a user activities worklist view which shows activities to be performed by the user Every activity is displayed with tools defined in model Authorized users with higher access can inspect flow of processes that they had taken in part User interface is integrated with document repository to display documents associated with current activity Documents can be organized into projects and folders in another module X File Category of the software product The main functionalities of X Flow include Y Modelling validating and simulating processes Y Modelling of the organization structure chart to resolve workflow participants according to their functional or hierarchical roles or organization units or to resolve possible proxies for main participants Processing and monitoring Business process instances Delivering activities workitems to the workflow participants via worklist or directly t
59. score ISO IEC 9126 assess result Functionality 20 60 20 4 Reliability 50 50 3 Usability 62 5 37 5 4 75 Efficiency 33 67 1 32 Maintainability 40 20 40 1 6 Portability 20 40 40 4 4 II Pie Charts Functionality Reliability Usability 0 60 50 Efficiency Maintainability Portability B0 GWeak m Good O Strong O Can t assess Figure 6 5 Pie charts for Borland Together Designer s characteristics WP2 Business workflow technology analysis and comparison VISP Consortium Page 167 of 239 D2 2 Workflow Software Analysis and Comparison Principal Functions Cape Clear I Functionality F1 Modelling process definition Fct no Function name Function implementation F1 1 chart process Process definition thread CapeClear 6 5 provides a very handy graphical BPEL process designer Both text and graphical versions can be displayed Three different views are available in the designers the activity view where the main process is defined the faults view where fault handlers are defined and the Event view Many activities are available for defining a business process Those are grouped in four categories Communication activities available are Receive Invoke Reply Pick defines possible sequences for a list of events when one of an event is trigger the corresponding diagram is processed OnMessage and OnAlarm both events first one is similar to
60. simulation The human user can interact with the YAWL arrival profile access data Engine using a Web interface The user can simulation process simulate the process run can input values for data elements defined in the process HTML forms are automatically generated for collecting the user input using Chiba XForms Processor F2 2 Process initialization service See above time profile necessary resources available resources child diagram F2 3 Event description simulation See above event generation definition of object simulation arrival profile F2 4 Junction description and or x See above or symbol simulation outflow F2 5 Links simulation probability See above type F2 6 General conditions simulation See above validation run simulation F3 Execution workflow engine F3 1 Processes Deployment It is not possible to deploy the YAWL specifications initialization repositories toa YAWL Engine directly from the YAWL Editor The YAWL specifications should be loaded using the YAWL Web interface or programmatically F3 2 Management of distributed Supported via WS interface it is possible to have any workflows number of YAWL_ Engine running and communication between them is achieved by exchanging HTML XML messages Note that the same engine does not support the allocation of tasks to separate resources i e the traditional resource perspective of workflow is not yet sup
61. specific application servers or environment e Open Source Workflow Engines Written in Java The review list consists e ActiveBPEL e Antflow e Apache Agila e Beexee e Bigbross Bossa e Codehaus Werkflow Werkflow e con cem e Dalma e Enhydra Shark e Freefluo e jBpm e Jfolder e MidOffice BPEL Engine e Micro Workflow e ObjectWeb Bonita e OFBiz e OpenWFE e OpenSymphony OSWorkflow e Pi Calculus for SOA e PXE e Syrup e Taverna e Twister e wfmOpen e Xflow2 e YAWL e Zbuilder e Zebra An extended description of each product is available from 3 4 A list with prospective tools is given below e Generic J2EE e Apache Agila e Bonita WP2 Business workflow technology analysis and comparison VISP Consortium Page 30 of 239 D2 2 Workflow Software Analysis and Comparison e Imixs e Jboss jBpm e Jfolder e Open Business Engine e wfmOpen e XFLow Other Java based products e Bossa e Enhydra Shark e Open Symphony Workflow e OpenWFE OSWorkflow e Syrup e Twister e Werkflow e Yet Another Workflow Language engine e Zebra Other Non Java tools e wftk workflow toolkit Other based For specific application servers or environment e Galaxia Tikiwiki Grid based computing workflow Taverna e Open for Business OfBiz OpenFlow e webMethods Business Proc
62. techniques The first standardization effort in workflow was the Workflow Management Coalition WfMC 2 1 In its reference model 2 2 it was defined the interfaces between a workflow management system and other actors Another development of WfMC is XPDL specification 2 3 defining an XML schema for specifying the declarative part of a workflow Another initiative that standardizes the automation of business processes on a J2EE server is JSR 207 Java Specification Request 2 4 In June of 2005 the Business Process Management Initiative BPMLorg and the Object Management Group OMG announced the merger of their Business Process Management BPM activities to provide thought leadership and industry standards for this vital and growing industry The combined group has named itself the Business Modelling amp Integration BMI Domain Task Force DTF The BMI s combined activities continue BPMI s and OMG s groundbreaking work and focus on all aspects of Business Process Management BPMI s widely used standard for business modelling Business Process Modelling Notation BPMN and the Business Motivation Model BMM contributed by the Business Rules Group have completed all but the final vote of the OMG adoption process 2 5 A joint initiative of OASIS and UN CEFACT is ebXML s BPSS Business Process Specification Schema standards for business collaboration 2 6 BPMI s BPML amp WSCI defines a specification BPMN which descr
63. the product be accessed with standard equipment and software or are there special software password or network requirements Can the product be accessed reliably in network environment Cost Currently open code products are perceived as being free However costs do exist for the market available products 3 3 2 Belyk s and Feist s Software Evaluation Criteria Another evaluation scheme for software products related to wide network exploitation is developed in Belyk and Feist 2002 The characteristics of this evaluation are commented below Product Selection Criteria A series of categories and criteria is suggested for the evaluation of online collaborative tools in the development delivery and administration online of software products ASTD 2001 Cost institutional and user e System requirements for the product operation open platform platform specific server purchased vs hosted Bandwidth for network exploitation modem cable ADSL T 1 etc License fees scaled per user User software hardware requirements Peculiarity of the installation of the product Complexity user focus e Technical support user manual frequently asked questions online and off line help e Collaborative tools if applicable asynchronous email conferencing synchronous chat audio conferencing whiteboard virtual networking e Usability seamless technology degree of intuitiveness ease of use navigation consi
64. the shift from data to processes Aalst et al 2003 The same source points out the seventies and eighties as dominated by data driven approaches At that period the information technology is associated with storing and retrieving information and as a result data modelling was the starting point for building an information system The processes had to adapt to information technology and modelling of business processes were often neglected On the contrary today the emphasis is on processes for instance business process reengineering Another development trend is the shift from carefully planned designs to redesign and organizational growth Aalst et al 2003 Business process management systems are information systems that are process aware i e systems that go beyond the automation of individual tasks Notable examples of business process management systems are workflow management systems such as Staffware MOQSeries and COSA and case handling systems such as FLOWer Note that leading enterprise resource planning systems also offer a workflow management module The workflow engines of SAP Baan PeopleSoft Oracle and JD Edwards can be considered as integrated business process management systems The idea to isolate the management of business processes in a separate component is consistent with the three trends identified Business process management systems can be used to avoid hard coding the work processes into tailor m
65. the software products which are offered as open code products and do not belong to propriety constraints The characteristics of the products are described according to the data available from the corresponding web addresses and web sources e Twister jBPM e Enhydra Shark OpenSymphony OSWorkflow e con cern Codehaus Werkflow e ObjectWeb Bonita Bigbross Bossa Open Business Engine The Open for Business Workflow Engine e OpenWFE WfMOpen e XFlow Jfolder e Taverna Freefluo e Micro Flow Jflower e YAWL Syrup e PXE ActiveBPEL e Antflow Swish Additional information can be found also in 3 5 e Commercial Workflow Tools e Active Endpoints ActiveWebflow ActiveWebflow Designer Server ADONIS Biztalk Server Cape Clear Orchestrator Digit Process Composer Fiorano SOA Platform FiveSight PXE FuegoBPM IBM BPWS4J WP2 Business workflow technology analysis and comparison VISP Consortium Page 32 of 239 D2 2 Workflow Software Analysis and Comparison e IBM WebSphere Business e OpenLink Virtuoso Universal Integration Server Foundation Server e OpenStorm ChoreoServer e Oracle BPEL Process Manager e Parasoft BPEL Maestro e PolarLake Integration Suite e SAP NetWeaver Exchange e SeeBeyond elInsight BPM Infrastructure e Commercial vendors Bea s WLI 3 6 Carnot 3 7 Dralasoft 3 8
66. which allows an activity to escape to the traditional start end synchronization model such that the user can cancel an execution activity or change the activity execution mode at runtime The Bonita Workflow also includes a browser based environment with Web Services integration using SOAP and XML that allows users to define and control the workflow processes by means of a browser The basic process implementation in Bonita is the Project CMP Bean that represents the key component of the Bonita Cooperative Workflow Kernel Every workflow process contains data information process name user creator etc and associated data in terms of activities connections between these activities process data process properties and participants Figure 4 19 shows the basic Architecture of the Bonita System WP2 Business workflow technology analysis and comparison VISP Consortium Page 101 of 239 D2 2 Workflow Software Analysis and Comparison Client Side Presentation Preentation Business Logic tosis l i Browser z e T e i MySQL s z z i Java Web Scena H Fongres Start H application A i i am a GraphEditor S lication H PP i i s Bonta Database Figure 4 19 The Bonita Architecture Since the Bonita system is meant to be used in a cooperative environment it includes some additional features such as the ones described below Some e
67. 0 of 239 D2 2 Workflow Software Analysis and Comparison 3 4 Conclusions The list of available products addressing the modelling issues as specification simulation and execution functionality of the workflow management systems is quite long The products have different level of maturity and they are presented both as market available products as an open source software suits The products try to support modelling standards as common execution formats recommended by the international standardization organization In this abundance of products and software tools the evaluation and choice of appropriate product is not an easy task Attempts to make appropriate evaluations have been done Several of the results are given in this chapter Unfortunately all these products endure continuous elaboration New futures are included in the software products Taking into account that the standardization efforts of the methodological background for the workflow management systems is far from completion an absolute evaluation and classification is a very ambitious work As results from this survey of the workflow products the consortium developments have been restricted to several prospective representatives of the workflow software management products For these representatives a thorough examination has been performed The appropriate works and results are presented in the next Chapter 4 WP2 Business workflow technology analysis and comparis
68. 1 Long list of products supporting standardization initiatives 61 Table 4 2 Workflow products allocated per partners for test and assessment 65 Table 4 3 Alphabetic order of the short list products evaluated by the VISP consortium 65 Table 4 4 Functional peculiarities of AWS tool oo eee cece eee ne ence eect ee eeeeenens 68 Table 4 5 Settings of AWS engine eee cece een e ence eee eeeneetaeteeeneeneenaes 69 Table 4 6 Functionalities of ActiveWebflow Designer ce ceee cece nee ee enact 72 Table 4 7 The assessed short list workflow software and corresponding workflow technologies broren aens aar E E EA AAEE sees Saves ea 118 Table 6 1 General workflow functionality decomposition of the products 216 Table 6 2 Average evaluation results per products ee eeeee cece nee ne ence ee eeeeees 222 Table 6 3 Average evaluation results Modelling Tools cece sees eee ee eee ees 222 Table 6 4 Average evaluation Workflow editors 0 sce eee eee eee eee en een e enone 223 Table 6 5 Average evaluation results Workflow Engines cceeeeeee eee ees 223 Table 6 6 Average evaluation Combined Products Editor Engines 224 Table 6 7 Modelling Tools cece cece cece nee ne ence eect KE EE TEREE EE 229 Table 6 8 Workflow Editors eee eee cece nce ne ence eee ee eee ene ene ene eneen
69. 1 and WSDL 1 1 specifications BPEL Designer uses the concept of partner link types as defined in 4 29 to link BPEL and WSDL specifications 4 16 ITP Commerce Process Modeler for Microsoft Visio Introduction Process Modeler is a Microsoft Visio plug in It enables to design business processes in Microsoft Visio utilizing BPMN 1 0 It fully supports the BPMN 1 0 standard including all BPMN elements and all BPMN attributes defined by specification Visio stencil consists of the 15 BPMN basic elements e Start event End event Intermediate Event Task Sub Process collapsed Sub Process expanded Gateway Sequence flow Message flow Assertion Text annotation Data object Group Pool Lane The tool offers the following features BPMN Diagram Validation User defined attribute maintenance using an Attribute Explorer Migration BPMN 0 9 to 1 0 BPMN style export Element numbering Process documentation BPEL 1 1 mapping and export with special support including round trip engineering for Oracle BPEL Process Manager WP2 Business workflow technology analysis and comparison VISP Consortium Page 108 of 239 D2 2 Workflow Software Analysis and Comparison e XPDL 1 0 mapping and export with special support including round trip engineering for the Carnot process engine ITpearls commerce started developing back in 2002 a modeler to run on every business analyst s desktop Process Modeler 2 1 is a typical plug in for Micros
70. 2 Workflow Software Analysis and Comparison 7 The message is sent out through a send adapter which uses an appropriate mechanism to communicate with the application for which this message is destined Because applications communicate in many different ways the BizTalk Server engine supports a variety of protocols and message formats It is important to remember that the engine works only with XML documents internally All messages are converted to XML documents when they are received Similarly if the recipient of a document requires a format other than XML the engine converts the document into the appropriate format The BizTalk Server engine uses adapters to talk to a wide range of other software An adapter is an implementation of a communication mechanism such as a particular protocol BizTalk Server provides several built in adapters and other adapters have been created for popular applications such as SAP A developer can determine which adapters to use in a given situation or can create custom adapters All adapters are built on a standard base called the Adapter Framework which is new with BizTalk Server This framework provides a common way to create and run adapters and enables you to use the same tools to manage both standard and custom adapters 4 5 Borland Together Designer 2006 Introduction Borland Together Designer 2006 is a modelling tool supporting UML MDA like model transformations utilizing QVT and busine
71. 2 Workflow Software Analysis and Comparison What is the authority or expertise of the individual or group that created this Software product How knowledgeable is the individual or group on the subject matter of the Software product Is the Software product sponsored by an individual or group that has created other Software products e Is any sort of bias evident e When was the Software product produced e When was the Software product mounted e When was the Software product last revised e How up to date are the links e How reliable are the links are there blind links or references to Software products which have moved e Is contact information for the author or producer included Structure e Does the window follow good graphic design principles e Do the graphics and art serve a function or are they decorative e Do the icons clearly represent what is intended e Does the text follow basic rules of grammar spelling and literary composition e Is there an element of creativity and does it add to or detract from the window itself e Can the text stand alone for use in line mode text only Web browsers as well as multimedia browsers or is there an option for line mode browsers e Are links provided to Web subject trees or directories lists of subject arranged Web sources Others Is appropriate interactivity available When it is necessary to send confidential information out over the Internet is encryption i e a secu
72. 2 2 Workflow Software Analysis and Comparison F2 Simulation debug Not available yet Work in progress F3 Execution workflow engine F3 1 Processes Deployment initialization repositories F3 2 Management of distributed workflows F3 3 Application Server Yes Compatibility JOnAS server JOnAS is a pure Java open source application server developed within the ObjectWeb consortium Its high modularity allows to it to be used as a J2EE server for deploying and running EAR applications i e applications composed of both web and ejb components an EJB container for deploying and running EJB components e g for applications without web interfaces or when using JSP Servlet engines that are not integrated as a JOnAS container a Web container for deploying and running JSPs and Servlets e g for applications without EJB components F3 4 File formats F3 5 Transaction See F1 6 mechanisms F3 6 Supported SOAP and XML The Bonita Workflow also includes a communication browser based environment with Web Services integration using protocol SOAP and XML F3 7 Users roles Users BONITA make the distinction between Users and Participants Users are people who will make use of the workflow system whatever process they will be part of Participants are all the users that are allowed to play some role in a given process First the user has to be registered in Bonita Sys
73. 39 D2 2 Workflow Software Analysis and Comparison Maintainability B g g 8 BActiveBPEL Engine DActive Webflow Standard DActiveWelbflow Designer OBiztalk Server Borland Together Designer 2006 mCape Clear Gconcem BEnhydra JawE BEnhydra Shark OenterpriseXtention mFreefluo m JBossjBPM mObjectWeb BONITA mOpenWFE OOracle BPEL Process Manager OProcess Modeler DSAP NetWeaver Exchange Infrasructure OWfMOpen o YWAL Engine Figure 6 28 Maintainability comparative chart Portability 6 5 4 3 2 1 0 m ActiveBPEL Engine ActiveWebflow Standard DActiveWebflow Designer o Biztalk Server m Borland Together Designer 2006 a capa Clear m con cem m Enhydra JaWE m Enhydra Shark o enterprise Xtention m Freefluo m JBoss jBP m ObjectWeb BONITA m OpenWFE O Oracle BPEL Process Bennet O Process Modeler m SAP NetWeaver Exchange Infrastructure OWfMOpen OYAWL Engine Figure 6 29 Portability comparative chart The column diagrams give integral view of the quality characteristics of the tested products Despite that they introduce quantitative approach for the comparison and assessment the problem of the choice is still vector one which does not allow finding narrow set of prospective candidates for practical use in the VISP project developments An approach to find unique solutions of the problem of vector choice of product is to weight the general software quality characteristics Radar diagrams This study tries to find a narrow se
74. 4 Mukherjee S et al Logic based approaches to workflow modelling and verification In J Chomicki R van der Meyden and G Saake eds Logics for Emerging Applications of Databases 2004 chap 5 Springer Verlag Berlin 167 202 Oestereich et al 2005 Bernd Oestereich B T Weilkiens F Ferrandina C Brocker iX Studie Bessere Software den Entwicklungsprozess im Griff UML2 und MDA Werkzeuge im Vergleich Heise Zeitschriften Verlag November 2005 http www heise de kiosk special ixstudie 05 02 Peterson 1981 Peterson James Lyle Petri Net Theory and the Modelling of Systems Prentice Hall ISBN 0136619835 1981 p 288 Reisig 1992 Reisig Wolfgang A Primer in Petri Net Design Springer Verlag ISBN 3 540 52044 9 1992 SAP97 SAP 1997 WF SAP Business Workow SAP AG Walldorf Germany Sheth 1999 Sheth A P W M P van der Aalst I B Arpinar Processes driving the networked economy 1999 IEEE Concurrency 7 3 18 31 Smith 1997 Smith Alastair G 1997 Testing the Surf Criteria for Evaluating Internet Information Resources The Public Access Computer Systems Review 8 no 3 Sta00 Sta_ware 2000 Sta_ware 2000 GWD User Manual Sta_ware plc Berkshire United Kingdom Thatte 2001 Thatte S XLANG Web Services for Business Process Design 2001 eo Microsoft Ver00 Verve 2000 Verve Component Workow Engine Concepts Verve Inc San Francisco CA USA Wegner 1996 Wegner P Intero
75. 5 Usability 12 5 75 12 5 5 Efficiency 67 33 2 68 Maintainability 20 80 0 8 Portability 20 20 60 2 WP2 Business workflow technology analysis and comparison VISP Consortium Page 157 of 239 D2 2 Workflow Software Analysis and Comparison n 0 Functionality 60 Efficiency II Pie Charts Reliability Usability 13 0 13 50 meet TIA Maintainability Portability B0 0 20 0 20 0 60 20 GWeak BGood OStrong O Can t assess Figure 6 2 Pie charts for ActiveWebflow Standard s characteristics Principal Functions ActiveWebflow Designer I Functionality F1 Modelling process definition Fct no Function name Function implementation IF1 1 Process chart process thread definition A BPEL process has several structural parts e Process Element and Properties e Variables e Partner Links e Activities e Fault Handlers e Compensation Handlers Process Properties Process Name Query Language Target Namespace Variables The BPEL process receives manipulates and sends data through XML variables Variables are defined in one of the following ways e WSDL message types e XML schema simple types e XML schema elements Partner Links used when defining Web service WP2 Business workflow technology analysis and comparison VISP Consortium Page 158 of 239 D2 2 Workflow Software Analysis and C
76. 5 Integration with other workflow engines Supported standards F5 1 Possibilities for collaboration with other workflow engines standards No explicit mechanism is present to collaborate with other workflow engines F6 Administration and monitoring F6 1 Life cycle management F6 2 Supervising capabilities The engine offers an administration and monitoring Process status tool which serves all typical functionalities you can see Interface 5 section for more information F6 3 Flexibility to workflow The engine allows participants administration It participants can be done using Administration tool or Java API Functional Auxiliary Functions FA1 Statistics Supported by Administration tool FA2 HELP Functionalities Help information are present II Integral Characteristics WfMOpen Characteristics can t score ISO IEC 9126 weak 2000 Serone assess result Functionality 20 20 60 4 8 Reliability 25 75 5 5 Usability 25 37 5 37 5 4 25 Efficiency 67 33 2 66 Maintainability 60 40 4 8 Portability 20 60 20 4 WP2 Business workflow technology analysis and comparison VISP Consortium Page 211 of 239 D2 2 Workflow Software Analysis and Comparison II Pie Charts Functionality Reliability Usability 0 0 0 20 25 i 25 38 50 20 75 w Efficiency Maintainability Portabil
77. 75 3 46 Efficiency 2 2 68 5 34 2 68 2 02 2 66 3 2 65 Maintainability 3 6 3 2 6 0 8 2 8 4 8 4 4 2 74 Portability 3 6 1 6 5 2 3 6 2 4 2 8 3 2 WP2 Business workflow technology analysis and comparison VISP Consortium Page 224 of 239 D2 2 Workflow Software Analysis and Comparison Table 6 6 Average evaluation Combined Products Editor Engines ActiveWebflow TM Standard i ActiveWebflow Cape Clear 6 5 con cern Enhydra oe PEIER Professional JaWE a Designer Enhydra Shark Characteristics score score score score ISO IEC 9126 score result result result result result Functionality 4 4 2 3 9 5 2 Reliability 4 2 5 3 2 13 4 5 Usability 4 88 3 75 2 75 3 19 3 75 Efficiency 2 68 2 68 2 66 3 33 2 68 Maintainability 1 2 2 4 1 9 2 8 Portability 1 8 3 2 5 6 2 5 2 8 Oracle jBPM Bonita OP WFE bikie SAP_Net VawL Products Tocess Weaver Manager Characteristics score score score score score Average ISO IEC 9126 score result result result result result value result Functionality 4 2 4 4 8 4 3 6 3 2 3 82 Reliability 2 5 2 5 2 5 3 2 5 2 3 05 Usability 2 25 2 3 75 4 5 3 3 75 3 46 Efficiency 2 2 68 5 34 2 68 2 02 3 2 65 Maintainability 3 6 3 2 6 0 8 2 8 4 4 2 74 Portability 3 6 1 6 5 2 3 6 2 2 8 3 2 Having the results from the evaluation an average score per each software quality for all products can be found Thus the average mar
78. Anticipating hook is called when an automatic activity is started only if the activity is anticipable It is considered to be in the same transaction than the activity OnReady hook is called when an activity becomes ready so it would be veiy useful to notify some kind of information to the user responsible to execute it It is not considered to be in the same transaction than the activity On Deadline hook is called when the activity deadline expires It is not considered to be in the same transaction than the activity F1 4 Flowline F1 5 Definition of organizational units See F1 3 F1 6 Junctions Transition between activities Most of the usual transition patterns can be achieved with BONIT A There is no special node to achieve these patterns rather any activity can act as a routing node The transition pattern will be determined according to the type of the activity which can be one of AND JOIN also known as synchronize or OR JOIN also known as asynchronous join The transition pattern will also be determined from and the number of outgoing edges from an activity that is the SPLIT construct which allows having several activities executing in parallel is not a specific type of activities if there are several outgoing nodes from a given activity then it is a SPLIT construct WP2 Business workflow technology analysis and comparison VISP Consortium Page 196 of 239 D
79. Arc Figure3 13 Sample process model implemented with Changengine WP2 Business workflow technology analysis and comparison VISP Consortium Page 45 of 239 D2 2 Workflow Software Analysis and Comparison Staffware Staffware Sta00 is one of the leading workflow management systems Staffware is authored and distributed by Staffware PLC Staffware PLC has its headquarters in Maidenhead UK operates through offices in 15 countries and has a network of 360 partners resellers and OEMs There is used the most recent version of Staffware i e Staffware 2000 which was released in the last quarter of 1999 Figure 3 14 shows the sample process introduced in Figure 3 10 implemented with Staffware Fujitsu i Flow Fujitsu i Flow Fuj99 is a workflow offering from Fujitsu that can be seen as the successor of the well established workflow engine from the same company TeamWare I Flow is web centric and has a Java CORBA based engine built specifically for Independent Software Vendors and System Integrators The evaluation here is based on version 3 5 of the product introduced in early 2000 The latest version of the product is 4 1 as of early 2002 The sample process introduced in Figure 3 10 implemented with i Flow is shown in Figure 3 15 i Step Condition Figure3 14 Sample process model implemented with Staffware OR Conditional Figure3 15 Sample process model implemented with i Flow
80. Business workflow technology analysis and comparison VISP Consortium Page 81 of 239 D2 2 Workflow Software Analysis and Comparison aworkflow engine a manager monitor Supported interfaces Interface 1 Cape Clear 6 5 provides a graphical process designer integrated to Eclipse platform It is possible to design business process but no to import them Interface 2 Cape Clear 6 5 runs the BEPL process as a Web service It is then possible to invoke the process from any client supporting web services web clients java stand alone clients Note that Cape Clear 6 5 provides a very useful tool inside the Cape Clear Studio it can dynamically generate SOAP requests to test deployed business process The screen is split in half the first half contains the request that the developer can update with its own data random data is generated by default The second half is the SOAP answer from the service Interface 3 Invoked applications can be of any type as long as they provide a web service interface i e a wsdl definition file But not all platforms are service WSDL enabled and not all data is XML Schema aware or accessible Cape Clear Studio offers a range of capabilities for creating interoperable and reusable endpoints from existing assets This can be achieved by auto generating WSDL interfaces from a variety of legacy systems These WSDL enabled entities are then accessible via transformation and mapping in the mediation layer
81. By iteratively comparing the functionality offered by one system with functionality offered by another system it has been identified functionalities common to all of them The quantitative analysis was performed using the patterns identified according to the ISO9126 standard for the evaluation of software products Thus common frameworks for the assessment of different in nature products were achieved Due to severe technical problems for the installation of various workflow management systems this deliverable decided to focus only to prospective software products The choice of them was done according to internal partner decision which lacks from theoretical basement and it can be regarded as a subjective point of the evaluation works Thus the consortium was able until now to tackle only several systems which are presented in the short list of Chapter 3 of this deliverable For the completeness of the survey comparisons and available data for other software products have been included The reasons for constraining the choice are quite practical and they address the possibilities to get an evaluation to actual software versions the availability of actual components for the software environment the documentation in common was completely lacking the software systems had bugs in their normal operation and performance This is obviously a real situation which constrained the survey to include more systems WP2 Business workflow technology an
82. COMPLETE 2003 06 12 11 2003 06 12 11 34 58 lrestrictGetResults COMPLETE 2003 06 12 11 2003 06 12 11 34 57 restrictCreateJob COMPLETE 2003 06 12 11 2003 06 12 11 34 54 restrictWait COMPLETE 2003 06 12 11 34 55 2003 06 12 11 34 56 r Workflow results lt xml version 1 0 encoding UTF 8 gt i lt dataset gt sdata gt lt ID gt 1 lt ID gt lt name gt reports name gt _chmasctrinaihina gt Workflow provenance lt workflowProvenance xmins httpviwww itinnovation soton ac ukitavernaiworkflow enactor provenance gt sworkflowlD FlowlD Taverna Workflow org embl ebi escience scufl ScuflModel 1 e9d0cc DEFAULT_USER lt workflowStatus gt COMPLETE lt workflowStatus gt lt xscuflDefinition xmins httpviwww itinnovation soton ac ukitavernatworkflowlenactorprogress i gt anamassequencestiames stype stringsitype svalue gt lt CDATA actagtacgcgttaggatcatacgatacatcgtatgcgcactagatcatcgtacatacatactataaag sidata gt sdata gt sID gt 1 lt ID gt lt name gt snplist lt name gt Figure 4 15 Taverna workbench WP2 Business workflow technology analysis and comparison VISP Consortium Page 96 of 239 D2 2 Workflow Software Analysis and Comparison Additional interfaces import export of data towards other products like databases file systems repositories UDDI LDAP monitoring of transactions The en
83. CT INCO COPERNICUS Project 960183 FRETRIS Road Freight Transport Demand amp Supply Information Systems A Telematic Pilot Tool for Europe Fuj99 Fujitsu 1999 i Flow Developers Guide Fujitsu Software Corporation San Jose CA USA Georgakopoulos et al 1995 Georgakopoulos D M Hornick A Sheth An Overview of Workflow Management From Process Modelling to Workflow Automation Infrastructure 1995 Kluwer Academic Publishers Distributed and Parallel Databases 3 119 153 Haller et al 2005 Armin Haller Eyal Oren Simeon Petkov Survey of Workflow Management Systems May 2 2005 Available at http www m3pe org deliverables syseval pdf HP00 HP 2000 HP Changengine Process Design Guide Hewlett Packard Company Palo Alto CA USA IBM99 IBM 1999 IBM MQSeries Workow Getting Started With Buildtime IBM Deutschland Entwicklung GmbH Boeblingen Germany Itpearls Itpearls commerce Ag Homepage Flyers Papers and Documents from Itpearls about Process Modeler Version 2 0 available at http www itp commerce com Jablonski et al 1996 Jablonski S and C Bussler Workflow Management Modelling Concepts Architecture and Implementation 1996 International Thomson Computer Press London Kapoun 1998 Kapoun Jim 1988 Teaching undergrads WEB evaluation A guide for library instruction C amp RL News July August 522 523 Kappel 2000 Kappel G S Rausch Schott W Retschitzegger A Framework for Work
84. EEE a IS EEEE EEA EEE REEERE 215 6 5 CONCIUSIONS ereere ea ern aeaa a aaa aa eaea esans 228 T CONCLUSIONS anne ik eh eho fies eosin a GA aan as 232 REFERENCES soi ccht Sea neasasenctasd dcrtalga tas thcban gcd secaeda rncbaldg ceeesg esata bedetg oxtah oacsagea Sed sake Metabesdaat casinaweldeieecans 234 WP2 Business workflow technology analysis and comparison VISP Consortium Page 8 of 239 D2 2 Workflow Software Analysis and Comparison Table of Figures Figure 2 1 History of Office Automation and Workflow Systems 2005 18 Figure 2 2 Software architecture of a Workflow Application cece eee ee 21 Figure 2 3 Collaborative workflow e cee cce scence eee e eee ne ence ee eeeeneeneeneen es 22 Figure 2 4 Production workflow ce ce eee eee e ence nee ee ence eens tee eaeen a 24 Figure 2 5 Administrative workflow 2 0 2 0 cece scence eee ee cece ne ene teaeeeeeneeneenaeeas 25 Figure3 1 Workflow Pattern 1 Sequence in i FloW eee eee e eee nee ee eee eee 37 Figure3 2 Workflow Pattern 1 Sequence in MQ Workflow ecceeeee eee 37 Figure3 3 Workflow Pattern 2 Parallel Split in i Flow 0 see eee eee eens 37 Figure3 4 Workflow Pattern 2 Parallel Split in MQ Workflow 0008 38 Figure3 5 Workflow Pattern 3 Synchronization in i FloWw ese eee cence eee eens 38 Figure3 6 Workflow Pattern 3 Synchronization in MQ Wor
85. Edges The Bonita modelling component allows the definition and visualization of the process by different users at run time and it thus involves some coordination and groupware methods for better communication between users WP2 Business workflow technology analysis and comparison VISP Consortium Page 100 of 239 D2 2 Workflow Software Analysis and Comparison a Workflow graph editor Project Order Processing tai GF 626882 HB Project example newProject martin in check e citizen Customer Service Order Processing I Order Processing_instance14 Todo List f R a else Figure 4 18 Bonita GraphEditor tool The Bonita Execution Component is based on the new activity anticipation model proposed by the ECOO team 4 13 The Bonita Execution environment is based on the principles of flexible data and workflow management which allows activities to exchange data more efficiently The Bonita system offers a WorkList application which allows the user to control process execution The user WorkList provides different information about the projects of every user The WorkList is organized in three different lists project list todo list and activity list The Bonita Execution Engine allows activities to share intermediate results when executing thus executing in a non isolated way The workflow execution is based on the principle of anticipation
86. F1 1 Process chart Processes are directly deployed in the engine using BPEL files definition process thread F1 2 Process description Deployed processes are graphically displayed by Administration major minor tool using a graph representation and are described with BPEL and WSDL standards F1 3 Event initial result All processes transactions results and alarms are visualized into triggering process Admin console thread event result correlation F1 4 Flowline Not applicable F1 5 Definition of Standard BPEL 2 0 processes description organizational units F1 6 Junctions Standard BPEL 2 0 processes description WP2 Business workflow technology analysis and comparison VISP Consortium Page 150 of 239 D2 2 Workflow Software Analysis and Comparison F2 Simulation debug F2 1 Objects definition The engine supports workflow simulation and debugging but simulation _arrivaljonly in the ActiveWebflow professional version which will be profile access data simulation process bought apart and it runs only in Windows based systems By this application the user can view all real time interactions and engine messages Moreover it is possible to change flow and processes parameters during the simulation and messages sent by the engine are displayed into a box console F2 2 Process initialization service time profile necessary resources available resources child d
87. Flow uses XPDL as process definition language with some proprietary extensions extended attributes are used Processes can be modeled manually in the text or import mode via heavy user v 2 52 or graphically as described in the section G 1 3 v 3 0 lightweight browser will be used as well IBM Lotus Domino server is the only platform for workflow execution v 2 52 Every Web Application Server supporting J2EE v 3 0 X Flow can execute every process defined according to XPDL specification 4 11 Freefluo Workflow software overview Workflow software presentation Freefluo is a workflow orchestration tool for web services initially developed by IT Innovation but now available to all from the Freefluo Sourceforge Site It can handle WSDL based web service invocation It supports two XML workflow languages one based on IBM s WSFL and another named XScufl that is under development as part of the Taverna WP2 Business workflow technology analysis and comparison VISP Consortium Page 94 of 239 D2 2 Workflow Software Analysis and Comparison Sourceforge project 4 9 Freefluo is very flexible at its core is a reusable orchestration framework that is not tied to any workflow language or execution architecture Freefluo includes extension libraries that enable execution of workflows written in a subset of WSFL Support exists for discovery via standard UDDI and recording of provenance Workflow software description T
88. Good O Strong O Not applicable cannot assess O Comments 4 Compliance the capability of the software to adhere standards conventions or regulations relating to reliability Weak O Good O Strong O Not applicable cannot assess O Comments IV USABILITY For this category of evaluation a variety of usability characteristics are considered Particular importance is features daily used for this tool DESCRIPTIONS e User Interface o Does the tool provide a user interface or is it simply a conversion tool YES NO Not applicable cannot assess Comments o Does the user interface abide by the hardware software system conventions YES NO Not applicable cannot assess Comments e User prompting o Does the tool allow the user to select metadata items from lists or menus where appropriate YES NO Not applicable cannot assess Comments o Can an experienced user bypass those lists YES NO Not applicable cannot assess Comments e Minimizing duplication of entry o Ifa provider describing a collection can the repeatable information that remains the same across the data sets be reused and not re entered YES NO Not applicable cannot assess Comments WP2 Business workflow technology analysis and comparison VISP Consortium Page 140 of 239 D2 2 Workflow Software Analysis and Comparison e Data Generation Integration o Is the metadatabase directly accessed by data manipulation applications YES NO
89. HAT tool arrival profile access data provides features for reporting analyzing and simulation process debugging data and messages that are archived in the BizTalk Tracking database F2 2 Process initialization service time profile necessary resources available resources child diagram F2 3 Event description simulation event generation definition of object simulation arrival profile F2 4 Junction description and or x or symbol simulation outflow F2 5 Links simulation probability type F2 6 General conditions simulation validation run simulation F3 Execution workflow engine F3 1 Processes Deployment Process deployment is done with the contextual menu initialization repositories in Visual studio Deployment is automated but if the project you are trying to deploy uses ports that are already in use you must first disable them F3 2 Management of distributed Distributed workflow support if applicable workflows F3 3 Application Server Compatibility N A F3 4 File formats Definition schemas are saved in xsd files Orchestration definitions are stored in odx files XML file F3 5 Transaction mechanisms Scopes can be defined as well as Exceptions and Compensation Activities Transactions are either Atomic or Long Running F3 6 Supported communication protocol Communication Protocols supported are POP3 SMTP SOAP HTTP FILE MSMQ W
90. JTA transactions F3 6 Supported communication BPEL Server communicates via SOAP considering protocol WS Addressing F3 7 Users roles BPEL Process Manager supports an identity service that runs on top of various user management infrastructures like for example LDAP The arrangement of users to groups roles is supported and utilized in the workflow services F4 Workflow client applications F4 1 interface application User client weight browsers technologies type proprietary heavy weight user clients or general purpose light Workflow clients can communicate with BPEL processes either via SOAP or via the proprietary Java Business Delegate Mechanism Only communication utilizing Axis 1 1 has been evaluated F5 Integration with other workflow engines Supported standards F5 1 standards Possibilities for collaboration with other workflow engines In principle is it possible to communicate with every engine that supports SOAP and WS Addressing F6 Administration and monitoring F6 1 Life cycle management The BPEL Console supports various mechanisms F6 2 Supervising capabilities to administer BPEL processes and instances Process status utilizing proprietary interfaces F6 3 Flexibility to workflow participants F7 Deployment and Binding Deployment of BPEL processes can be triggered by the BPEL Designer as well as by the B
91. LI Lotus Notes Microsoft CRM oracle Applications PeopleSoft BEA Tuxedo It also supports the following industry specific B2B adapters UCCnet SWIFT and RosettaNet Interface 4 Workflow collaboration can be achieved with web services ends Interface 5 NetWeaver provides a Central monitoring feature messages components performance can be monitored and alert messages can be sent Additional interfaces Netweaver provides adapters for B2B like RosettaNet UCCNet CIDX Supported standards WP2 Business workflow technology analysis and comparison VISP Consortium Page 110 of 239 D2 2 Workflow Software Analysis and Comparison Workflow execution tools NetWeaver XI runs BPEL process on its execution engine Integration Server Fifure 4 22 PEOPLE INTEGRATION Multi channel access Portal Collaboration INFORMATION INTEGRATION Bus Intelligence Knowledge Mgmt Master Data Management PROCESS INTEGRATION Integration Bus Process Broker Mgmt LINSAWS9YNVW 37949 3417 APPLICATION PLATFORM J2EE ABAP DB and OS Abstraction Se S W Z ire z E q 9 l a a 1 w E n O o fa a e WebSphere Figure 4 21 SAP NetWeaver Exchange structure SRE NetWeaver y ren ajntg an susiness Process Management 5 z E p a 5 E a 3i 2 Figure 4 22 SAP NetWeaver Exchange structure 4 18 WfMOpen Workflow software overview WfMOpen is a J2EE based implement
92. No explicit mechanism is presented to other workflow engines standards __ collaborate with other workflow engines F6 Administration and monitoring F6 1 Life cycle management The Administration tool manages all main functionalities for the execution of the workflow processes while modelling and simulation can be managed using an external tool e g JaWE F6 2 Supervising capabilities Process instantiation management Active processes Process status Name Category Version State Enable Disable Process monitor Start Suspend Resume Terminate Abort Show history Description Variables Activity management Delete finished Delete selected Check deadlines Check limits F6 3 Flexibility to workflow Access rights various access rights from participants administrator projectmanager moderator with full rights to simple user worker player author without administrative rights Supports application mapping map a package and package s processes applications to the real applications handled by a tool agent Currently six tool agents come with the Shark distribution cache management handle the size of the shark caches using this section Functional Auxiliary Functions FA1 Statistics Fctno Function name Function Implementation FA1 1 Number of users Support FA1 2 Number of processes Support FA1 3 User rights Support FA1 4 Process Informa
93. Not applicable WP2 Business workflow technology analysis and comparison VISP Consortium Page 174 of 239 D2 2 Workflow Software Analysis and Comparison II Integral Characteristics con CERN Characteristics Jeil good siron can t score ISO IEC 9126 8 8 assess result Functionality 60 20 20 2 Reliability 50 50 3 Usability 50 25 12 5 12 5 2 75 Efficiency 671 33 2 66 Maintainability 20 20 20 40 2 4 Portability 20 80 5 6 III Pie Charts Functionality Reliability Usability 0 20 0 20 25 0 60 75 0 Efficiency Maintainability Portability 20 0 20 40 GWeak BGood OStrong OCan t assess Figure 6 7 Pie charts for Con Cern s characteristics Enhydra JaWE I Functionality Principal Functions F1 Modelling process definition Fct no Function name Function implementation F1 1 Process chart definition JaWE is consisted of two logical parts Package level process thread and Process level Package level e Meta Model describes the top level entities WP2 Business workflow technology analysis and comparison VISP Consortium Page 175 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation contained within a Process Definition their relationships and attributes e Package It is possible to define sev
94. Not applicable cannot assess Comments o Does the tools support workflow planning status recording auditing and notification Eg e mail or report to data owner that a data set requires updating according to its metadata YES NO Not applicable cannot assess Comments e Cut and Paste o Can standard metadata information items be pulled or pasted in from external sources YES NO Not applicable cannot assess Comments o Can metadata elements be saved for use in other metadata documents YES NO Not applicable cannot assess Comments e Restart ability o Does the tool allow metadata to be written in stages YES NO Not applicable cannot assess Comments o Does it support incremental updates YES NO NOT APPLICABLE e Documentation o Is documentation provided YES NO Not applicable cannot assess Comments o Does the tool provide on line help YES NO Not applicable cannot assess Comments o Does the tool s help function use the help mechanism native to the hardware software system and presumably familiar to the user YES NO Not applicable cannot assess Comments o How extensive is the documentation Comments o How extensive is the on line help Comments e Miscellaneous o Does the tool provide a spell checking capability YES NO Not applicable cannot assess Comments o Can new terms be added to the spell checking dictionary YES NO Not applicable cannot assess Comments o Does the tool pr
95. OpenWFE Oracle BPEL Process Manager SAP NetWeaver Exchange Infrastructure WfMOpen YAWL Combined Products ActiveWebflow Designer ActiveWebflow Standard Editor Engine Cape Clear con cern Enhydra JaWE Enhydra Shark enterprise Xtention JBoss jBPM ObjectWeb BONITA OpenWFE Oracle BPEL Process Manager SAP NetWeaver Exchange Infrastructure YAWL The comparative assessment of the products belonging to the category Workflow editors and addressing their functional rating is given to the bar chart diagram WP2 Business workflow technology analysis and comparison VISP Consortium Page 217 of 239 D2 2 Workflow Software Analysis and Comparison Functionality Workflow Editors Products score result E ActiveWelflow Designer Cape Clear Oconmcern OenterpriseXtention E Enhydra JawE BJBossjBPM D ObjectWeb BONITA mOpenWFE E Oracle BPEL Process Manager OSAP NetWeaver Exchange Infrastructure m YAWL Figure 6 20 Workflow Editors comparative chart According to this diagram potential candidates and winner for application in the VISP developments are the products with score around 4 and supporting workflow standards recommened by D2 1 BPEL XPDL These products are Active Webflow Designer Cape Clear Enhydra JaWE and Oracle BPEL Process Manager Their personal rates concerning the functional and usability software quality are presented on the pie chart diagrams The functional comparis
96. P2 Business workflow technology analysis and comparison VISP Consortium Page 163 of 239 D2 2 Workflow Software Analysis and Comparison MQSeries Following B2B languages are also supported RosettaNet HIPAA HL7 SWIFT F3 7 Users roles Role Link feature in the designer enables the grouping of Ports F4 Workflow client applications F4 1 User interface technologies client application type proprietary heavy weight user clients or general purpose light weight browsers Clients can be of various kind Net client any client aware of Web Service if the business process is deployed as such mail clients etc F5 Integration with other workflow engines Supported standards IFS 1 Possibilities for collaboration with other workflow engines standards A process deployed on BizTalk can be part of a collaboration workflow support for BPEL XLANG F6 Administration and monitoring F6 1 Life cycle management F6 2 Supervising capabilities Monitoring is done with BAM Business Activity Process status Monitoring portal solution You can then search for a process instance and display specific information about it setup alerts F6 3 Flexibility to workflow N A participants Functional Auxiliary Functions FA1 Statistics Not applicable FA2 HELP Functionalities Help information II Integral Charact
97. PEL Console Binding to Web services endpoints is done via the information provided in the WSDL It is foreseen to support the modification of Web service endpoints or the definition of multiple endpoints in the BPEL Console Functional Auxiliary Functions FA1 Statistics Not applicable FA2 HELP Functionalities Oracle provides comprehensive documentation and examples for the BPEL Process Manager WP2 Business workflow technology analysis and comparison VISP Consortium Page 204 of 239 D2 2 Workflow Software Analysis and Comparison II Integral Characteristics Oracle BPEL Process Manager Characteristics weak sood stron can t score ISO IEC 9126 8 8 assess result Functionality 40 40 20 4 Reliability 75 25 3 Usability 75 25 4 5 Efficiency 67 33 2 68 Maintainability 20 80 0 8 Portability 60 20 20 3 6 III Pie Charts Functionality Reliability Usability 0 20 0 25 ig 40 0 40 75 Efficiency Maintainability Portability 0 0 20 2 a i 0 ET 20 B0 GWeak m Good O Strong O Can t assess Figure 6 15 Pie charts for Oracle BPEL Process Manager s characteristics Process Modeler I Functionality Principal Functions F1 Modelling process definition Fct no Function name Function implementation F1 1 Process chart definition Process Modeler for Microsoft Visio is a user friendly process threa
98. T e Agentflow e T T WP2 Business workflow technology analysis and comparison VISP Consortium Page 62 of 239 D2 2 Workflow Software Analysis and Comparison Amazonas Worflow Antflow Apache Agila HT a Proprietary Aspen Grove Aspose Workflow Axonet BEA WebLogic product IBexee IBigbross Bossa BizFlow Biztalk Server 2006 Bonita Borland Together Designer 2006 Bossa Brightwater Software Breeze Business Integration Engine Business Process Management by COSA Cape Clear Orchestrator Captaris Workflow Carnot CaslonSoft Codehaus Werkflow Collaxa Orchestration Server Proprietary Pe NS O P Proprietary Proprietary LANG Proprietary ia eC ee 2 Proprietary ee Proprietary Proprietary p Proprietary Proprietary e Proprietary Proprietary Proprietary COLOSA ProcessMaker Compuware UnifaceFlow BPM con cern CuteFlow Dalma DralaSoft DynaFlow Inc Enhydra JaWE Enhydra Shark eTouch Workflow EventStudio Ezenia Inc Proprietary Proprietary Proprietary Proprietary Proprietary Proprietary e Proprietary e Proprietary e Proprietary Proprietary Proprietary FileNet FlowRunner FloSuite BPM Software Flotiva Flux Freefluo Fuego BPM Galaxia Tikiwiki Proprietary Proprietary Proprietary Proprietary Proprietary Proprietar
99. TA transaction manager Spring Integration Interface 5 Monitoring of the workflows activities is done via log files in table form There is no life cycle management of distributed workflows A particularity is the fact that the graphical modelling tool can produce a timing Gantt chart if there are no cycles in the process Additional interfaces There are no import export facilities of data towards other products like databases file systems repositories UDDI LDAP monitoring of transactions Supported standards Conformity to standards and exchange formats a Process definition tools The process is defined using the graphical modelling tool allowing describing activities conditions events and a direct graph Complex workflows can be easily modeled Supported user interfaces in order to describe the processes the user can launch the local graphical modelling tool or to use its preferred browser to access the con cern web site and activate the Modeler jnlp b Workflow execution tools Run on any J2EE compliant application server It is deployable in open source only environment Linux SAP DB Postgres JBoss is recommended and tested Since con cern runs on a J2EE Server it is possible to communicate with other software components for example SOAP JMS JNDI SMTP CORBA JDBC J2EEE Connector Architecture e g SAP WP2 Business workflow technology analysis and comparison VISP Consortium Page 84 of 239 D2 2
100. The Bonita JMS message service implementation notifies the definition and execution changes within a workflow process Every user interaction is notified to Bonita Kernel and it is throwing a JMS event Bonita activity deadline service uses the Java Management Extensions JMX to advice the user if an activity does not end at the expected date Bonita Jabber service notification that allows the users to receive notifications at real time and exchange different kinds of messages Usability Issues The Bonita system does not include very sophisticated computational steering facilities as a result of which the user does not have complete control over the workflow as it is executing The Bonita system does not include extensive data mapping and data transformation features The ones that exist thus far are very basic Since the Bonita system is developed with Business Organizations in mind it does not handle scientific data very accurately It also has limited visualization features The Bonita system includes very basic decision supporting features and the user has limited ability to define decisions and conditions on his own The Bonita system does not provide extensive verification and validation features while constructing the workflows If an exception is caught during execution the system displays error messages on the screen that may not be completely understood by the user The Bonita system does not allow easy interoperability with other s
101. The selection of the invoked worklet is done at runtime based on a selection condition YAWL Engine has a Web based interface HTML There is also a standalone version of the engine written in Java Swing for testing and evaluating purposes b Workflow execution tools YAWL Engine has been implemented in Java using XML based standards such as XPath XQuery and XML Schema The technical environment needed for the YAWL Engine includes e Java 2 Standard Edition J2SE 1 4 2_07 Apache Tomcat 5 0 28 PostgreSQL 8 if you wish to use database persistence YAWL Editor needs Java 2 Standard Edition Additional libraries are packed in a jar file No additional software is needed in order to run the editor Apache Tomcat ea worklist war ig pea ay eee eo NOES yawl war SS Web Service Be Sa gt a lt ne E Se a rae yawlWSInvoker war iis se eee rn oy Browser http localhost 8080 worklist Figure 4 26 YAWL Engine YAWL Engine Architecture The environment of a YAWL system is composed of YAWL services End users applications and organizations are abstracted as services in YAWL YAWL services include 1 YAWL worklist handler 2 YAWL web services broker 3 YAWL interoperability broker and 4 custom YAWL services The YAWL worklist handler corresponds to the classical worklist handler the inbox and it is used to assign work to users of the system Through the worklist handler users
102. WL specifications Figure 4 25 YAWL Editor Figure 4 27 and YAWL Editor Lite versions YAWL Engine Web application Figure 4 26 YAWL Standalone a Java standalone application with the same functionalities as the Web YAWL Engine WP2 Business workflow technology analysis and comparison VISP Consortium Page 114 of 239 D2 2 Workflow Software Analysis and Comparison Definition of task register lt task id register gt lt name gt Collect information from customer lt name gt lt flowsInto gt lt nextElementRef id flight gt lt predicate gt data want_flight true lt predicate gt lt isDefaultFlow gt a After registering the request for a trip a flight a hotel and or a car lt flowsInto gt are booked followed by a payment lt flowsInto gt lt nextElementRef id hotel gt H lt predicate gt data want_hotel true lt predicate gt lt flowsInto gt lt flowsInto gt lt nextElementRef id car gt lt predicate gt data want_car true lt predicate gt lt flowsInto gt lt join code and gt lt split code or gt lt startingMappings gt lt mapping gt lt expression query data customer gt lt mapsTo gt customer lt mapsTo gt D A trip may consist of several legs The sub process Is instantiated for each lag lt mapping gt lt startingMappings gt lt completedMappings gt lt mapping gt lt expression query data customer gt lt m
103. Whenever the first activity has been started using the User API the process goes to started state The execution of the process is performed by the BONITA enactment engine under control of applications with the User API A process is started as soon as the first activity has started While being executing the process definition still can be modified using the Project API When all activities are terminated the process stays in state started It still can be modified for example new activities can be added A process is terminated once it has been explicitly terminated by an application thru the User API In terminated state the process definition cannot be modified any more F1 3 Event initial result triggering process thread event result correlation Or for F1 5 Event in BONITA called Activity The activity is the basic unit of work within a process Execution of an activity can either be automatic or manual Automatic In this case the BONITA enactment engine will start it as soon as the applicable transitions from preceding activities are successfully evaluated Manual the BONITA enactment engine will not start a manual activity until some application has explicitly started it through the User API Any activity is associated with a role All the users being allocated that role in the scope of the process have the possibility to take over the activity Any activity is enclosed in a Transacti
104. a e ee ee ee Discriminator i Ce ee ee eee ee ee Arbitrary Cycles Ee e e a eee eee Implicit Termination f a a a ee ae ee without A l Synchronization WP2 Business workflow technology analysis and comparison VISP Consortium Page 42 of 239 D2 2 Workflow Software Analysis and Comparison MI with a Priori Design Time Knowledge MI with a Priori Runtime Knowledge H MI without a Priori Runtime Knowledge Deferred Choice Interleaved Parallel Routing f Milestone Cancel Activity Cancel Case Table 3 3 Product Pattern attern roduct IMQSeries Fort Verve hangemg _Flow SAP R3 Sequence Parallel Split Synchronization H a a o Eo Exclusive Choice Simple Merge Multi Choice Synchronizing Merge Multi Merge Discriminator Arbitrary Cycles a ee eooo eooo eooo Implicit Termination MI without Synchronization MI with a Priori Design Time Knowledge MI with a Prior Runtime Knowledge MI without a Priori Runtime sow ane a Deferred Choice FY Interleaved Parallel Routing El Milestone a ae ae ee ee ee ee Cancel Activity ee ee ee ee ee Se ee Cancel Case es SS ee ee eee ee ee From the comparison it is clear that none of the tools support all the selected patterns In fact many of these tools only support a relatively small subset of the more advanced patterns The assessment of these products has been extended in Kiep
105. a elements back and forth External data passed to i Flow in the prologue or epilogue actions of any node are always mapped to so call User defined process attributes UDAs UDAs are variables which hold values in a running process set by a user with a form script or a JavaAction Triggers allow mapping external data from XML files to UDAs By loading a XML schema file mappings can be defined from each element to define UDAs for the activity D Operational aspect i Flow provides communication with external applications over Java Actions A Java Action is a call to a static method on a specified Java class The Java action is configured to pass UDA values as parameters and the result of the method is assigned to a UDA A Java Action can be invoked when a process starts when a node is activated or completed when a timer expires at time of role resolution and when the process ends Many nodes see table 3 1 have the ability to specify a list of actions to be performed when activated Table 3 1 List of nodes and their perspective support for Java Actions Node Prologue Epilogue OR Node yes AND Node yes Condition Node yes Start Node Stop Node Chained Subprocess r yes Activity yes yes Voting Activity yes yes Subprocess yes yes Remote Subprocess we Delay yes yes It is distinguished between Prologue Actions performed in a node before all its other assigned activities are execut
106. a specified modification to be implemented Implementation includes coding designing and documenting changes Weak X Good O Strong O Not applicable cannot assess O Comments 3 Stability the capability of the software to minimize unexpected effects from modifications of the software Weak X Good O Strong O Not applicable cannot assess O Comments 4 Testability the capability of the software product to enable modified software to be validated Weak X Good O Strong O Not applicable cannot assess O Comments 5 Compliance the capability of the software to adhere to standards or conventions relating maintainability Weak X Good O Strong O Not applicable cannot assess O Comments 6 Administrative This category of evaluation criteria considered acquisition installation and maintenance issues that would normally concern a system administrator or someone installing the tool We also tried to consider how adaptable a tool would be as the metadata standard changed or whether a user would have to rely on the support of the tool s creators e Platforms Installation o What hardware software platforms does the tool operate on Comments o Does the tool work on more than one hardware software combination Comments o How much disk space and memory does the tool require Comments o How easy is the tool to install Comments e Stand alone o Is the tool dependent on other software packages or libraries YES NO Not appli
107. about the prospective set of products which have to be used for the VISP developments This project has received research funding from the European Community s Sixth Framework Program This document reflects only the author s views The European Community is not liable for any use that may be made of the information contained therein WP2 Business workflow technology analysis and comparison VISP Consortium Page 3 of 239 D2 2 Workflow Software Analysis and Comparison Abbreviations API Application Program Interface BAM Business activity monitoring ADSL Asymmetric Digital Subscriber Line ASAP Asynchronous Application Service Protocol AWS Active Webflow Standard B2B Business to Business BPDM Business Process Definition Metamodel BPEL Business Process Execution Language BPEL4WS Business Process Execution Language for Web Services BPM Business Process Management BPMI Business Process Management Initiative BPML Business Process Modelling Language BPMN Business Process Modelling Notation BPMS Business Process Management Systems BPQL Business Process Query Language BPSS Business Process Specification Schema BSF Bean Scripting Framework CORBA Common Object Request Broker Architecture CPA Collaboration Protocol Agreement CPP Collaboration Protocol Profile CRM Customer Relationship Management DB DataBase DBMS Database Management Systems DPQ Delivered Product Quality DQ Design Quality EAI Entreprise Application In
108. access Poor workability may indicate that the help library should store the data locally if intellectual property considerations allow this Aspects of workability include also User friendliness Are any special commands clear Is help information available Have user interface issues been addressed such as menu design readability of screens etc Required computing environment Can the product be used with standard equipment and software or are there special software password or network requirements Has the product been designed to work well with one software and user interface Images and other multimedia may create problems if users have not installed the correct support Searching How effectively can information be retrieved for the product functionality Is the product organized in a logical manner to facilitate the functional utilization Is a useful search engine provided What operators and ranking features are available Is the search engine interface intuitive Does the search engine index the whole product Browsability and organization Is the product organized in a logical manner to facilitate the location of the different functions WP2 Business workflow technology analysis and comparison VISP Consortium Page 50 of 239 D2 2 Workflow Software Analysis and Comparison Interactivity Where interactive features such as forms menus are provided do these work Do they add value to the product Connectivity Can
109. actical attempt to evaluate workflow software the products under considerations are i Flow Interstage Business platform of the company Fujitsu Regatta and Websphere MQ Workflow which is part of the Websphere MQ product line of IBM The comparison addresses five general aspects of evaluation functional behavioural operational informational and organizational e The functional aspect presents a functional decomposition of activities in the workflow network e The behavioural aspect focuses on the time It describes the execution order and dependencies of the control flows and activities in the workflow e The operational aspect describes the interaction of the workflow management system with its environment the methods for accessing or invoking external applications e g interaction mode invocation mode parameters and the communication with human users e The informational aspect describes the data exchange between activities The data in a workflow management system can be distinguished to internal data managed by the workflow management system and external data exist even without workflow and might be used e The organizational aspect addresses the resources executing the work The resources can be human employees computers additions necessary for the specific workflow etc The organization can have hierarchical structure and resource allocation to activities has to be done Qualitative Analysis i Flow Interstage Business platf
110. ad to be restricted to a short list of prospective products which are accessible by the VISP consortium for testing However the evaluation process has to tackle a methodological problem which origins from the fact that different experts assess different products The qualification of the experts their experience the variety of the workflow software products and the lack of common evaluation methodology all these factors can strongly influence the results of the product evaluation A second methodological problem arises for the evaluation findings how to quantify the evaluation results to generate a common scale for products comparison This scale is necessary to support the decision making process for finding a restricted set of prospective products for implementation in VISP project and even to make a unique choice which is the target objective for the designers of workflow management systems During the test processes the VISP consortium tried to design its own methodology for evaluation and comparison of the software products This methodology targets the minimization of the subjective influences coming from the different experts The theoretical background of the VISP methodology is founded on consideration to minimize the noise influences which take place in a control and management systems The formal considerations are given below The following notations are used A assessment rate of software product i i 1 N N Number
111. ade applications and thus support the shift from programming to assembling Moreover process orientation redesign and organic growth are supported For example today s workflow management systems can be used to integrate existing applications and support process change by merely changing the workflow diagram Workflow Management Systems Workflow management systems use a large variety of languages and concepts based on different paradigms Most of the products available use a proprietary language rather than a tool independent language Some workflow management systems are based on Petri nets but typically add both product specific extensions and restrictions Other systems use a completely different mechanism For example IBM s MQSeries workflow uses both active and passive threads rather than token passing The differences between the various tools are striking One of the reasons attributed to the lack of consensus of what constitutes a workflow specification is the variety of ways in which business processes are otherwise described The absence of a universal organizational theory and standard business process modelling concepts it is contended explains and ultimately justifies the diversity in workflow languages and the major differences between them What is more the comparison of different workflow products winds up being more of a dissemination of products and less of a critique of workflow language capabilities Web Services Composi
112. ager Functionality Efficiency D Avarage Value O Oracle BPLE Process Manager WP2 Business workflow technology analysis and comparison VISP Consortium Page 228 of 239 D2 2 Workflow Software Analysis and Comparison Process Modeler SAP NetWeaver Exchange Infrastructure Portail iby oa Maintain ability Efficiency E Avarage Value O ProcessModeler D Avarage Value O SAP N ebweaver Exchange Infrastructure WfMOpen YAWL Functionality Functionality A 5 Portability D Maintain abel Efficiency Efficiency DAwarage Value O WittOpen Dfwarage Value OYAWL Engine Following the drawings of the radar diagrams the prospective candidates are the software products Active BPEL Engine Active Webflow Designer Cape Clear Enhydra Shark FreeFlue and Yawl 6 5 Conclusions The evaluations and comparisons between the software products which are targeted for implementation in the VISP project allows narrowing the choice to a restricted set of products An advantage of the product is this one related to it functionality to cover both editing and execution operations for the workflow design and exploitation The prospective set of products is defined as Modelling tools Borland Together Designer Process Modeler Editing tools Borland Together Designer Cape Clear JBoss jBPM and Oracle BPEL Process Manager WP2 Business workflow technology analysis and comparison VISP Consortiu
113. aluators for the assessment process of software products it is beneficial to base the evaluation scheme on common well accepted methodology Our choice was to find appropriate standardization approach which gives ground of this work to be performed in independent way from the applied assessment scheme As successful solution for objective evaluation methodology in this deliverable it has been chosen the international standard ISO IEC 9126 It specifies a common framework WP2 Business workflow technology analysis and comparison VISP Consortium Page 120 of 239 D2 2 Workflow Software Analysis and Comparison for evaluation and comparisons of software products The standard ISO IEC 9126 works out a quality model that categorises software quality attributes into six characteristics which are further sub divided into sub characteristics 5 1 5 2 These sub characteristics are used externally when the software is used as a part of a computer system and their assessment results define the product quality which is an inexplicit influence by the internal software attributes The software quality is assessed addressing the user needs by the definition of evaluation criteria of the product quality in use The standard ISO IEC 9126 describes software quality metrics based on internal software attributes and external computer system behaviour These types of metrics are applicable when specifying quality requirements and design goals for s
114. alysis and comparison VISP Consortium Page 27 of 239 D2 2 Workflow Software Analysis and Comparison 3 Suites for Workflow Software Workflow is the operational aspect of a work procedure how tasks are structured who performs them what their relative order is how they are synchronized how information flows to support the tasks and how tasks are being tracked 3 1 As the dimension of time is considered in Workflow Workflow considers throughput as a distinct measure Workflow problems can be modeled and analyzed using Petri nets Peterson 1981 Reisig 1992 While the concept of workflow is not specific to information technology support for workflow is an integral part of groupware and software Distinction can be made between scientific and business workflow paradigms While the former is mostly concerned with throughput of data through various algorithms applications and services the latter concentrates on scheduling task executions ensuring dependencies that are not necessarily data driven and may include human agents 3 1 Classifications of Software Tools The list of available products for modelling including specification simulation and execution functionality of the workflow management systems is quite long During the D2 2 work a set of 134 software products has been found This set is not complete several of the products could be out of date but they still present in the virtual domain Thus the problem
115. ances BPEL Console is a Web based application that communicates with BPEL Server using proprietary interfaces Auxiliary interfaces BPEL Server offers technology adapters 4 23 to access various resources via generated WSDL interfaces This feature has not been evaluated yet e File adapter FTP adapter Advanced queuing service adapter Database adapter JMS adapter e Oracle application adapter BPEL Designer includes a UDDI browser to retrieve information about available WSDL specifications Supported standards The software supports the BPEL 1 1 standard in detail it supports the activities assign invoke reply receive wait terminate throw compensate empty Together with the control elements e scope e switch e while e pick e flow Additionally it supports BPEL 2 and other enhanced features like e Java embedding e XPath extension functions e Support of BPEL Process Manager Services like o XSLT mapper and transformations WP2 Business workflow technology analysis and comparison VISP Consortium Page 107 of 239 D2 2 Workflow Software Analysis and Comparison Workflow services Worklist applications Notification services eMail voise fax SMS pager Sensors oO0 0 The latter enhancements are only supported by the JDeveloper BPEL Designer Consequently incomplete abstract BPEL 1 1 and WSDL 1 1 specifications can be imported into the BPEL Designer that produces complete executable BPEL 1
116. and efficiency e the quality in use for a person involved in the software maintenance is a result of maintainability e The quality in use for a person engage in product deployment is a result of portability WP2 Business workflow technology analysis and comparison VISP Consortium Page 127 of 239 D2 2 Workflow Software Analysis and Comparison Quality in use is always influenced by any quality characteristics but it contains broader meaning than usability The last addresses features which concern only easy usage and attractiveness of the product Choice of metrics The Workflow software tools can be evaluated from the following points of view e developer using internal measures of the quality characteristics e person responsible for the implementation of the software in different environments using metrics for portability e end user using metrics for quality in use and external metrics for functionality reliability usability and efficiency e maintainer using metrics for maintainability Workflow software s quality characteristics and specifications The quality model for the software evaluation of the Workflow software is chosen in this development to contain six characteristics functionality reliability usability efficiency maintainability portability For each quality characteristic several sub characteristics are chosen which contribute for the quality assessment of the softw
117. apability of the software to avoid failure because of faults in the software Fault tolerance it is the capability of the software to maintain a specified level of performance in cases of software faults or of infringement of its specified interface The specified level of performance may include fail safe capability Recoverability the capability of the software to re establish its level of performance and recover the data directly affected in the case of a failure Following a failure a software product will sometimes be down for a certain period of time the length of which is assessed by its recoverability Compliance it is the capability of the software to adhere to standards conventions or regulations relating to reliability Usability The usability is the capability of the software to be understood learned used and liked by the user when used under specified conditions Usability should address all of the different user environments that the software may affect which may include preparation for usage and evaluation of results The usability sub characteristics are the following Understandability it is the capability of the software product to enable the user to understand whether the software is suitable and how it can be used for particular tasks and conditions of use This will depend on the documentation and initial impressions given by the software Learnability it is the capability of the software product to enabl
118. apsTo gt customer lt mapsTo gt register register do_tineraryS register_Itinerary gt sagment prepare_payment_ Information cancel booking_in progress lt mapping gt cH lt mapping gt e Banay Fi lt expression query data want_flight gt wen segment pay lt mapsTo gt want_flight lt mapsTo gt TS Sh eo ee lt mapping gt c Again the sub process Is instantiated for each leg but now It Is possibile to cancel the whole trip by ramoving tokens from the region tee Indicated lt completedMappings gt lt decomposesTo id register gt lt task gt Figure 4 25 YAWL Specifications Category of the software product Workflow specifications in YAWL language are designed using the YAWL Editor and deployed into the YAWL Engine which stores these specifications in the YAWL Repository The YAWL Repository manages a collection of runable workflow specifications After deployment workflow specifications can be instantiated through the YAWL engine leading to workflow instances or cases The engine handles the execution of these cases The engine can be invoked using the Web interface or from client WS Web Services via YAWL WS Invoker interface Supported interfaces The YAWL engine supports all the 5 interfaces of the WfMC reference model A interfaces capturing the interactions between the YAWL designer an
119. arative chart cceeececeeceeeeeneee eens teen eenes 217 Figure 6 22 Workflow Editors Engines comparative chart sceceeeeeee ene eneeees 218 Figure 6 23 Workflow Editors Usability comparative chart cececeeeeeeeeeeeneee ees 218 Figure 6 24 Workflow Engines Usability comparative chart ccceceeeeeeeeeeeeeees 219 Figure 6 25 Workflow Editors Engines Usability comparative chart 0 000 219 Figure 6 26 Reliability comparative Chart sisare korone id r ernt E NEENA ANKEA KENNEY IA Eoen ees 220 Figure 6 27 Efficiency comparative chart eccecececeeeceeeeneeeeeeeeneneneeaeeaeeees 220 Figure 6 28 Maintainability comparative chart ssesssessseesresserrssrresesessressssressere 221 Figure 6 29 Portability comparative chart ssssssssssssirsesrrssersserresseressereseresseen 221 WP2 Business workflow technology analysis and comparison VISP Consortium Page 10 of 239 D2 2 Workflow Software Analysis and Comparison List of Tables Table 3 1 List of nodes and their perspective support for Java Actions 4 35 Table 3 2 Product Pattern ly 222svasinuiv is ayer tite Tae ea a as 41 Table 3 3 Prod t Patteri 2 meore ke ioiei anean EEE ERER EEA 42 Table 3 4 Matrix wighted evaluation of the software product ceeceee eee eee 51 Table 3 5 Five criteria for evaluating Web pages cccsssecssssressresssrrrrerrrereesen 52 Table 4
120. are product Functionality The functionality is the capability of the software to provide functions which meet specified needs when the software is used under defined conditions This characteristic is concerned with what the software does to fulfil needs whereas the other characteristics are mainly concerned with when and how it does The functionality sub characteristics are the following Suitability the capability of the software to provide an appropriate set of functions for specified tasks and user objectives Accuracy it is the capability of the software to provide the right or agreed results or effects Interoperability it is the capability of the software to interact with one or more specified systems Security the capability of the software to protect information and data so that unauthorised persons or systems cannot read or modify them and authorised persons or systems are not denied access to them Compliance the capability of the software to adhere to application related standards conventions or regulations in laws and similar prescriptions Reliability WP2 Business workflow technology analysis and comparison VISP Consortium Page 128 of 239 D2 2 Workflow Software Analysis and Comparison The reliability is the capability of the software to maintain its level of performance when used under specified conditions The reliability sub characteristics are the following Maturity it is the c
121. are product Using the main categorization scheme for quality assessment of software product an evaluation template is developed Thus using common evaluation scheme the evaluation works the deliverable targets to overcome the general drawback that different evaluator have to evaluate different software products The common evaluation scheme and the derived template are prerequisites for minimizing the evaluation errors A comparative evaluation scheme is developed It allows minimizing the evaluation errors originating from the methodological drawbacks of the evaluation scheme and from the personal incompetence of the different evaluator A relative assessment and comparison is introduced Thus the quality of the products has been assessed by Absolute evaluation notated as RA Pie chart diagrams define these quality assessments An absolute integral evaluation JRA is applied according to weighted assessment scheme Thus a unique value per quality category is found for each software product Arelative evaluation between the products is applied notated as Ajj A block diagrams are defined for these relative assessments which compare the products towards the minimal value of IRA i N A relative evaluation of all products towards the average level of the product quality is evaluated The results of these comparisons are given as radar diagrams The evaluation findings and their graphical interpretation are presented in Chapter 6 of
122. ary wfmOpen Proprietary Proprietary wftk workflow toolkit WinOcular WinOcular Workflow Workflow Systems RAPID WorkMovr A Frame IW orkPoint Workflow Editor WorkTicket com IXFlow2 YAWL ZBuilder Zebra Proprietary Proprietary Proprietary Proprietary Proprietary Proprietary Proprietary Proprietary Proprietary As a result from the survey performed in Chapter 2 it is common wise to select several representatives of the available set of products and to continue their evaluation including installation configuration and trial test The short list of the candidate products has been chosen according to Table 4 2 The reason for this choice has been based on e available current experience of the partners involved the recommendations in the web for different open source products e the availability of market and commercial workflow tool allowed for test and trial purposes WP2 Business workflow technology analysis and comparison VISP Consortium Page 65 of 239 D2 2 Workflow Software Analysis and Comparison The testing and the evaluation activities of the software products have been allocated as follows Table 4 2 Workflow products allocated per partners for test and assessment fs Valtech UAM FhI Fokus Metaware WUT ICCS ejBpm e OpenW e Oracle Enhydra e YAWL Active Endpoints FE BPEL Shark Active Webflow e Biz
123. assaed th bday elu 149 Active Endpoints Active Webflow Standard cc sccsccsccesessesseessceseescenseesceeessecceseeseeeeeseeeeeeeenneneeaes 153 Active Webflow LDE NET oea nens ni a eA AO SIS AO ae 157 BizTalk Servet iinei tie van eee E sng Cease Teak av aves ce Gash EE A TE Bidet eh 161 Borland Together Designer 2006 rion eah A A A NE N e E E e a T E 164 ET AO I 17 ENEI AA A RENEE E EEA E pepe tree A E A 167 20RA A EEA E E A dd od aad anna hase 171 Enhydra Ja WE iriiria oii a E Aa E a AUR e a siglo tases as E en Ea Ea 174 Enhydra Shaik oenina a n E EE EA A EE E E E i 179 EnterpriseXtenti oh aa e e E E E A E e a e aa 182 FreeflhO ron ei tE E E E EREE E RE E OA EE A E N Cee RE 186 JBoss JBPM vasisscsctscseagsibiessesdesc goad eaavistea daze geasveaiaathcdece Sonsaa sapeita enaena at aE aaien aanas aidian 188 ODjECtWED BONITA Mit cite A A E Gag SAA Sak ead et ON A ed ay GA ae 193 ODEN WEE esteceaccc cis yi inaia tes E EEE Pe danas uot iw Sateen pian eaten 199 Oracle BPEL ProCess MANGGOI airet soos chek cna E ca dans bi EEEE dudh cta akg arava E TE baa doe 201 Process Modeleren siete aie a Rana aT E AT eases eae eaves 204 SAP NetWeaver Exchange Infrastructure ccccscccsccsesesessceseeeescesseessecesecesseesscesseceaecesasesaessaesesesenaes 206 WIMOP eI hres E 8 EE EE A caeath deans tite cel E ndash auton Shteea S E 208 VA WL i evat ead ticcess haces a uacadia tetera aaha sand A 211 6 4 COMP ATISOMNS sess ai ecce5ecissessoxtascccocn ss KOTAK E
124. associated to relative WSDL The engine hands Web services to manage both synchronous and asynchronous communication Interface 4 Support of workflow integration and collaboration between different domains and or distributed workflow execution platforms Not applicable Interface 5 Monitoring and administration of the workflows activities Life cycle management of distributed workflows The ActiveBPEL Engine can be managed by BpelAdministration tool It is a web based application which permits to manage workflow activities configure engine parameters persistent storage deployed processes partner definitions processes status alarm and receive queues Additional interfaces import export of data towards other products like databases file systems repositories UDDI LDAP monitoring of transactions Supported standards Conformity to standards and exchange formats The engine supports BPEL 1 1 standard and WSDL catalogs Additionally it supports PDD Format URL and URN resolutions Tamino XML database XPath and XQuery APIs JavaScript and Apache Bean Scripting Framework BSF The engine version 2 0 supports new BPEL activities the Break amp Continue and Suspend activities as defined in the new BPEL 2 0 standard Support for additional WS specifications including e WS Security e WS ReliableMessaging e WS Addressing e WS Policy 4 2 ActiveWebflow Standard ActiveWebflow Standard AWS is a complete BPEL engine r
125. at Do the visual effects enhance the resource distract from the content or substitute for content If audio video virtual reality modelling etc are used are they appropriate to the purpose of the source A related criterion to graphic design is navigational design mentioned below in the context of browsability and organization Purpose What is the purpose of the resource Is this clearly stated Does the resource fulfill the stated purpose Audience Who are the intended users of this resource At what level is the resource pitched a subject expert a layperson or a school student Will the resource satisfy the needs of the intended users Does the user group have the connectivity to access the resource Does your user group correspond to the intended audience Workability Is the resource convenient and effective to use This is the area where criteria for Workflow software resources differ most from print sources Aspects of workability include User friendliness Are any special commands clear Is help information available Have user interface issues been addressed such as menu design readability of screens etc WP2 Business workflow technology analysis and comparison VISP Consortium Page 58 of 239 D2 2 Workflow Software Analysis and Comparison Required computing environment Can the resource be accessed with standard equipment and software or are there special software password or network requirements Has
126. ata like testing if account balance is positive for loan approval task node represents one or more tasks that are to be performed by humans node serves the situation where you want to write your own code in a node but is also responsible for propagating the execution state the process goes into a wait state and waits for a message to resume its execution transitions connect nodes Actions are JAVA classes implementing a given interface They can be executed either on a task and then is responsible for propagating the execution or an event entering leaving a WP2 Business workflow technology analysis and comparison VISP Consortium Page 189 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation node taking a transition F1 2 Process description major minor Processes are called Actions Actions implement the interface ActionHandler provided by jBpm This interface defines only one method to be implemented execute EvoutionContext ec This method is the core method called when the Action is to be executed The parameter EvolutionContext provides access to the process execution context information like accessing variables Processes can perform whatever you want like updating al database Actions can be performed at two different times on an event like entering a node or on a node F1 3 Event initial result
127. ata for revision YES NO Not applicable cannot assess Comments o Are the input formats it will accept flexible YES NO Not applicable cannot assess Comments o What are those formats Comments o Does the tool can import metadata elements from external sources e g a DBMS YES NO Not applicable cannot assess Comments o What hooks are provided to connect the tool with external sources of information Comments e Export capabilities What format does the tool generate Comments o Is there support for multiple output formats YES NO Not applicable cannot assess Comments e Completeness Compliance o Is the output complete compliant with workflow standard formats YES NO Not applicable cannot assess Comments VI MAINTAINABILITY This category of evaluation considers acquisition installation maintenance issues that would normally concern a system administrator or someone installing the tool Integral evaluations for the maintainability categories WP2 Business workflow technology analysis and comparison VISP Consortium Page 143 of 239 D2 2 Workflow Software Analysis and Comparison 1 Analyzability the capability of the software product to be diagnosed for deficiencies or causes of failures in the software or for the parts to be modified to be identified Weak X Good O Strong O Not applicable cannot assess O Comments 2 Changeability the capability of the software product to enable
128. ate a process diagrammatically on the canvas Use the diagrammatic and synchronized Outline view to see a hierarchical element hierarchical view of structure of the process Source view is also available to view process BPEL 1 1 code that ActiveWebflow generates Process Editor Canvas Drag and drop icons onto a canvas to create a process ActiveWebflow creates valid BPEL code and generates a task list for missing and invalid activity properties WP2 Business workflow technology analysis and comparison VISP Consortium Page 73 of 239 D2 2 Workflow Software Analysis and Comparison Web References Add the necessary WSDL files to the Web References view for automatic discovery and organization of all pertinent information stored in existing WSDL Comprehensive searching is available to locate namespaces messages and other elements Drag and drop operations to the Process Editor canvas for automated activity creation Management Data of Sample Add sample data files for all WSDL messages for a convenient repository of test data across all processes using the messages Add multiple files for various test scenarios During simulation test various execution paths using different data Automatic Task Generation static analysis ActiveWebflow generates a problem list for all incomplete or invalid BPEL constructs Thus the problems can be fixed without hunting for them This feature works on i
129. atibility The Shark workflow engine consists essentially of a Java library Applications built on top of it can be hosted by any Application Server examples provided with Shark run on Apache Tomcat F3 4 File formats XPDL XML F3 5 Transaction mechanisms Transactions are supported by Shark transaction manager This component implements and manages persistency of transactions state using a Enhydra DODS relational object mapping Transactions are mapped into SharkTransaction objects and are visible to the client and to the internal shark interfaces Moreover it is possible to use Shark with external transaction F3 6 Supported communication protocol Shark supports SOAP ASAP Asynchronous SOAP Corba Wf XML Due to the exposing of API interfaces other protocols can be implemented if necessary F3 7 Users roles Shark supports user roles mechanisms with its Authentication and UserGroup API The first one is DB based in fact it uses DB for storing and retrieving information about organizational structure and the other one is LDAP based it uses LDAP server for getting organizational information Supports user management e Accounts manage the users of the shark server by defining the new ones deleting the existing ones or changing their properties e Logged displays the list of currently logged users e Mapping enables mapping the package and package s processes participant
130. ation of a workflow facility workflow engine as proposed by the Workflow Management Coalition WfMC and the Object Management Group OMG WP2 Business workflow technology analysis and comparison VISP Consortium Page 111 of 239 D2 2 Workflow Software Analysis and Comparison WfMOpen is based on the WfMCore project that started in summer 2001 as a development initiative within Danet GmbH It was triggered by the observation that implementing configurable workflow processes was a recurring task in several software development projects Workflow software description The workflow component includes and it is based on a set of JAVA interfaces that define an API for a workflow management facility These omgcore interfaces follow OMG s Workflow Management Facility Specification V1 2 very closely while making some changes to adapt the CORBA service to the established design practices for a Java API The workflow engine is designed as a J2EE component It is intended to be integrated in an application that requires a workflow engine Processdefinition Interface 1 XPDL Workflow Engine Resource as 38 Container A gt mers amp Monitoring a Interface 5 e OMG Danet yopcs ase saL OMG RTE Interface 2 t Interface 3 fom Danet Workflow Client Invoked Applications Application Figure 4 23 The workflow engine s architecture The previous image gives a view of engine architec
131. ational research projects Thus their evaluation is based on practical experience The extensions to BPEL4WS 1 1 introduced by Oracle are supported by the Oracle BPEL Process Manager for Developers This tool has been evaluated especially in the context of VISP The functionality of Oracle BPEL Process Manager for Oracle AS Middle Tier has been considered on the bases of the accompanying documentation e Oracle BPEL Designer evaluated e Oracle BPEL Process Manager for JBoss evaluated or WebLogic application server e Oracle BPEL Process Manager for Developers evaluated o JDeveloper BPEL Designer o Oracle BPEL Server o Oracle AS J2EE Container o Oracle Database Lite e Oracle BPEL Process Manager for Oracle AS Middle Tier o Oracle BPEL Server Runtime services Adapters Requires Oracle AS 10g O O O o Oracle Database Lite WP2 Business workflow technology analysis and comparison VISP Consortium Page 105 of 239 D2 2 Workflow Software Analysis and Comparison Category BPEL Designer is a graphical and textual BPEL editor It uses WSDL 1 1 4 17 specifications of the invoked services as input data and produces a BPEL 1 1 specification together with the provided WSDL 1 1 specification as output data After validating the BPEL specification the designer compiles it into a Java jar file that can be deployed on the supported application servers BPEL Server is a workflow execution tool It runs within a Java application
132. ations are used to present the relative assessment A j LJ LN of the products in a bar chart diagrams using the absolute values of the integral product evaluation JRA i 1 N Development of new relative evaluation schemeA i N where T is the average result for all tested workflow software products Thus T represents the average level which is supported from an ideal but not real existing product The comparison of the quality of the product i towards the average value T shows the relative place of the product i concerning the current state of the technology addressing the workflow software The results of these comparisons have been presented by a set of radar spider diagrams The common evaluation template for assessing the software product has been designed according to the chosen methodology in Chapter 4 based on a ISO IEC 9126 standard for the quality of the software product The template consists of the following evaluation categories 1 General categories G Workflow software overview with sub categories G1 1 Workflow software presentation G1 2 Workflow software description G1 3 Category of the software product G1 4 Supported interfaces G1 5 Supported standards Confirming standards and exchange formats 2 Functional categories F Principle functions F1 Modelling process definition F2 Simulation debug WP2 Business workflow technology analysis and comparison VISP Consortium Page 134
133. ave scored more than 4 and they are ActiveWebflow Standard ActiveWebflow Designer Cape Clear Enhydra Jawe Shark Oracle BPEL Process Manager An evaluation of the products per category Editor Engine Editor Engine is performed for the software quality Usability The corresponding block diagrams are Us ability Workflow Editors Products score result m ActiveW ebflow Designer O Cape Clear Ocon cem o enterpriseXtention m Enhydra JaWE E BossjBPM D ObjectWeb BONITA m OpenWFE a Seay BPEL Process Manager o SAP NetWeaver Exchange Infrastructure a Figure 6 23 Workflow Editors Usability comparative chart WP2 Business workflow technology analysis and comparison VISP Consortium Page 219 of 239 D2 2 Workflow Software Analysis and Comparison Usability Workflow Engines Products 6 45 4 25 F 5 75 3 3 2 1 o BActiveBPEL Engine DActiveWebflow Standard E Biztalk Server OCape Gear Ocon cern Enhydra Shark menter prise Xtention m Freefluo m JBoss jBPM o Object Web BONITA E Open FE E Oracle BPEL Process Manager E SAFP NetWeaver Exchange hfrastructure BwfMOPEN DYAWL Figure 6 24 Workflow Engines Usability comparative chart Combine Products Usabilty score result E Active Webflow Designer Active Webflow Standard E Cape Clear Ocon cern O Enhydra JaW E Enhydra Schark enterprise Xtention m JBoss jBPM E ObjectWeb BONITA OpenW FE E Oracle BPEL Process Manager ESAF NetWeaver Exchange hfrastru
134. begin Transaction commitTransaction and rollbackTransaction called on jBpmSession object WP2 Business workflow technology analysis and comparison VISP Consortium Page 99 of 239 D2 2 Workflow Software Analysis and Comparison 4 13 ObjectWeb BONITA BONITA based on WfMC XPDL standard is a workflow system featuring a lot of innovative features like activities that can start in anticipation awareness infrastructure allowing users to be notified of any events occurring during the execution in a given process or automatic activation of user s code according to a defined activity life cycle 4 12 Traditional workflow features like dynamic user roles resolution activity performer and sequential execution are also included in Bonita to support both cooperative and administrative workflow processes BONITA is a fully conformant J2EE application taking advantage of the power and robustness of the J2EE platform The BONITA API is accessible either through EJB s Processes are created using a graphical definition tool or by using the Project interface API A process is defined as a set of activities and an associated execution model The enactment engine takes care of scheduling the activities according to the defined execution model The User API provides full control over the execution of the process for example allowing starting or stopping an activity BONITA supports also dynamic modification of an existing process that
135. bflow Designer Functionality Functionalty DA 5 Portability o Vaintain ability Efficiency Efficiency z 7 D Avarage Value O Active Webflow Designer D Avarage Value DO Active Webflow Standard WP2 Business workflow technology analysis and comparison VISP Consortium Page 226 of 239 D2 2 Workflow Software Analysis and Comparison Biztalk Server Borland Together Designer 2006 Fu wae lity Functionalty Miintainabilty Efficiency sibel D Avarage Value O Borbnd Together Designer D Avarage Value O BrtakSermer Cape Clear Con cern Functionalty 6 X Nbintainaty lt gt tpit ate Efficiency Efficiency D Avarage Value O Cape Gear 645 Aage Vehie tioon oam Enhydra JaWE Enhydra Shark Functionality ae EtAc Efficiency E Avarage Value O Enhydra Ja WE DAvarage Value O Enhydra Shark average WP2 Business workflow technology analysis and comparison VISP Consortium Page 227 of 239 D2 2 Workflow Software Analysis and Comparison EnterpriseXtention Functionalty A Efficiency D Avarage Vahe O enterpriseXtention JBoss jBPM Fu eet Efficiency OD Avarage Value OjBosjBRul OpenWFE Functionalty Niintaingbaty o Efficiency D Avarage Value O Open WFE Freefluo Efficiency DAvarage Value OFreefluo ObjectWebBonita Fuge tignality Efficiency GAvarage Value O Object Web BONITA Oracle BPEL Process Man
136. cable can t assess Comments o Are these provided Comments o Does the tool cause any conflicts with other common software packages on the platform YES NO Not applicable can t assess WP2 Business workflow technology analysis and comparison VISP Consortium Page 144 of 239 D2 2 Workflow Software Analysis and Comparison Comments o Is the tool publicly available YES NO Not applicable can t assess Comments o Is it maintained YES NO Not applicable can t assess Comments o What is the cost of acquiring the tool Comments e Updates o Is there a mechanism to modify update the tool or the input or output it generates YES NO Not applicable can t assess Comments o Can an administrator for example add new menu items or change the order of presentation YES NO Not applicable can t assess Comments o How will the tool be updated when the standard is updated Comments o Will administrators be able to modify the tool appropriately YES NO Not applicable can t assess Comments o How easy is that Comments o Is source code provided YES NO Not applicable can t assess Comments Vil PORTABILITY This category considers acquisition installation and maintenance issues that would normally concern a system administrator or someone installing the tool Integral evaluations for the portability categories 1 Adaptability the capability of the software to be modified for di
137. can accept work items and signal their completion In YAWL the worklist handler is considered a service decoupled from the engine The YAWL web services broker is the glue between the engine and other web services It is unlikely that web services will be able directly connect to the YAWL engine It is desirable not to adapt the interface of the WP2 Business workflow technology analysis and comparison VISP Consortium Page 116 of 239 D2 2 Workflow Software Analysis and Comparison engine to suit specific services The YAWL web services broker acts as a mediator between the YAWL engine and external web services The YAWL interoperability broker is a service designed to interconnect different workflow engines To illustrate that there is not a fixed set of YAWL services we included a custom YAWL service A custom service connects the engine with an entity in the environment of the system YAWL Editor Figure 4 27 is a screen shot of YAWL Editor version 1 3 02 The Editor incorporates and or uses components of the following tools YAWL Engine JGraph 3 1 Proguard 3 2 WofYAWL 0 4 and PostgreSQL 8 0 The Editor offers the facility to validate the workflow export the workflow to YAWL engine and define workflow variables YAWLEditor C YAWL Examples es AU Specification Net Edit Elements Tools Help Wl ela ale slelm Fee eels Pia My Career oY ioj xi Q a
138. ces quality internal influences quality depends on depends on Figure 5 3 Relationship between different types of quality WP2 Business workflow technology analysis and comparison VISP Consortium Page 124 of 239 D2 2 Workflow Software Analysis and Comparison It is not practically possible to estimate all qualitative characteristics internally or externally for all components of a complex software product The same case is met when many user tasks scenarios have to be assessed by means to define the appropriate quality in use During the product quality assessment it is necessary to allocate and to spend different resources time and cost for the product evaluation The amount of the resources firmly depends from the business objectives the application performance of the software it nature and peculiarities of its design process Metrics for qualitative Attributes and characteristics Terms and definitions Quality External quality The extent to which the product satisfies a set of stated and implied needs when it is used under specified conditions Internal quality The set of attributes of the product that determine the product ability to satisfy stated and implied needs when it is used under specified conditions Quality The set of characteristics of a product that bear on its ability to satisfy stated and implied needs Quality in use The extent to which a product can be used by spe
139. cess workflow In the health claims workflow a claim form is first manually scanned and stored into an object database Then the claim is manually indexed in a relational database This information is subsequently analyzed by an automated Assess Claim task The task is performed by an expert system which uses an eligibility database to determine if payment should be made If the claim is rejected a claim representative discusses the claim with the customer and agrees either to make some payment or to reject the claim If payment is made the make payment task accesses the finance database and records the payment The significant differences between this production workflow and either the ad hoc collaborative or the administrative workflow is i the interaction of information systems with the business process and ii the use of automated non human task performers WP2 Business workflow technology analysis and comparison VISP Consortium Page 24 of 239 D2 2 Workflow Software Analysis and Comparison Sean Claim Form Figure 2 4 Production workflow Administrative Workflow corresponds to well defined processes related to day to day operations such as purchase orders travel requests expense forms and personnel management processes It imposes less restrictive performance requirements uses stable processes and frequently runs with simple forms and document attachments Many processes can co exist in the same sy
140. cess thread F1 2 Process description major minor WP2 Business workflow technology analysis and comparison VISP Consortium Page 207 of 239 D2 2 Workflow Software Analysis and Comparison F1 3 Event initial result triggering process thread event result correlation F1 4 Flowline F1 5 Definition of organization units F1 6 Junctions F2 Simulation debug Not applicable F3 Execution workflow engine F3 1 Processes Deployment Business Processes and Business Scenarios are stored initialization repositories in a repository called Integration Repository and brought to the Integration engine for execution F3 2 Management of distributed workflows F3 3 Application Server N A Compatibility F3 4 File formats F3 5 Transaction mechanisms Transactions are supported with BTP protocol F3 6 Supported communication Communication protocols supported are SOAP protocol HTTP S FTP SMTP FILE JDBC JMS F3 7 Users roles F4 Workflow client applications F4 1 User interface technologies Workflow clients can be of various types grace of client application type the great number of adapters available to proprietary heavy weight user communicate with external applications clients or general purpose light weight browsers F5 Integration with other workflow engines Supported stan
141. cified users to meet their needs to achieve specified goals with effectiveness task efficiency and satisfaction in a specified context of use Quality model The set of characteristics and the relationships between them which provide the basis for specifying quality requirements and evaluating quality Software and user Software All or part of the programs procedures rules and associated documentation of an information processing system Software is an intellectual creation that is independent of the medium on which it is recorded Software product The set of computer programs procedures and possibly associated documentation and data designated for delivery to a user The set of the software products include also intermediate products intended for users like developers and maintainers User An individual that uses the software product to perform a specific function Users may include operators recipients of the results of the software or developers or maintainers of software Measurement Attribute Characteristic A measurable physical or abstract property of an entity Direct measure A measure of an attribute that does not depend upon a measure of any other attribute WP2 Business workflow technology analysis and comparison VISP Consortium Page 125 of 239 D2 2 Workflow Software Analysis and Comparison External measure An indirect measure of a product derived from measures of the behaviour of the system of
142. cked into a bpr file and then the process is ready to be deployed F3 5 Transaction mechanisms WS Transactions F3 6 Supported communication protocol SOAP F3 7 Users roles BPEL defines several constructs to identify roles and relationships used in interactions WP2 Business workflow technology analysis and comparison VISP Consortium Page 155 of 239 D2 2 Workflow Software Analysis and Comparison F4 Workflow client applications F4 1 User interface technologies Generic SOAP client or JAVA API client application proprietary heavy weight user clients or general purpose light weight browsers type F5 Integration with other workflow engines Supported standards F5 1 Possibilities for collaboration AWS supports BPEL standard for choreography with other workflow engines and orchestration of services and WSDL SOAP standards conventions so the collaboration should be based on these standards F6 Administration and monitoring F6 1 Life cycle management Web based consoles allow the configuration and administration of the server s execution environment and deployed and running processes The Engine console pages allow the main settings of the engine to be viewed and managed e Enable and disable process instance logging e Turn on and off message validation e Enable or disable BPEL extensions e Set en
143. competence is subtracted for the overall evaluation to A jA Thus for the final evaluation rating A according to scheme 5 2 the incompetences of the evaluators influence slower the result when the errors are from the same sign in comparison to the absolute evaluation scheme residing on 1 Consequently the relative assessment of the products following 5 2 has three general benefits theerror from the evaluation methodology is suppressed the evaluation findings are influenced by the difference of the evaluator s incompetence not from their absolute values for the VISP experts according to their real work during the test of the software products their absolute incompetence vanish limel t gt 0 Vi lN WI 1LM Following these theoretical findings for the assessment of the software products the work in D2 2 has been conducted in the following order Design of a common evaluation template for the assessment of the quality of the software products The evaluation template has to support the experts by decreasing their incompetence This is achieved by adding more questions for hinting the experts in the workflow software product implementation Derive appropriate qualitative scheme and to identify scores for the quality of the products Particularly a quantification scheme has been developed to estimate the relative assessments RA i 1 N for each product The results of these estimations have bee
144. ct FRETRIS FRETRIS The evaluation criteria have been classified as follows General Considerations Hereafter are described the pointers for evaluating software and also as a source of specific information Content amp Evaluation e Who is the audience What is the purpose of the Software product amp what does it contain How complete and accurate are the information and the links provided What is the relative value of the Software product in comparison to the range of information resources available for this topic What other resources print amp non print are available in this area What are the date s of coverage of the site and site specific documents How comprehensive is this Software product What are the link selection criteria if any Are the links relevant and appropriate for the Software product Is the Software product inward focused pointing outward or both Is there an appropriate balance between inward pointing links inlinks amp outward pointing links outlinks Are the links comprehensive or do they just provide a sampler What do the links offer that is not easily available in other sources Are the links evaluated in any way Is multimedia appropriately incorporated How valuable is the information provided in the Software product intrinsic value Source amp Date e Who is the author or producer WP2 Business workflow technology analysis and comparison VISP Consortium Page 56 of 239 D2
145. cture OvAWL Figure 6 25 Workflow Editors Engines Usability comparative chart For integral evaluation of the quality of the tested product a common comparison has been performed for the other main software quality categories reliability efficiency maintainability portability The comparative assessments are given below WP2 Business workflow technology analysis and comparison VISP Consortium Page 220 of 239 D2 2 Workflow Software Analysis and Comparison Reliability 6 5 Fi 4 i 3 g 2 1 0 pActiveBPEL Engine a Active Webflow Standard DActiveW ebfiow Designer OBiztalk Server BBorland Together Designer 2006 E Cape Clear Ocon cem E Enhydra JawE BEnhydra Shark o emerpriseXtertion Freefiuo E JBoss jBPM ObjectWeb BONITA B OpenWFE OOracle BPEL cite te peat O Process Modeler oSAP NetWeaver Exchange Infrastructure oOWfMOpen o YAWL Engine Figure 6 26 Reliability comparative chart Efficiency 6 5 4 3 2 1 0 ActiveBPEL Engine D Active Webflow Standard OActiveWebflow Designer D Biztalk Server Borland Together Designer 2006 B Cape Clear con cerm B Enhydra Ja WE m Enhydra Shark o enterpriseXtention m Freefluo m JBoss jBPM m ObjectWeb BONITA m OpenWFE O Oracle BPEL Process ere m Process Modeler m SAP NetWeaver Exchange Infrastructure OWfMOpen OYAWL Engine Figure 6 27 Efficiency comparative chart WP2 Business workflow technology analysis and comparison VISP Consortium Page 221 of 2
146. d Product Quality RPQ is what is actually defined in the quality requirement specification Quality requirements should be defined in the quality requirement specification RPQ should consist of not only the optimal requirements to the product but also the minimum requirements which it has to satisfy Design Quality DQ is the quality supported by the core parts of the product achieved during the stage of it software design This quality address the software architecture of the product it program structure the user interface design s strategy DQ is the reflection of the design philosophy and implementation strategy Details of the software quality may be improved during the tasks of code implementation and code testing Estimated Product Quality EPQ is the quality that is estimated or predicted for the final software product quality after the completition of every stage of the product development This quality category is closely related to DQ Delivered Product Quality DPQ is the quality of the delivered product typically tested in a simulated environment with simulated data During the tests the bigger part of the faults are discovered and eliminated However some faults may remain after testing Quality in Use QIU is the user s view of the quality of a system containing software and is measured in terms of the result of using the software Users refers to both end users and maintainers The quality in the users envir
147. d graphical modelling editor The business process diagram WP2 Business workflow technology analysis and comparison VISP Consortium Page 205 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation tools palette in the editor provides the upper basic elements for designing a BPMN diagram The user can drag and drop elements to a BPMN diagram and set after that their properties in a special window F1 2 Process description not applicable major minor F1 3 Event initial result In BPMN events are Start events End events and triggering process thread Intermediate events event result correlation Processes are Tasks or Sub Processes expand or collapsed Process Modeler contains these elements F1 4 Flowline Process Modeler fully supports BPMN 1 0 So every kind of Flowline modelling is possible if it is possible in BPMN F1 5 Definition of In BPMN organizational units are Groups Pools or organizational units Lanes Process Modeler contains these elements F1 6 Junctions Process Modeler fully supports BPMN 1 0 So every kind of junction is possible if it is possible in BPMN F2 Simulation debug It is not applicable BPMN is not an executable format F3 Execution workflow engine It is not applicable BPMN is not an executable format F4 Workflow client applications It is not applicable BPMN is not an executable format
148. d the run time system It consists of the execution interface seen by end users and the workflow engine an execution environment that assists in coordination and performing the processes and activities Applying this categorization of the software tools for business and scientific workflow systems an available list of products 3 2 is the following e Tools for business workflow o enterprise o Aegeanet System http www groiss com en index html http www aegeanet system com o Agentflow o Amazonas Worflow http www flowring com flowring en_page http objeng ch web oe sw index jsp products awf awf de html o Bonita o Business Integration Engine http bonita objectweb org http www brunswickwdi com what_is_b ie o Business Process Management o Captaris http www cosa de BPM_Produkte html http www captaris com workflow o COLOSA o EmeriCon http www colosa com http www emericon com index html o Enhydra Shark o EventStudio http shark objectweb org http www eventhelix com EventStudio o FlowRunner o iKE http www brightsoft com http www ike com o Ils process o infoRouter http www ilogs com en html index php http www inforouter com o IngTech Corporation o Interstage BPM http www ing tech com http www fujitsu com global services so ftware interstage products bpm o Jboss jBPM o K2 net Enterprise Workflow http jbpm org http www k2workflow com Default aspx o MyContr
149. d the YAWL manager on the one hand and the YAWL engine on the other and B interfaces capturing the interactions between the YAWL services and the YAWL engine The group of interfaces A corresponds to Interface 1 Process Definition tools and Interface 5 Administration and Monitoring tools The group set of interfaces B corresponds to WfMC s Interface 2 3 Workflow Client Applications and Invoked Applications and Interface 4 Workflow Interoperability Both interfaces A and B are specified in WSDL Users interact with the YAWL system through a Web browser Notice that for Interface 1 YAWL workflows are stored in a XML file which does not comply with any standard Neither the engine nor the designer does not offer support for import export facilities from to other WF languages WP2 Business workflow technology analysis and comparison VISP Consortium Page 115 of 239 D2 2 Workflow Software Analysis and Comparison Additional interfaces Import export of data to other products databases repositories etc is not supported Supported standards a The process is modeled using YAWL Editor GUI implemented in Java Swing YAWL is an advanced workflow language Complex workflows can be modeled easily Two mechanisms for linking one process to another are provided static linking design time directly using YAWL editor and language constructs Dynamic linking using YAWL worklets see worklet description below
150. d the conditions that enable or disable them during workflow execution JaWE has three types of transition simple self routed and circular Simple transition is link between two activities represented graphically with one straight line Self routed transition is link between two activities which is graphically broken in three parts but essentially they do not differ in the XPDL logic they are representing and circular transition is transition from activity to itself and is graphically represented as a circle with an arrow F2 Simulation debug Not applicable Not applicable Not applicable Not applicable Not applicable F3 Execution workflow engine F4 Workflow client applications F6 Administration and monitoring Functional Auxiliary Functions FA1 Statistics Not applicable FA2 HELP Functionalitis Support F5 Integration with other workflow engines Supported standards II Integral Characteristics Enhydra JaWE Characteristics weak pood strong can t score ISO IEC 9126 assess result Functionality 60 20 20 3 6 Reliability 25 75 1 5 Usability 62 5 12 5 25 3 25 Efficiency 100 4 Maintainability 20 80 0 8 Portability 20 40 40 2 WP2 Business workflow technology analysis and comparison VISP Consortium Page 179 of 239 D2 2 Workflow Software Analysis and Comparison III Pie Charts Functionalit
151. dards F5 1 Possibilities for collaboration Workflow collaboration can be achieved with web with other workflow engines services ends It also supports WSCI for standards choreography workflow F6 Administration and monitoring F6 1 Life cycle management F6 2 Supervising capabilities Process status F6 3 Flexibility to workflow participants WP2 Business workflow technology analysis and comparison VISP Consortium Page 208 of 239 D2 2 Workflow Software Analysis and Comparison II Integral Characteristics SAP NetWeaver Exchange Infrastructure Characteristics can t score ISO IEC 9126 Weak good steong assess result Functionality 60 20 20 3 6 Reliability 25 50 25 2 5 Usability 75 25 3 Efficiency 33 34 33 2 02 Maintainability 20 60 20 2 8 Portability 20 40 40 2 III Pie Charts Functionality Reliability Usability 50 Efficiency Maintainability Portability 20 20 20 3 3 oy wn 0 1 0 0 40 OWeak BGood OStrong OCan t assess Figure 6 17 Pie charts for SAP NetWeaver Exchange Infrastructure s characteristics WfMOpen I Functionality Principal Functions F1 Modelling process definition Not applicable the WfMOPEN only features the WF engine WP2 Business workflow technology analysis and comparison VISP Consortium Page 209 of 239 D2 2 Workflow
152. de in such a way that it is clear that an external resource is being referred to Quality of writing Is the description of the product is well written The quality of writing is important for the content of the product description to be communicated clearly Graphic and multimedia design Is the product is interesting to look at Do the visual effects and working examples enhance the product or substitute the product If audio video virtual reality modelling etc are used are they appropriate to the purpose of the product presentation Purpose What is the purpose of the product Is this clearly stated Does the resource fulfill the stated purpose Audience Who are the intended users of this product At what level is the product pitched a subject expert a school student Will the product satisfy the needs of the intended users Does this user group correspond to the intended audience Reviews What do other reviewing services say about the product The use of reviewing journals has been a mainstay of collection development in print collections In the Internet environment the evaluator will need to become familiar with the strengths and weaknesses of the range of virtual sources reviewing the product Workability Is the product convenient and effective to use An issue in providing access to electronic help documents is whether a help library should just provide links to the originating site or acquire the publication for local
153. de of the dialog Then the user should enter some mapping parameters for tool agent When a mapping of the application definition to the tool agent is done shark will try to connect to the proper tool agent and ask him to execute its application and will retrieve the results of execution Here is the brief description of parameters that the user can enter when mapping of the application is performed e User name and password not required for tool agents distributed with Shark Some other tool agents can use it when calling applications that require login procedure e Application name the name of application that should be started by tool agent i e for JavaClassToolAgent that would be the full name of the class for RuntimeApplicationToolAgent it would be the name of executable file that should be in the path of the machine where tool agent resides For JavaScriptToolAgent this can be either the name of the java script file or the java script itself depending on Application mode attribute for SOAPToolAgent it is the location of WEB service WP2 Business workflow technology analysis and comparison VISP Consortium Page 91 of 239 D2 2 Workflow Software Analysis and Comparison and for MailToolAgent it is a class of MailMessageHandler called to actually send receive mails e Application mode various tool agents use this attribute for different purposes The RuntimeApplicationToolAgent uses mode 0 to indicate that it should not fi
154. defined which was used for making a short list with choice for prospective list of products which are applicable for the VISP project To make a decision for the product which would be applied in the VISP project additional investigations have been done by testing and validating the functional potential of the workflow software products Because it was unreasonable and unrealistic to perform tests installations training and validation with all available and overviewed products presented in the previous chapter the partner consortium decided to prepare a prospective short list of products This list will be targeted for precise evaluation and comparison The role of the short list of the software products is to restrict the amount of additional investigations by means to find appropriate products for the project developments The short list has been extracted from the set of products which meet workflow standardization requirements In Table 4 1 a classification of the products related to workflow standardization initiatives has been done Table 4 1 Long list of products supporting standardization initiatives products tandard Others enterprise Web Workflow System Proprietary Abydos Suite Proprietary ActionWorks Process Builder Proprietary ActionWorks Process Engine Proprietary ActiveBPEL f Proprietary ActiveWebflow Server T Proprietary Active Webflow Professional Designer f Proprietary ADONIS O
155. domain of the document what institution e What credentials are listed for the authors e Where is the document published Check publishes this document eee e Does the publisher list his or her qualifications 3 Objectivity of Web Documents Objectivity e What goals objectives does this e Determine if page is a mask for advertising page meet if so information might be biased e How detailed is the e View any Web page as you would an information infommercial on television Ask yourself WP2 Business workflow technology analysis and comparison VISP Consortium Page 53 of 239 D2 2 Workflow Software Analysis and Comparison e What opinions if any are why was this written and for whom expressed by the author 4 Currency of Web Documents e When was it produced e When was it updated e How up to date are the links if Currency e How many dead links are on the page e Are the links current or updated regularly e Is the information on the page outdated any 5 Coverage of the Web Documents Coverage e Are the links if any evaluated e If page requires special software to view the and do they complement the information how much are you missing if documents theme you don t have the software e Is it all images or a balance of e Is it free or is there a fee to obtain the text and images information e Is the information presented e Is there an option for text only or frames or cited correctly a
156. ducer Comments Price options Comments Open platform Comments Platform specific Comments Server Purchased Comments Hosted Comments License fee Comments Content covered Comments Intended audience s Comments Documentation provided useful Comments Program free of bugs amp errors Comments WP2 Business workflow technology analysis and comparison VISP Consortium Page 146 of 239 D2 2 Workflow Software Analysis and Comparison Entry level skills required describe Comments Computer skills required describe Comments Other technical skill requirements Comments describe Distribution policy installation Comments Distribution policy download Comments Market share and position in the market Comments maintenance Market share and position in the market Comments technical support 5 4 Conclusions The overview performed for the methodologies used for the evaluation of software products and information resources demonstrates that the evaluation methodology can be strongly influenced by subjective reasons These influences can origin from both the evaluation methodology the choice of the criteria the incompetence of the experts and the users expectations from the software product To minimize these subjective influences this work gives preferences to the standardization approach by performing a comparison of the product according to the recommendations of the standard ISO IEC9126 for assessing the quality of the softw
157. e 169 of 239 D2 2 Workflow Software Analysis and Comparison details cannot be changed after deployment so one must make changes to the configuration before deploying the Web service F3 2 Management of distributed Cape clear 6 5 workflows supports either being called workflows in a more global workflow or call other distant workflow F3 3 Application Server CapeClear 6 5 engine can be run on the following Compatibility application servers e jBoss e WebLogic e Websphere e Tomcat F3 4 File formats The WSDL files describing the business process as well as the partners services are stored under the ws directory of the project The BPEL script is stored in the WS WSAR_INF directory of the project with a bpel extension In the same subdirectory is the ws_application xml file in which can be configured the URL of the WSDL file this service implements the URL of the BPEL file whether to load or not the service if the validation of the BPEL file does not succeed F3 5 Transaction mechanisms Scopes can be defined so that exceptions can be caught in a compensation block but remote transactions aren t supported Note that compensation is not supported in the runtime of the tested version 6 5 F3 6 Supported communication Cape Clear 6 5 supports a various number of protocol communication protocols e SNMP for administration e JMS Java Messaging Service for asynchronous me
158. e COSA is a Petri net based workflow management system developed by Ley GmbH formerly operating under the names Software Ley COSA Solutions and Baan e FLOWer is Pallas Athena s case handling product e DominoWorkow is the workflow extension of the widely used groupware product Lotus Domino Notes Lotus IBM WP2 Business workflow technology analysis and comparison VISP Consortium Page 41 of 239 D2 2 Workflow Software Analysis and Comparison Eastman Software offers a variety of imaging products Their software is used to electronically capture share display fax print and store vital document based information On top of their imaging products Eastman Software also offers a workflow management system Visual WorkFlow is one of the market leaders in the workflow industry It is part of the FileNet s Panagon suite Panagon WorkFlo Services that includes also document management and imaging servers Fort Conductor is a workflow engine that is an add on to Forte s development environment Forte 4GL formerly Forte Application Environment Meteor Managing End To End OpeRations is a CORBA based workflow management system developed by members of the LSDIS laboratory of the University of Georgia USA Mobile is a workflow management system developed by members of the Database Systems group at the University of Erlangen Nurnberg Germany MOQSeries Workflow is the successor of IBM s workflow offering FlowMark Staffware
159. e art analysis with a comparison of workflow software products A special emphasis is placed on the comparison of existing Open Source software supporting the different workflow technologies since the project intends to integrate existing software solutions not to redevelop what already exists The developments in the deliverable begin with the identification of the importance of the automation for the design implementation and exploitation of workflow management systems An extensive survey is performed about the products software suits and programs which deal with different aspects of the workflow management Classifications of these products have been done concerning their internal software origin their sets of functionalities and targeted domains of implementation Because of the different functional nature of the products the problem for the evaluation and comparison of these products has to be resolved It has been analyzed the current experience addressing the comparison and evaluation of different software products and the methodological solutions applied for the assessment of relatively different software suits The lack of direct quantitative evaluations of the products required the works in this deliverable to be directed towards getting personal experience of them Thus the deliverable work involve installation configuration and trial test of a several software products chosen among the set of candidate technologies The products hav
160. e been tested and personal experience has been got about the product potential An evaluation methodological scheme was designed which minimizes the subjective influence of the experts for their personal evaluation findings A common evaluation scheme based on objective requirements towards the products derived from the standard ISO IEC 9126 for the quality of the software products was designed Following the requirements of the standard a template has been designed for a common framework of the evaluation of the software products The results from the assessment have been summarized and classified The products have been classified in four general functional groups e Modelling Tools e Workflow Editors e Workflow Engines e Combined Products Editor Engine For each group appropriate weighted evaluation scheme has been performed The prospective products were identified as WP2 Business workflow technology analysis and comparison VISP Consortium Page 233 of 239 D2 2 Workflow Software Analysis and Comparison Modelling tools The modelling tools which are prospective for the next VISP developments could be the products based on BPMN and UML standardization methodology Particular interest for the project developments are the tested products Borland Together Designer Process Modeler UML Tools Editing tools Borland Together Designer Cape Clear JBoss jBPM and Oracle BPEL Process Manager Execution tools Acti
161. e functional evaluation of the characteristics of the short list products are presented in Chapter 6 It is described the methodology for the comparison of the products proposed and developed by the VISP partners In the Conclusion paragraph a suggestion is made that for the next project developments the VISP partners are not restricted to use only one product but to have the opportunity to choose more than one workflow software product These conclusion origins from the fact that it exists now several useful workflow software products appropriate for VISP utilization These products can combine functionalities in modelling editing and executing workflow objects and tasks However the important issues are that these products have to support common workflow standards which are used for the development and implementation of workflow systems The deliverable suggests a set of recommended tools which are prospective for the VISP project developments WP2 Business workflow technology analysis and comparison VISP Consortium Page 13 of 239 D2 2 Workflow Software Analysis and Comparison 2 Importance of Workflow Automation 2 1 Introduction To implement automation techniques and control methods in the business processes it is necessary to apply modelling techniques for the non technical and organizational systems and to extend the functionalities of the informational computer driven systems in the organizations Over the last decade th
162. e the user to learn its application Operability it is the capability of the software product to enable the user to operate and control it Attractiveness it is the capability of the software product to be liked by the user Compliance the capability of the software to adhere to standards conventions style guides or regulations related to usability Efficiency The efficiency is the capability of the software to provide the required performance relative to the amount of resources used under stated conditions The efficiency sub characteristics are the following Time behaviour it is the capability of the software to provide appropriate response and processing times and throughput rates when performing its function under stated conditions WP2 Business workflow technology analysis and comparison VISP Consortium Page 129 of 239 D2 2 Workflow Software Analysis and Comparison Resource utilisation the capability of the software to use appropriate resources in an appropriate time when the software performs its function under stated conditions Compliance it is the capability of the software to adhere to standards or conventions relating to the efficiency Maintainability The maintainability is the capability of the software to be modified Modifications may include corrections improvements or adaptation of the software to changes in environment and in requirements and functional specifications The mainta
163. e unique choice of product could not be the right strategy for implementation The benefit of the existence of different and wide available products has to be consumed by allocating rights for the choice for the different workflow partners in the workflow integration However the definition and exploitation of a common business distributed workflow system has to respect common standards for modelling and execution of the workflow tasks Thus the integration can be achieved despite the different software products which are used but based on a common used standardization and methodological approach WP2 Business workflow technology analysis and comparison VISP Consortium Page 232 of 239 D2 2 Workflow Software Analysis and Comparison 7 CONCLUSIONS This deliverable contains the results of the analysis and comparison of different business workflow products which are implemented for the stages of modelling simulation and exploitation of workflow management systems The diversity of these technologies and of the existing workflow specification activities makes difficult the right technological decision about the two key aspects that affect the entire life cycle of any eBusiness development the choice of a choreography language and of an orchestration language Respectively to find the prospective products implementing such modelling and execution tasks is an ambitious and not easy task The deliverable D2 2 performs a state of th
164. eate Package Name Version v gt Initial workflow processes Create Account disable x D gt Initial workflow processes HTML Generation disable X O gt Initial workflow processes Service Registration disable x O gt Initial workflow processes Simple Session HTTP disable x D I Start in debug mode Remove Read of a process definition XPDL Browse Submit Done Figure 4 24 The workflow engine s application 4 19 YAWL Workflow software overview YAWL is a new powerful workflow language Yet another Workflow Language It was inspired by the Petri nets as a starting point and mechanisms to allow for a more direct and intuitive support of the workflow patterns have been added While not a commercial language itself it encompasses these languages and in addition it has a formal semantics YAWL supports the control flow perspective and the data perspective However it is important that relations with the resource perspective are investigated and formalized YAWL language supports the following elements atomic tasks composite tasks conditions one input condition and one stop condition Each task can have multiple instances A task can be AND OR XOR split task or AND OR XOR join task YAWL provides a notation for removing tokens from one specified region the cancellation region Figure 4 25 presents these elements in detail Workflow software description YAWL environment is composed of the YA
165. eated in the BPMN project can later be mapped and exported to BPEL WSDL files with the help of the Export command on the File menu Together Designer 2006 provides a special view for the BMPN validation After the validation the tool creates a list of problems with information about potential reasons From the context menu the user can quickly find on the diagram the element which could not pass the validation The tool provides comprehensive documentation and examples for the business process modelling on BPMN The following BPMN elements are supported and can be mapped to BPEL 1 1 Details about BPMN are provided in deliverable D2 1 Process Structure Flows and Sequences Starting and Ending of Business Processes Executing Tasks Sequentially Executing Tasks in Parallel Flow Inside Flow Exclusive Gateways Exception Flows non standard mapping Elements e Business Processes Events Activities Gateways Message Flow The following list shows the BPMN elements that are not supported in the evaluated version Artifacts The mapping is not provided by specification Complex gateways The mapping is not provided by specification Lane The mapping is not required by specification Cancel events The mapping is not provided by specification Inclusive gateway It is not supported in this version Manual tasks and script tasks Their implementation is server dependent Independent subprocesses Service tasks should be used instead
166. eates representations of BPEL processes When an incoming message triggers a start activity the engine creates a new process instance and starts it running The engine takes care of persistence queues alarms and many other execution details The ActiveBPEL engine runs in any standard servlet container such as Tomcat 5 5 and supports Java 1 5 Moreover the engine boasts automation features such as static analysis process persistence and process versioning WP2 Business workflow technology analysis and comparison VISP Consortium Page 67 of 239 D2 2 Workflow Software Analysis and Comparison Supported interfaces Interface 1 Exchange of workflow descriptions models choreographies orchestration between the tool and other modelling tools repositories workflow execution tools The ActiveBPEL engine can import either 1 X or 2 0 Process Deployment Descriptor PDD Partner Definitions PDEF WSDL BPEL and BPRD deployment files Interface 2 Supports the invocation of workflow engines by workflow clients Implementation of the interface by WSDL interface or a programming language interface The workflow engine can be invoked using distribution java API or by SOAP calls Interface 3 Application invocation which perform additional workflow activities Implementation of the interface by WSDL interface programming language interface notification mechanism for human actions The engine can invoke Web services which are
167. eaver Exchange Infrastructure eeeesceseccsceceneceseecaceceeeceaeeeeeesees 109 4 18 WIMOP EDs cecscssasesccsscectesessnsacccesacsestenss savececesagcnstenseeciestdedhanemtpn odes EAE IEEE RY 110 ALVQO YAW E EE E A EE EAE 113 WP2 Business workflow technology analysis and comparison VISP Consortium Page 7 of 239 D2 2 Workflow Software Analysis and Comparison 4 20 Survey of UML Modelling Tools 0 cece scesccssseeseeceseeeseeeseeeeeeseeeseesseeeseeenaeeees 117 4 21 Assessed Software and Corresponding Covered Technologies esceeeeeeees 118 5 Software Evaluation Methodologies eeeeeesccesecesecenecesceceseceseecaceceeeceneeeeeesnes 119 5 1 ISO IEC 9126 Evaluation Plano ecccccccsscccsseceesneeeseeeccseeceeeeceeeeeceueeesneeenaees 119 5 2 VISP Methodology for Comparison of the Workflow Software Products 130 5 3 VISP Template For Evaluation Workflow Software Products ceeeeseeereeeees 134 DAS Conclusions ss aicellessen hadtecteen sateen teehee eee a E Seated deco EE eaten 146 6 Evaluation Findings 0 cccccccescceessccesseecesseecesaceeseeeeeseecesaeeenaeceeseecesaeeeeseeeeeeeeeaas 147 6 1 Introductions inene ei a EA EE EE R AERE 147 6 2 Functional Evaluation Of Characteristics Of Short List Products 00 0 0 147 6 3 Evaluation Se re a ec pier aston esti node T webs a a eevee oubeles 149 ACTIVEBPEL PN gine ananena ae a y By ehabda aids oraplnsslbcahoteditas vane tanetedoadedinange
168. ected Supported Interfaces Interface 1 AWS uses BPEL descriptions for the processes and WSDL descriptions for the services They files can be created manually or using Active Webflow Designer Interface 2 ActiveBPEL engine starts with the servlet container In order for the engine to execute a BPEL process several files must be packaged in a business process archive bpr file for deployment The basic business process archive includes e BPEL process bpel file WSDL file s referenced in the BPEL process wsdl file WSDL catalogue xml file Process deployment descriptor pdd file Optionally a partner definition file pdef file These files can be created manually or using ActiveWebflow Designer Interface 3 WS applications with a valid partner link type in the associated WSDL can be invoked using generic SOAP client and Java client application Interface 4 Support of workflow integration and collaboration The collaboration should be possible and be based on SOAP WSDL standards Interface 5 AWS provides comprehensive management and administration capabilities Web based consoles allow the configuration and administration of the server s execution environment and deployed and running processes WP2 Business workflow technology analysis and comparison VISP Consortium Page 71 of 239 D2 2 Workflow Software Analysis and Comparison 4 3 ActiveWebflow Professional Designer Introduction ActiveWebf
169. ed and epilogue Java Actions performed as closure actions in a node Java Actions allow executing Java business methods that are outside the scope of i Flow By using Generic Java Actions it is possible to use methods within autonomous Java classes A Java Action can pass an Enactment context to the invoked application which constitutes an API that can be used to retrieve information out of the process instance Action Sets can also execute rules Rules have to be defined in a rules file created with a supported rules engine The rules engine must have access to the i Flow Business Object Model used by i1 Flow to implement the rules created by the rules engine E Organizational aspect At design time template owners have the option of assigning process ownership Ownership can be assigned to any i Flow role or set of users Activities are assigned to a role a user or a set of users If more than one user is assigned each assignee receives a separate activity in the Activity List Every user has its own profile defining the way the user is notified when a work item is assigned and the association of a DMS directory for its user ID The reassignment Java action allows reassigning tasks A task can either be manually reassigned or automatically to a user or users with the predefined Assign Task to User Action A work item owner can also reassign the task to any other role whereas the new owner can accept or reject the reassignment The directory adap
170. ed by applying a set of criteria for Internet based information resources 3 26 Because the project VISP targets developments and implementation of informational functionalities for Internet based systems the evaluation scheme has to consider the peculiarities of the informational systems The basis of the applied evaluation methodology Smith 1997 is described below As a descriptive list of requirements important features of the products are summarized Scope of the product What items are included in the product What subject area time period formats or types are covered Is the scope stated through meta information such as an introduction or only implied Does the actual scope of the product match expectations Aspects of the scope include Breadth Are all aspects of the subject covered Depth To what level of detail in the subject does the resource go Time Is the information in the resource limited to certain time periods Format Are certain kinds of Internet resources for example PDF FTP excluded Content Is the information for the product is factual or opinion Is the product an integral or is it integrated from several other resources Specific aspects related to the product include the accuracy authority currency and uniqueness of it Accuracy Is the information for the resource accurate The Internet has become a prime marketing and advertising tool and it is advisable to ask what motivation does the authors
171. edict values of the external metrics A distinction has to be made between the evaluation of a software quality of the product and the evaluation of the system quality in which the product is executed The reliability of a system is assessed by observing all failures due to hardware software human error etc The reliability of the software product is assessed only by the failures due to faults originating from product requirements design or implementation mistakes in the software STANDARDISED Quality model The software quality has to be evaluated according to a developed and defined quality model The quality model has to be developed when quality goals for the software products are stated on the stage of product development The international standard ISO IEC 9126 provides and recommends a quality model which can be used as a checklist of issues related to the quality Figure 5 2 The attributes of the software product quality consist of a set of several main quality characteristics each of them is constituted by a set of sub characteristics WP2 Business workflow technology analysis and comparison VISP Consortium Page 123 of 239 D2 2 Workflow Software Analysis and Comparison functionality reliability efficiency maintainability portability suitability understandability analysability adaptability maturity accuracy learnability time behaviour changeability installability interoperability ait tolerance operabi
172. eeneeeneen ea 229 Table 6 9 Workflow Engines ccc cece cece eee ce ence nee ee eee eeeeeneetaeteeneeneenaenas 230 Table 6 10 Combined Products Editor Engine 0 cece cece ence ence nee ee eee ee en 231 WP2 Business workflow technology analysis and comparison VISP Consortium Page 11 of 239 D2 2 Workflow Software Analysis and Comparison 1 Introduction Workflow Management Systems are a mature technology for automating and controlling business processes Kappel 2000 Leymann 2000 One widely accepted definition of workflow comes from the Workflow Management Coalition WfMC Glossary 1999 Workflow is the computerized facilitation or automation of a business process in whole or part An extended definition in WfMC Glossary 1999 works out the definition as a system that defines creates and manages the execution of workflows through the use of software running on one or more workflow engines which is able to interpret the process definition interact with workflow participants and where required invoke the use of IT tools and applications With the rise of the Web as the major platform for making data and services available for both humans and applications a new challenge has become prevalent requiring not only the support of workflows within individual organizations called intraorganizational workflows but also workflows crossing organizational boundaries referred to as inter
173. efinition still can be modified using the Project API When all activities are terminated the process stays in state started It still can be modified for example new activities can A process is terminated once it has been explicitly terminated by an application thru the User API In terminated state the process F6 2 Supervising capabilities Process status F6 3 Flexibility to Users BONITA make the distinction between Users and workflow Participants participants Users are people who will make use of the workflow system WP2 Business workflow technology analysis and comparison VISP Consortium Page 198 of 239 D2 2 Workflow Software Analysis and Comparison whatever process they will be part of Participants are all the users that are allowed to play some role in a given process Functional Auxiliary Functions FA1 Statistics Not applicable FA2 HELP Functionalities Not applicable II Integral Characteristics ObjectWeb BONITA Characteristics wak anna airon can t score ISO IEC 9126 8 8 assess result Functionality 60 40 2 4 Reliability 25 50 25 2 5 Usability 50 50 2 Efficiency 67 33 2 68 Maintainability 80 20 3 2 Portability 40 60 1 6 III Pie Charts Functionality Reliability Usability 0 2 2 0 o 50 50 ao 0 54 0 Efficiency Maintainability Portability 0 20
174. elements such as Activities and Transitions WP2 Business workflow technology analysis and comparison VISP Consortium Page 87 of 239 D2 2 Workflow Software Analysis and Comparison There are four kinds of Activities defined in JaWE e Generic Activity e Sub Flow Activity e Block Activity e Route Activity The link between two activities is established by transitions Transitions are more than just link between activities They describe possible transitions between activities and the conditions that enable or disable them during workflow execution JaWE has three types of transition simple self routed and circular Simple transition is link between two activities represented graphically with one straight line Self routed transition is link between two activities which is graphically broken in three parts but essentially they do not differ in the XPDL logic they are representing and circular transition is transition from activity to itself and is graphically represented as a circle with an arrow Participant representation Figure 4 11 Process level WP2 Business workflow technology analysis and comparison VISP Consortium Page 88 of 239 D2 2 Workflow Software Analysis and Comparison Text view Text view is used for showing a tree like structure of designed XPDL In some cases it can make the editing of XPDL quicker because when the user right click appropriate element in tree
175. ent methodology to support the expert qualification in workflow product assessment The evaluation methodology following Chapter 4 has been based on a common standard concerning the quality of software products Thus the standardization approach targets the minimization of the expert subjective influence to the evaluation findings The evaluation methodology has been designed to provide a common evaluation background for all experts Thus the noise which arises from the methodological evaluation scheme will be equal to all evaluation findings according to 5 1 The next improvement in Task 2 2 evaluation scheme has been performed using the formal description 5 1 The idea in the assessment process is not to use the absolute values of the real assessment RA but to make a relative comparison between the evaluated products It means that if product i is assessed according to 5 1 hence the product j will have analogical assessment RA ze l RA A E Ey However for making quality assessments of the products the difference A has to be considered A RA RA The benefit of using A instead of RA and RA comes from the difference A RA RA A E A 4 A amp amp Thus having the differences between the products i j k it follows l l A A A amp E A A A amp amp 5 2 If A gt A we can strongly confirm that the software produc
176. ents It also contains a built in worklist handler application that can be used for performing workitems or for reassigning workitems from one user to another The process monitor is divided into four major parts Figure 4 13 The package process definition process instances tree enables to select a running instance of a package s process definition When the user selects the process instance other parts graphical data correspond to this process instance He can see the main properties of the instance the name and the current state the graphical diagram of the process instance with activities that are currently running being marked to perform different operations on that process instance using the buttons at the bottom The operations which can be performed are start the process suspend the process resume the process terminate the process abort the process view the process history see the description of the process see and edit the process variables and that way the user can manage the process flow if needed WP2 Business workflow technology analysis and comparison VISP Consortium Page 89 of 239 D2 2 Workflow Software Analysis and Comparison e Enter activity management dialog The dialog displays the list of process activities and when the user selects one of them its current state is displayed in the text box From this dialog the user can perform additional operations on single activities o sus
177. er During simulation one canl debug the process by using breakpoints or stepping In simulate run mode the process executes but thel execution cannot be suspended or examined In simulate step mode execution can be suspended and resumed and variables can be inspected and modified F2 2 Process initialization serviceWhen one simulates execution of a process inl time profile necessaryActiveWebflow the simulation engine behaves resources available resources identically to the server engine where the deployed child diagram processes run It can be set preferences to modify the server engine behaviour and the same preferences for the simulation engine Prerequisites for Simulation e all the required properties for each activity arel filled in e the Abstract Process property is set to No for the process e Make sample data available for all variables e If the process contains a Pick activity you canl select a branch to execute F2 3 Event description simulationiAs the process executes the following events occur object simulation arrival profile event generation definition ofEach activity is highlighted as it prepares to execute e In Process Variables view sample data is cleared at the beginning of simulation and then is displayed as the corresponding activities execute e The Console view shows simulation events e If an error occurs an error message pops up thel simulation terminates and the activity is marked w
178. eral processes within one package which may share the same tools applications and participants The Package acts as a container for grouping together a number of individual process definitions and associated entity data which is applicable to all the contained processes definitions Package Attributes e Workflow Application Declaration is a list of all applications or tools required and invoked by the workflow processes Formal Parameters are parameters that are interchanged with the application via the invocation interface External Reference is a reference to an external definition of an entity e Workflow Relevant Data represent the variables of a Process Definition or Package Definition They are typically used to maintain decision data or reference data values which are passed between activities or sub processes e Workflow Participant Specification Minimal Organisation Model it is defined by a type and related information which is a set of type specific attributes LDAP Support e Declared Data Types WfMC assumes a number of standard data types such data types are relevant to workflow relevant data system environmental data or participant data Expressions may be formed using such data types to support conditional evaluations e External Package External package reference allows referencing definitions contained within other Package definitions Importing processes JaWE provides a possib
179. ere has been increasing interest in information systems that are used to support control and or monitor business processes Examples of systems that are managed by implicit or explicit process models are Enterprise Resource Planning ERP systems Work Flow Management Systems WFMS and Customer Relationship Management CRM systems These systems are implemented to support specific business processes A set of formal languages have been worked out to support process orientation in the context of web services cf BPEL4WS BPML WSCTI etc The support of leading firms as IBM Microsoft HP and SAP for a language like BPEL4WS Business Process Execution Language for Web Services Andrews 2003 Andrews 2003 Andrews T F Curbera H Dholakia Y Goland J Klein F Leymann K Liu D Roller D Smith S Thatte I Trickovic and S Weerawarana Business Process Execution Language for Web Services Version 1 1 2003 Technical report Accessed at http xml coverpages org BPELv11 May052003Final pdf reinforces the fact that process awareness has become one of the comerstones of information systems development Existing languages and tools focus on control flow and combine this focus with mature support for data in the form of XML and database technology As a result control flow and data flow are well addressed in languages and systems BPEL4WS XPDL Womb 2002 WfMC 2002 WfMC Workflow Process Definition Interface XML Process Definition Lang
180. eristics BizTalk Server Characteristics can t score ISO IEC 9126 Weak 200d sone assess result Functionality 20 60 20 2 8 Reliability 25 50 25 2 5 Usability 12 5 37 5 25 25 3 25 Efficiency 33 34 33 2 02 Maintainability 60 20 20 3 6 Portability 80 20 1 6 WP2 Business workflow technology analysis and comparison VISP Consortium Page 164 of 239 D2 2 Workflow Software Analysis and Comparison 1 0 Functionality III Pie Charts Reliability Usability 13 25 z 50 Efficiency Maintainability Portability 20 0 20 3 0 20 1 50 GWeak BGood OStrong O Can t assess Figure 6 4 Pie charts for Biztalk Server s characteristics Borland Principal Functions F1 Modelling process definition Together Designer 2006 I Functionality Function implementation Fct no Function name F1 1 Process chart definition process thread F1 2 Process description major minor F1 3 Event initial result triggering process thread event result correlation F1 4 Flowline F1 5 Definition of organizational units F1 6 Junctions Borland Together Designer 2006 contains a user friendly graphical modelling editor The business process diagram tools palette in the editor provides all necessary elements for modelling business activities The user can drag and
181. ervices o Processes can be automatically deployed to the appropriate server location Figure 4 2 presents a typical picture of an ActiveWebflow BPEL process WP2 Business workflow technology analysis and comparison VISP Consortium Page 72 of 239 D2 2 Workflow Software Analysis and Comparison A Receive Custormerhe questfarLoanamt gt amp InvokeLoanAssessor 2 a nvokeLoanApprover x gt a AssignYestoAccept Replz AccaptMessageToCustomer Figure 4 2 Active Webflow BPEL process The following snippet is the BPEL code corresponding to the illustration above as generated by ActiveWebflow Designer 9 0 xml version 1 0 encoding UTF 8 gt PR 3PEL Process Definition tdited using ActivewWebflow tm Designer version 1 0 0 htt process name loanApprovalfrocess suppressdoinFailure y lt partnerLinks gt lt partnerLink myRole customer name Customer partn lt partnerLink name approver partnerLinkType ins lo lt partnerLink name assesscor partnerLinkType in3 r1 lt partnerLinks gt lt variables gt lt variable messageType ins creditinfommationMessage wariahie meeeaadneTywne Ines ri ekascesecementMecsaane na Figure 4 3 Generated BPEL code Functionality The main functionality of ActiveWebflow Designer can be summarized in the following table Table 4 6 Functionalities of ActiveWebflow Designer Simultaneously displayed Cre
182. es Adapter Web Service _ __BAM Alert Provider for SQL Notification Services _ BAM Event API SQL Server 2000 SP4 SQL Server 2000 Client Tools Windows SharePoint Services 2 0 SP2 Visual Studio 2005 Microsoft Management Console 3 0 Internet Information Services IIS Jele el ADO NET 9 0 fel le SQM 3 0 sP3 jeje le MDAC 2 8 a Business Rule Engine SCS es Figure4 5 Biztalk Server s supported standards WP2 Business workflow technology analysis and comparison VISP Consortium Page 76 of 239 D2 2 Workflow Software Analysis and Comparison The following figure shows the main components of the BizTalk Server engine Incoming Message Outgoing Message Inbound Business Rule Outbound Engine Receive Adapter gt Receive Send Pipeline Pipeline XML XML d XML Message Message Message Subscriptions MessageBox Figure4 6 Components of the BizTalk Server engine A business process is implemented as one or more orchestrations each of which consists of executable code Orchestrations are not created by writing code in a language such as C Instead a business analyst uses the Orchestration Designer for Business Analysts a Microsoft Visio snap in to organize graphically a defined group of shapes to express the conditions loops and other behaviour of the business process Business processes can also use
183. es in a given period of execution time during a trial of the software and internally by inspecting the detailed specifications and source code to assess the level of fault tolerance The correlation between internal attributes and external measures is never perfect and the effect that a given internal attribute has upon an associated external measure will be determined by experience and will depend on the particular context in which the software is used One can use direct and indirect measures for assessing software quality to obtain the estimations of the indicators Some software attributes can be represented quantitatively by measuring software product parameters directly An indirect measure is derived from measures of one or more other attributes A measure of an attribute from a running computer system is used as an indirect measure of attributes of the evaluated software because the computer environment strongly influence the attributes of the software product Internal metrics Overview Internal metrics can be applied to a non executable software product such as a program specification or source code during the stages of design and coding of the software The internal metrics measurements estimate the values of the internal attributes or indicate external attributes by analysing the static properties of the intermediate or final software products The measurements of internal metrics use quantitative numbers about the frequency WP2
184. eseeeseerss 27 3 1 Classifications of Software Tools 0 eeeeceesccesecesceceseceeceeececeneceeecseeceaeceseeceeeceseeeseeess 27 3 1 1 Classifications of Software Tools for Business and Scientific Workflows 27 3 1 2 Classifications Of Software Tools According To Their Software Language DIESE ea PEPEE E EE E E EE late eoebaneaael heeds vteteonsaeotess 29 3 1 3 Classifications Of Software Tools According To Their Supported Standard 30 3 1 4 Open Source and Commercial Workflow Tools 0 ecccesssceeesceeeneecesteeeeseeeeeeeeesaes 31 3 2 Current Experience in Evaluation of Workflow Software Products 32 3 2 1 Comparisons And Assessments Of Workflow Software Products And Tools 32 3 2 2 Evaluation of Workflow Software Products According To The Workflow Patterns Stpported ss acscsisecat e centre andes E ede ote eh ie ate ected 39 3 3 Software Evaluation Methodology ecceecesccseseceeseeeeeceseceececeeeceseceeeeeeneesseeeseeess 47 3 3 1 Smith s criteria for evaluation of Internet based software and information TE SOUICES pee cdence tee EN E O O E T A EN E sore seeeueiea tenons 48 3 3 2 Belyk s And Feist s Software Evaluation Criteria eeeeeeeseeseeereeressrsrrerresrrsrrerrerre 50 3 3 3 Five Criteria For Evaluating Web Pages eeceescescesecececeeeecereceeceeeeceeeceseenseeess 52 3 3 4 WWW CyberGuide Ratings ce ceeceeccceneceseceeeecesecececseeceneceseecsceceseceeeseneeeseeeseeees 53
185. ess Management BizFlow e ActionWorks WebAsyst Workflow Management Software e WebAsyst Issue Tracking 3 1 3 Classifications Of Software Tools According To Their Supported Standard A short classification performed according to the supported workflow standards and business modelling is done below XPDL based e Aspose Workflow Vignette Process Workflow Modeler e Agentflow Aspose Workflow e Enhydra JaWE ObjectWeb BONITA e Enhydra Shark Fuego BPM e Interstage BPM Newgen e OFBiz Workflow Engine Open Business Engine e wfmOpen YAWL BPEL based e iGrafx BPEL Apache Agila e ActiveBPEL Engine Bexee e ActiveWebflow Standard Cape Clear WP2 Business workflow technology analysis and comparison VISP Consortium Page 31 of 239 D2 2 Workflow Software Analysis and Comparison e Biztalk Server IBM BPWS4J e Oracle BPEL Process Manager JOpera e PXE MidOffice e Parasoft BPEL Maestro Twister e SAP NetWeaver Exchange Infrastructure e BPMN based Borland Together Desidner 2006 ITpearls Process Modeler IntalioDesigner AXway Process Manager Fujitsu Interstage Business Process Manager 7 1 Kaisha Tec ActiveModeler Lanner Witness Mega International Suite Mega 3 1 4 Open Source and Commercial Workflow Tools e Open Source Workflow Tools This classification concerns
186. esses Deployment Depends on the external application server initialization repositories F3 2 Management of distributed Not a subject for con cern workflows F3 3 Application Server Runs on any J2EE compliant application server Compatibility F3 4 File formats Java classes appropriate JARs F3 5 Transaction mechanisms F3 6 Supported communication SOAP JMS JCA protocol F3 7 Users roles How to define different categories of users if applicable F4 Workflow client applications F4 1 User interface technologies client application type proprietary or general purpose light weight browsers The clients are written in Java using the con cern API The web site presents three examples of clients F5 Integration with other workflow engines Supported standards F5 1 Possibilities for collaboration with other workflow engines standards There are no clear statements concerning the possibilities to collaborate with other workflow engines F6 Administration and monitoring F6 1 Life cycle management There are no facilities to manage the time schedule for modelling simulation and execution functionalities F6 2 Supervising capabilities Process There are no supervising capabilities status F6 3 Flexibility to workflow Access rights participants Functional Auxiliary Functions FA1 Statistics Not applicable FA2 HELP Functionalities
187. fferent specified environments without applying actions or means other than those provided for this purpose for the software considered Weak O Good O Strong O Not applicable can t assess O Comments 2 Installability the capability of the software to be installed in a specified environment Weak O Good O Strong O Not applicable can t assess O Comments 3 Co existence the capability of the software to co exist with other independent software in a common environment sharing common resources WP2 Business workflow technology analysis and comparison VISP Consortium Page 145 of 239 D2 2 Workflow Software Analysis and Comparison Weak O Good O Strong O Not applicable can t assess O Comments 4 Replaceability the capability of the software to be used in place of other specified software in the environment of the software Replaceability is used in place of compatibility in order to avoid possible ambiguity with interoperability Replaceability does not imply that this software is able to replace the software under consideration Weak O Good O Strong O Not applicable can t assess O Comments 5 Compliance the capability of the software to adhere to standards or conventions relating to portability Weak O Good O Strong O Not applicable can t assess O Comments Vill EXTERNAL METRICS Software Evaluation Checklist Elements Information General information Product name Comments Pro
188. fications e Process Modeler 2 1 allows converting diagrams witch had been created with Process Modeler 1 1 based on BPMN specification 0 9 to the latest version The tool can export e BPEL 1 1 BPMN diagrams are mapped to BPEL 1 1 with optional support for Oracle BPEL Process Manager e XPDL 1 0 BPMN diagrams are mapped to XPDL1 0 The exported files are ready to be used in XPDL 1 0 editors like Carnot process engine e BPMN diagrams as image files Category Process Modeler is a modelling tool Interfaces As a modelling tool Process Modeler does not support any of the interfaces identified in the WfMC reference model Instead it exports abstract BPEL 1 1 and XPDL 1 0 specifications that can be refined utilizing a BPEL or XPDL modelling tool Recommendation Carnot process engine is an eclipse based XDPL editor and engine provided by Carnot AG http www carnot ag WP2 Business workflow technology analysis and comparison VISP Consortium Page 109 of 239 D2 2 Workflow Software Analysis and Comparison If we are interested in Process Modeler for VISP we should observe whether an adequate documentation would be released in future The integration in VISIO and thus in the typical working environment of a business modeler is a strong advantage of the tool The availability of mapping to favoured orchestration languages like BPEL and XPDL is another advantage of the tool 4 17 SAP NetWeaver Exchange Infrastructure Wo
189. flicts arise it makes a decision e The user management facility manages the access of system users to work lists and all the workflow management system The information from the organizational repository is used by this module for determining of the workflow participants e The application invocation module controls the interaction of the workflow engine with its applications e The data management unit executes data conversion and data mapping between activity instances e The history management component logs system events in the audit trail These events can be either system related e g user log on and logoff or workflow instance related e g activity started activity completed e Integration APIs provide access to the workflow engine for external systems In this way the workflow engine can be used in another application Figure 2 2 shows an example of relationships between the main components in a technical and software system performing workflow management activities zur Muehlen 2004a WP2 Business workflow technology analysis and comparison VISP Consortium Page 21 of 239 D2 2 Workflow Software Analysis and Comparison Workflow Modeling Component Integration Specification Process z Organization Modeling Data Modeing Modeling Organizational Repository gt Workflow Model Repository 43 Workflow Engine gt Process Data User Management Management Management Co
190. flow Management Systems Based on Objects Rules and Roles 2000 ACM Computing Surveys Electronic Symposium on Object Oriented Application Frameworks M E Fayad guest editor WP2 Business workflow technology analysis and comparison VISP Consortium Page 238 of 239 D2 2 Workflow Software Analysis and Comparison Karen McLachlan 2002a Karen McLachlan 2002a WWW CYBERGUIDE RATINGS FOR CONTENT EVALUATION East Knox High School Howard Ohio http www cyberbee com content pdf Karen McLachlan 2002b Karen McLachlan 2002b WWW CYBERGUIDE RATINGS FOR WEB SITE DESIGN East Knox High School Howard Ohio http www cyberbee com design pdf Kiepuszewski 2003 Kiepuszewski B 2003 Expressiveness and Suitability of Languages for Control Flow Modelling in Workflows PhD Thesis Queensland University of Technology Kitchenham 1996 Kitchenham B A Evaluating Software Engineering Methods and Tool Part 1 The Evaluation Context and the Evaluation Methods 1996 ACM SIG SOFT Software Engineering Notes 21 pp 11 15 Leymann 2000 Leymann F and D Roller Production workflow concepts and techniques 2000 Prentice Hall Leymann 2001 Leymann F Web Services Flow Language WSFL 1 0 2001 IBM Marshak 1994 Marshak R T Perspectives on Workflow In T E White L Fischer ed New Tools for New Times The Workflow Paradigm 1994 Future Strategies Inc Alameda CA USA pp 165 176 Mukherjee et al 200
191. flow clients Implementation of the interface is by WSDL interface or a programming language interface The engine can be called by web service SOAP In fact the engine exposes some methods described by a WSDL file Interface 3 Application invocation which performs additional workflow activities Implementation of the interface is by WSDL interface programming language interface notification mechanism for human actions WSFL is an XML language for the description of Web Services compositions so external applications can be invoked by Web Services interfaces To define the public interface of the composition the lt flowModel gt WSFL element includes a declaration of the supported service provider type as an attribute of the flow model This mapping is specified by an lt export gt element which relates an activity of the flow model and an operation of its public interface The mapping defines the effect of each operation by relating it to the execution of the internal composition WP2 Business workflow technology analysis and comparison VISP Consortium Page 95 of 239 D2 2 Workflow Software Analysis and Comparison As indicated in the figure the relation between an operation on the public interface of a flow model and an operation of a service provider is established through a lt plugLink gt element Thus a plug link represents the inherent client server structure of a Web Service lt operation gt ope
192. form and thus in any Web application server F3 4 File formats IA PAR archive contains the processdefinition xml file is mandatory for the deployment but then only JAVA classes are needed F3 5 Transaction mechanisms Transactions are the beginTransaction commitTransaction and rollbackTransaction called on a jBpmSession object The behaviour of these methods depends on the Hibernate configuration If you have configured hibernate to manage its own JDBC connections the transaction operations will result in the corresponding operations on the JDBC connection Otherwise the transaction methods will call the corresponding methods on the UserTransaction object in the container supported in jBPM API F3 6 Supported communication protocol As said before all kind of communication protocols can be used as long as the corresponding libraries are accessible along your application For instance you can easily add al SOAP HTTP support to your application if you deploy it on an J2EE application server F3 7 Users roles User roles are called Swimlanes It specifies that multiple tasks in the process should be done by the same actor F4 Workflow client applications F4 1 User interface technologies client application type lproprietary heavy weight user clients or general purpose light weight browsers You can have any kind of client you want as long as the
193. formats OpenWFE for configuration and operation fe storing expressions and workitems in the filesystem or for dispatching a workitem to a participant uses xml files encoded ISO 8859 1 Implementation of persistence in DB and in memory is included in OpenWFE package The user can choose between them F3 5 Transaction mechanisms The OpenWFE has build in transaction mechanism It is supported by do undo and redo tags in workflow definition F3 6 Supported communication TCP SMTP POP3 IMAP protocol F3 7 Users roles User s are connected to participants le in a workflow One user can play many roles F4 Workflow client applications F4 1 User interface technologies client OpenWFE includes webclient which is web application application type written in Java The Jetty java webserver engine is proprietary heavy weight user included together in the OpenWFE package application clients or general purpose light But the end user can switch to another webserver for weight browsers example F5 Integration with other workflow engines Supported standards F5 1 Possibilities for collaboration Not supported with other workflow engines standards F6 Administration and monitoring F6 1 Life cycle management OpenWFE has built in cronService The service is configured in workflow definitions F6 2 Supervising capabilities Process Through the control interface administ
194. ftware assessed by the partners and the corresponding workflow technologies and standards which these tools are based on Table 4 7 The assessed short list workflow software and corresponding workflow technologies No Assessed Products Covered Technologies 1 ActiveBPEL Engine Metaware XML BPEL WSDL SOAP XPath XQuery 2 Active Endpoints XML BPEL WSDL SOAP XPath XQuery ActiveWebflow Standard ICCS 3 ActiveWebflow Designer ICCS XML BPEL WSDL 4 Biztalk Server VALTECH XML BPEL WSDL SOAP XPath EDI RosettaNet 5 Borland Together Designer 2006 BPMN UML FhI Fokus 6 Cape Clear VALTECH XML BPEL WSDL SOAP 7 con cern WUT SOAP 8 Enhydra JaWE ICCS XPDL Wf XML 9 Enhydra Shark ICCS Metaware XPDL Wf XML SOAP ASAP 10 enterprise Xtention UAM 11 Freefluo Metaware WSFL WSDL 12 JBoss jBPM VALTECH LDAP jPDL 13 ObjectWeb BONITA ICCS XPDL SOAP WSDL 14 OpenWFE UAM XML 15 Oracle BPEL Process Manager XML BPEL WSDL SOAP UDDI XPath FhI Fokus 16 Process Modeler FhI Fokus BPMN 17 SAP NetWeaver Exchange XML BPEL WSDL SOAP UDDI WS Infrastructure VALTECH Security 18 WfMOpen Metaware XPDL Wf XML 19 YAWL WUT WSDL WP2 Business workflow technology analysis and comparison VISP Consortium Page 119 of 239 D2 2 Workflow Software Analysis and Comparison 5 Software Evaluation Methodologies
195. ftware Analysis and Comparison BPMN Business Process Modelling Notation BPMN Version 1 0 May 3 2004 available at http www BPMI ORG BPMI Using BPMN to Model a BPEL Process Stephen A White March 2005 Cichocki 1997 Cichocki A A Helal M Rusinkiewicz and D Woelk Workflow and Process Automation Concepts and Technology Kluwer Academic Publishers 1997 ISBN 0 7923 8099 1 Curbera 2002 Curbera F Y Goland J Klein F Leymann D Roller S Thatte S Weerawarana S Thatte Business Process Execution language for Web Services Version 1 0 2002 IBM Dayal 2001 Dayal U M Hsu R Ladin Business Process Coordination State of the Art Trends and Open Issues 2001 Proc of the 27th VLDB Conference DBE06 DBE Execution Environment European Project 2006 Vidal M Technical Coordinator Ellis and Nutt 1980 Ellis C A Nutt G J Office Information Systems and Computer Science 1980 In ACM Computing Surveys 12 1980 1 pp 27 60 Fenton and Pfleeger 1996 Fenton N E and S L Pfleeger Software Metrics A Rigorous and Practical Approach 1996 Thomson Computer Press Fil97 FileNet 1997 Visual WorkFlo Design Guide FileNet Corporation Costa Mesa CA USA Fil99 FileNet 1999 Panagon Visual WorkFlo Architecture FileNet Corporation Costa Mesa CA USA For98 Fort_e 1998 Fort_e Conductor Process Development Guide Fort_e Software Inc Oakland CA USA FRETRIS R amp D PROJE
196. ftware Ltd Orbis TaskCentre Pallas Athena FLOWer Parasoft BPEL Maestro Pi Calculus for SOA PXE PL FLOW workflow engine Popkin Software BPM Proprietary oe Proprietary ee Proprietary a e Proprietary D ee ee Proprietary re WP2 Business workflow technology analysis and comparison VISP Consortium Page 64 of 239 D2 2 Workflow Software Analysis and Comparison Process Orch Platform Portellus BRMS IRoleFlow 1 Process Designer 2 Process Manager 3 Monitoring and Reporting SAP NetWeaver Exchange Infrastructure Savvion Savvion BPM Studio ies Proprietary Bee Singularity Ltd Singularity Process Platform Skelta Workflow NET SPA Scientific Process Automation Sparta Systems TrackWise Stellent Imaging and BPM Sun WSCI Editor Syrup Taverna Proprietary Proprietary Proprietary Proprietary Proprietary Proprietary WSC Proprietary TIBCO Staffware Process Suite TQS Europe ActiveModeler Triana Twister Ultimus Versata Vignette Process Workflow Modeler W4 Global W4 Suite Web and Flo Kontinuum BPM Suite SFL Proprietary ae Proprietary er Proprietary Proprietary Cr er E Proprietary Proprietary WebAsyst Issue Tracking Proprietary webMethods Business Process Management sProprietary WebSphere MQ Workflow Proprietary Werkflow Propriet
197. g branches The process will only continue if every preceding activity is finished Figure 3 5 In MQ Workflow no explicit synchronization node is available or necessary this construct is achieved by having multiple incoming control connectors to an activity Multiple incoming control connectors mean that the activity is only enabled if all incoming control connectors are enabled which means that all preceding activities have terminated Figure 3 6 Pattern 4 Exclusive choice It defines a point in the process where a certain condition based on a decision in the flow is taken I Flow does not support an explicit XOR construct but a conditional node to define exclusive transition conditions Figure 3 7 In MQ Workflow a similar approach must be taken a transition condition on the control connector defines which branches are activated setting excluding transition conditions on two branches ensure exclusive choice behaviour Transition conditions are not graphically visible Figure 3 8 Administrators Action 1 re questF orQuote Action 4 dministrators CustomerRegistra Figure3 3 Workflow Pattern 2 Parallel Split in i Flow WP2 Business workflow technology analysis and comparison VISP Consortium Page 38 of 239 D2 2 Workflow Software Analysis and Comparison gt gt enome Recistration i m w Request for Quot eo t Ca Quote Figure3 4 Workflow Pattern 2 Paralle
198. g team of any factors e g a recently found error after the evaluation that would invalidate the evaluation result Responsibilities of the testing team Responsibilities of the testing team are to fulfill the requirements for working procedures of testing laboratories in order to avoid appeal and review procedures in the context of software evaluation The testing team shall establish and maintain a quality system appropriate to the evaluation of software according to the procedure described in this evaluator s guide The quality system must be documented in a quality manual Topics of the quality manual include e General quality procedures and instructions e Quality assurance procedures specific for each evaluation e Feedback and corrective actions whenever evaluation discrepancies are detected e Procedures for dealing with complaints Evaluation Level Concept An evaluation level defines the depth or thoroughness of the evaluation in terms of evaluation techniques to be applied and evaluation results to be achieved both with reference to evaluation objectives e g safety conditions security constraints economic risk availability conditions application constraints As a consequence evaluation at different levels gives different confidence in the quality of the software product The level can be chosen independently of each characteristic WP2 Business workflow technology analysis and comparison VISP Consortium Page 6
199. gine caching parameters e Add and remove licenses e Prune completed processes by date e Prune deployment logs by date e Prune deployed process definitions e Version and build numbers for all ActiveWebflow Standard components The Deployment console pages allow the deployed processes and their artifacts to be managed e Deployment of Business Process Archive bpr files e Deployment logs for each bpr file for errors and warnings e Lists of all deployed processes with selection filters e Detailed version information including the ability to modify specific data based on the version state e g status effective and expiration dates e Detailed information regarding other artifacts deployed with process e WSDL files deployed in the BPR e Global Partner definition files deployed to the server F6 2 Supervising capabilities The Process Status console pages allow to view and Process status manage information associated with individual process instances These pages provide the ability to sort and filter the information in ways that make easier to deal with only WP2 Business workflow technology analysis and comparison VISP Consortium Page 156 of 239 D2 2 Workflow Software Analysis and Comparison the most relevant process information For running and completed processes the consoles are used in order to perform the following tasks e Suspend Resume and Terminate executing processes e V
200. gine supports discovery via standard UDDI Supported standards The engine supports SCUFL and WSDL Security mechanisms between clients and FreeFluo web system are provided using HTTPS protocol 4 12 JBoss jBPM Workflow software overview Workflow software presentation jBossjBPM is java based BPM Open Source solution It can run on any J2SE compliant architecture Latest version available is 3 0 2 under a LGPL licence Workflow software description jBpm mainly consists of two parts a XML file defining the workflow chart PDL aJAVA API to implement nodes and transitions jPDL description Consider your application as two parts 1 a graph of a state machine which represents the business model business interactions states etc and 2 the code JAVA code to implement a transition to a state or implementing task The graph The graph is just a graphical representation of an XML file GPDL which is convenient for business analysists A graphical process designer can be downloaded from jBoss under LGPL licence It is very easy for non coding people to use it and design process models Every graph must start with a start state and end with an end state The jPDL XML file is generated as well as a picture file of the diagram which is convenient to import in document or just check Another xml file is generated gpd xml which is the textual representation of the graph giving coordinates of nodes transitions etc
201. haracteristics scececeeceneneeneeeeneneeeeaes 164 Figure 6 5 Pie charts for Borland Together Designer s characteristics ceeeeee eee 166 Figure 6 6 Pie charts for Cape ooo eee ce ecececeeeeeeneee eee eaeneeeenens 171 Figure 6 7 Pie charts for Con eee eeeeecee eee eeeeeeeneeneee ences eds 174 Figure 6 8 Pie charts for Enhydra JaWE s characteristics csc eeeeeeeneeeeceneeeeeeees 179 Figure 6 9 Pie charts for Enhydra oo see eee eee cence ence teen ence is 182 Figure 6 10 Pie charts Tor cuinar nanan 185 Figure 6 11 Pie charts for Freefluo s characteristics e cc ececeeeee ene eneeneeeeeenees 188 Figure 6 12 Pie charts fOr 0 ec sceceeeec ee ene eens ee en ees 193 Figure 6 13 Pie charts for ereda a eer eee e ee eneeeeneeeeaees 198 Figure 6 14 Pie charts TOF cc cceceeeeceeeeeeeeneeeeeeeeaenens 201 Figure 6 15 Pie charts for Oracle BPEL Process 4 204 Figure 6 16 Pie charts for Process Modeler for Microsoft 206 Figure 6 17 Pie charts for SAP NetWeaver Exchange Infrastructure s characteristics 208 Figure 6 18 Pie charts for WfMOpen s characteristics 0 eee eceeeceeeeeeneeeeneeeeeeeeees 211 Figure 6 19 Pie charts for YAWL s characteristics 20 0 e cece ecee eee ee ee eeeeereneeneneeaes 215 Figure 6 20 Workflow Editors comparative chart sceceeceeeeeeceeeeeeeeeeeneneenenes 217 Figure 6 21 Workflow Engines comp
202. has been determined mainly by the terminology and glossary work of the Workflow Management Coalition WfMC Glossary 1999 According to it the workflow management system consists of a modelling component for the creation of workflow models functionality for the creation of workflow instances from these workflow models and functionality for the execution of these workflow instances Respectively the products which implement the workflow technology have to follow this functional consistence with appropriate software modules The functional component for the enactment of workflow instances is called workflow engine In the sixties information systems were built on top of a small operating system with limited functionality These systems mainly consisted of tailor made applications New types of WP2 Business workflow technology analysis and comparison VISP Consortium Page 16 of 239 D2 2 Workflow Software Analysis and Comparison product software added new functionalities since then The nowadays operating systems offer much more functionality than in the sixties Database management systems offer functionality which used to be in tailor made applications This trend leads to the shifted emphasis from programming to assembling of complex software systems The coding of individual modules is already an old approach The challenge now is orchestrating and combining pieces of software from the different functional layers Another trend is
203. hat is persisted includes Definitions State Variables data Alarms Web Services AWS includes a J2SE compliant mechanism for handling Web service Support requests and Web service invocations In addition to ActiveWebflow s built in support you can optionally use any Web service container running in Tomcat to deploy the process s services You can also provide a unique override per Partner Link for invoking services WP2 Business workflow technology analysis and comparison VISP Consortium Page 69 of 239 D2 2 Workflow Software Analysis and Comparison Process Versioning AWS provides an implementation of process versioning that is flexible and robust The following version parameters can be specified e Version number default is to automatically increment if the process has significantly changed and no version number provided e Effective Date default is to take effect immediately if not set e Expiration Date default is to not expire e Running process instance disposition e Maintain default allow running instances to complete using the definition that they started under e Migrate migrate all running instances to the new definition definitions must be compatible e Terminate terminate all running instances AWS Management Features AWS provides comprehensive management and administration capabilities Web based consoles allow the configuration and administration of the ser
204. he engine has a basic command line client primarily for testing and is very easy to deploy as a web service to provide multi user access to workflow execution services It contains libraries that enable execution of workflows written in a subset of IBM WSFL and in Scufl Simple Conceptual Unified Flow Language Scufl and XScufl its XML representation was developed by It Innovations together with some member of myGrid consortium 4 10 The graphical environment for building workflows is not included with Freefluo while it is provided from the Taverna project Freefluo is bundled as an embedded workflow engine with Taverna Main functionalities The Freefluo workflow enactment engine is a task orchestration tool and interpreter for executing workflow scripts Using Freefluo it s possible to execute workflows to coordinate web services local applications and your own custom processing steps It supports Scufl workflow specifications and a subset of IBM s WSFL Web Services Flow Language Supported interfaces Interface 1 Exchange of workflow descriptions models choreographies orchestration between the tool and other modelling tools repositories workflow execution tools The workflow engine supports execution of workflow scripts written in the Scufl workflow language Scufl is being developed as part of the Taverna project The tool can also execute a subset of WSFL Interface 2 Supports the invocation of workflow engines by work
205. his node corresponds to the sub process node with the only difference that the sub process resides in another workflow engine i Flow supports other i Flow servers Collaboration Ring or other SWAP compatible process engines So that it is possible to start a remote sub process from the local i Flow Server The local process waits for the remote process to complete and incorporates the results of the remote process back into the local process Chained Process Node When the workflow reaches this node another process is activated similarly to a sub process The difference is that the node does not enter a suspended state and the chained process operates as an independent entity Delay Node When the workflow reaches this node the process pauses until the first timer attached to the node fires Triggers Triggers either start processes or make choices of activities in response to Data Event files added to a particular directory by a data source external to i Flow Exit Node Identifies the end of the process Every process must have at least one Exit Node C Informational aspect i Flow uses the principle of globally shared data All data items defined within a workflow type are shared between the tasks Only between super and sub WP2 Business workflow technology analysis and comparison VISP Consortium Page 35 of 239 D2 2 Workflow Software Analysis and Comparison workflows a distinct data mapping has to be defined to pass dat
206. ia and Terminology International Review of Research in Open and Distance Learning ISSN 1492 3831 BPEL 1 1 IBM BEA Systems Microsoft SAP AG Siebel Systems Business Process Execution Language for Web Services Version 1 1 May 2003 available at http www 128 ibm com developerworks library specification ws bpel BPEL 2 0 OASIS Web Services Business Process Execution Language Committee Draft Version 2 0 December 2005 available at http www oasis open org committees download php 16024 wsbpel specification draft Dec 22 2005 htm BPEL Ad Oracle Adapters for Files FTP Databases and Enterprise Messaging 10g Release 2 10 1 2 November 2005 available at http www oracle com technology products ias bpel index html BPEL DG Oracle BPEL Process Manager Developer s Guide 10g Release 2 10 1 2 October 2005 available at http www oracle com technology products ias bpel index html BPEL IG Oracle Application Server Integration Installation Guide 10g Release 2 10 1 2 August 2005 available at http www oracle com technology products ias bpel index html BPEL UniS Hantschel Ruf Strotbek Vergleich von BPEL Laufzeitum gebungen Fachstudie 54 Universitat Stuttgart January 2006 ftp ftp informatik uni stuttgart de pub library medoc ustuttgart_fi FACH 0054 FACH 0054 pdf in German WP2 Business workflow technology analysis and comparison VISP Consortium Page 237 of 239 D2 2 Workflow So
207. iagram The simulation needs only to define a sample set of data for its execution At this point you can start simulation and execute step by step the designed workflow The simulation will be represented by a workflow graph panel and the current activity will be clearly underlined F2 3 Event description simulation event generation definition of object simulation arrival profile Event can be simulated directly using activities which had been defined into BPEL file Those can be modified by user at simulation time F2 4 Junction description and or x or symbol simulation outflow Junctions can be simulated and changed in real time F2 5 Links simulation probability type During the simulation a user can modify or correct all links Data which is possible to change are name source and target and transition condition F2 6 General conditions simulation validation simulation run Not applicable F3 Execution workflow engine F3 1 Processes Deployment initialization repositories Deploying a BPEL process involves creating a deployment archive file a JAR with an extension of bpr and copying that to your servlet container To create this archive you need to organize your files into a particular directory structure create one or two configuration files and then create an archive from that directory Create a directory for your deploymen
208. ibe how the executional business processes can be visually represented 2 7 OMG s Workflow management facility is based upon the WfMC specifications and defines how this gets translated into CORBA 2 10 Different standards have been developed like UML 2 11 for modelling and designing software systems RosettaNet 2 12 for Partner Interface Processes UBL the Universal Business Language UBL 2 13 a standard library of XML documents for communication between different organizations The standardization efforts try to extend the application area of e Business solutions and to make easier the technological developments of e Business systems A new funded EC project DBE06 is going to develop platform on which other projects can develop e Business solutions Thus the DBE project contributes to the domain of integration of distributed e WP2 Business workflow technology analysis and comparison VISP Consortium Page 20 of 239 D2 2 Workflow Software Analysis and Comparison business solutions This is targeted also by VISP project but in VISP the integration is achieved through the design of a common workflow business system Standardization in workflow management is more detailed considered and assessed in deliverable D2 1 of VISP project 2 4 System s and Technological Architecture of Workflow Management Systems The structure of a workflow management systems consist of a development environment named build
209. ical view of package level is divided into some parts Left side of the main window shows Package Hierarchy Tree Root of the tree is main package and branches are imported external packages If these external packages have their own external packages they are shown in the tree too Since all packages have unique IDs circular references are allowed though tree expansion will stop on package which is displayed before Right side of the main window displays workflow processes defined in package which is selected on the hierarchy tree Process level The second part of JaWE is Process level which is some kind of editing window This part of JaWE is used for graphical representation of process definition and for defining attributes of entities on that level Figure 4 11 represents this level Business_Example JaWE Bre Orda Y El FP toobox y O0 8eHE8R AgS Package and external pactages dependence Particpant_Repository Application_Repository Oy Process _Repostory Participant_Repostory Application Repository Cees EE Status bar Figure 4 10 Package level The Process level view is essentially an editing window that can be used for graphical representation of process definition and for defining attributes of entities on that level In the visible working area the user inserts visible objects and adjusts them The first thing drawn must be a participant after which the user may insert other
210. iew the process execution state graphically hierarchically and textually e Examine the content and status of process variables activities and links For the persistent queues that allow for the re hydration of processes on server startup the following can be inspected e Alarms events that will execute at a specific time as specified by executing processes e Receives the result of a BPEL activity or Event Handler specifying that a message is expected Once a process is deployed to the AWS server the administrator can leverage the capabilities of ActiveWebflow Professional to debug and analyze the execution of running or completed processes F6 3 Flexibility to workflow participants Access rights Functional Auxiliary Functions FAI Statistics Fct no Function name Function Implementation FA1 1 Number of users Not applicable FA1 2 Number of processes The statistic is available in the Administration Console FA1 3 User rights Not applicable FA1 4 Process Information Full information about the deployed processes is available in the Administration Console FA2 HELP Functionalities There are two User Guides with very useful and thorough help information II Integral Characteristics ActiveWebflow Standard Characteristics can t score ISO IEC 9126 weak good strone assess result Functionality 20 60 20 4 4 Reliability 50 25 25 3
211. ility 1 5 2 25 2 3 75 4 5 3 4 25 3 75 3 46 Efficiency 2 68 2 2 68 5 34 2 68 1 32 2 02 2 66 3 2 65 Maintainability 2 8 3 6 3 2 0 8 2 8 4 8 4 4 2 74 Portability 4 3 6 1 6 5 2 3 6 3 6 2 4 2 8 3 2 The following subtables present these scores again but for each category a Modelling tools b Workflow editors c Workflow engines and d Combined products Table 6 3 Average evaluation results Modelling Tools Borland ProcessMo Products Together deler Characteristics score score Average ISO IEC 9126 result result value Functionality 4 3 6 3 82 Reliability 3 4 3 05 Usability 4 75 4 3 46 Efficiency 1 32 1 32 2 65 Maintainability 1 6 2 2 74 Portability 4 4 3 6 3 2 WP2 Business workflow technology analysis and comparison VISP Consortium Page 223 of 239 D2 2 Workflow Software Analysis and Comparison Table 6 4 Average evaluation Workflow editors ActiveWe briona Cape enterprise Profession con cern Enhydra jBPM Clear 6 5 Xtention al JaWE Designer Characteristics ISO IEC 9126 score score score Sore score score result result result result result result Functionality 3 6 4 2 3 6 5 2 4 Reliability 4 5 2 5 3 1 5 4 5 2 5 Usability 4 75 3 75 2 75 3 25 3 75 2 25 Efficiency 2 68 2 68 2 66 4 2 68 2 Maintainability 1 2 2 2 4 0 8 2 8 3 6 Portab
212. ility 1 6 3 2 5 6 2 2 8 3 6 Oracle Bonita OpenWFE BPEL SAP_Net YAWL Products Process Weaver Manager Characteristics ISO IEC 9126 score scote score score score Average result result result result value result Functionality 2 4 4 8 4 3 6 3 2 3 82 Reliability 2 5 2 5 3 2 5 2 3 05 Usability 2 3 75 4 5 3 3 75 3 46 Efficiency 2 68 5 34 2 68 2 02 3 2 65 Maintainability 3 2 6 0 8 2 8 4 4 2 74 Portability 1 6 5 2 3 6 2 2 8 3 2 Table 6 5 Average evaluation results Workflow Engines BET pees BizTalk Cape con cern Enhydra enterpr Be FreeFluo Server Clear 6 5 Shark Xtention Engine Standard Characteristics score score score score score score score score ISO IEC 9126 result result result result result result result result Functionality 4 8 4 4 2 8 4 2 4 2 5 2 3 2 Reliability 4 5 3 5 2 5 2 5 3 2 75 4 5 1 5 Usability 2 75 5 3 25 3 75 2 75 3 125 3 75 1 5 Efficiency 2 68 2 68 2 02 2 68 2 66 2 65 2 68 2 68 Maintainability 3 6 0 8 3 6 2 2 4 2 8 2 8 2 8 Portability 4 4 2 1 6 3 2 5 6 3 2 8 4 Oracle jBPM Bonita OPe WFE tues SAP_Net wentopen YAWL Products rocess Weaver Manager Characteristics ISO IEC 9126 score score ore score score score score Average result result esalt result result result result value Functionality 4 2 4 4 8 4 3 6 4 8 3 2 3 82 Reliability 2 5 2 5 2 5 3 2 5 5 5 2 3 05 Usability 2 25 2 3 75 4 5 3 4 25 3
213. ility of importing processes from external packages e Extended Attributes Extended Attributes are the primary method to support such extensions They are attributes those defined by the user or vendor where necessary to express any additional entity characteristics Process level e Workflow Process Definition The Process Definition entity provides contextual information that applies to other entities within the process It is a container for the process itself and provides information associated with the administration or it is used during process execution e Workflow Applications Declarations is a list of all WP2 Business workflow technology analysis and comparison VISP Consortium Page 176 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation applications or tools required and invoked by the workflow process e Workflow Relevant Data represent the variables of a Process Definition or Package Definition e Workflow Participants All descriptions and explanations for participants at Package level are almost the same as on the Process level e Workflow Process Activity is a piece of work that will be done by combination of resources and computer applications Atomic Activities Subflow Block Activity Route Start and End Objects e Transitions Link between two activities is established by transitions They describe possible
214. inability sub characteristics are the following Analysability it is the capability of the software product to be diagnosed for deficiencies or causes of failures in the software or for the parts to be modified and identified Changeability it is the capability of the software product to enable a specified modification to be implemented Implementation includes coding designing and documenting changes Stability it is the capability of the software to minimise unexpected effects from modifications of the software Testability it is the capability of the software product to enable modified software to be validated Compliance it is the capability of the software to adhere to standards or conventions relating to maintainability Portability The portability is the capability of software to be transferred from one environment to another The environment may include organisational hardware or software environment The portability sub characteristics are the following Adaptability the capability of the software to be modified for different specified environments without applying actions or means other than those provided for this purpose for the software considered Installability it is the capability of the software to be installed in a specified environment Co existence it is the capability of the software to co exist with other independent software in a common environment sharing common resources Replaceability i
215. ing arrow must be chosen to allow process ending if conditions are not satisfied The order for conditions evaluation can be determined For conditions defining are applied standard JavaScript expressions Complex Conditional Node The behaviour of this node is similar to the Conditional Node Here the expressions for defining conditions can include multiple incoming data items OR Node It can be used either as a split construct it behaves as a parallel split that executes all subsequent activities simultaneously or in any order or as a join construct the OR node merges two or more branches without synchronization the subsequent activity is started as soon as one branch is finished but when the subsequent activity finishes all active branches are terminated AND Node It can be used as a split construct it is identical to the behaviour of the OR node When it is a join construct it is synchronizing the process waits until all activities that lead to this node are completed before starting the subsequent activity Subprocess Node The workflow reaching this node set process control to a sub process and the node enters a Waiting for Sub process state When the sub process completes control returns to this node and all ensuing activities connected to the node are activated simultaneously Both run time and design time sub processes are used to break complex tasks into a hierarchy of easier to handle units Remote Sub process Node T
216. ing blocks e BPEL Designer a tool supporting to model edit design and deploy BPEL processes BPEL Designer allows viewing and modifying the BPEL source code It is available with Oracle JDeveloper or as a plug in on the Eclipse Platform version 3 0GA e Oracle BPEL Server the server to which BPEL process will be deployed It contains human workflow technology adapters and notification services components e Oracle BPEL Console a console to run manage and test deployed BPEL process It provides a Web based interface for management administration and debugging of processes deployed to the Oracle BPEL Server e Oracle Database Lite a lightweight database that holds the BPEL schema Windows only WP2 Business workflow technology analysis and comparison VISP Consortium Page 104 of 239 D2 2 Workflow Software Analysis and Comparison Developer Design BPEL BPEL Designer BPEL Server Dehydrate WSDL Binding Built in Integration Services Tech Human wes Oracle BPEL JCA Console Manage Ema Core BPEL Services J2EE Application Server Figure 4 20 Components of the Oracle BPEL Process Manager Description Oracle BPEL Designer and the Oracle BPEL Process Manager for JBoss are based on the Collaxa tools designer and BPEL engine that have been bought by Oracle in 2004 Both tools have been used by FhI FOKUS in student projects at the Technical University Berlin as well as in intern
217. ing heterogeneous distributed computing graphical user interfaces application and subsystem integration messaging document management simulation and business practices and re engineering The actuality of the WFMS is approved by the attempts of developing such systems for e business services A new funded EC project DBE06 tries to develop platform on which other projects can develop e Business solutions Thus the DBE project contributes to the domain of integration of distributed e business solutions This is targeted also by VISP project However in VISP the integration is achieved through the design of a common workflow business system 2 3 The Evolution of Business Process Management One of the leaders in development of workflow technology is Wil van der Aalst Aalst 1998 Aalst 1999 Aalst et al 2000 Aalst and Hee 2002 Aalst et al 2003 In Aalst et al 2003 he makes a history review of the workflow technology There are examples of workflow management systems such as Staffware enterprise resource planning systems such as SAP and Baan and other specific systems Only separate consultants and companies are interested in business processes There is missing a more fundamental approach until the nineties considered now as the beginning of researchers work on the foundations of business process management systems The aim of workflow management technology is the separation of process logic from application logic in
218. ing them with similar ones It is important that the investigator does not have control over the situation and the software product For the case of assessment it is not possible to manipulate variables to perform case studies and experiments Surveys try to mark what is happening broadly over large groups of projects Fenton and Pfleeger 1996 The qualitative methods on their turn assess the extent to which software tools provide the required functionality on a more personal opinion In Kitchenham 1996 the term feature analysis is used to describe such kind of software evaluation Feature analysis requires a subjective assessment of the relative importance of different features of the products This kind of analysis is frequently applied different types of weekly and monthly magazines when assessing computer platforms hardware devices software tools This deliverable categorizes common functionality of available workflow management systems and identifies the scope that these software tools have to cover This software evaluation applies a combined approach both with quantitative and a qualitative assessments The deliverable carries out a feature analysis based on documentation of the assessed software tools and when available a first hand experience of the systems obtained by software tests Thus an attempt to capture the whole functionality of systems was targeted and therefore the evaluation does not focus on a specific application domain
219. ion minor 1 1 4 One consequence of the BPEL 1 1 WP2 Business workflow technology analysis and comparison VISP Consortium Page 202 of 239 D2 2 Workflow Software Analysis and Comparison F1 3 Event initial result triggering process thread event result correlation F1 4 Flowline F1 5 Definition of organizational units F1 6 Junctions specification is that it is possible to invoke one BPEL process from another BPEL process utilizing the corresponding WSDL interface The concept of sub processes is not supported in BPEL 1 1 BPEL Designer is a graphical tool for the definition of BPEL processes The current version is based on various wizards that ease the task of defining consistent workflow models a lot In practise it is hard to define complex workflows utilizing graphical tools because the graphical notation is not sufficiently compact and unclear in details The same is true for the lengthy XML representation of the BPEL workflow F2 Simulation debug F2 1 Objects definition simulation arrival profile access data simulation process F2 2 Process initialization service time profile necessary resources available resources child diagram 23 Event description simulation event generation definition of object simulation arrival profile F2 4 Junction description and or x or symbol simulation outflow F2 5
220. ion Servers Compatibility which are compatible with J2EE specifications although our tests were performed on Apache Tomcat only F3 4 File formats For the workflow execution three files are necessary e BPEL e WSDL e WSDL catalog which provides a way for the ActiveBPEL engine to find WSDL Optionally a user can give the PDD file for process deployment description F3 5 Transaction Transactions are supported by Web Service Transaction mechanisms standards The Web Services Transactions specifications define mechanisms for transactional interoperability between Web services domains and provide a means to compose transactional qualities of service into Web services applications F3 6 Supported SOAP and ASOAP communication protocols are fully communication supported protocol F3 7 Users roles User roles are defined using BPEL standard Thus a user can define roles using keyword partnerRole in BPEL source files WP2 Business workflow technology analysis and comparison VISP Consortium Page 152 of 239 D2 2 Workflow Software Analysis and Comparison F4 Workflow client applications F4 1 User interface technologies client application type proprietary heavy weight user clients or general purpose light weight browsers The workflow engine operates with client applications using web services communication or java API invocations F5 Integration with other workf
221. is one of the leading workflow management systems Staffware is authored and distributed by Staffware PLC Verve debuted to the workflow market as in 1998 In late 2000 it was acquired by Versata and renamed Versata Integration Server VIS I Flow is a workflow offering from Fujitsu that can be seen as a successor of the workflow engine from the same company TeamWare I Flow is web centric and has a Java CORBA based engine built specifically for Independent Software Vendors and System Integrators Changengine is a workflow offering from HP the second largest computer supplier in the world SAP R 3 Workflow SAP is the main player in the market of ERP systems For each product pattern combination was checked whether it is possible to realize the workflow pattern with the tool If a product directly supports the pattern through one of its constructs it is rated If the pattern is not directly supported it is rated Any solution which doesn t give direct support is rated The two tables 3 2 and 3 3 summarize the evaluation results of the products pattern Table 3 2 Product Pattern products MI Staffware COS AllnConcertEastman FLO WerlDomino MeteorMobile Sequence EO E o Parallel Split Le es ee eH oP Synchronization Ece e E o an ee Exclusive Choice ee ee Simple Merge H H H a ae aes Seed Multi Choice E e Ce ae eo e Synchronizing Merge oe ee ee ee ee ee ee Multi Merge
222. ith an X When a simulation terminates the process diagram shows the simulation path One can step through the execution of a BPEL process one activity at a time While you are stepping through the simulation execution results can be seen in the Console Viewing the Execution State of an Activity or Link WP2 Business workflow technology analysis and comparison VISP Consortium Page 160 of 239 D2 2 Workflow Software Analysis and Comparison During simulation and remote debugging BPEL activities and links can have one of the following states e Inactive e Active links only e Ready to execute e Executing e Dead Path will not run because of links on conditional execution e Execution Completed activity only e Execution Faulted activity only F2 4 Junction description and or xSee above lor symbol simulation outflow F2 5 Links simulation probability See above type F2 6 General conditions simulationNot applicable validation run simulation F3 Execution workflow engine Not applicable F4 Workflow client applications Not applicable F6 Administration and monitoring Not applicable Functional Auxiliary Functions FA1 Statistics Not applicable FA2 Help Functionalities AWDesigner User Guide is very useful and thorough help provided as a part of Active F5 Integration with other workflow engines Supported standards Not applicable
223. itly supported and explained in 4 19 e One Way Message Synchronous Interaction Asynchronous Interaction Asynchronous Interaction with Timeout Asynchronous Interaction with a Notification Timer One Request Multiple Responses One Request One of Two Possible Responses One Request a Mandatory Response and an Optional Response Partial Processing Third Party Interactions It has to be noticed that BPEL Server uses WS Addressing to identify BPEL process and Web service instances If an invoked service is stateful or third party interactions have to be supported the invoked Web services either have to support WS Addressing too or BPEL correlation sets have to be introduced WP2 Business workflow technology analysis and comparison VISP Consortium Page 106 of 239 D2 2 Workflow Software Analysis and Comparison Additionally Oracle BPEL Server supports so called workflow services that allow including human users in specified roles in the BPEL workflows Such a feature is currently part of the ongoing BPEL 2 0 standardisation Interface 4 The interaction patterns between different BPEL processes have been introduced above Cooperation with other workflow execution platforms seems to be possible as long as they satisfy the WSDL SOAP conventions together with WS Addressing that are necessary to collaborate with BPEL Server Interface 5 BPEL Console allows configuring monitoring debugging and controlling BPEL processes and inst
224. its native file LDAP format Wf XML standard and LDAP connections A process can be imported from external package and participants can be imported from LDAP server Oracle BPEL Process XML BPEL Oracle as an editor supports the Manager WSDL specification of BPEL utilizing XPath and WSDL incl associated XML if necessary BPEL WSDL and XML can be imported and exported It utilizes UDDI and WS_Inspection for the discovery of WS As an engine it supports BPEL that has been compiled to Java code It utilizes SOAP and WS_Adressing and proprietary Java mechanisms WP2 Business workflow technology analysis and comparison VISP Consortium Page 230 of 239 D2 2 Workflow Software Analysis and Comparison Table 6 9 Workflow Engines Workflow Products Software Covered Technologies Comments ActiveBPEL Engine XML BPEL WSDL SOAP XPath XQuery The ActiveBPEL engine can import either 1 X or 2 0 Process Deployment Descriptor PDD Partner Definitions PDEF WSDL BPEL and BPRD deployment files The workflow engine can be invoked using distribution java API or by SOAP calls synchronous and asynchronous communication are supported Import export data towards other products like databases file systems repositories UDDI LDAP monitoring of transactions ActiveBPEL Standard XML BPEL WSDL SOAP XPath XQuery AWS uses WSDL and BPEL for specifying services and processes XML da
225. ity 0 0 o 20 60 GWeak BGood OStrong O Can t assess Figure 6 18 Pie charts for WfMOpen s characteristics YAWL I Functionality Principal Functions F1 Modelling process definition Fct Function name Function implementation no F1 1 Process chart definition Each process definition consists of tasks whether process thread composite or atomic and conditions which can be interpreted as places Each process definition has one unique input condition and one unique output condition see Figure 1 G1 3 and G 15 for details In contrast to Petri nets it is possible to connect transition like objects like composite and atomic tasks directly to each other without using a place like object i e conditions in between For the semantics this construct can be interpreted as a hidden condition i e an implicit condition is added for every direct connection F1 2 Process description major Each task either composite or atomic can have minor multiple instances Each task can have AND XOR splits joins and OR splits and OR joins corresponding WP2 Business workflow technology analysis and comparison VISP Consortium Page 212 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation respectively to Multi choice pattern and Synchronizing merge pattern Finally YAWL provides a notation for removing tokens
226. k 40 good 40 strong 20 Not applicable can t assess WP2 Business workflow technology analysis and comparison VISP Consortium Page 149 of 239 D2 2 Workflow Software Analysis and Comparison This result is illustrated as a pie chart diagram which for the case is presented as E o weuk good Ostrong i Ocen t assess Similar pie chart diagrams are defined for every integral software quality criteria functionality reliability usability efficiency maintainability and portability Thus a relative evaluation of the products in regards to it different software characteristics is found To obtain a common evaluation score for each product a weighted evaluation scheme is applied To each evaluation level of the software sub criteria a weighted coefficient is assigned This weight corresponds to the relatively worth of the evaluation level For this study the weights which were applied were chosen to be week score 2 good score 4 strong score 6 Cannot assess not applicable 0 This weighted evaluation scheme allows the vector evaluation of the main software quality characteristics to be allocated a unique quantitative level Thus the functionality evaluation criteria will have the score FUNCTIONALITY 2 x 0 4 x 40 6 x 40 0 x 20 4 0 6 3 Evaluations ActiveBPEL Engine I Functionality Principal Functions F1 Modelling process definition
227. k for all products for the category Functionality is calculated as Functionality average Functionality product1 Functionality productN N where N is the number of the tested product By the same way appropriate average values have been calculated per each software category reliability usability efficiency maintainability portability Then every tested product has been compared with the average results by means to identify the difference between the product quality and the average products scores The results have been presented in a form of radar diagrams The axis of the diagrams consist the main software quality characteristics The area covered by the product from the radar diagram is a measure for the potential and the performance of the product The particular product is compared with the area covered by the average values for the tested products Thus the prospective product can be identified by the overlapping regions of the radar diagrams The close overlap defines the better software product The particular results for the product assessment according to the average values of the testing are given per product in a radar diagram form WP2 Business workflow technology analysis and comparison VISP Consortium Page 225 of 239 D2 2 Workflow Software Analysis and Comparison ActiveBPEL Engine Fu ney Efficiency D Avarage Value O Active BPLE Engine ActiveWebflow Standard ActiveWe
228. kflow 66 38 Figure3 7 Workflow Pattern 4 Exclusive choice in i FlOW cece eee eens 39 Figure3 8 Workflow Pattern 4 Exclusive choice in MQ Workflow 4 39 Figure3 9 Design patterns for the multi choice ec ece cece ence ee eeeeeneeee 40 Figure 3 10 Sample process ssscsessesessersreseessssrerressessesteseessesssres 43 Figure3 11 Sample process model implemented with Visual WorkFlo 43 Figure3 12 Sample process model implemented with Fort Conductor 44 Figure3 13 Sample process model implemented with Changengine 44 Figure3 14 Sample process model implemented with Staffware 05 45 Figure3 15 Sample process model implemented with i Flow eeeeeeee 45 Figure3 16 Sample process model implemented with MQSeries Workflow 46 Figure3 17 Sample process model implemented with Verve eeeeeeeeee 46 Figure 3 18 Sample process model implemented with SAP R 3 Workflow 47 Figure 4 1 ActiveBPEL engine seetri si erca oree o EEEE AAEREN ERKE eS 66 Figure 4 2 ActiveWebflow BPEL process ccsssssssssresssssssesserreeersssrerereen 72 Figure 4 3 Generated BPEL code o oo cee cee eee e eee ce ence nee ee ene eneeeeeeaeeneenens 72 Figure 4 4 Creating processes cece eee oi ence nee ne E e E EO RRE a k 74 Figure4 5 Biztalk Server s supp
229. kflow Patterns Supported The workflow patterns initiative started at the Fourth IFCIS International Conference on Cooperative Information Systems in Edinburgh in 1999 Aalst et al 2000 In the beginning of 2001 when the workflow patterns site 3 25 was released it attracts the attention of researchers and practitioners to apply the patterns in product development and product evaluations The workflow patterns become an evaluation framework for the assessment of WP2 Business workflow technology analysis and comparison VISP Consortium Page 40 of 239 D2 2 Workflow Software Analysis and Comparison the quality of the workflow software products The results of the patterns evaluations were applied to ERP systems E business systems Call center software An assessment study addressing the quality of workflow software products based on pattern evaluation was performed in Aalst et al 2003 To illustrate this methodology and its evaluation results here is presented the sequence and part of the results obtained for the product evaluation Some of the patterns which have been used for the comparative study and which match the definitions of elementary control flow concepts are Pattern 1 Sequence Pattern 2 Parallel Split Pattern 3 Synchronization Pattern 4 Exclusive Choice Pattern 5 Simple Merge Pattern 6 Multi choice Figure 3 9 Pattern 7 Synchronizing Merge pI F x gt 5 amp yz x lt 5 y gt 7 SoG KORY x
230. l F4 Workflow client applications F4 1 User interface technologies client v 2 52 For full functionality including secure application type proprietary document access Lotus Notes client needed heavy weight user clients or reduced functionality available via MSIE browser general purpose light weight v 3 0 Full functionality via lightweight browser browsers F5 Integration with other workflow engines Supported standards F5 1 Possibilities for collaboration with other jonly XPDL workflow engines standards F6 Administration and monitoring F6 1 Life cycle management Monitoring of all processes available for administrator built in reporter Process validation and simulation allows to Determine dengerous time zone and tune time schedule in runtime administrator can browse for dead processes and Imanage time schedule and routing F6 2 Process status Supervising capabilities Workflow log registers all process events Workflow monitor changes statuses of the activities in the process according to the time schedule and process model Built in reporter shows the list of processes of different status overall per user or per process type F6 3 Flexibility to workflow participants Flexible mechanism for automatic access rights assignment in the runtime Manual access assignment available for administrators X Flow in the runtime resolve
231. l Split in MQ Workflow Administrators factiont4 Action 5 CustomerRegistra Figure3 5 Workflow Pattern 3 Synchronization in i Flow LE gt gt E A Quote ii Broi w achive i gt gt Customer Registratior Figure3 6 Workflow Pattern 3 Synchronization in MQ Workflow WP2 Business workflow technology analysis and comparison VISP Consortium Page 39 of 239 D2 2 Workflow Software Analysis and Comparison Ad ninistrators Action 1 Request orQuote Action 2 Administrators CustomerRegistra Figure3 7 Workflow Pattern 4 Exclusive choice in i Flow gt gt eomer Registration i B w Request for Quote e Ba i co Quote Figure3 8 Workflow Pattern 4 Exclusive choice in MQ Workflow Despite that the evaluation is titled Quantitative Relative Analysis gives graphical representation of the tools about their implementation of workflow patterns Such graphical comparison does not introduce quantitative evaluation scheme and particularly the user cannot make right decision about the quality of the products The derived practical conclusions for user utilization are quite few This is a result both from the complexity of the evaluated tools as from the lack of common evaluation methodology which can derive practical and useful conclusions 3 2 2 Evaluation of Workflow Software Products According To the Wor
232. l WFM systems Cichocki 1997 in ad hoc workflow there is no predefined workflow model for the business process The business process is built ad hocly as it is enacted using distributed services activities Business rules which capture invariant inter service logic are associated with the services and they are used to determine the next activities to be performed on behalf of the business process The main advantage of ad hoc workflow systems is that the business process can be built dynamically and flexible Another advantage is the ability of ad hoc workflow to cope with WP2 Business workflow technology analysis and comparison VISP Consortium Page 23 of 239 D2 2 Workflow Software Analysis and Comparison the dynamic changes in business rules and service definitions implementations and or locations The service providers taking part in the ad hoc workflow are not required to be dedicated services They could be cooperative services in an organization s Intranet or could be loosely coupled e commerce services The following list outlines the main features necessary for effective ad hoc and collaborative workflow applications Ader 2004 Worklist handler important features list order manage and select activities History management and graphical status view Activity definition by scripting actions Graphical procedure definition Features supported by the workflow engine for simple procedure definition Activity
233. l and User Guide are available for YAWL Engine and YAWL Worklet Several documents and white papers are available for download from the YAWL website The white papers are organized in two levels an academic more theoretical level and a system practical oriented level No help available for YAWL Editor II Integral Characteristics YAWL Engine Characteristics can t score ISO IEC 9126 Weak Fogd strong assess result Functionality 40 40 20 3 2 Reliability 100 2 Usability 37 5 37 5 25 3 75 Efficiency 50 50 3 Maintainability 40 60 4 4 Portability 20 40 40 2 8 WP2 Business workflow technology analysis and comparison VISP Consortium Page 215 of 239 D2 2 Workflow Software Analysis and Comparison III Pie Charts Functionality Reliability Usability 0 0 20 25 0 j 40 0 100 w Efficiency Maintainability Portability 0 0 20 a j 40 0 50 50 60 0 40 GOWeak BGood OStrong O Can t assess Figure 6 19 Pie charts for YAWL s characteristics 6 4 Comparisons This section presents comparative diagrams of the assessed workflow products Column diagrams This paragraph performs a decomposition of the software products according to their general workflow functionality Four general categories of the products have been defined Modelling Tools Workflow Editors Workflow Engines Combined Products Editor Engine
234. l mirror site available or do international traffic charges have to be incurred Cost Currently the costs of Internet information resources become important Costs can be divided into a costs of connecting to the resource and b costs associated with the use of the intellectual property contained in the resource In terms of a users paying traffic charges are already having to consider the costs of connection and may want include this in criteria for selection for instance to text based rather than image intensive sites if the image content is the same Increasingly the user will see sites where b is a consideration and a charge is made for the intellectual content of the site The Internet has created an expectation and an opportunity to make charged services available to end users Workflow software Providers have a role in negotiating subscriptions and site licenses for organizational access to charged services If online transactions are used to pay for information the security of these transactions at a site may become important Charged services may be available with limited functionality or for trial periods for free Workflow software Providers will need to decide whether to provide the enhanced or the enhanced or limited version Responsibilities of Parties involved In the evaluation process different parties are involved which play special roles e software developer that creates the software product e testing team perf
235. le of interpretation in different workflow run time products The principles of Process Definition Interchange are based on Meta Model framework which identifies commonly used entities within a process definition their relationships and attributes A variety of attributes describes the characteristics of this limited set of entities Using this Meta Model JaWE can transfer models using a XPDL as a common exchange format Beside this interchange JaWE is also used for internal representation of process definitions The whole concept is shown in Figure 4 9 There is a mandatory minimum set of objects which must be supported within XPDL This minimum meta data model identifies those commonly used entities within a process definition and describes their usage semantics Extensibility is provided by the facility to encompass additional object attributes extended attributes which can be included as extensions to the basic Meta Model to meet the specific needs of an individual product or workflow system Meta Model The Meta Model Process Meta Model describes the top level entities contained within a Process Definition their relationships and attributes It also defines various conventions for grouping process definitions into related process models and the use of common definition data across a number of different process definitions or models Here is a short list of the entities e Workflow Process Definition Workflow Process Activity
236. lity resource utilisation stability co existence recoverability security compliance compliance attractiveness compliance testability replaceability compliance compliance compliance Figure 5 2 Software product quality The attributes of the software quality are categorised into six characteristics functionality reliability usability efficiency maintainability portability The characteristics are sub divided into sub characteristics which can be measured either by internal metrics or by external metrics The quality category Quality in use normally represents the user s point of view about the quality of the software product To achieve appropriate quality in use means to meet quality criteria about external assessments of the product implementation However because the quality in use is a resulting quality characteristic from the external and internal quality of the product the total product quality has to be estimated having assessment for the all quality categories of the product Quality estimations are normally required for the all three levels of the product development However satisfying the quality requirements for internal product measures is not usually sufficient to ensure appropriate quality for the product towards the criteria of external measures Respectively satisfying the appropriate criteria for external measures does not guarantee quality in use Figure 5 3 external influen
237. low Professional Designer is a comprehensive process management solution for organizations that need to create and deploy complex services oriented integrations Based on the BPELAWS 1 1 specification and schema ActiveWebflow includes a high productivity Eclipse based visual design environment and an enterprise class server 4 2 www eclipse org Description ActiveWebflow Designer Designer for short is a visual environment for creating testing and deploying BPEL based process compositions The ActiveWebflow Designer is a plug in to the Eclipse 4 3 ActiveWebflow Enterprise and Standard Server User s Guide 4 4 integrated development environment ActiveWebflow takes advantage of the Eclipse Workbench features to provide BPEL building capabilities Main features e Creating BPEL processes o processes are built by choosing partners services and operations and defining how data flows among those entities o to do so icons are organized on the Process Editor canvas o inthe same time ActiveWebflow constructs valid BPEL code e Testing processes Simulation and Debugging o Simulate process execution using sample data o Set breakpoints step through or run the process o Remotely debug a process running on the server e Deploying created processes o endpoint references for services used in a process are provided by Deployment wizard o A process deployment descriptor provides error free techniques for binding the created s
238. low support for BPEL XLANG Interface 5 BizTalk ships with a Monitoring Notifier tool Business Activity Monitor A portal gives access to process instances statistics information One can also define alerts which can be sent by email for instance Finally BAM exposes web services interface to create alerts retrieve BAM configurations Additional interfaces BizTalk supports import export to UDDI directories via a wizard Supported standards a Process definition tools The business processes are stored as XLANG definitions BPEL is not natively supported that means BPEL definitions that are imported into BizTalk are converted to XLANG definitions Microsoft also gives recommendations to developers to export processes definitions safely by not using such or such functionality in XLANG b Technical environment is Windows Server platform with Net framework and SQL server Figure 4 5 summarizes all the dependencies z3 0 Analysis Services SP4 Documentation Server Runtime Base EDI Adapter Administrative Tools O Developer Tools and SDK __ _Portal Components _ J __ Business Activity Monitoring __ Business Activity Services _ _ ___Human Workflow Web Service _ J l Additional Software Enterprise Single Sign On Master Secret Server __ Enterprise Single Sign On Administration _ Business Rules Components _ MQSeries Agent o o ooo ooo _ Windows SharePoint Servic
239. low Software Analysis and Comparison 4 1 ActiveBPEL Engine Workflow software overview Workflow software presentation ActiveBPEL Engine used in thousands of organizations worldwide is an open source workflow engine written in Java distributed under the GNU General Public License GPL and is a robust runtime environment that is capable of executing process definitions created to the Business Process Execution Language for Web Services BPEL4WS or just BPEL 1 1 specifications The ActiveBPEL engine technology is developed and maintained by Active Endpoints Workflow software description The ActiveBPEL engine executes Business Process Execution Language BPEL processes It accepts BPEL process definitions creates process instances and executes them There are three main areas in the architecture of the ActiveBPEL engine the engine processes and activities The ActiveBPEL engine coordinates the execution of one or more BPEL processes Processes are in turn made up of activities which may in turn contain or link to further activities The architecture of engine is depicted below 4 Deployment oO Plans A o D Process al State O D fe j T Queues D a Alarms ad Figure 4 1 ActiveBPEL engine Category of the software product The ActiveBPEL engine is an Open Source implementation of a BPEL engine written in Java It reads BPEL process definitions and other inputs such as WSDL files and cr
240. low engines Supported standards F5 1 Possibilities for collaboration with other workflow engines standards The engine is only compatible with BPEL 1 x or 2 0 standards F6 Administration and monitoring F6 1 Life cycle All parameters for life cycle management are editable in management ActiveWebFlow application in fact using the engine administration tool is not possible to manage life cycle F6 2 Supervising Using the administration tool a user can supervise processes capabilities status and alarm queue The tool shows a graph which Process status represents the process and updates it in real time F6 3 Flexibility to The BpelAdmin is accessible to all workflow partecipants workflow authentication management tools are not provided with participants ActiveBPEL engine distribution Functional Auxiliary Functions FA1 Statistics Fct no Function name Function Implementation FA1 1 Number of users Not possible FA1 2 Number of processes Active processes are visible in administration tool and a user can view all processes which are in execution or stopped onto engine It is possible to define selection filter criteria to display certain execution period or certain process state running completed faulted FA1 3 User rights INot possible FA1 4 Process Information All processes information is showed in the process status panel FA2 HELP Functionalitie
241. lutions netweaver index epx http www savvion com products http www seebeyond com software ican asp http www sonicsoftware com products sonic_orchestration_server index ssp http www staffware com http www ultimus com index http www versata com products index htm http www webmethods com meta default folder 0000005452 http is tm tue nl research patterns http info lib uh edu pr v8 n3 smit8n3 html http www axia consulting co uk index html http www library cornell edu olinuris ref research webcrit html http www cyberbee com content pdf http www cyberbee com design pdf http www lanner com http www mega com http www intalio com http www fujitsu com global services software interstage products bpm http www axway com WP2 Business workflow technology analysis and comparison VISP Consortium Page 235 of 239 D2 2 Workflow Software Analysis and Comparison 3 36 4 1 4 2 4 3 4 4 4 5 4 6 4 7 4 8 4 9 4 10 4 11 4 12 4 13 4 14 4 15 4 16 4 17 4 18 4 19 4 20 4 21 4 22 4 23 4 24 4 25 4 26 4 27 4 28 4 29 5 1 5 2 5 3 5 4 http www active flow com http www active endpoints com www eclipse org ActiveWebflow Enterprise and Standard Server User s Guide ActiveWebflow Designer User s Guide WIfMC Workflow Reference Model available at http www wfmc org standards model htm htt
242. m Page 229 of 239 D2 2 Workflow Software Analysis and Comparison Execution tools Active BPEL Engine Active Webflow Standard Cape Clear Enhidra Shark Oracle BPEL Process Manager Both modelling and execution tools ActiveWebflow Standard ActiveWebflow Designer Cape Clear Enhydra Jawe Shark Oracle BPEL Process Manager The average comparison between the products identifies the prospective tools as Active BPEL Engine Active Webflow Designer Cape Clear Enhydra Shark and FreeFlue Yawl The supported workflow standardization approach per products is presented in the tables below Table 6 7 Modelling Tools Software Products Covered Technologies Comments Borland Together BPMN UML Borland Together supports the Designer specification of UML and BPMN It supports import of WSDL and associated XML and it exports BPEL Process Modeler BPMN Process Modeler imports WSDL and exports BPEL and XPDL Table 6 8 Workflow Editors Workflow Software Covered Comments Products Technologies ActiveWebflow Designer XML BPEL AWD supports BPEL standard A process WSDL can be created by either using existing WSDL files or building an abstract BPEL and then create the WSDL files for it Data manipulation is accomplished through XML variables The links connecting activities use XPath expression Cape Clear XML BPEL WSDL Enhydra JaWE XPDL Wf XML JaWE supports XPDL as
243. mparison VISP Consortium Page 183 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation transitions and participants specified as v 2 52 Lotus Notes documents with possibilities to export import XPDL files v 3 0 XML database will be used as the optional process storage Process activities of Generic Complex Route or Subprocess types include activity beans definitions split join conditions and related transitions Process participants activity performers definitions are based on Person Hierarchical Role Functional Role Organization Unit System Unknown selected manually Relative like activity n performer or current performer s manager types In every case the engine resolves activity performers to real people or their proxies F1 3 process thread event result correlation Event initial result triggering b F1 4 Flowline F1 5 Definition of organizational units Organization units and Hierarchical Functional roles are specified as workflow participants the same way the people are The real performer s resolution is accomplished in the runtime according to the Organization model and personal availability F1 6 Junctions Flow controls conditions are specified in the process definition model based on events or current activity results Manual controls are available as well
244. mplementation no process thread F1 2 Process description major See above minor F1 3 Event initial result triggering process thread event result correlation F1 4 Flowline F1 5 Definition of organizational units F1 6 Junctions F2 Simulation debug Not applicable F3 Execution workflow engine F3 1 Processes Deployment initialization repositories A business process archive is a container for all the relevant files needed for deploying a BPEL process to the ActiveWebflow server It is an archive file with a bpr extension and is similar to a Web archive file bpr files can be created in two ways e Automatically create a bpr file ActiveWebflow Designer e Manually create a bpr file The basic business process archive includes BPEL process bpel file WSDL file s referenced in the BPEL process wsdl file WSDL catalog xml file Process deployment descriptor pdd file and optionally a partner definition file pdef file in F3 2 Management of distributed workflows Based on BPEL WSDL SOAP F3 3 Application Server Compatibility ActiveWebflow Standard installs into the Apache Tomcat Server F3 4 File formats The following files BPEL process bpel file WSDL file s referenced in the BPEL process wsdl file WSDL catalog xml file Process deployment descriptor pdd file and optionally a partner definition file pdef file are pa
245. mported BPEL files as well as native ones Create Partner Link Add partner link types to an existing or new WSDL file by Types using the partner link type wizard Partner link types are WSDL extensions required for BPEL processes Swimlanes Visual display of each partner s role in the process to show a service is being invoked received from or replied to Export information to share with partners Automatic Variable Assignment Create Copy Operations automatically for new or existing Assign activities Drag the Copy FROM variable to the Copy TO variable Icons and colors indicate at a glance how a variable is used Expression and Query Builders ActiveWebflow provides visual expression editing controls for building a wide range of scripts ActiveWebflow s expression editor can be readily extended in order to be included custom functions Built in BPEL functions are automatically added to expressions as appropriate Activity Properties Required and optional activity attributes are grouped for easy selection in the Properties view Pertinent selections are in drop down lists Add comments if desired Add correlation properties compensation and fault handling Create BPELets to re use a selection of activities in other processes Select one or more activities on the Process Editor canvas and save them to the Custom Palette for later use Significantly shorten design time by reusing modular elements
246. multiplication weighting x evaluation score It may be obvious from the evaluator scorecard results which software product should be short listed The preparation of a common comparison matrix consisting the results of each of the scorecards above can be a good choice for presentation of the total result in a table form 3 3 3 Five Criteria For Evaluating Web Pages The development methodology in Kapoun 1998 is directly addressed for the evaluation of Web pages and Web presence Because the domain of operation of the software products of workflow execution address the global network from usability consideration it is beneficial to cope requirements from Web presence to workflow execution products The criteria for evaluation of Web pages are discussed in 3 28 The evaluation is advised to be performed according to table 5 2 with requirements and appropriate recommendations Table 3 5 Five criteria for evaluating Web pages Evaluation of Web documents How to interpret the basics 1 Accuracy of Web Documents e Who wrote the page and can you contact him or her e What is the purpose of the document and why was it produced Accuracy e Make sure author provides e mail or a contact address phone number e Know the distinction between author and e Is this person qualified to write Webinasicr this document 2 Authority of Web Documents e Who published the document and is it separate from the Authority Webmaster e Check the
247. n collaborative WFMSs are not missioning critical i e periodic failure of such workflows does not significantly interfere with the overall business process Collaborative WFMSs usually use a proprietary database to store shared information e g documents such as conference review forms or papers The example on Figure 2 3 illustrates a simplified collaborative workflow involving the review process for conference papers The review process which starts after collecting all papers is to select reviewers distribute the paper s to the selected reviewers collect and reviews and produce a joint review document for each paper and finally forward it to the authors This is a collaborative workflow because it involves i negotiation for selecting the reviewers and ii collaboration between the reviewers for producing a joint review Furthermore subsequent paper reviews may not be performed by the same reviewers Distribute Papers Combine Fonword Reviews Review Figure 2 3 Collaborative workflow Ad hoc Workflow relates to applications where the process is not defined in advance and is specific to each process instance An example is an on the fly definition of all the steps and deadlines that are needed to handle a customer query The critical point here is the ability to define a process in minutes without requiring any help from a specialist WFMS that support ad hoc workflow are also called groupware Unlike traditiona
248. n functionality free text G1 3 Category of the Describe the main functionalities free software product text G 1 4 Supported interfaces Describe the interfaces Interface 1 Exchange of workflow WP2 Business workflow technology analysis and comparison VISP Consortium Page 135 of 239 D2 2 Workflow Software Analysis and Comparison Cat Function Fct Function name Function implementation no category no descriptions models choreographies orchestration between the tool and other modelling tools repositories workflow execution tools Interface 2 Supports the invocation of workflow engines by workflow clients Implementation of the interface by WSDL interface or a programming language interface Interface 3 Application invocation which perform additional workflow activities Implementation of the interface by WSDL interface programming language interface notification mechanism for human actions Interface 4 Support of workflow integration and collaboration between different domains and or distributed workflow execution platforms Interface oF Monitoring and administration of the workflows activities Life cycle management of distributed workflows Additional interfaces import export of data towards other products like databases file systems repositories UDDI LDAP monitoring of transactions Supported standards Describe Conformity to c Process definition tools Support standards
249. n next steps Document history This document will be kept up to date during the duration of the project Version Date Author Partner Comments 1 0 27 03 06 Todor Stoilov ICCS First version WP2 Business workflow technology analysis and comparison VISP Consortium Page 2 of 239 D2 2 Workflow Software Analysis and Comparison Executive summary This deliverable addresses the set of problems related to the assessment and application of software products which are used for the design and exploitation of workflow management systems The deliverable draws the attention towards the available experience of assessing and comparing such software suits The works in deliverable D2 2 have been conducted in the following sequence First it has been identified the importance of the automation for the design implementation and exploitation of workflow management systems Next it has been performed surveys which present the current state about workflow targets in automation representatives of workflow tools their classifications available results in the product evaluation and current practice in software evaluation The surveys give ground for the project development which are presented in Chapters 5 and later Using the overview descriptions it has been defined the functionalities which have to be supported by the workflow software products Appropriate classifications of the pr
250. n presented as pie chart diagrams WP2 Business workflow technology analysis and comparison VISP Consortium Page 133 of 239 D2 2 Workflow Software Analysis and Comparison To make a unique integral score for the product quality a weighted evaluation scheme discussed in p 3 3 2 is applied The evaluation findings are multiplied by the weights 2 for week 4 for good 6 for strong and 0 for Not appropriate can t assess Thus the integral score per quality category is calculated as IRA J RA E y q Where RA are the evaluation findings of the expert for quality sub category q of the product j IRA is the integral score of the product j Having the absolute scores RA i 1 N the product quality is assessed according to a relative evaluation scheme A IRA IRA ij LN 5 4 The products are compared each others which gives relative assessment of the quality of the products To minimize the relative comparisons following relation 5 4 the product j was chosen with the lowest absolute score min ZRA j 1 N Thus the relative assessment for the product i A ij 1 N towards the worst bp product j is directly related with the absolute values of the assessment J RA Hence the result of the relative assessments A can be presented as a bar chart i j diagram towards IRA and the best product will have the bigger domination over the minimal value of min ZRA j j 1 N These consider
251. n the jBPM java objects and the persistent representation of these objects in a relational database Though it doesn t mean to have any knowledge in Hibernate to build a jBPM based application as it s only used internally by jBPM engine The database schema is provided in jBPM package and the only configuration to be done is to give the database location information as well as credentials and database type Figure 4 16 Category of the software product jBpm is both a modeler and not really an engine but a library that can be run in a JAVA engine aka JVM The modeler part is provided by an Eclipse graphical plugin You can use any JAVA editor to implement your workflow Supported interfaces Interface 1 The process definition is stored in a jBPM database Oracle MySQL on which a jBPM schema is created lt lt Start State gt gt create new web sale order more info needed ya Task Node gt gt wm sTask Node gt gt fix web order data evaluate web order ok off lt lt Fork gt payment shipping y lt Task Node gt gt wait for money lt lt Node gt gt ship item lt Node gt update books She lt lt Joine gt lt lt End State gt gt end Figure 4 16 Example of graph from the editor WP2 Business workflow technology analysis and comparison VISP Consortium Page 98 of 239 D2 2 Workflow Software Analysis and Comparison Interface 2 Any kind of clients as long as the application has set it
252. nal workitem which is then checked back into the engine allowing the original process to continue Worklets can be substituted for atomic tasks and multiple instance atomic tasks In the case of multiple instance tasks a worklet is launched for each child workitem Because each child workitem may contain different data the worklets that substitute for them are individually selected and so may all be different The repertoire of worklets can be added to at any time as can the rules base used for the selection process Thus the service provides for dynamic ad hoc change and process evolution without having WP2 Business workflow technology analysis and comparison VISP Consortium Page 117 of 239 D2 2 Workflow Software Analysis and Comparison to resort to off system intervention and or system downtime or modification of the original process specification 4 20 Survey of UML Modelling Tools Deliverable D2 1 has identified the Unified Modelling Language UML 2 as a possible candidate to be utilized for the specification of choreographies The specific modelling element that should be used for the definition of choreographies is UML activity diagrams Because almost every UML tool supports the definition of such diagrams the evaluation of UML tools as part of the work in task 2 2 seems not to be meaningful Instead we will reference to available evaluations of UML 2 tools If the need to select such a tool will arise in VISP the a
253. nd evaluate each condition The first transition for which the conditions resolves to true will be taken Alternatively an implementation of the DecisionHandler can be specified Then the decision is calculated in a java class and the selected leaving transition is returned by the decide method of the DecisionHandler implementation DecisionHandler interface defines a unique method String decide ExecutionContext ec It must return the name of the transition to follow WP2 Business workflow technology analysis and comparison VISP Consortium Page 190 of 239 D2 2 Workflow Software Analysis and Comparison F2 Simulation debug Not applicable jBPM does not come with a debugger tool or a simulation tool F3 Execution workflow engine F3 1 Processes Deployment initialization repositories The deployment of the process diagram must be done according this the definition file XML must be packed in a PARI archive Process Archive The deployment can be done in 3 different ways via the Designer tool an Ant Task on programmaticaly both using ProcessArchive DeployerTask Class Deploying a jBPM process is saving its definition in a jBPM database JBPM supports Oracle MySQL MSQL It also saves the O R model used for Hibernate F3 2 Management distributed workflows ofIN A F3 3 Application Compatibility ServerjBPM is a JAVA component that can be used in any J2SE plat
254. ne of the following e Receive activity e Pick activity e Flow activity containing one or more Receive or Pick activities The middle of the process consists of linked activities running in sequence or concurrently The process instance ends in one of the following ways e An activity defines that the process is complete e A fault reaches a process scope and the process terminates abnormally F1 4 Flowline Link A link is a structure that connects two activities and controls the order of execution of the two activities A link can include a condition further controlling when or if an activity executes Thel condition is an XPath expression WP2 Business workflow technology analysis and comparison VISP Consortium Page 159 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation F1 5 Definition of organizationalThere are basic activities and structured activities lunits F1 6 Junctions Model of flow controls if applicable In Active Webflow Designer these are Links with al Transition Condition One can control the start of a link targeted activity by writing an expression for a join condition property F2 Simulation debug F2 1 Objects definition simulation Processes can be simulated within ActiveWebflow arrival profile access datajusing sample data or remotely debugged from the simulation process ActiveBPEL serv
255. net surroundings This attention is influenced by the requirements of the VISP project the software tools to serve and support Internet functionalities in message generation and data processing which are natively used in workflow management systems The evaluation scheme which is targeted in this chapter has to minimize the subjective influence of the evaluation performed from different experts to different software products The experience which exists until now about the particular domain for methodology development for assessment of software and informational products is not mature to propose to users a common easy and useful methodology for products evaluation The evaluation methodologies does not found on an objective background which can minimize the subjective expert influence As an attempt to find a common objective background for the evaluation of software product this deliverable introduces the standardization approach in the assessment of the quality of the software products ISO IEC 9126 Thus a common objective methodology is used for the particular problem in product evaluation for this D2 2 deliverable For the next section common notions of the standard ISO IEC 9126 are introduced by means to give explanations to the particular criteria which are used as their hierarchical subordination for the evaluation of the quality of the software products 5 1 ISO IEC 9126 Evaluation Plan To minimize the subjective influence of the ev
256. ng OMG Object Management Group OS Operation System PDD Process Deployment Descriptor PDEF Partner Definitions PDF Portable Document Format PHP PHP Hypertext Preprocessor POJO Plain Old Java Object POOL Process Oriented OpenWFE Lisp Language POP3 Post Office Protocol QIU Quality in Use QVT Query View Transformation RDBMS Relational Database Management Systems REST Representational State Transfer RMI Remote Method Invocation RPQ Required Product Quality SAML Security Assertions Mark up Language SCUFL Simple Conceptual Unified Flow Language SNMP Simple Network Management Protocol SMTP Simple Mail Transfer Protocol SOA Service Oriented Architecture SOAP Simple Object Access Protocol SQL Structured Query Language TCP Transmission Control Protocol UBL Universal Business Language UDA User defined attribute UDAs User defined process attributes UDDI Universal Description Discovery and Integration UML Unified Modelling Language URI Uniform Resource Identifier URN Uniform Resource Name VIS Versata Integration Server WP2 Business workflow technology analysis and comparison VISP Consortium Page 5 of 239 D2 2 Workflow Software Analysis and Comparison WAPI World Association of Professional Investigators WFM Workflow Management WfMC Workflow Management Coalition WFMS Work Flow Management Systems Wf XML Workflow XML WSCI Web Service Choreography Interface WS CDL Web Services Choreography Description La
257. ng assess result Functionality 40 40 20 4 Reliability 25 50 25 2 5 Usability 12 5 50 25 12 5 3 75 Efficiency 67 33 2 68 Maintainability 20 40 40 2 Portability 20 40 20 20 3 2 WP2 Business workflow technology analysis and comparison VISP Consortium Page 171 of 239 D2 2 Workflow Software Analysis and Comparison Functionality Efficiency III Pie Charts Reliability Usability 13 13 50 Maintainability Portability 20 20 0 40 40 GOWeak BGood OStrong OCan t assess Figure 6 6 Pie charts for Cape Clear s characteristics Principal Functions p F1 Modelling process definition Con cern Functionality Fct no Function name Function implementation F1 1 Process chart process thread definition A process is a loosely coupled collection of activities which are executed on a subject e g proposal application reclamation depending on its state A project can contain one or more processes with or without interconnections An activity is an isolated task transaction executed on a subject The activity obtains information from the subject and or adds information to the subject and interacts with the environment If the execution of an activity executes incompletely or with errors it will be re executed after a delay A distinction is drawn between synchronous and asynchronous acti
258. nguage WSDL Web Services Description Language WSFL Web Services Flow Language WSIF Web Services Invocation Framework WSIL Web Services Inspection Language WS RM WS ReliableMessaging XLANG XML LANGuage XMI XML Metadata Interchange XML Extensible Markup Language XPDL XML Processing Description Language XSD XML Schema Definition XSLT EXtensible Stylesheet Language Transformations YAWL Yet Another Workflow Language WP2 Business workflow technology analysis and comparison VISP Consortium Page 6 of 239 D2 2 Workflow Software Analysis and Comparison Table of Content 1 Trt Gui Cti On ss6sseccseceenkeessSsagtassteses eaa a syed steh cue ngs dg suouans ER tenes secosstensbass 12 2 Importance of Workflow Automation cccesccssceceeccesceeseecsaeceaeeececsaceeseecseeenaees 14 Qels WntrOduCtions seoses mipana e ieri ten EEEE VARE E TOE RAE SY 14 2 2 Research Areas Relevant to Software Workflow Modelling neeeeeneeeereesesee 14 2 3 The Evolution of Business Process Management cesccescccececeseceeeeeeneeeeeeeneees 16 2 4 System s and Technological Architecture of Workflow Management Systems 20 2 5 Classes of Workflow Applications cceecesccessecececeseceseecececececeaeeeseseneceeeeseeess 21 2 6 Methodology for the Evaluation of Software Tools esceeeceeseceseeeeeeeeeeeeeeeeeeess 25 3 Suites for Workflow Software eecesccesccesceceseeseeeseeeceseceeecececesecsseeceseceseeseeeseeee
259. nish execution until the system application is finished otherwise it will start system application and return finished status gt activity does not wait for system application to finish but process proceeds to the next activity and JavaScriptToolAgent uses mode 0 to indicate that it should search for java script file Enhydra Shark project delivers a workflow server with a difference It is an extendible workflow engine framework including a standard implementation completely based on WfMC specifications using XPDL without any proprietary extensions as its native workflow process definition format and the WfMC ToolAgents API for serverside execution of system activities Every single component persistence layer transaction manager scripting engines process repository can be used with its standard implementation or extended replaced by project specific modules This way Enhydra Shark can be used as a simple Java library in servlet or swing applications or running in a J2EE container supporting a session beans API Corba ORB or accessed as a web service 4 10 EnterpriseXtention Workflow software overview Workflow software presentation EnterpriseXtention is a comprehensive Document amp Workflow management system consisting of two main elements Document Repository x File and Workflow Engine x Flow and a number of surrounding applications like Corporate Mail Room x MailRoom or Project Manager x Project X Flow i
260. ns for workitems coming back from participants A Worklist is a set of Workitem Stores There is usually one store per participant per role The role is performed by a human a user or by an automated participant apre A Workitem depending on the flow could represent a task a set of files a request etc The Worklist component exposes a Worksession interface that enables its clients to manipulate the workitems in its stores This worksession also contains methods for launching processes creating running workflow instances from workflow definitions Webclient gives the access to the worklist OpenWFE can run completely standalone without any Application Server requiring only a Java SDK 1 4 x or better Category of the software product OpenWEE contains the following features Modelling processing and management of business workflow Worklist component for storing workitems tasks for participants An APRE component allowing you to implement automated agents into your work flows WP2 Business workflow technology analysis and comparison VISP Consortium Page 103 of 239 D2 2 Workflow Software Analysis and Comparison Droflo web based flow designer a well documented REST interface and several libraries to access it Supported interfaces Interface 1 OpenWFE uses his own Process definition language POOL Process Oriented OpenWFE Lisp Language There were some trials to build the xpdl2owfe tool
261. ntrol Flow Event History Manager Handler Management Worklist Integration Application Handler APIs Invocation Workflow Instance Database Figure 2 2 Software architecture of a Workflow Application 2 5 Classes of Workflow Applications Workflow applications fall into four different categories Ader 2004 administrative collaborative and ad hoc The dimensions along which these kinds of workflow are often described include e repetitiveness and predictability of workflows and tasks e how the workflow is initiated and controlled e g from human controlled to automated e requirements for WFMS functionality Collaborative Workflow involves less rigid processes where the essential feature is providing a structured way for participants to work together Typical applications are documentation preparation from multiple sources with approval cycles budget preparation and negotiation or product life cycle management Copied from zur Muehlen 2004 WP2 Business workflow technology analysis and comparison VISP Consortium Page 22 of 239 D2 2 Workflow Software Analysis and Comparison Workflow management systems WFMS that support collaborative workflows must provide functionality for facilitating human coordination collaboration and co decision Georgakopoulos 1995 Users of a collaborative workflow need to access the WFMS to determine if work was completed In additio
262. o participant s mailboxes Providing automatic modification of access control list of the related documents Providing graphic tools for modelling Version 2 52 uses Java Organization Editor TRIDENT Software Group product for Organization model in the case of the process model Open Source JaWE can be used Version 3 0 will use the complete GraphicToXML tool TRIPLAN v 2 0 by TRIDENT Software Group Y Providing graphic viewer of the process status Gantt chart style by means of TRIPLAN v 1 2 v Providing user graphic interface for workflow participants integrated with the other enterpriseXtention modules Providing WEB access MSIE to the worklist SN KN Supported interfaces Interface 1 Exchange of workflow descriptions models choreographies orchestration between the tool and other modelling tools repositories workflow execution tools Process models can be exported as xpdl xml documents Some activity procesing tools assignments use extensions to xpdl specification extended attributes Interface 2 Supports the invocation of workflow engines by workflow clients Implementation of the interface by WSDL interface or a programming language interface WP2 Business workflow technology analysis and comparison VISP Consortium Page 93 of 239 D2 2 Workflow Software Analysis and Comparison Invocation of workflow processes is possible via Lotus Notes client full functionality or WEB client MSIE with the abo
263. od O Strong O Not applicable can t assess O Comments lll Reliability This category analysis the degree to which the tool can be trusted and what it does in unknown situation DESCRIPTIONS e Robustness o How well does the tool behave given error conditions Comments e Recovery mechanisms o Are there checkpoints or partial recovery of entered information Comments o To what degree can one recover entered data Comments e Consistency WP2 Business workflow technology analysis and comparison VISP Consortium Page 139 of 239 D2 2 Workflow Software Analysis and Comparison o Does the tool consistently provide the same output given the same input Comments Integral evaluations for the reliability categories 1 Maturity the capability of the software to avoid failure as a result of faults in the software Weak O Good O Strong O Not applicable cannot assess O Comments 2 Fault tolerance the capability of the software to maintain a specified level of performance in case of software faults or in infringement of its specified interface Weak O Good O Strong O Not applicable cannot assess O Comments 3 Recoverability the capability of the software to re establish its level of performance and recover the data directly affected in the case of a failure Following a failure a software product will some times be down for a certain period of time the length of which is accessed by it recoverability Weak O
264. oducts have been performed concerning their internal software origin their sets of functionalities and targeted domains of implementation It has been identified the problems related to the comparison and evaluation of different software products and the experience available for the assessment of relatively different software suits The lack of direct quantitative evaluations of the products insisted the works in this deliverable to be directed towards getting personal experience of them Thus the deliverable works involve installation configuration and trial test of a several software products carefully chosen among a set of candidate technologies By testing the products we get personal experience for their potential which benefits the assessment and comparison of the products The problem which arises was to minimize the subjective influence of the testing experts in their personal evaluation findings An idea to overcome this problem developed in this deliverable was to apply a common evaluation scheme which is based on objective requirements towards the products We found such common basis by using the standard ISO IEC 9126 for the quality of the software products Following the general requirements of this standard a template has been designed which gives a common framework for the evaluation of the software products The results from the assessment have been summarized and appropriate classification is performed leveraging the decisions
265. of identification and assessment of prospective workflow software products is from high scale and it is difficult to find appropriate solution from users and applications point of view The products have different level of maturity and they are presented both as market available products as an open source software suits Here attempts for classifications of these products are made applying different criteria e Classifications of software tools for business and scientific workflows e Classifications of software tools according to their software language design e Classifications of software tools according to their supported standard e Open Source and Commercial Workflow Tools 3 1 1 Classifications of Software Tools for Business and Scientific Workflows Workflows systems in scientific domain receive wide acceptance particularly in bioinformatics and cheminformatics in the 2000s They are considered very successful to perform multiple interconnections between tools to handle different data formats and data volumes 3 1 The models of scientific workflows are close related to the traditional CGI and server language scripting The adoption of the workflow methodology represents a natural step towards the implementation of automatic techniques in researches and experimental data processing and retrieval The workflow systems in the business domain are more generic They represent in a structural way the set of business tasks in the organizations
266. of 239 D2 2 Workflow Software Analysis and Comparison F3 Execution workflow engine F4 Workflow client application F5 Integration with others workflows engines Supported standards F6 Administration and monitoring FA Auxiliary functions statistics registration country area information help functionalities 3 Reliability 4 Usability 5 Efficiency 6 Maintainability 7 Portability 8 External metrics The different categories were decomposed when this was available to several subcategories Thus the evaluation scheme tries to give hints to the evaluators by means to decrease the values of these incompetences The quantitative evaluations have been introduced by the definition of four levels of assessment categories weak good strong and not applicable cannot assess These categories have been used to calculate scores of the products per evaluation category The evaluation findings are given in Chapter 6 5 3 VISP Template For Evaluation Workflow Software Products Here is presented the evaluation template used by the partners for evaluation of the workflow software products Workflow software evaluation findings GENERAL DESCRIPTIONS Cat Function Fct Function name Function implementation no category no G1 Workflow G1 1 Workflow software Workflow software title and free text software presentation presentation overview G1 2 Workflow software Workflow software structure and descriptio
267. of tested and evaluated products Evaluation error performed by expert during evaluation of product i i 1 N M Number of experts evaluating the software products Eu Error which origins from the methodological approach applied for the assessment of the workflow software products The ideal case will be when the expert identifies the quality of the software product just as its ideal assessment value A Unfortunately the background of the expert j influences the evaluation findings by his error of incompetence 7 An addition noise influence comes from the methodology applied for the product assessment Hence the real evaluation values concerning the quality of the product i will be RA A E y 5 1 WP2 Business workflow technology analysis and comparison VISP Consortium Page 131 of 239 D2 2 Workflow Software Analysis and Comparison The evaluation methodology has to minimize the influence of and by means the working estimations RA to tend towards the real value of the product quality A Because the noise and amp are not measurable during the evaluation process they have to be kept minimal if this is possible The approach implemented for Task 2 2 of WP2 is based on the requirements to increase the expertise of the experts involved in the product assessment to improve the evaluation methodology for assessment of the quality of the products the assessm
268. oft Visio that implements the BMPN specification 1 0 and that uses the functionality of the widespread Microsoft Office product family to generate an environment for designing BPNM diagrams Process Modeler 2 1 is available in English German and Japanese It comprises e BPMN graphical editor with validation checking Because Process Modeller is a plug in for Microsoft Visio it is possible to built BPMN diagrams via drag and drop e Capability to enrich BPMN models with Web services instrumentation in order to export valid BPEL 1 1 and XPDL 1 0 definitions Compliant BPEL infrastructures like Oracle s BPEL Process Modeller are able to import this process definition for final orchestration and deployment e Capability to map export BPMN diagrams to XPDL 1 0 Compliant XPDL infrastructures like Carnot s process engine are able to import this process definition for final orchestration and deployment Because BPMN is no executable language BPMN tools cannot support the interfaces identified in the WfMC reference model Instead a BPMN tool has interfaces to other workflow editors like BPEL or XPDL editors Like most of these tools Process Modeler can import WSDL specifications of existing services The WSDL specifications can be used to specify BPMN interfaces and are part of the export to other workflow editors The tool can import e WSDL Process Modeler has to import WSDL files before it is possible to transform BPMN diagrams to BPEL speci
269. oftware products including intermediate products The characteristics and sub characteristics provide consistent evaluation methodology for the software quality They also provide a framework for specifying quality requirements for software and making trade offs between different software product capabilities such as functionality reliability usability and efficiency The standard ISO IEC 9126 enables the software product quality to be specified and evaluated from different perspectives by those associated with acquisition requirements development use evaluation support maintenance quality assurance audit of the software The quality model defined in the standard ISO IEC 9126 can be used to e validate the completeness of the requirements definition e identify software requirements e identify software design objectives e identify software testing objectives e Identify user acceptance criteria for a completed software product Any specification for the evaluation of the software quality conforming to ISO IEC 9126 results from an evaluation process that considers the potential relevance of the product to e criteria for internal metrics of the product quality e criteria for external metrics of the product quality e Criteria for quality in use metrics Product quality and the life cycle During the life cycle the software endures much quality The product quality at the beginning of the life cycle differs from the actual or to
270. ol Workflow Server o OpenFlow http www mycontrol de workflow http www openflow it o OpenSymphony o OpenWFE http www opensymphony com osworkflow http web openwfe org display openwfe Home o Oracle BPEL Process Manager o PL FLOW WP2 Business workflow technology analysis and comparison VISP Consortium Page 29 of 239 D2 2 Workflow Software Analysis and Comparison http www oracle com technology products ias bpel index html http plflow sourceforge net o Skelta Workflow NET http www skelta com o VivTek http www vivtek com wftk o W4 http www w4global com o Web and Flo Kontinuum http www webandflo com o WebSphere MQ Workflow http www 306 ibm com software integration wmqwf o YAWL http www yaw1 fit qut edu au e Tools for scientific workflow http www trianacode org o Taverna o Kepler http taverna sourceforge net http kepler project org o GridNexus o SPA http www gridnexus org http www casc lInl gov sdm o Triana o JOpera http www jopera ethz ch 3 1 2 Classifications Of Software Tools According To Their Software Language Design A review of the set of open source workflow project is given in 3 3 A classification is performed according to program language used for the design of the software tool The categories used in this classification are projects written in Java other Java other non Java for
271. ollection of coordinated tasks designed to carry out a well defined complex process Mukherjee et al 2004 A workflow management system is a generic information system WP2 Business workflow technology analysis and comparison VISP Consortium Page 14 of 239 D2 2 Workflow Software Analysis and Comparison that supports modelling execution management and monitoring of workflow Many different workflow management systems have been developed that focus on different application domains and provide different functionality Aalst et al 2003 Workflow management lacks a standardized theory that provides a theoretical background for workflows like the relational algebra provide for databases Aalst 1998 Despite efforts of standardization bodies there is no consensus on the representation or conceptual model of workflow processes Sheth 1999 In this diverse and complicated landscape it is a challenge to evaluate and compare the functionality of various workflow management systems and to survey the functional requirements of workflow management systems A number of approaches attempt to address this situation In Jablonski et al 1996 Jablonski et al 1996 Jablonski S and C Bussler Workflow Management Modelling Concepts Architecture and Implementation 1996 International Thomson Computer Press London there are described a lot of essential perspectives and aspects of comprehensive workflow management functionality They pro
272. omparison Fct no Function name Function implementation interaction activities A partner link definition consists of e A unique name e A partner link type e At least one role and can include two roles e Role names of My Role which is the process role and Partner Role At a minimum a process must have one partner linki for each type of conversation it is engaged in Activities the processing steps performed in the order described by the flow diagram In Active Webflow there are several types of activities e Basic activities to exchange and assign data andl define execution steps e Containers to structure activities and handle faults and compensation e Event Handlers Fault Handlers A fault handler defines the activity that the process must perform in response to an error condition Compensation Handlers Compensation is the process of reversing or providing an alternative for al successfully completed activity especially when al fault occurs F1 2 minor Process description major Two kinds of processes can be built abstract andi executable ActiveWebflow provides containers to structurel activities Each container has its own rules for how its child activities are executed F1 3 process thread correlation Event initial result triggering event result A BPEL process instance has a beginning middle and end which are all defined by activities The process must begin with o
273. ompletely new workflow process Process definition within the subflow is entirely independent from the first one where subflow activity resides It has its own set of activities internal transitions participants application definitions and other workflow relevant data Latter three though may be inherited from the package which is common for both workflow process definitions e Block activity An activity may be a block activity that executes an activity set or map of activities and transitions Activities and transitions within an activity set share the name space of the containing process e Route activity Dummy route activity does nothing on its own This type of activities is used for synchronization and constructing complex and sophisticated transitional conditions e g activity pre and post conditions F1 4 Flowline See F 1 6 F1 5 Definition of organizational units Workflow process consists of a number of workflow activities e Atomic activities Generic e Subflow activity e Block activity WP2 Business workflow technology analysis and comparison VISP Consortium Page 178 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation e Route activity See also F1 3 F1 6 Junctions Link between two activities is established by transitions Transitions describe possible transitions between activities an
274. on VISP Consortium Page 61 of 239 D2 2 Workflow Software Analysis and Comparison 4 Survey of Software Products Supporting Workflow Management This chapter presents the results of the software analysis and trials for a prospective list of software products It contains description of the tools that have been evaluated in Task 2 2 of the VISP project In Chapter 2 it has been performed a survey identifying the sets of products related to the workflow domain of activities specification editing simulation and execution of business tasks their integration management and control The survey performed meets a very big list of products which quality is not obvious from descriptive presentation The user can find a lot of redundancy in the descriptions respectively several products are given with a few documentation and explanations An important products feature is what kind of standards related to the workflow management the products can respect and obey The standardization approach is a vital prerequisite for the integration of distributed and cooperating info services which is targeted by the developments of the VISP project Thus the tools which have to be implemented in the current development of the VISP project have to satisfy appropriate standards and requirements Following this conclusion an overview of the products concerning their support to workflow standards is performed Thus an extensive list of products is
275. on and every call to a method WP2 Business workflow technology analysis and comparison VISP Consortium Page 195 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation of the Bonita API which changes the state of an activity is considered as part of a transaction that means every method but those beginning with getxxx which only retrieve information Concept of Hooks Hooks are user defined logic that can be triggered at some defined points in the life of the activity Those defined points are Before Start hook is called just before the activity starts The Before Start hook is not considered to be in the same transaction than the activity The Before Start hook is not triggered for automatic activities After Start hook is called just after the activity has started It is considered to be in the same transaction than the activity The After Start hook is not triggered for automatic activities that cannot be anticipated Cancel hook is called before cancelling an activity and it s considered to be in the same transaction than the activity Before Terminate hook is called just before the activity terminates The Before Terminate hook is considered to be in the same transaction than the activity After Terminate hook is called just after the activity has terminated It is not considered to be in the same transaction than the activity
276. on between the products belonging to the category Workflow engines is given below Functionality Combine Products score result E Active Webflow Designer Active Webflow Standard O Cape Clear Ocon cern O Enhydra JaW E Enhydra Schark menter prise Xtention m JBoss jBPM D ObjectWeb BONITA E Open FE E Oracle BPEL Process Manager E SAP NetWeaver Exchange hfrastructure OYAWL Figure 6 21 Workflow Engines comparative chart This diagram points the potential candidates and winner for application in the VISP development according to the products functional rate which is above the score 4 and WP2 Business workflow technology analysis and comparison VISP Consortium Page 218 of 239 D2 2 Workflow Software Analysis and Comparison according to recommended standards These products are Active BPEL Engine Active Webflow Standard Cape Clear Enhydra Shark Oracle BPEL Process Manager The last diagram summarizes the rates of the products from the category of mutual support of editing and execution functionality Functionality Combine Products 5 2 score result o N U A U m m Active Webflow Designer Active Webflow Standard GB Cape Clear Ocon cem D Enhydra JaWEEnhydra Schark BenterpriseXtention B JBoss jBPM D ObjectWeb BONITA B OpenWFE B Oracle BPEL Process Manager B SAP NetWeaver Exchange Infrastructure OYAWL Figure 6 22 Workflow Editors Engines comparative chart The prospective products h
277. on with the graphical process designers starting from the WSDL of collaborated workflows Each partner can be identified by a given colour in the diagram which helps a lot for readability F6 Administration and monitoring F6 1 Life cycle management The Cape Clear Manager a web based administration application enables the administrator to deploy edit like disable a web service or even suppress a deployed Web Service F6 2 Supervising capabilities Process status The Cape Clear Orchestration Manager lists all the deployed BPEL processes giving detailed information such as status green red light deployed time active suspended completed terminated and failed process instances Clicking on the count of the chosen count gives the details F6 3 Flexibility to workflow participants Both Cape Clear Manager and Cape Clear Orchestration Manager access are protected with a login password Functional Auxiliary Functions FA1 Statistics Fct no Function name Function Implementation FA1 1 Number of users FA1 2 Number of processes Processes are listed FA1 3 User rights FA1 4 Process Information Each process can be clicked to get detailed information process instances FA2 HELP Functionalities Help information II Integral Characteristics Cape Clear 6 5 Characteristics can t score ISO IEC 9126 Weak C00 sti
278. onment may be different from that in the developers environment because some functions may not be visible to a user or may not be used by a user The user evaluates only those characteristics of software which are visible to him during the processes of product utilization Sometimes software characteristics specified by an end user during the requirements analysis phase no longer meet the user requirements when the product is in use because of changing the user requirements and the difficulty of specifying the project needs The changes in the quality categories during the product life cycle are presented in Figure 5 1 Internal External measures measures Process quality Produced effect Product Quality in use Figure 5 1 Quality in the life cycle WP2 Business workflow technology analysis and comparison VISP Consortium Page 122 of 239 D2 2 Workflow Software Analysis and Comparison The evaluation of the products in order to assess the software product quality is the problem which the standard tries to resolve during the different stages of the product design development exploitation maintenance The software product quality can be measured internally generally by static metrics for the code performance or externally generally by measuring the behaviour of the software The design process quality contributes for the improvement of the product quality respectively the product quality contributes f
279. ons there is no one size fits all technology Recognizing this reality Active Endpoints has exposed a wealth of internal server APIs via Web services What s more it is the first commercial BPEL product company to commit the source code of its core engine technologies into open source through ActiveBPEL initiative giving the necessary power and control to understand the internal workings of AWS servers ActiveWebflow Standard Main features AWS Server Features AWS provides an enterprise level business process execution engine that runs as an application in the Tomcat server AWS can be used to e Execute BPEL4WS 1 1 BPEL compliant processes Manage the server s configuration Monitor and analyze process execution using the server s management consoles Suspend resume or terminate running process instances Manage the effective and expiration dates of process versions In addition the processes can be debugged visually using ActiveWebflow Professional Tools The main features of AWS server can be summarized in the following Table 4 4 Table 4 4 Functional peculiarities of AWS tool Fault Tolerance AWS provides the fault tolerance capabilities that are required to support standard class process deployments Using standard database servers ActiveWebflow persists the information about a process and all running instances that allow for the recovery of a process state if a server is shut down for any reason The process information t
280. onses are recommended to be performed in the following sequence e Analyze each evaluation response using a score card e Review each requirement listed in the score card and check the answer s It is recommended to use a simple Yes or No marking or a combined weighting and scoring method to indicate to what degree the scorecard requirements are met by the evaluator e Repeat the process using a new scorecard for each software product An example of the weighted score card is presented here Table 3 4 Table 3 4 Matrix wighted evaluation of the software product SCORECARD Reviewer Date Products Software Requirements 8 1 06 A qualification Evaluation Weighting Evaluation Points Notes Criteria Score Workflow 3x 3 9 good functionality Purchase order 3x 3 9 strong cost 3x 3 9 excellent Needs for 3x 3 9 limited training TOTAL SCORE MAX SCORE e The evaluation criteria have to formalize the requirements towards the software products e Requirement weighting Essential 3 x Desirable 2 x Nice to have 1 x WP2 Business workflow technology analysis and comparison VISP Consortium Page 52 of 239 D2 2 Workflow Software Analysis and Comparison e Evaluation score is based upon reviewing and analyzing the score card The evaluation marks are 0 does not meet requirements 1 partially meets requirements 2 meets requirements 3 exceed requirements e The total points for the evaluation are the
281. or the improvement of the quality in use Therefore assessing and improving the quality of the design process is a means to improve the product quality respectively in this chain by improving the product quality improvement of the quality in use is achieved Hence the requirements for having integral software product quality will influence the set of criteria for internal product quality the criteria for external quality as criteria for quality in use by users Items to be evaluated Items for quality assessments can be found by direct measurement or indirectly by measuring their consequences and related influences The software product quality may be estimated by measuring the performance of the user work when the product is applied The software product is assessed towards predefined set of external metrics which describe the product interaction with the working environment and which assesses the software in his operation functionality The external quality that demonstrates the extent to which the product satisfies the stated and implied user needs can be measured in the operational environment by evaluating quality in use to achieve specified goals with effectiveness productivity and user satisfaction At the earliest stages of product life cycle only resources and process can be measured When intermediate products specifications source code etc become available these can be evaluated by chosen internal metrics that can be used to pr
282. organizational workflows Aalst 1999 Although interorganizational workflows are still very much open to research one can identify two major characteristics which distinguish them from intraorganizational workflows and at the same time lead to several new functional requirements on specification languages not present in the intraorganizational case First interoperability is a prerequisite for interorganizational workflows Interoperability requires agreements on the interfaces between organizations which provide a common understanding of the data and services exchanged Interface standardization or interface bridging become necessary in spite of potential heterogeneity of autonomous organizations interfaces Wegner 1996 Second the autonomy of organizations participating in an interorganizational workflow has to be considered whereby different kinds of autonomy are relevant at different stages in the lifecycle of the workflow These comprise design autonomy at build time communication and execution A general task of the development of the workflow system in the current business activities is the implementation of principles of the automatic control for business systems These systems do not consist of pure technical components but they integrate both human and human computer activities and non automatic interactions Thus the implementation of the principles of the automation will benefit the exploitation behaviour of the business systems
283. orm i Flow Interstage Business platform is a Business Process Management The system has 4 tier architecture repository process logic web tier user interface Haller et al 2005 The web tier contains servlet components running in a web server The main process logic is in the business process management tier The fourth tier contains the database directory document management as well as connectivity to other systems The main tool within the Interstage suite is the Development Manager Client It defines workflow types called WP2 Business workflow technology analysis and comparison VISP Consortium Page 34 of 239 D2 2 Workflow Software Analysis and Comparison workflow templates in i Flow and manages the execution of workflows The Administration Client has the responsibility for administering processes and templates A Functional aspect The tasks performed in the process the operators representing the workflow activities are components of i Flow workflow templates The workflow template has one start node and at least one end node Workflow templates can be organized in super and respective sub workflows B Behavioural aspect i Flow provides a graphical user interface to create process templates The units below are available for designing the sequential behaviour Arrow They are used to link two activities to denote the flow of events Conditional Node This node realizes an exclusive OR or an AND A default outgo
284. orms the test in order to evaluate required software quality WP2 Business workflow technology analysis and comparison VISP Consortium Page 59 of 239 D2 2 Workflow Software Analysis and Comparison e potential clients operate the software product in order to evaluate if it is acceptable for his needs Responsibilities of the developer e designing and implementing the more useful solutions for obtaining the specified quality for the software product e test the software product before to be tested by the test team as a third party in the development process of the software product e making all the necessary corrections in order to remove the errors occurred during the testing process Responsibilities of the client e establishing necessary legal rights in the software product including documentation for the purpose of evaluation e providing information necessary for identification and description of the product e specifying the software characteristics and evaluation level to be considered in cooperation with the testing team e providing suitable access to computers and other equipment used for operational use of the software product e providing general support to the testing team including informal training and access to suitable staff for informal discussions etc e ensuring the timely supply of the software product including documentation and other material necessary for the evaluation e informing the testin
285. orted standards ecceeceec eee eee ene eeeeeneeas 75 Figure4 6 Components of the BizTalk Server engine sce eceeeeee eee eee eees 76 Figure 4 7 Cape Clear 6 5 s Structure 00 0 cece cece cece eee ee ene ene ene eeeeeenaennaes 79 Figure 4 8 Cape Clear 6 5 Interfaces 2 2 0 cece eee eee cece eee ne ene ene ene eeeeeneenaens 82 Figure 4 9 Concept of the Process Definition Interchange eeeeeeeeeee 85 Figure 4 10 Package level snosimo cheb sien chs e ra e E E e ia aih 86 Figure 4 11 Pr cesslevel seco eesetsvelacs eir a e N ER 87 Figure 4 12 Architecture of Enhydra Shark cssssssssssessessssrrrerrrrreressserreen 89 Figure 4 13 Enhydra Shark process monitor esssssesssreersssrssrrrrerresessseeee 90 Figure 4 14 Supported interfaces esssccsssreeresesessssesrrrersrsseeerrreesrsseeeesrs 95 Figure 4 15 Taverna workbench cece cee ee cece cence ence eects tae eneeneeneeeaenas 95 Figure 4 16 Example of graph from the editor sce ece eee eee eee eee eee een ens 97 Figure 4 17 jBPM database overview cece ce ecece nee ne eee neeeec ences eaeeneneeseneneeneneens 98 Figure 4 18 Bonita GraphEditor tool 2 2 0 0 cece eee e cence eee e eee ne ence teen eeeenaens 100 Figure 4 19 The Bonita Architecture 2 0 0 0 cece e cee ce cece eee ee ene e nee tee tee eneenaens 101 Figure 4 20 Components of the Oracle BPEL Process Manager
286. ovide a mechanism for maintaining a history of metadata changes YES NO Not applicable cannot assess Comments WP2 Business workflow technology analysis and comparison VISP Consortium Page 141 of 239 D2 2 Workflow Software Analysis and Comparison Integral evaluations for the usability categories 1 Reuse of Meta data elements from similar documented data sets Weak O Good O Strong O Not applicable cannot assess O Comments 2 Possibility to compare the tool to other applications in a same environment Weak O Good O Strong O Not applicable cannot assess O Comments 3 Availability and completeness of documentation and on line help Weak O Good O Strong O Not applicable cannot assess O Comments 4 Understandability the capability of the software product to enable the user to understand whether the software is suitable and how it can be used for particular tasks and conditions of use this will depend on the documentation and initial impressions given by the software Weak O Good O Strong O Not applicable cannot assess O Comments 5 Learnability the capability of the software product to enable the user to learn its application Weak O Good O Strong O Not applicable cannot assess O Comments 6 Operability the capability of the software product to enable the user to operate and control it Weak O Good O Strong O Not applicable cannot assess O Comments 7 Attractiveness the ca
287. p con cern org http projects niekom de workflow wiki About SharkEnhydra http shark objectweb org doc overview html http taverna sourceforge net http www myerid org uk http tikiwiki org tiki index php page GalaxiaWorkflow http bonita objectweb org html Documentation index html http www inria fr recherche equipes ecoo en html IBM BEA Systems Microsoft SAP AG Siebel Systems Business Process Execution Language for Web Services Version 1 1 May 2003 available at http www 128 ibm com developerworks library specification ws bpel OASIS Web Services Business Process Execution Language Committee Draft Version 2 0 December 2005 available at http www oasis open org committees download php 16024 wsbpel specification draft Dec 22 2005 htm Oracle Application Server Integration Installation Guide 10g Release 2 10 1 2 August 2005 available at http www oracle com technology products ias bpel index htm IBM Microsoft Web Services Description Language Version 1 1 March 2001 available at http www w3 org TR wsdl W3C Web Services Addressing W3C Member Submission August 2004 available at http www w3 org Submission ws addressing Oracle BPEL Process Manager Developer s Guide 10g Release 2 10 1 2 October 2005 available at http www oracle com technology products ias bpel index html Apache Axis project available at http ws apache org axis Web Services Interoperability Organisation Basic Profile Ver
288. pability of the software product to be liked by the user Weak O Good O Strong O Not applicable cannot assess O Comments 8 Compliance the capability of the software to adhere to standards conventions style guides or regulations relating to usability Weak O Good O Strong O Not applicable cannot assess O Comments V EFFICIENCY Integral evaluations for the efficiency categories 1 Time behaviour the capability of the software to provide appropriate response and processing times and throughput rates when performing its function under stated conditions Weak X Good O Strong O Not applicable cannot assess O Comments WP2 Business workflow technology analysis and comparison VISP Consortium Page 142 of 239 D2 2 Workflow Software Analysis and Comparison 2 Resource utilization the capability of the software to use appropriate resources in appropriate time when the software performs its function under stated conditions Weak X Good O Strong O Not applicable cannot assess O Comments 3 Compliance the capability of the software to adhere to standards or conventions relating to efficiency Weak X Good O Strong O Not applicable cannot assess O Comments 4 Metadata exchange The tool is evaluated for its support for metadata import generated by other tools or export of metadata in a standard form that would be ingestible by other tools e Import capabilities o Does the tool can import existing metad
289. parison Cat Function Fct no Function name Function Implementation no category Number of processes Description if applicable User rights Description if applicable Process Information Description if applicable FA2 REGISTRAT Country and zone Description if applicable ION registration FA3 Country area User details Description if applicable information FA4 HELP Help information Description if applicable Functionalitie s Integral evaluations for the functional categories 1 Suitability the capability of the software to provide an appropriate set of functions for specified tasks and user objectives Weak O Good O Strong O Not applicable cannot assess O Comments 2 Accuracy the capability of the software to provide the right or agreed results or effects Weak O Good O Strong O Not applicable cannot assess O Comments 3 Interoperability the capability of the software to interact with one or more specified systems Weak O Good O Strong O Not applicable cannot assess O Comments 4 Security the capability of the software to protect information and data so that unauthorized persons or systems cannot read or modify them and authorized persons or systems are not denied access to them Weak O Good O Strong O Not applicable cannot assess O Comments 5 Compliance the capability of the software to adhere to application related standards conventions or regulations in laws and similar prescriptions Weak O Go
290. pend activity o resume activity o terminate activity abort activity process becomes stucked o manually start an activity delete all finished processes delete selected process perform a check for activity deadlines for all processes perform a check for limits of all processes and activities SysLog callback API Map store Instance database JNDI LDAP Agents Scripts active passive Participants and history Scripting Engines Repository with versioning Process ransac Eon JDBC Mail EJB Database Ressources M as POJO JavaScript Log Sink Log Sink or Memo Proc Def anag BPEL DynWF ry JMS net send J2EE Timer Figure 4 12 Architecture of Enhydra Shark WP2 Business workflow technology analysis and comparison VISP Consortium Page 90 of 239 D2 2 Workflow Software Analysis and Comparison Shark s Administrator Application Administrator Admin 3 ale xj Fie Connection Refreshing Misc Repository management Package management Process instantiation management Process monitor User management Application mapping Cache management Workst management AQIQA ew Opened packages E Package Application_Repository E B Package Business_Example Process definition Check Credit Process definition Customer Service Request foi EPE Process definition Sales Order Processing _Busin Package Participant_Repositar E Package Proce
291. perability 1996 In ACM Computing Surveys Vol 28 No 1 WfMC Glossary 1999 WfMC Glossary Terminology and Glossary 3rd Edition Document No WFMC TC 1011 Workflow Management Coalition Winchester 1999 Wf MC 2002 WfMC Workflow Process Definition Interface XML Process Definition Language Technical Report Document Number WFMC TC 1025 Workflow Management Coalition 2002 http www wfmc org standards docs htm WP2 Business workflow technology analysis and comparison VISP Consortium Page 239 of 239 D2 2 Workflow Software Analysis and Comparison Wohed 2002 Wohed P W M P van der Aalst M Dumas A H M ter Hofstede Pattern Based Analysis of BPEL4WS QUT Technical report FIT TR 2002 04 Queensland University of Technology Brisbane 2002 WSDL 1 1 IBM Microsoft Web Services Description Language Version 1 1 March 2001 available at http www w3 org TR wsdl WS Addr W3C Web Services Addressing W3C Member Submission August 2004 available at http www w3 org Submission ws addressing WS_I Web Services Interoperability Organisation Basic Profile Version 1 0 available at http www ws i org Profiles BasicProfile 1 0 2004 04 16 html WS Insp IBM Microsoft Web Services Inspection Language WS Inspection Version 1 0 2001 available at http www 128 ibm com developerworks library specification ws wsilspec WS Inv Apache Web Services Invocation Framework available at http ws apache o
292. ported Graphical WSDL and schema editors Wizards generate Java Web service skeleton classes to which business logic is added using sophisticated Java Web services tooling Manager Browser based tool providing configuration monitoring diagnostics and troubleshooting capabilities for your SOA Easiness to configure servers and clusters and additional infrastructure like adapters transports and integration with legacy messaging systems Manage service life cycle and configuration for all hosted services with Cape Clear Manager provides comprehensive insight into running systems and includes support for logging traps alerts and faults all of which are configured from the JMX or SNMP management console A sample MIB and MIB browser is included by default Cape Clear Orchestration Manager provides management and monitoring functionality for the Cape Clear Orchestration Engine Using Orchestration Manager an administrator can track the progress of business processes view a history of business process activities drill down to see message exchanges and configure specific variables to be exposed within the console Any Cape Clear server and any services deployed therein can be managed via any JMX or SNMP aware management platform for example HP OpenView CA Unicenter or IBM Tivoli Category of the software product Cape Clear is a all in one solution it includes aprocess modeler support of BPEL 1 1 WP2
293. ported F3 3 Application Server Apache Tomcat 5 0 Compatibility F3 4 File formats YAWL XML Format F3 5 Transaction mechanisms Not applicable F3 6 Supported communication HTML WSDL WP2 Business workflow technology analysis and comparison VISP Consortium Page 214 of 239 D2 2 Workflow Software Analysis and Comparison protocol F3 7 Users roles It is possible to create an organization model with users and other type of resources using the Web interface F4 Workflow client applications F4 1 User interface technologies Any Web browser can be used to administrate and client application type to operate the YAWL Engine proprietary heavy weight user clients or general purpose light weight browsers F5 Integration with other workflow engines Supported standards F5 1 Possibilities for collaboration Not supported with other workflow engines standards F6 Administration and monitoring F6 1 Life cycle management Not supported F6 2 Supervising capabilities What kind of services monitoring active Process status processes alarm queue Failures F6 3 Flexibility to workflow YAWL Organizational model supports the participants management of users roles and other resources Functional Auxiliary Functions FA1 Statictics Not supported FA2 HELP Functionalities Detailed Installation Manua
294. ppropriate links have to be checked respectively the partners experience with such tools has to be considered e A comprehensive list of available UML tools is provided at http www objectsbydesign com tools umltools_byCompany html e An overview and comparison of selected properties of more than 30 UML tools can be found at http www oose de umltools de e An actual evaluation of ten UML 2 tools from November 2005 in German can be found in Oestereich et al 2005 This evaluation compares commercial UML products including Borland Together Architect that has been evaluated in VISP as a BPMN modelling tool ARTISAN Studio 6 0 Borlang Together Architect 2006 02 10 Poseidon for UML 3 2 community edition IBM Rational Software Architect 6 0 IBM Rational Software Modeler ARIS UML Designer 7 0 objectIF 5 0 innovatorAOX 2006 02 10 EclipseUML 2 1 Enterprise Architect 5 0 Telelogic TAU 2 5 The evaluation considers the following criteria General information Supported platforms requirements Supported interfaces Supported UML diagram types UML2 support Code generation Reverse engineering Support for MDA Support for XMI Generation of documentation WP2 Business workflow technology analysis and comparison VISP Consortium Page 118 of 239 D2 2 Workflow Software Analysis and Comparison 4 21 Assessed Software and Corresponding Covered Technologies The following table presents the short list workflow so
295. pre and post conditions in the activity properties F1 5 Definition of organizational The process chart is composed by activities units conditions events listeners edges and operators and or F1 6 Junctions The and or operators are related to the pre post conditions and other junction types are not allowed F2 Simulation debug F2 1 Objects definition simulation Not applicable arrival profile access data simulation process F2 2 Process initialization service Not applicable except the Gantt chart generated time profile necessary using the graphical modelling tool resources available resources child diagram F2 3 Event description simulation It is described by a Java class A template is event generation definition generated from the process description of object simulation arrival profile F2 4 Junction description and or It is described by a Java class A template is x or symbol simulation generated from the process description outflow F2 5 Links simulation probability Simulation functionality of object links if type applicable F2 6 General conditions simulation Support of model validation and run time validation run simulation simulation if applicable WP2 Business workflow technology analysis and comparison VISP Consortium Page 173 of 239 D2 2 Workflow Software Analysis and Comparison F3 Execution workflow engine F3 1 Proc
296. process definition can be exchanged between those two programs without any loss of information both provide Import Export functionality for that purpose IF1 2 Process description major minor Processes are defined as a flow of activities that are drag and drop ed from the toolbox to the designer panel Several activities are provided to interact with the workflow such as Send Receive A workflow can also start another workflow WP2 Business workflow technology analysis and comparison VISP Consortium Page 162 of 239 D2 2 Workflow Software Analysis and Comparison Fct Function name Function implementation no F1 3 Event initial result triggering A Listen activity enables to arm a timer and execute process thread event result a flow of activities if no message is received correlation F1 4 Flowline Flow lines don t hang properties F1 5 Definition of organizational units Presentation and functionality of organizational units and how they relate to the processes chart free text if applicable F1 6 Junctions IA Decide activity is provided and behaves as a If then Else structure It is not possible to define multiple conditions so another Decide activity must be inserted in the Else branch to add another rule F2 Simulation debug F2 1 Objects definition simulation The Health and Activity Tracking
297. purpose effectively Karen McLachlan 2002a The content appears to be complete no under construction signs for example The content of this site is well organized The information in this site is easy to understand This site offers a sufficient information related to my needs purposes The content is free of bias or the bias can be easily detected This site provides interactivity that increases its value The information appears to be accurate based on user s previous knowledge of subject The information is consistent with similar information in other sources e Grammar and spelling are correct Further Information e There are links to other sites that are related to the user needs purposes e The content of linked sites is worthwhile and appropriate to the user needs purposes WWW Cyberguide rating for Web site design Karen McLachlan 2002b Speed the homepage downloads efficiently Home page e The homepage is attractive has strong eye appeal e The user can tell where he is immediately clear title description image captions etc There is an index table of contents or other clear indicator of the contents of the site Site sponsor provider is clearly identified Information method for contacting sponsor provider is readily available Copyright date or date site was established is easy to determine Ease of navigation e User is able to move around within the site with ease Directions for using the site
298. r For98 is a workflow engine that is an add on to Fort s development environment Fort 4GL formerly Fort Application Environment Conductor s engine is based on experimental work performed at Digital Research and its modelling language is powerful and flexible Fort Software was acquired by Sun Microsystems and subsequently became a part of iPlanet E Commerce Solutions in October 1999 In late 2000 version 3 0 of the product became an integral part of iPlanet Integration Server The evaluation here is based on version 1 0 of the product The sample process introduced in Figure 3 10 implemented with Fort Conductor is shown in Figure 3 12 Bor C and D Eal E E First Last Figure3 12 Sample process model implemented with Fort Conductor Changengine Changengine HP00 is a workflow offering from HP the second largest computer supplier in the world The first major version of the product 3 0 has been introduced in 1998 and it is focused on high performance and support for dynamic modifications In late 2000 the product changed its name to HP Process Manager to better convey the purpose of the product to the customers The evaluation here is based on version 4 0 introduced in early 2000 A business process in Changengine consists of a number of different process elements called Nodes linked by Arcs The sample process introduced in Figure 3 10 implemented with Changengine is shown in Figure 3 13 Reset
299. r is F4 Workflow client applications F4 1 User interface technologies client Yes weight user clients or general developed by ECOO team application type proprietary heavy Bonita system have built in client applications purpose light weight browsers www inria fr recherche equipes ecoo fr html F5 Integration with other workflow engines Supported standards F5 1 Possibilities for collaboration Not available yet Work in progress Possibilities for with other workflow engines collaboration with other XPDL based workflow engines standards XPDL module supporting import export XML files conforming to XPDL specification This service will be integrated in GraphEditor application F6 Administration and monitoring F6 1 Life cycle Life Cycle of Process BONITA has a very simple process life cycle applications with the User API be added definition cannot be modified any more management A process as initial once it has been created As soon as the process is in this state it can be controlled using both User API amp Project API The User API allows monitoring the execution of the process Whenever the first activity has been started using the User API the process goes to started state The execution of the process is performed by the BONITA enactment engine under control of A process is started as soon as the first activity has started While being executing the process d
300. ration WSEL WSDL Figure 4 14 Supported interfaces Interface 4 Support of workflow integration and collaboration between different domains and or distributed workflow execution platforms Interface 5 Monitoring and administration of the workflows activities Life cycle management of distributed workflows No tool is provided with engine distribution In fact the only way to have monitoring and administration tools is using the Taverna workbench Figure 4 15 Scufl Workbench i lo x Pag Scun Model Explorer E Available se o 2f i Pr Available Processors lt s input restrictDeleteJab inO lt s input gt a won lt s output gt restrictCreateJob createEmptyJobReturn lt s output gt compare lt fs link gt F create_mutant_sequence A s source gt sequences s source gt F restrict mutant ss source gt snplists s source gt Enactor invocation run lt s sink gt reports s sink Processor statii s coordination name testcoordination gt Type Name Status Start Time End Time lt s condition compare COMPLETE 2003 06 12 11 34 57 2003 06 12 11 34 57 s state Completeds s state gt create_mutant_seq COMPLETE 2003 06 12 11 2003 06 12 11 34 53 lt s target gt restrict_mutant lt s target gt restrict_mutant COMPLETE 2003 06 12 11 2003 06 12 11 34 54 restrictRun COMPLETE 2003 06 12 11 2003 06 12 11 34 55 restrictSetInputt COMPLETE 2003 06 12 11 2003 06 12 11 34 55 restrictDeleteJob
301. rator can status manage all workflows and their participants There is also command line tool that can be used to admin the engine F6 3 Flexibility to workflow One user can play some roles in a workflow participants Functional Auxiliary Functions FAI Statistics Not applicable FA2 HELP Functionalities Not applicable WP2 Business workflow technology analysis and comparison VISP Consortium Page 201 of 239 D2 2 Workflow Software Analysis and Comparison II Integral Characteristics OpenWFE Characteristics weak good strong can t score ISO IEC 9126 assess result Functionality 20 20 60 Reliability 25 25 50 Usability 12 5 50 25 12 5 Efficiency 33 67 5 34 Maintainability 100 6 Portability 20 80 III Pie Charts Functionality Reliability Usability 0 20 0 25 13 13 i0 20 25 43 Efficiency Maintainability Portability 0 pi 0 0 20 1 0 G B0 100 GOWeak m Good O Strong O Can t assess Figure 6 14 Pie charts for OpenWFE s characteristics Oracle BPEL Process Manager I Functionality Principal Functions F1 Modelling process definition F1 1 Process chart definition Oracle BPEL Process Manager fully supports process thread BPEL 1 1 Additional concepts concerning the F1 2 Process description major integration of human users are explained in sect
302. re coding system available How secure is it Are there links to search engines or is a search engine attached to embedded in the Software product All the question above can have an answer which positively reflect the features and capabilities of Workflow software This is a toolbox of criteria that enable Workflow software to be evaluated for use in current commercial activity of transport field actors Another criteria are Scope What items are included in Workflow software What area time period types of information are covered Does the actual scope of the resource match expectations Breadth Are all aspects of Workflow software documentation covered Depth To what level of detail of information provided does Workflow software go Time Is the information in the resource limited to certain time periods WP2 Business workflow technology analysis and comparison VISP Consortium Page 57 of 239 D2 2 Workflow Software Analysis and Comparison Format Are certain kinds of Internet resources for example FTP excluded Content Is the resource an integral resource updated by the information original source or has it been abstracted from another source by an administrator perhaps losing meaning or links in the process Specific aspects related to the content include the accuracy authority currency and uniqueness of a resource Accuracy Is the information in the resource accurate The information is placed to
303. ree text if applicable Junctions Model of flow controls if applicable F2 Simulation F2 1 Objects definition Description of the categories objects in debug simulation arrival the simulation framework if applicable profile access data simulation process F2 2 Process initialization Description of the category process and service time profile its parameters if applicable necessary resources available resources child diagram F2 3 Event description Simulation functionality of object simulation event event if applicable generation definition of object simulation arrival profile F2 4 Junction Simulation functionality of object description and or x junction if applicable or symbol simulation outflow F2 5 Links simulation Simulation functionality of object probability type Jinks if applicable WP2 Business workflow technology analysis and comparison VISP Consortium Page 137 of 239 D2 2 Workflow Software Analysis and Comparison Cat Function Fct Function name Function implementation no category no F3 Execution workflow engine F4 Workflow client applications Integration with other workflow engines Supported standards F6 Administration and monitoring General conditions simulation validation run simulation Processes Deployment initialization repositories Management of distributed workflows Application Server Compatibility File formats
304. rg wsif Yan et al 2001 Y Yan Z Maamar W Shen Integration of Workflow and Agent Technology for Business Process Management The Sixth International Conference on CSCW in Design July 12 14 2001 London Ontario Canada zur Muehlen 2004 M zur Muehlen Organizational management in workflow applications issues and perspectives Information Technology and Management 5 2004 271 291 zur Muehlen 2004a Michael zur Muehlen Workflow based Process Controlling Foundation Design and Application of Workflow driven Process Information Systems 2004 Logos Verlag Berlin 2004 ISBN 3 8325 0388 9 WP2 Business workflow technology analysis and comparison VISP Consortium Page 240 of 239
305. rkflow software overview SAP NetWeaver Exchange Infrastructure 3 0 is the latest version of the NetWeaver platform NetWeaver is an integration and application platform SAP NetWeaver unifies integration technologies into a single platform and it is preintegrated with business applications reducing the need for custom integration The platform is based on industry standards and can be extended with commonly used development tools such as Java 2 Platform Enterprise Edition J2EE Microsoft NET and IBM WebSphere Figure 4 21 Workflow software description SAP NetWeaver Exchange Infrastructure SAP XJ provides open integration technologies that support process centric collaboration among SAP and non SAP applications both within and beyond enterprise boundaries It provides many adapters such as SOAP JMS JDBC to interconnect with heterogeneous systems Figure 4 22 Category of the software product Process modeler and engine Supported interfaces Interface 1 Possibility to import BPML and BPEL definitions Interface 2 Workflow clients can be of various types grace of the great number of adapters available to communicate with external applications see Interface 3 Interface 3 SAP XI provides web services support and provides a set of adapters Remote applications can be hosted on SAP systems via IDOC RFC JAVA applications with JCA It also supports JMS Corba Tibco HTTP S FTP and SMTP Application adapters Ariba BEA W
306. rocedures that need to be presented and managed But the motivation for its booming is its promising usage in managing business processes The benefits of applying workflow technology to business process management are as follows Yan et al 2001 The business processes are explicitly defined so that the responsibilities and the coordination relations are clearly determined Itis easy to optimize the business processes because of their explicit definitions Business processes are modularized and these modules can be reorganized by the WFMS to form new business processes so as to react quickly to unexpected changing business needs and conditions WFMS can track daily operations WFMS integrates applications on different platforms into a business process WFMS provides personal workplaces WFMS separates business logic of a process from the tasks themselves in the process Therefore the user in the workflow system does not have to deal with the route of the business process but only concentrates on the task itself From a technical perspective WFMS bring together principles methodologies and technologies from various areas of computer science control theory automation and management science For example WP2 Business workflow technology analysis and comparison VISP Consortium Page 15 of 239 D2 2 Workflow Software Analysis and Comparison workflow techniques involve database management client server comput
307. rocess definition that was effective when the process was created F3 2 Management of distributed workflows Not provided F3 3 Application Server As suggested by the engine documentation WfmOpen runs Compatibility on JBoss It is the only tested environment F3 4 File formats For the workflow execution are necessary only XPDL files F3 5 Transaction Transaction mechanisms are not directly supported mechanisms However they can be built upon the XPDL subflows which clearly define the interface between interactive processes In all cases the workflow operator has to implement mechanism to treat XPDL exceptions supported by WfMOpen F3 6 Supported WfMOPEN supports SOAP ASAP Asynchronous SOAP communication Corba Wf XML Due to the exposing of API interfaces protocol other protocols can be implemented if necessary F3 7 Users roles User roles can be defined using an engine API called WfMCoreAdmin WP2 Business workflow technology analysis and comparison VISP Consortium Page 210 of 239 D2 2 Workflow Software Analysis and Comparison F4 Workflow client applications F4 1 User interface technologies client application type proprietary heavy weight user clients or general purpose light weight browsers The workflow engine operates with client applications using SOAP communication or java API invocations provided by engine tools F
308. rt to XPDL 1 1 and XML format using WfMC specifications Interface 2 Supports the invocation of workflow engines by workflow clients Implementation of the interface by WSDL interface or a programming language interface Clients invoke engine using java API The engine client API follows the OMG s Workflow Management Facility Specification Interface 3 Application invocation which perform additional workflow activities Implementation of the interface by WSDL interface programming language interface notification mechanism for human actions The WfMOPEN engine can invoke external applications which are involved into workflow process In the engine architecture figure see previous paragraph it is clear that applications are called using OMG asynchronous mechanisms and those are supported by engine tools Interface 4 Support of workflow integration and collaboration between different domains and or distributed workflow execution platforms There is no specific support Integration must be realized ad hoc Interface 5 Monitoring and administration of the workflows activities Life cycle management of distributed workflows Monitoring and administration are supported In fact as well as a Java API the engine comes packaged with a simple web application which supports user authentication mechanisms By this application an administrator can manage e Process Definitions lists all currently imported process definitions and allow
309. s Help is accessible directly by Administration tool It is a simply set of html pages and explain well Administration tool possibilities and how to configure the engine and persistent storage WP2 Business workflow technology analysis and comparison VISP Consortium Page 153 of 239 D2 2 Workflow Software Analysis and Comparison II Integral Characteristics Active BPEL Engine Characteristics can t score ISO IEC 9126 weak good simong assess result Functionality 20 20 60 4 8 Reliability 75 25 4 5 Usability 50 12 5 37 5 2 75 Efficiency 67 33 2 68 Maintainability 60 20 20 3 6 Portability 20 60 20 4 4 III Pie Charts Functionality Reliability Usability 0 0 20 25 60 D 75 Efficiency Maintainability Portability 0 20 0 20 0 20 r e 20 60 0 ETA 60 GWeak BGood OStrong OCan t assess Figure 6 1 Pie charts for Active BPEL Engine s characteristics 13 Active Endpoints ActiveWebflow Standard I Functionality Principal Functions F1 Modelling process definition Fct Function name Function implementation no F1 1 Process chart definition BPEL compliant WP2 Business workflow technology analysis and comparison VISP Consortium Page 154 of 239 D2 2 Workflow Software Analysis and Comparison Fct Function name Function i
310. s a Production Type Workflow Engine based on XPDL specification using prioprietary extensions X Flow engine analyses each Business Process instance interprets its model definition stored in the process model database and resolves activity workitem transition and participants based on organization model stored in the organization model database Current version of enterpriseXtention 2 52 released in October 2005 has its only implementation on IBM Lotus Domino Notes platform Forthcoming version of X Flow 3 0 release planned for June 2006 will be platform independent J2EE product based on SOA The evaluation will concern the 2 52 version The 3 0 version s planned features will be described in the comments Workflow software description Workflow software consists of workflow engine processes and activities storage activities user interface worklist process models storage and additional elements such as organization model module WP2 Business workflow technology analysis and comparison VISP Consortium Page 92 of 239 D2 2 Workflow Software Analysis and Comparison Process model is stored as a set of Notes database documents for processes activities and transitions Database contains also a set of user tools that can be included into activities to achieve needed functionality Process model includes functionality defined in WFMC standards and can be translated into XPDL XML files Workflow engine due to
311. s hooks For example the application can be seen as a web service but a mail client or web client can also interact with it Interface 3 can send mail call a web service and thus any kind of application Interface 4 Can be implemented with web services Interface 5 Workflow activity is persisted in database so any database client can retrieve or set data A web application is also provided Additional interfaces Support of any kind of relational database Oracle MySQL as well as repositories Supported standards Conformity to standards and exchange formats a Process definition tools the plugin tool supports jPDL only It is not designed to model complex workflows This plugin is dedicated to Eclipse platform plain java xml jBPM object model jBPM database logging Figure 4 17 jBPM database overview b Workflow execution tools The workflow can be run in any J2SE context as a JAVA standalone application web application SWING EJB The plug in requires Eclipse 3 0 and J2SE 1 4 JBPM is dependent from other libraries such as Hibernate for O R mapping de hydrating dom4J xml parsing CommonsLoging and Beanshell light JAVA interpreter As it can run on any J2SE environment you can deploy the application on a web application server JBOSS Tomcat The supported protocols are all the ones that can be used in a Java environment like SOAP HTTP Transactions are supported in the jBPM API
312. s real persons or their proxies according to the Organization model database For B2B purpose this database can store different organizations from different domains and can be used for execution of processes across the organizations Functional Auxiliary Functions FAI Statistics Fct no Function name Function Implementation FA1 1 Number of users Tested for 4000 concurrent users on UNISYS 7000 Intel server WP2 Business workflow technology analysis and comparison VISP Consortium Page 185 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function Implementation FA1 2 Number of processes Tested to run 5000 processes daily FA1 3 User rights Flexible mechanism of runtime access rights assignment manual rights assignment by administrators FA1 4 Process Information Graphic process viewer Gantt style TRIPLAN 1 2 Process progress visualized according to user s place in the Organization hierarchy or process ownership FA2 HELP Functionalities Help database amp printed or pdf manual II Integral Characteristics enterpriseXtention Characteristics ear Sad ion can t score ISO TEC 9126 8 8 assess result Functionality 40 60 5 2 Reliability 75 25 4 5 Usability 25 62 5 12 5 3 75 Efficiency 67 33 2 68 Maintainability 40 20 40 2 8 Portability 40 20 20
313. s the import of additional process definition files e Processes details of a selected process can be viewed and management operations can be performed e Assigned Activities it lists all known resources for a detail view of the selected resource s activity assignments e Staff Members lists all members of the staff known to the resource assignment system Staff members may be added edited or removed e Groups lists all staff groups known to the resource assignment system Groups may be added edited or removed Additional interfaces import export of data towards other products like databases file systems repositories UDDI LDAP monitoring of transactions WfmOPEN supports explicitly XPDL Wf XML SOAP ASAP LDAP and even for several DBMS Moreover it can be extended by Java modules in order to embrace other standards WP2 Business workflow technology analysis and comparison VISP Consortium Page 113 of 239 D2 2 Workflow Software Analysis and Comparison Supported standards The WfmOpen engine supports projects based on WfMC specifications expressed by XPDL format WfMCore Admin Client Mozilla Firefox File Edit View Go Bookmarks Tools Help E r S 4 O hepian andanetde 8080 workflow z Go dane IT Innovation into Business Value Process Definitions l Processes Assigned Activities Staff Members Groups About Options Process Definitions Cr
314. s to the real shark users F4 Workflow client applications F4 1 User interface technologies client application type proprietary heavy weight user clients or general purpose light weight browsers Along with its POJO interface it provides a CORBA interface through which the CORBA client applications can communicate with the shark deployed as a CORBA service It can be configured to use organizational structure defined on LDAP server with specific implementation of shark s UserGroup and Authentication component Its interfaces allow passing of external transactions used in some applications so shark can work with this client transactions It uses DODS OR M tool from Enhydra which enables shark to use almost any DB system for storing information and it can be easily configured to switch target DB vendor and or url it has predefined scripts and means to automatically create appropriate WP2 Business workflow technology analysis and comparison VISP Consortium Page 181 of 239 D2 2 Workflow Software Analysis and Comparison tables in those DBs using Octopus ETL tool from Enhydra Shark can use custom Java classes and even interfaces or abstract classes as process variables Supported user interfaces heavy user client lightweight client F5 Integration with other workflow engines Supported standards F5 1 Possibilities for collaboration with
315. server like JBoss WebLogic or Oracle AS The process manager comprises a SOAP engine to communicate with other services or to be invoked by its clients It can be controlled and configured by the Oracle BPEL Console a Web based management tool For the support of long lasting workflows the process manager uses a lightweight respectively a complete database to dehydrate and store the workflow instances Interfaces Interface 1 BPEL Designer can be used to create a BPEL specification from scratch or to import modify and extend existing BPEL choreographies The first case is guided by tool specific wizards In the second case the appropriate configuration files have to be created manually At least the XML configuration file that maps partner links to WSDL files and the WSDL file containing the description of the provided service have to be defined Interface 2 BPEL Designer creates a WSDL file that contains the service definition of the BPEL workflow including the corresponding partner link types Interface 3 BPEL Server is able to invoke Web services that provide a valid partner link type in the associated WSDL This includes BPEL processes running in the Oracle BPEL Server The WSDL can be retrieved using UDDI and WS Inspection 4 22 APIs used by a BPEL Designer wizard Thus the designer is able to browse WSDL repositories to retrieve the needed WSDL definitions Between BPEL processes the following interaction patterns are explic
316. sion 1 0 available at http www ws i org Profiles BasicProfile 1 0 2004 04 16 html IBM Microsoft Web Services Inspection Language WS Inspection Version 1 0 2001 available at http www 128 ibm com developerworks library specification ws wsilspec Oracle Adapters for Files FTP Databases and Enterprise Messaging 10g Release 2 10 1 2 November 2005 available at http www oracle com technology products ias bpel index htm1 Apache Web Services Invocation Framework available at http ws apache org wsif http www webasyst net http smarty php net http www wfmc org http www danet com http schemas xmlsoap org ws 2003 05 partner link http info lib uh edu pr v8 n3 smit8n3 html http www axia consulting co uk index html http www library cornell edu olinuris ref research webcrit html http www cyberbee com content pdf WP2 Business workflow technology analysis and comparison VISP Consortium Page 236 of 239 D2 2 Workflow Software Analysis and Comparison 5 5 http www cyberbee com design pdf 5 6 http www standards com au catalogue script Search asp 5 7 http jhss wrdsb on ca library html evaluate evalinfo htm Aalst 1998 W M P van der Aalst The application of Petri nets to workflow management The Journal of Circuits Systems and Computers 8 1 p 21 66 1998 Aalst 1999 W M P van der Aalst Process Oriented Architectures for Electronic Commerce and Interorganizational Workflow
317. ss process modelling utilizing the Business Process Modelling Notation BPMN It supports the most frequently needed diagrams and notations defined by UML 1 4 like e Component diagram Use case diagram Deployment diagram Activity diagram Sequence diagram Collaboration diagram Statechart diagram Class diagram includes packages Together Designer 2006 also provides support for the most frequently notations defined by UML 2 0 like e Activity diagram Class diagram Component diagram Composite structure diagram Deployment diagram State Machine diagram Use case diagram Interaction Sequence and Communication diagrams In the context of VISP especially the ability to model business processes has been evaluated Together Designer 2006 contains a user friendly graphical modelling editor supporting WP2 Business workflow technology analysis and comparison VISP Consortium Page 78 of 239 D2 2 Workflow Software Analysis and Comparison BPMN The business process diagram tools palette in the editor provides all necessary elements for modelling business activities The user can drag and drop elements to a BPMN diagram and set after that their properties in a special window Together Designer 2006 supports BPMN with some minor changes related to mapping BPMN to BPEL 1 1 BPMN is designed to cover many types of business process modelling with any level of detailing and allows the creation of end to end business processes A diagram cr
318. ss_Repository Process definition Customer Service notify custc S Process detinition Produce Widgets m i Package test_js pProcess properties Name Sales Order Processing me openrunning Crested 2006 01 06 1210 07 2 ie stan suspend E Resume FH terminate HB svon EI show history a Description Variables Activity mmanagemet 2 Delete tinished Delete selected EP Check deaatines g Check limits Figure 4 13 Enhydra Shark process monitor The user management console s page is divided into three parts Functionalities e Accounts the administrator can manage the users of the shark server by defining the new ones deleting the existing ones or changing their properties e Logged displays the list of currently logged users e Mapping enables the administrator to map the package and package s processes participants to the real shark users Enhydra Shark allows mapping a package and package s processes applications to the real applications handled by a tool agent Currently six tool agents come with the Shark distribution To map application definition to tool agent application the user has to go to the application mapping section of admin application and press the add button The dialog will arise and one has to select the application definition at the left side of dialog and the tool agent on the right si
319. ssaging bundled server e HTTP FTP SMTP mail file drop e SOAP for web services over HTTP FTP e Websphere MQ e WS RM WS Reliable Messaging F3 7 Users roles N A F4 Workflow client applications F4 1 User interface Cape Clear 6 5 runs the BEPL process as a Web service It technologies client is then possible to invoke the process from any client application type supporting web services web clients java stand alone proprietary heavy clients Note that Cape Clear 6 5 provides a very useful weight user clients or tool inside the Cape Clear Studio it can dynamically general purpose light generate SOAP requests to test deployed business process weight browsers The screen is split in half the first half contains the request that the developer can update with its own data random data is generated by default The second half is the SOAP answer from the service WP2 Business workflow technology analysis and comparison VISP Consortium Page 170 of 239 D2 2 Workflow Software Analysis and Comparison F5 Integration with other workflow engines Supported standards F5 1 Possibilities for collaboration with other workflow engines standards Cape Clear 6 5 supports workflow collaboration as the process is seen as a web service it can be re used by any of other workflow systems supporting web services Moreover it is very easy to design an orchestrati
320. stem and the number of participants can be very large A typical application is processing forms The ordering and coordination of tasks in administrative workflows can be automated WFMS that support administrative workflow handle simple information routing and document approval functions such as those found in travel planning and purchase requests Administrative workflows do not encompass a complex information process and do not require accesses to multiple information system used for supporting production and or customer services Administrative WFMS are generally non mission critical Consider again the paper review process assuming that the reviewers are known in advance e g the same reviewers are used for all paper reviews Furthermore suppose that the reviewers do not collaborate in producing a joint review Instead they produce individual reviews that are considered by the editor e g program chair who makes the final decision Under these assumptions the paper review workflow becomes an administrative workflow such as depicted in Figure 2 5 In an administrative workflow users are actively prompted to perform their tasks Whereas reviewers using a collaborative workflow needed to access the WFMS to determine if work was completed reviewers using an administrative WFMS may receive email with review instructions along with the paper to be reviewed and a reviewer s comments form When the form is completed it is automatically routed
321. stency stability functionality Control e Secured access password protection encryption firewall e Personalization e Privacy Clarity resolution size layout etc Common Technical Framework interoperability integration protocols standards supported scalability platform file sharing Features administrator tools registration report generation WP2 Business workflow technology analysis and comparison VISP Consortium Page 51 of 239 D2 2 Workflow Software Analysis and Comparison Weighing Product Selection Factors Before selecting specific products institutions should consider each of the above factors balancing as far as possible the merits of specific products against the general features of the system The selection of a specific product requires attention to e Software reliability e Availability of technical support by the institution to the users e Availability of support by the software supplier to the institution and the users e Cost to the institution e g is full ownership 1 e local server support available for the software Matrix weighted evaluation of the product A quantification approach using evaluation matrix is applied for the software product evaluation in 3 27 The evaluation responses may be weighted using points scoring criteria and scorecards Results can then be compared quantitatively according to the evaluation matrix The review and the analysis of the resp
322. structure he get the dialog for editing its properties It is also used to display XPDL in more user friendly way and it provides action to save this user friendly description of XPDL In addition there is a Print button in the menu but printing is not implemented yet XPDL view XPDL view is used for showing a structure of designed process definition in form of XML or more precisely in XPDL Every entity or attribute which is graphically added or changed in JaWE is automatically shown in this panel XPDL view 4 9 Enhydra Shark Java Open Source XPDL Workflow It is a workflow engine completely based on Wf MC and OMG specifications 4 7 Enhydra Shark architecture Based on the agreed components based approach the current architectural goal of Enhydra Shark looks like the following Figure 4 12 4 8 Shark Admin application is Java swing application meant to be used by administrator to manage Shark engine There are two kind of admin application the first one is using shark directly as a library and the other one communicates with shark deployed as a CORBA service using shark s CORBA wrapper interface It can be used to handle shark s external repository containing XPDLs to upload new XPDL files or delete existing ones to load some XPDL file into shark unload it update it to instantiate and monitor shark s processes to perform mappings among participant definitions and real users and among application definitions and Tool ag
323. suggested browser 3 3 4 WWW CyberGuide Ratings An additional approach for the evaluation of the content of Internet based informational resources is described in 3 29 The content evaluation and the quality of a Web site design is assessed by Karen McLachlan 2002a for instructional purposes and the methodology is available from 3 30 WWW Cyberguide rating for content evaluation Karen McLachlan 2002a First look e User is able to quickly determine the basic content of the site e User is able to determine the intended audience of the site Information Providers The author s of the material on the site is clearly identified Information about the author s is available According to the info given author s appears qualified on this topic The sponsor of the site is clearly identified A contact person or address is available so the user can ask questions or verify information Information Currency Latest revision date is provided Date last revised Latest revision date is appropriate to material Content is updated frequently Links to other sites are current and working properly Information Quality WP2 Business workflow technology analysis and comparison VISP Consortium Page 54 of 239 D2 2 Workflow Software Analysis and Comparison e The purpose of this site is clear business commercial entertainment informational news personal page persuasion The content achieves this intended
324. sult correlation F1 4 Flowline Users can monitor the current state of the workflow using webclient application F1 5 Definition of organizational Organizational units are not represented in OpenWFE units It s possible to set up the organizational unit as a participant in a workflow F1 6 Junctions F2 Simulation debug Process definitions can be checked by the validate flowdef script before running the engine OpenWFE starts in console so all errors are displayed All events are also logged to dedicated files separatelly for engine worklist webclient etc F3 Execution workflow engine F3 1 Processes Deployment Not applicable All changes in the workflow are done in initialization repositories config files To apply changes the server has to be restarted F3 2 Management of distributed OpemnWFE supports distributed workflows The engine workflows uses dispatcher and listeners that uses files TCP socket and mail boxes It s possible to implement them in other WP2 Business workflow technology analysis and comparison VISP Consortium Page 200 of 239 D2 2 Workflow Software Analysis and Comparison way F3 3 Application Server OpenWFE includes webclient which is web application Compatibility written in Java The Jetty java webserver engine is included together in the OpenWFE package application But the end user can switch to another webserver for example F3 4 File
325. system The control patterns are divided in several groups basic patterns advanced branching patterns structural patterns multiple instance patterns state based patterns and cancellation patterns Haller et al 2005 The basic patterns capture elementary control flow consists a sequence of activities in which two activities are executed after each other It means that the second one becomes enabled when the first one completes a parallel split and parallel synchronization and join of activities in which several activities execute in parallel or in any order Later they are synchronized the synchronize activity waits until all parallel branches are completed and then continues An exclusive choice xor split and exclusive synchronization xor join in which one out of several branches is chosen based on some condition and later synchronized the synchronize activity waits until the active branch completes since only one branch is assumed to be active The results of the comparisons are expressed in a graphical way For the case of control flow patterns here are presented the results of the comparison in Haller et al 2005 for implementation of Patternl sequence Pattern 2 Parallel split Pattern 3 Synchronization and Pattern 4 Exclusive choice Pattern I Sequence Two or more activities in a workflow type are processed in the order in which they were defined This most basic construct is achieved in i Flow by connecting
326. t files we ll name it mybpel in this example Create the subdirectories e bpel META INF wsdl partners optional As an example let s say you have one BPEL file my_process bpel and two WSDL files servicel wsdl and service2 wsdl Your directory structure would look something WP2 Business workflow technology analysis and comparison VISP Consortium Page 151 of 239 D2 2 Workflow Software Analysis and Comparison like this mybpel META INF bpel Cy process pa wsdl Using this directory structure create the archive and copy it to your servlet container Your WSDL files could live anywhere even on another machine Packaging them inside the pdd lets the ActiveBPEL engine get to them quicker The ActiveBPEL engine reads the WSDL references from the pdd file and uses the location attribute of the lt wsdl gt element as a key into the WSDL catalog If the WSDL catalog contains a matching location the engine loads the WSDL from the corresponding classpath If no mapping exists in the catalog the engine assumes the location is an absolute URL and attempts to load the WSDL from that location The engine supports hot deployment thus administrators can add new processes or modify existing processes without restarting it F3 2 Management of Not applicable distributed workflows F3 3 Application Server The engine is able to work on all Web Applicat
327. t i is more qualified than product k This conclusion is influenced by the errors of the expert evaluations E el However having in mind that during the VISP project developments the partners experience rises it is true that the expert errors vanish by the increase of the time WP2 Business workflow technology analysis and comparison VISP Consortium Page 132 of 239 D2 2 Workflow Software Analysis and Comparison lime t gt 0 Vi LN VI 1LN 5 3 An advantage of the classification scheme 5 2 based on relative assessments A comes from the fact that the error originated by the evaluation scheme disappears This is important having in mind that absolute evaluation scheme is difficult to design Additional benefit of scheme 5 2 in comparison with the assessment scheme 5 1 comes for the expert evaluation background For the scheme 5 1 the final evaluation RA is directly influenced by the expert incompetence l For the scheme 5 2 the final evaluation A is influenced by the subtraction of the two incompetences and j It means that if the incompetence of the evaluator is the same for the different products the integral error e El vanish which is beneficial for the evaluation process For the case when two experts l and m have to assess different products the evaluation scheme A is influenced by the incompetence of the two experts and g However this in
328. t is the capability of the software to be used in place of other specified software in the environment of that software Replaceability is used in place of compatibility in order to avoid possible ambiguity with interoperability Replaceability does not imply that this software is able to replace the software under consideration Compliance it is the capability of the software to adhere to standards or conventions relating to portability WP2 Business workflow technology analysis and comparison VISP Consortium Page 130 of 239 D2 2 Workflow Software Analysis and Comparison 5 2 VISP Methodology for Comparison of the Workflow Software Products Task 2 2 has to tackle the methodological difficulties for the evaluation and assessment of the workflow software products The researches in D2 2 have to identify the products which belong to the category workflow management products The overview presented in Chapter 3 found a large number of products which claim to belong to the categories related to workflow management modelling specification execution During the work of WP2 a set of 134 software products has been identified However these products address different area of system applications scientific systems business systems They are described according to the available references having different level of maturity functionality usability Hence to perform a practical investigation in depth the works in Task 2 2 h
329. t of prospective workflow software products by using the test results of the products The average evaluation results per product is summarize in a table below WP2 Business workflow technology analysis and comparison VISP Consortium Page 222 of 239 D2 2 Workflow Software Analysis and Comparison Table 6 2 Average evaluation results per products ActiveWe Ace Acive We bellow a BizTalk Borland Cape Enhydra enterprise BRED billow Erofession Server Together Clear 6 5 concern Enhydra Shark Xtention Engine Standard al JaWE Designer P T score score score score score score score score score result result result result result result result eee result result Functionality 4 8 4 4 3 6 2 8 4 4 2 3 6 4 2 5 2 Reliability 4 5 3 5 4 5 2 5 3 2 5 3 1 5 2 75 4 5 Usability 2 75 5 4 75 3 25 4 75 3 75 2 75 3 25 3 125 3 75 Efficiency 2 68 2 68 2 68 2 02 1 32 2 68 2 66 4 2 65 2 68 Maintainability 3 6 0 8 1 2 3 6 1 6 2 2 4 0 8 2 8 2 8 Portability 4 4 2 1 6 1 6 4 4 3 2 5 6 2 3 2 8 Oracle FreeFluo jBPM Bonita OPe WFE BPEL ProcessM SAP_Net Wevtonen YAWL Products Process odeler Weaver Manager Characteristics score score score score score score score score Average ISO IEC 9126 score result result result result result result result result result value Functionality 3 2 4 2 4 4 8 4 3 6 3 6 4 8 3 2 3 82 Reliability 1 5 2 5 2 5 2 5 3 2 5 5 5 2 3 05 Usab
330. ta files SOAP for communication Service location is specified using WS Addressing XPath expression is within BPEL files Cape Clear XML BPEL WSDL SOAP Enhydra Shark XPDL Wf XML SOAP ASAP Supports SOAP ASAP Asynchronous SOAP Corba Wf XML Based on Wf MC specifications using XPDL as its native workflow process definition format WfMC ToolAgents API for serverside execution Wf XML standard XPDL XML file formats Oracle BPEL Process Manager XML BPEL WSDL SOAP UDDI XPath Oracle as an editor supports the specification of BPEL utilizing XPath and WSDL incl associated XML if necessary BPEL WSDL and XML can be imported and exported It utilizes UDDI and WS_Inspection for the discovery of WS As an engine it supports BPEL that has been compiled to Java code It utilizes SOAP and WS_Adressing and proprietary Java mechanisms WP2 Business workflow technology analysis and comparison VISP Consortium Page 231 of 239 D2 2 Workflow Software Analysis and Comparison Table 6 10 Combined Products Editor Engine Workflow Software Products Covered Technologies ActiveWebflow Designer XML BPEL WSDL SOAP XPath XQuery ActiveWebflow Standard Cape Clear XML BPEL WSDL SOAP Enhydra JaWE Enhydra XPDL Wf XML SOAP ASAP Shark Oracle BPEL Process Manager XML BPEL WSDL SOAP UDDI XPath These results remind that th
331. talk e Con Process Standard Server e Enterpr WfMOpen cern Manager eSAP ise workflow e ActiveWebflow v Xtention Borland engine Designer NetWeaver Together Exchange De air Freefluo e Enhydra JaWE Instat 2006 e ActiveBP e Enhydra Shark g e e Process BE Engu e ObjectWeb Modeler BONITA 2 1 for Microsoft VisioT The software products given in Table 4 2 have been rearranged in an alphabetical order according to Table 4 3 Table 4 3 Alphabetic order of the short list products evaluated by the VISP consortium ActiveBPEL Engine Metaware Active Endpoints ActiveWebflow Standard ICCS ActiveWebflow Designer ICCS Biztalk Server VALTECH Borland Together Designer 2006 FhI Fokus Cape Clear 6 5 VALTECH con cern WUT INIAN BY GO RD rR Enhydra JaWE ICCS O Enhydra Shark ICCS Metaware mi EnterpriseXtention UAM jani jomit Freefluo Metaware N JBoss jBPM VALTECH ww ObjectWeb BONITA ICCS P Open WFE UAM Nn Oracle BPEL Process Manager FhI Fokus oN SAP NetWeaver Exchange Infrastructure VALTECH N WebAsyst Workflow Management Software ICCS ioe WfMOpen Metaware O YAWL WUT WP2 Business workflow technology analysis and comparison VISP Consortium Page 66 of 239 D2 2 Workf
332. tandardization background of the product its features to cooperate with other software products the possibility to model simulate manage and WP2 Business workflow technology analysis and comparison VISP Consortium Page 148 of 239 D2 2 Workflow Software Analysis and Comparison administer the workflow management processes The evaluation findings are result from installation configuration and trial test of the chosen software among the set of candidate technologies Thus the evaluation is given by direct test with the product which improves the partner experience both in working with this class of software products as with their ability to manage problems related to the design of workflow management systems An additional outcome from the tests and personal evaluations is the integral evaluation of the products addressing the main software quality characteristics This integral assessing introduces the quantitative scores of the quality of the products The integral evaluation has been performed by giving expert ranking for every software quality sub criteria Four level scale has been chosen week good strong cannot assess not applicable which formalize the expert opinion for the appropriate quality sub criteria A particular evaluation finding for the main quality criteria functionality is presented below Integral evaluations for the functional categories 1 Suitability the capability of the software to provide
333. tegration ebXML Electronic Business using eXtensible Markup Language ECM Enterprise Content Management EJB Entreprise Java Bean EPC Event driven Process Chains EPQ Estimated Product Quality ERP Enterprise Resource Planning ESB Enterprise Service Bus FDL Flow Definition Language FTP File Transfer Protocol GNU GNU s Not UNIX GPL General Public License GQ Goal Quality GUI Graphical User Interface HTML HyperText Markup Language HTTP Hypertext Transfer Protocol IMAP Internet Message Access Protocol IT Information Technology Java API Java Application Program Interface JBPEL JavaBusiness Process Execution Language jBPM Java Business Process Management WP2 Business workflow technology analysis and comparison VISP Consortium Page 4 of 239 D2 2 Workflow Software Analysis and Comparison JCA Java Connector Architecture JCP Java Community Process J2EE Java 2 Platform Enterprise Edition JDBC Java DataBase Connector JMS Java Message Service JMX Java Management Extensions JNDI Java Naming and Directory Interface J2SE Java 2 Platform Standard Edition jPDL jBPM Process Definition Language JSP Java Server Page JSR Java Specification Request JTA Java Transaction API KPIs Key Performance Indicators LDAP Lightweight Directory Access Protocol LGPL Lesser General Public License MDA Model Driven Architecture MIB Management Information Base MSIE Microsoft Internet Explorer MSMQ Microsoft Message Queui
334. tem for authentication need using Bonita User Registration API Then he has to be declared as participant in each project in which he is involved in using Bonita Project API He is then able to take part in the process Users are managed in BONITA specific base or thru a LDAP repository as well This base allows storing properties also called preferences for a given user Properties are key value pairs where both key and values are String variables The application can set and retrieve properties using the User interface BONITA makes use of specific user properties in order to store the User preferences Relationship to processes users have to be explicitly associated to processes in order to participate and to have WP2 Business workflow technology analysis and comparison VISP Consortium Page 197 of 239 D2 2 Workflow Software Analysis and Comparison Participant of this process role to them visibility of events occurring in those processes Two scenarios allow to associate a User with a process that is make a User a Whenever a process is created it is created on behalf of the User that initiated the Project Interface automatically associated to the newly created process and can from now on assume the Admin role in the scope of the process The users assuming the admin role for a given process has the right to associate new users to the process and to allocate any This use
335. ter WP2 Business workflow technology analysis and comparison VISP Consortium Page 36 of 239 D2 2 Workflow Software Analysis and Comparison implements an i Flow specific interface to expand a group into a list of individuals The enactment engine uses this at runtime to determine work assignments The ability to read the directory or to expand groups into a list of individuals is exposed by the Model API i Flow provides adaptors to standard LDAP directory such as Sun ONE Directory Server to Microsoft Active Directory and to Microsoft Windows native user group support By the same way have been described the second product Websphere MQ Workflow which is used for the comparison with i Flow Interstage Business platform This descriptive way is worth for experts in the workflow domain but it does not give relative knowledge about the quality of these two products The evaluation continues with the introduction of quantitative analysis which has to introduce appropriate score scheme for the product assessment For illustration purposes the qualitative analysis is referred by Haller et al 2005 Quantitative Relative Analysis of the products iFlow and Websphere MQ Workflow The quantitative analysis describes the level of support in each workflow management systems for the control flow and data patterns These patterns are summarized and then they have been evaluated for each pattern if it is supported in each workflow management
336. terns Thus the recommendations made by such evaluation address design issue They do not address explicitly quantitative characteristics which can help the common user for making relative choice about the application quality of the software tools 3 3 Software Evaluation Methodology This chapter presents an overview of different methodologies applied for the evaluation of the software products The overview demonstrates that there are several approaches and WP2 Business workflow technology analysis and comparison VISP Consortium Page 48 of 239 D2 2 Workflow Software Analysis and Comparison application methodologies for assessment of software products 3 3 1 3 3 5 Particular attention is done for those methodologies which address information systems and products which commonly operate in global network environment and Internet surroundings The experience gathered in the domain of developing methodologies for assessment of software and informational products is presented by short description of several approaches applied for software evaluation 3 3 1 Smith s criteria for evaluation of Internet based software and information resources The developments in Smith 1997 address the problem of the definition of a methodology for the evaluation and comparison of Internet based software products which implement appropriate information system offering software and informational resources The evaluation is perform
337. the deliverable D2 2 WP2 Business workflow technology analysis and comparison VISP Consortium Page 147 of 239 D2 2 Workflow Software Analysis and Comparison 6 Evaluation Findings 6 1 Introduction It is virtually difficult to give a full overview and a detailed comparative analysis for all practically available software products and the reason that the best software product can be found in this prospective raising domain as workflow management and business process automation It is however a useful exercise to make a bit general comparison of prospective products since the evaluation procedure may otherwise get lost in details and fail to see the main objective and essential characteristics of each product The presentation in this chapter is therefore not a brief summary of each product description but rather a snapshot of each product s most noticeable aspects from our own point of view We tried to establish a common basis for comparison and evaluation of the products and to derive charts for comparative presentation The more details of each product are given in the general description for each performed in chapter3 of the deliverable Here for each product it is presented e A pie chart which illustrates how well each product meets the main requirements for the software quality e A bar chart which compares the average scores of the products in the category where they compete e A radar diagram which assess the
338. the resource been designed to work well with one software and user interface but is difficult to use with others It is useful to test resources with a variety of browsers and connections Some resources may pose problems to users who have not installed appropriate software Images and other multimedia may create problems if users have not installed the correct viewer Searching How effectively can information be retrieved from the resource Is the resource organized in a logical manner to facilitate the location of resources Is the organizational scheme appropriate for example chronological for an historical source or geographical for a regional resource Is a useful search engine provided What operators and ranking features are available Is the search engine interface intuitive Does the search engine index the whole resource Browsability and organization Is the resource organized in a logical manner to facilitate the location of resources Is the organizational scheme appropriate for example chronological for an historical source or geographical for a regional resource Interactivity Where interactive features such as forms cgi scripts etc are provided do these work Do they add value to the site Connectivity Can the resource be accessed with standard equipment and software or are there special software password or network requirements Can the resource be accessed reliably or is it frequently overloaded or off line Is a loca
339. the Business Rule Engine which provides a simpler and more easily modified way to express the rules in a business process Each orchestration creates subscriptions to indicate the kinds of messages it receives As illustrated in the preceding figure the message processing proceeds as follows 1 A message is received through a receive adapter Different adapters provide different communication mechanisms so a message might be acquired by accessing a Web service reading from a file or in some other way The message is processed through a receive pipeline This pipeline can contain components that perform tasks such as converting the message from its native format into an XML document and validating its digital signature The message is delivered to a database called MessageBox database which is implemented by using Microsoft SQL Server When a message arrives in the MessageBox database that message is dispatched to its target orchestration which takes whatever action the business process requires The result of this processing is typically another message which is produced by the business process and saved in the MessageBox database The new message is processed by a send pipeline which may convert it from the internal XML format used by BizTalk Server 2004 to the format required by its destination add a digital signature and more WP2 Business workflow technology analysis and comparison VISP Consortium Page 77 of 239 D2
340. the delivered product quality The assessment of the quality is also a reflection of different points of view of the evaluator It is necessary to define in advance the set of evaluation criteria about the quality of the product and to follow the changes in this quality along the life cycle of the product The standard considers several categories of the product quality for the different stages during the life cycle of the product These quality categories are shortly introduced below Practical implementation for the D2 2 works has the quality category Quality in Use QIU Goal Quality GQ is a necessary and sufficient quality that reflects the real user needs ISO 8402 defines the quality in terms of the ability to satisfy stated and implied user needs Needs defined by a user do not always reflect the real user needs because a usually the user is not always aware with his real needs In addition these needs are not constant and they may change in time GQ is a conceptual entity which cannot be completely defined at the beginning of the product design but the developers have to try to get closer to it GQ does not WP2 Business workflow technology analysis and comparison VISP Consortium Page 121 of 239 D2 2 Workflow Software Analysis and Comparison necessarily mean perfect quality but necessary and sufficient quality Requirements for GQ can be evaluated by measuring quality in use QIU when the product is complete Require
341. time component and an execution environment named run time component zur Muehlen 2004a The development environment gives workflow designers tools for the design of workflow models the specification of workflow relevant data structures and the design of the organizational model relevant to the execution of the workflow models The modelling of processes and organization structures are mainly supported through graphical modelling tools The specification of data structures and integration adapters is ordinary text based and resembles to the traditional programming view The last can be stored in a workflow model repository The second main part of the Workflow management system is the workflow engine or run time environment which consists of modules which cover different functional aspects Usually the modules are hierarchically organized The coordinator is an event handler send event notifications to and receive notifications from these modules zur Muehlen 2004a e The process management facility create workflow instances from the workflow model It ensures an appropriate entry to the workflow instance database It has to obey to the execution constraints like the validity period of a workflow model e The control flow manager controls state changes of the workflow instances It has to handle the control flow conditions e The worklist handler creates and manages access rights to work items It handles the users work lists and if con
342. tion Languages There are two trends coming together in the world of E business that are creating both opportunities and pressures to automate business processes across organizational boundaries One is the technology push created by enabling technologies taking XML based standards and the Internet as a starting point The other trend is the need to improve the efficiency of processes from a business perspective After the dotcom crash there is a pressing need to truly utilize the potential of Internet technology by automating business processes across enterprise boundaries The goal of web services is to WP2 Business workflow technology analysis and comparison VISP Consortium Page 17 of 239 D2 2 Workflow Software Analysis and Comparison exploit XML technology and the Internet to integrate applications than can be published located and invoked over the Web A typical example of a web services application is the Galileo system that connects more that 42 000 travel agency locations to 37 car rental companies 47 000 hotels and 350 tour operators To truly integrate business processes across enterprise boundaries it is not sufficient to merely support simple interaction using standard messages and protocols Business interactions require long running interactions that are driven by an explicit process model This raises the need for web services composition WP2 Business workflow technology analysis and comparison VISP Consortium
343. tion Support FA2 HELP Functionality Help functionalty is not provided by the administration or toolagent tools but an understandable guide comes with the Shark installation package WP2 Business workflow technology analysis and comparison VISP Consortium Page 182 of 239 D2 2 Workflow Software Analysis and Comparison II Integral Characteristics Enhydra Shark Characteristics can t score ISO IEC 9126 weak good strog assess result Functionality 60 40 4 8 Reliability 25 50 25 4 Usability 37 5 62 5 3 25 Efficiency 61 33 2 66 Maintainability 60 40 4 Portability 25 60 25 4 4 III Pie Charts Usability Functionality Reliab ility 0 0 0 50 Portability Efficiency Maintainability 0 0 54 GWeak BGood OStrong O Can t assess Figure 6 9 Pie charts for Enhydra Shark s characteristics EnterpriseXtention I Functionality Principal Functions F1 Modelling process definition Fct no Function name Function implementation F1 1 Process chart definition process Process chart is transformed into the process model thread via graphic tools which produce XML XPDL F1 2 Process description major Process definitions models are arranged into minor packages according to XPDL specification Each process definition includes the set of activities WP2 Business workflow technology analysis and co
344. tion event generation potential reasons From the definition of object simulation arrival profile context menu the user can F2 4 Junction description and or x or symbol jquickly find on the diagram the simulation outflow element which could not pass the F2 5 Links simulation probability type validation F2 6 General conditions simulation validation run simulation F3 Execution workflow engine Not applicable F4 Workflow client applications Not applicable F5 Integration with other workflow engines Supported standards Not applicable F6 Administration and monitoring Not applicable Functional Auxiliary Functions FA1 Statistics Fct no Function name Function Implementation FA1 1 INumber of users One user WP2 Business workflow technology analysis and comparison VISP Consortium Page 166 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function Implementation IFA1 2 Number of processes not applicable IFA1 3 User rights not applicable IFA1 4 Process Information not applicable FA2 HELP Functionalities Borland Together Designer 2006 provides comprehensive documentation and examples for the business process modelling on BPMN II Integral Characteristics Borland Together Designer 2006 for Eclipse Characteristics weak good strong can t
345. tion on itself cannot result in problems It is only the execution of delegation classes that can lead to exceptions On process definitions nodes and transitions a list of exception handlers can be specified Each exception handler has a list of actions When an exception occurs in a delegation class the process element parent hierarchy is serached for an appropriate exception handler When it is found the actions of the exception handler are executed Note that the exception handling mechanism of jBPM is not completely similar to the java exception handling In java a caught exception can have an influence on the control flow In the case of jBPM control flow cannot be changed by the jBPM exception handling mechanism The exception is either caught or uncaught Uncaught exceptions are thrown to the client or the exception is caught by a jBPM exception handler For caught exceptions the graph execution continues as if no exception has occurred Functional Auxiliary Functions FA1 Statistics Not applicable FA2 HELP Functionalities Help available online on the jBoss website II Integral Characteristics jBPM Characteristics can t score ISO IEC 9126 Weak 200d sumone assess result Functionality 20 60 20 4 Reliability 25 50 25 2 5 Usability 37 5 37 5 25 2 25 Efficiency 50 50 2 Maintainability 20 20 40 20 3 6 Portability 20 20 40 20 3 6
346. to the program committee chairperson who is alerted when all of the reviews are completed WP2 Business workflow technology analysis and comparison VISP Consortium Page 25 of 239 D2 2 Workflow Software Analysis and Comparison Select Reviewers Review Review Review request 4 request 2 request n n Distribute Papers Review 1 Review 2 Review 3 Produce Fonword Joint Figure 2 5 Administrative workflow The following list outlines the main features necessary for effective production and administrative workflow applications Ader 2004 Representation of sequence alternative parallelism loop multiple path Variables definition representing the procedure context Organization modelling role group participant authority Administration Application Programmatic Interfaces Multilingual support Expression of pre and post conditions path conditions exceptions Exception processing related to time management Verification and simulation Dispatching rules based upon an organization model Management of deadlines documents and folders automatic activities Events processing mechanisms based upon time and external events 2 6 Methodology for the Evaluation of Software Tools The evaluation of a software product can be performed in a different ways The product quality can be assessed according to quantitative and qualitative software evaluations Kitchenham 1996 The quantitative e
347. tools included in con cern 1 a graphical modelling tool 2 a generator for process description Java templates unit tests and HTML documentation WP2 Business workflow technology analysis and comparison VISP Consortium Page 83 of 239 D2 2 Workflow Software Analysis and Comparison Con cern is a tool for the administration of processes and diagnostics Category of the software product A process is described as a set of activities with pre and postconditions An activity is executed when its preconditions are met It manipulates the process item thereby creating postconditions The process flow is determined at run time The process is described via the modeler and then a Java code is generated After the deployment of the process to an application server a client can be written using the Java templates to connect to it Supported interfaces Interface 1 There are no facilities to exchange of workflow descriptions models choreographies orchestration between the tool and other modelling tools repositories workflow execution tools Interface 2 Supports the invocation of workflow engines by workflow clients Interface 3 Implementation of the interface is done by using the standards used for deployment to a application server JBoss AS or Tomcat and stubs are generated using the con cern APIs Notifications are not implemented Interface 4 Controllers can be deployed as MBeans JMX Integration or using a J
348. triggering process thread event result correlation Events specify moments in the execution of the process The JBPM engine will fire events during graph execution This occurs when jbpm calculates the next state An event is always relative to an element in the process definition like e g the process definition a node or a transition Most process elements can fire different types of events A node for example can fire a node enter event and a node leave event Events are the hooks for actions Each event has a list of actions When the jBPM engine fires an event the list ofl actions is executed External events can also occur the reception of a message from an external system can resume the execution of the process diagram However everything must be done outside the process definition file F1 4 Flowline Flowlines are Transitions Transitions don t do anything except to define a path through Nodes It is possible to execute an Action when the transition is processed F1 5 Definition of organizational units N A F1 6 Junctions Junctions don t exist on their own The only way is to add al Decision node There are basically 2 ways to specify the decision criteria Simplest is by adding condition elements on the transitions Conditions are beanshell script expressions that return a boolean At runtime the decision node will loop over its leaving transitions in the order as specified in the xml a
349. ture The central component is the workflow engine It consists of a set of EJBs and some JMS queues packaged as an EJB jar that can be integrated in any application The workflow engine can be used without any of the other components of the project provided that all management functions e g importing process definitions are implemented by your client s Moreover the engine offers a set of tools like e JavaScript interpreter based on Rhino JavaScript interpreter Jelly a tool for turning XML into executable code LDAP queries and manipulation A SOAP tool which invokes web services dynamically XSLT Mail javax mailing service Wait a tool can be used for process delay Channel based Access Tools that support message oriented communication with process instances e Tool Agents the possibility to add your tool plugins to the workflow engine WP2 Business workflow technology analysis and comparison VISP Consortium Page 112 of 239 D2 2 Workflow Software Analysis and Comparison Category of the software product The WfMOPEN engine is an Open Source implementation of an XPDL engine written in Java It offers a set of java libraries API DBMS connectors and tools to support workflow environments Supported interfaces Interface 1 Exchange of workflow descriptions models choreographies orchestration between the tool and other modelling tools repositories workflow execution tools The tool can import and expo
350. uage Technical Report Document Number WFMC TC 1025 Workflow Management Coalition 2002 http www wfmc org standards docs htm Wixom 2 2 Research Areas Relevant to Software Workflow Modelling The workflow management system becomes important term Workflow can be defined as the sequence or steps used in business processes Marshak 1994 The workflow process has to prescribe that more than one person is involved with their activities and that the workflow consists of both sequential and parallel steps Workflow Management is supporting and controlling the workflow An important objective in Workflow Management is to automatically route artefacts documents messages e mails through a network to actors having predefined roles The routing is done according to a set of predefined rules and is often controlled by the state of the artefact e g the price Business rules are particularly important for routing of artefacts This approach requires relatively stable business rules as the rules cannot always be changed on the fly The business domain of Workflow Management is addressing the information services The intent of using workflow technology within the Workflow Management presumes to be developed the full range of problems from understanding to automation Workflow management deals with supporting business processes in organizations and it involves managing the flows of work through an organization Aalst 1998 Workflows are a c
351. ulation process default log level to log SOAP messages requests and replies F2 2 Process initialization service N A time profile necessary resources available resources child diagram F2 3 Event description simulation N A event generation definition of object simulation arrival profile F2 4 Junction description and or x N A or symbol simulation outflow F2 5 Links simulation probability N A type F2 6 General conditions simulation The BPEL file is validated every time it s saved in validation run simulation the process designer It s validated another time while being deployed on the server F3 Execution workflow engine F3 1 Processes initialization repositories Deployment When you create a new Web service project Cape Clear Studio creates a ws application xml file in the ws WSAR INF directory of the project The project s ws application xml file is the application descriptor for the server This file contains static information about the application WSDL schema mappings and component or adapter type Default values for these elements are configured automatically by Cape Clear Studio when generating the ws application xml file However one can change several of these settings through the WS Application Editor user interface Some of the ws application xml file configuration WP2 Business workflow technology analysis and comparison VISP Consortium Pag
352. ulation validation run simulation INot applicable F3 Execution workflow engine F3 1 Processes Deployment The workflow SCUFL file must be passed to engine vial initialization repositories SOAP In fact the engine exposes some methods to receive as input SCUFL files F3 2 Management of distributedNot applicable workflows F3 3 Application ServerfAll application servers which are compatible with Compatibility Apache Tomcat 5 x F3 4 File formats XScufl files XML format F3 5 Transaction mechanisms _ Scufl specifications F3 6 Supported communicationSOAP and ASAP communication protocols are fully protocol supported F3 7 Users roles Scufl specifications WP2 Business workflow technology analysis and comparison VISP Consortium Page 187 of 239 D2 2 Workflow Software Analysis and Comparison F4 Workflow client applications F4 1 User interface technologies he workflow engine operates with client client application type applications using web services communication proprietary heavy weight user clients or general purpose light weight browsers F5 Integration with other workflow engines Supported standards Not applicable F6 Administration and monitoring F6 1 Life cycle management Only by Taverna workbench F6 2 Supervising capabilities See above Process status F6 3 Flexibility to workflowJ2EE web container sec
353. unning either on top of a J2EE application server or standalone with a web servlet container such as Tomcat 4 1 AWS servers are high performance BPEL servers that deliver many enterprise features including static analysis process persistence process versioning extensive runtime web console programmable Web Service and Java APIs plus diagram based diagnostics WP2 Business workflow technology analysis and comparison VISP Consortium Page 68 of 239 D2 2 Workflow Software Analysis and Comparison Key Benefits e Accuracy AWS servers support multilevel validation including validity verification of BPEL process definitions and of the incoming message s format e Speed AWS servers are fast as they use BPEL as their native process language and do not have to translate between BPEL and proprietary internal constructs e Reliability AWS servers support process persistence which caches state information at critical points during process execution If a server goes down either unexpectedly or for maintenance process executions will resume automatically when the server is returned to operation e Growth AWS servers provide comprehensive versioning features AWS servers use the new version for all new process instances and older versions for in flight instances Once all in flight instances have completed the older process versions are automatically retired e Control When it comes to complex process management applicati
354. urity can be used to help participants secure a Freefluo web service Functional Auxiliary Functions FA1 Statistics Only by Taverna workbench FA4 HELP Functionalities Not applicable II Integral Characteristics FreeFluo Characteristics vak dda laron can t score ISO IEC 9126 8 8 assess result Functionality 40 60 3 2 Reliability 25 25 50 1 5 Usability 75 25 1 5 Efficiency 67 33 2 68 Maintainability 20 60 20 2 8 Portability 40 20 40 4 WP2 Business workflow technology analysis and comparison VISP Consortium Page 188 of 239 D2 2 Workflow Software Analysis and Comparison II Pie Charts Functionality Reliability Usability 0 sli 25 i lt 50 50 aii 25 Efficiency Maintainability Portability sid 20 20 0 ee 0 40 0 67 60 20 GBWeak BGood OStrong O Can t assess Figure 6 11 Pie charts for Freefluo s characteristics JBoss jBPM I Functionality Principal Functions F1 Modelling process definition Fctno Function name Function implementation IF1 1 Process chart 3 categories of objects definition process states objects Start state where the process is beginning thread End state where the process is ending State object custom state nodes fork launch several tasks simultaneously join wait for all tasks to finish decision the process must take al decision depending on some d
355. user agent features view manage enter data decide and control Dynamic procedure definition change capabilities Activity definition through forms designers Libraries of activities and actions Production Workflow is an intensive application with dedicated agents working full time on repetitive operations This corresponds to very formal processes with few variations It requires tight integration with document management applications and legacy systems Unlike administrative workflow production workflows typically encompass a complex information process involving access to multiple information systems The ordering and coordination of tasks in such workflows can be automated However automation of production workflows is complicated due to i information process complexity and ii accesses to multiple information systems to perform work and retrieve data for making decisions administrative workflows rely on humans for most of the decisions and work performed WFMS that support production workflow must provide facilities to define task dependencies and control task execution with little or no human intervention Production WFMS are often mission critical and must deal with the integration and interoperability of heterogeneous and distributed information systems Typical applications are insurance claims processing and loan applications The illustrative example in Figure 2 4 Georgakopoulos 1995 presents a simplified health claims pro
356. uszewski 2003 It has been graphically illustrated how these products implement a sample process shown in Figure 3 10 Kiepuszewski 2003 Kiepuszewski 2003 Kiepuszewski B 2003 Expressiveness and WP2 Business workflow technology analysis and comparison VISP Consortium Page 43 of 239 D2 2 Workflow Software Analysis and Comparison Suitability ofThis process employs all WfMC defined basic constructs which are used in a typical context leaving no scope for ambiguous interpretation Figure 3 10 Sample process model FileNet s Visual WorkFlo Visual WorkFlo Fil97 Fil99 is one of the leading workflow products in the industry It is part of the FileNet s Panagon suite PanagonWorkFlo Services which includes document management and imaging servers as well Visual WorkFlo is one of the oldest and best established products on the market Since its introduction in 1994 it managed to gain a respectable share of all worldwide workflow applications The evaluation here is based on version 3 0 introduced in late 1998 of the product Figure 3 11 shows the sample process introduced in Figure 3 10 implemented with Visual WorkFlo Rendez Vous id Figure3 11 Sample process model implemented with Visual WorkFlo WP2 Business workflow technology analysis and comparison VISP Consortium Page 44 of 239 D2 2 Workflow Software Analysis and Comparison Fort Conductor Fort Conducto
357. valuation identifies the benefits which are expected from the software tool to deliver in measurable terms It involves collection of data determining whether the expected results are delivered or not In Kitchenham 1996 three different ways of organizing a quantitative evaluation exercise are defined WP2 Business workflow technology analysis and comparison VISP Consortium Page 26 of 239 D2 2 Workflow Software Analysis and Comparison e Formal experiment This is a controlled investigation of an activity where key factors are identified and manipulated to document their effects on the outcome Because the formal experiments require a great deal of control these experiments tend to be small involving small numbers of people or events Fenton and Pfleeger 1996 e Case Study This is a research technique where key factors are identified that may affect the outcome of an activity imposed by a real project using the standard project development procedures of the evaluating organization and then document the activity its inputs constraints resources and outputs Case studies usually look at a typical project rather than trying to capture information about all possible cases Fenton and Pfleeger 1996 e Survey A survey is a retrospective study of a situation to try to document relationships and outcomes A survey is always done after an event has occurred A survey is a retrospective study by recording situations and compar
358. ve BPEL Engine Active Webflow Standard Cape Clear Enhidra Shark Oracle BPEL Process Manager Both editing and execution tools ActiveWebflow Standard ActiveWebflow Designer Cape Clear Enhydra Jawe Shark Oracle BPEL Process Manager These results remind that the unique choice of product could not be the right strategy for implementation The benefit of the existence of different and wide available products has to be consumed by allocating rights for the choice for the different workflow partners in the workflow integration However the definition and exploitation of a common business distributed workflow system has to respect common standards for modelling and execution of the workflow tasks Thus the integration can be achieved despite the different software products which are used but based on a common used standardization and methodological approach Taking into account the supported standardization and technological support prospective technologies for the VISP project developments appear to be XPDL and BPEL Respectively the products which support them can be used in particular project solutions WP2 Business workflow technology analysis and comparison VISP Consortium Page 234 of 239 D2 2 Workflow Software Analysis and Comparison REFERENCES 2 1 2 2 2 3 2 4 2 5 2 6 2 7 2 8 2 9 2 10 2 11 2 12 2 13 3 1 3 2 3 3 3 4 3 5 3 6 3 7 3 8 3 9 3 10 3 11
359. ve limitations Interface 3 Application invocation which perform additional workflow activities Implementation of the interface by WSDL interface programming language interface notification mechanism for human actions For additional workflow applications and complex activities invocation X Flow uses proprietary activity beans defined in the process definition model WSDL interface available for additional workflow applications invocation in v 3 0 Interface 4 Support of workflow integration and collaboration between different domains and or distributed workflow execution platforms Organization model is designed to support B2B workflow applications between different domains Distributed workflows will be available via WSDL interface according to v 3 0 Interface 5 Monitoring and administration of the workflows activities Life cycle management of distributed workflows Processes can be modified in such a way that all started processes run according to modified model or can run according to completely new model Models can be marked as archived Additional interfaces import export of data towards other products like databases file systems repositories UDDI LDAP monitoring of transactions X Flow stores all process data in the Lotus Notes database All these data can be exported in XML format Organization Editor JOE can use LDAP service to will units and roles with real people data Supported standards X
360. ver s execution environment and deployed and running processes The console pages are grouped into three categories The Home page provides an overview of the server including the type of configuration license status and engine running status Engine The Engine console pages allow to be viewed and managed settings of the engine main of which are listed in the following Table 4 5 Table 4 5 Settings of AWS engine Engine Settings Configuration of ActiveWebflow Standard Enable and disable process instance logging Turn on and off message validation Enable or disable BPEL extensions Set engine caching parameters Detailed license information Add and remove licenses Persistent storage maintenance e Prune completed processes by date e Prune deployment logs by date e Prune deployed process definitions Detailed information regarding the version of Version and build numbers for all Active Webflow Standard installed ActiveWebflow Standard components Engine Status Information When the engine is running there are two Web pages available that display information about the server the Axis Web services listing all the available services and the ActiveBPEL engine administration page Deployment The Deployment console pages allow the processes to be managed as well as their artifacts that are deployed to the ActiveWebflow Standard server The main functions are e Deployment of Business Process Archive bpr files e Deployment
361. vide a structure in the complex environment of workflows In Aalst et al 2003 it is systematically analyzed available functionality in existing workflow management systems and they are categorized in a number of workflow patterns For the evaluation of the software tools deploying workflow technologies an integrated view is applied in this deliverable combining both qualitative and quantitative indicators to assess them for their support in workflow management systems Many organizations came to the conclusion that although they have adapted the Information Technology IT for the improvement of their working efficiency the business processes within their organizations and between themselves and their partners have not been clearly described and streamlined Yan et al 2001 During the execution of business processes there are not enough techniques and methods to monitor and control the processes This leads to the misunderstanding of responsibilities blocks in coordination and slow reaction to the changing market Workflow management technology is among the ones under development to overcome these shortcomings Workflow management comes from office automation area where all kinds of documents need to be digitized and transferred among co workers Nowadays the workflow management attracts a lot of attention due to its ability in modelling executing and monitoring processes The processes can be not only the business processes but also any p
362. vities A synchronous activity is invoked by the controller as soon as its preconditions are met The result is available immediately If the preconditions of an WP2 Business workflow technology analysis and comparison VISP Consortium Page 172 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation asynchronous activity are met it is enlisted for asynchronous execution An actor user other process event may fetch the subject from the list manipulate it and announce the change at any time F1 2 Process description major A process is described as a set of activities with pre minor and post conditions An activity is executed when its preconditions are met It manipulates the process item thereby creating postconditions F1 3 Event initial result An event is basically an asynchronous activity triggering process thread without a precondition It is executed by an external event result correlation trigger for example a scheduler timeout A listener is basically a synchronous activity without a postcondition It is called by the controller when its preconditions are met Listeners can destroy the subject F1 4 Flowline The process flow is determined at run time The graphical modelling tool generates the edges arrows between the activities or events and the conditions according the description of
363. which it is a part The system includes any associated hardware software either custom software or off the shelf software and users The number of faults found during testing is an external measure of the number of faults in the program because the number of faults are counted during the operation of a computer system running the program to identify the faults in the code External measures can be used to evaluate quality attributes closer to the ultimate objectives of the design Indicator A measure that can be used to estimate or predict another measure The measure may be of the same or a different characteristic Indicators may be used both to estimate software quality attributes and to estimate attributes of the production process They are indirect measures of the attributes Measure noun The number or category assigned to an attribute of an entity by making a measurement Measure verb Make a measurement Measurement The process of assigning a number or category to an entity to describe an attribute of that entity Category is used to denote qualitative measures of attributes Metric A measurement scale and the method used for measurement The levels of certain internal attributes have been found to influence the levels of some external measures so that there is both an external aspect and an internal aspect to most characteristics For example reliability may be measured externally by observing the number of failur
364. y SFL Proprietary e H fk Proprietary Proprietary WP2 Business workflow technology analysis and comparison VISP Consortium Page 63 of 239 D2 2 Workflow Software Analysis and Comparison GridNexus iApprove by Integrify iBEST LLC Proprietary Proprietary IBM BPWS4J iGrafx BPEL iLaunch i man integrated management Imixs Incodea Corporation Business Pilot infoRouter IKE Ils process Interstage BPM IvyTeam Xpert ivy ivyGrid Proprietary Proprietary Proprietary Proprietary Proprietary Proprietary Proprietary Proprietary Proprietary He H Proprietary Proprietary JBoss jBpm JFolder JOpera peek Pam il eae el EE K2 net Enterprise Workflow Kepler Kintana Legistar Lexmark Document Distributor Lotus Domino Workflow Metastorm Micro Workflow MidOffice MQSeries Workflow MyControl Workflow Server Newgen Nsite Workflow On Demand Oak Grove Systems Inc LegaSuite BPM OFBiz Workflow Engine Open Business Engine OpenFlow OpenLink Virtuoso Universal Server Proprietary ae Proprietary Proprietary Proprietary Proprietary Proprietary Proprietary rr es ee Proprietary Proprietary eH Proprietary Proprietary Proprietary E ee OpenSymphony OS Workflow OpenWFE Oracle BPEL Process Manager Orbis So
365. y Rahabtny Usability 25 0 D Efficiency Maintainab ility Portability 0 20 j D 0 40 OWeak BGood OStrong O Can t assess Figure 6 8 Pie charts for Enhydra JaWE s characteristics 0 25 0 0 20 100 0 Enhydra Shark I Functionality Principal Functions F1 Modelling process definition Not applicable Shark only features the WF engine However a complete modeler Jawe is available that fully integrates with Shark F2 Simulation debug It is not applicable to Shark itself Shark via its monitoring application can provide detailed information about a process status F3 Execution workflow engine Fct no Function name Function implementation F3 1 Processes Deployment It supports repository management package initialization repositories management process instantiation management The workflow XPDL representation can be loaded into shark engine using the administrator application User can load xpdl files into the workflow system repository for process instantiation Moreover the Wf XML protocol is supported F3 2 Management of Unsupported Can be implemented using Web WP2 Business workflow technology analysis and comparison VISP Consortium Page 180 of 239 D2 2 Workflow Software Analysis and Comparison Fct no Function name Function implementation distributed workflows Services RMI F3 3 Application Server Comp
366. y driven by software vendors like IBM Microsoft Sun BEA SAP and Intalio This has resulted in an abundance of standards having overlapping functionality When looking at the standards in more detail it is clear these are often based on existing products A good example is WSFL which is almost a copy of IBM s Flowmark MQ Series Workflow language Standards which involve multiple software vendors are often a compromise between competing viewpoints As a result such standards tend to be imprecise or unnecessarily complex WfMC s XPDL is an example of a standard which is an imprecise thereby allowing vendor to have his or her own interpretation of the standard thus making the standard useless BPEL4WS joins viewpoints from both WSFL and XLANG thus making the language very complex Given these observations it is useful to look for objective measures for comparing web services composition languages because this comparison will give ground for the evaluation and assessment of corresponding software tools which implement the different modelling and evectional standards in the workflow domain One of the conclusions in Aalst et al 2003 is that the world is confronted with too many standards which are mainly driven by concrete products and or commercial interests The efforts of specialists are directed to narrow the launch of software workflow tools by ignoring standardization proposals that are not using well established process modelling
367. ystems WP2 Business workflow technology analysis and comparison VISP Consortium Page 102 of 239 D2 2 Workflow Software Analysis and Comparison e Workflow Administrators cannot view modify and update certain project information at this point e The workflows described in the Bonita system do not conform to any particular standard so the user is not able to edit the workflow for minor changes in text format e The current version is pre configured to with the JonAS Application server and to change it to work with an application server of the user s choice is not a trivial task 4 14 O penWFE Workflow software overview Workflow software presentation OpenWFE is an Open source WorkFlow Environment written in java It is a complete Business Process Management suite Workflow software description OpenWFE features five components a workflow engine a worklist handler an apre Automatic Participant Runtime Environment webclient application and web interface for modelling business processes Droflo Engine interprets and runs process definitions A Business Process Definition describes the transition of Workitems between participants A Participant is usually mapped to a role in an organization Engine can run many instances of each of those definitions The engine relies mainly on 2 services The Participant Map contains information about how to dispatch workitems to the Participants A Listener liste
Download Pdf Manuals
Related Search
Related Contents
取扱説明書 「安全上のご注意」 - 昭和機器工業株式会社 HTLV SCREENING Benutzerhandbuch - CONRAD Produktinfo. Igloo FRF434 User's Manual Copyright © All rights reserved.
Failed to retrieve file