TrueMethyl™6 Kit User Guide
Contents
1. 31 Kit Contents TrueMethyl 6 Kit oxBS reactions 6 BS only reactions 6 TOTAL number of samples 6 Oxidation Workflow oxBox P N CEG5110 Oxidant Solution 10 pL 2 P N CEG1400 Denaturing Solution 1 0 mL 1 P N CEG1300 Ultra Pure Water 200 mL 1 P N CEG1910 BioRad P6 Micro Bio Spin Columns 6 1 P N CEG2300 Wash Tubes 2 0 mL 6 1 P N CEG2010 Collection Tubes 1 5 mL 6 1 Bisulfite Workflow P N CEG1500 Bisulfite Reagent aliquot 4 rxn per aliquot 3 aliquots 1 P N CEG2200 Bisulfite Diluent 30 mL 1 P N CEG2100 Bisulfite Additive 960 pL 1 P N CEG1110 Millipore Amicon Ultra 0 5 30 kDA Filter 12 1 P N CEG1210 Collection Tubes 2 mL 24 1 P N CEG1700 Desulfonation Buffer 80 mL 1 P N CEG1800 Wash Buffer 80 mL 1 PCR Workflow P N CEG5410 TrueMethyl DNA Polymerase 20 uL 2 P N CEG5210 5X TrueMethyl Buffer 150 uL 2 P N CEG5310 10 mM dNTP Mix 30 uL 2 Spike in Controls P N CEG5510 Sequencing Spike in Controls 8 ng uL 25 uL 2 P N CEG5910 Digestion Control 5 ng uL 15 uL 2 P N CEG5710 Digestion Control FWD PCR Primer 100 uM 45 uL 2 P N CEG5810 Digestion Control REV PCR Primer 100 uM 45 uL 2 P N CEG5610 Cutting Control 20 ng uL 15 uL 2 www cegx co uk info cegx co uk echnical cegx co uk Oxidation Solution Sensitivity CRITICAL The Oxidant solution supplied in this k2. TrueMethy workflow PCR amplification In order to prepare TrueMethyl libraries for sequencing material recovered from the TrueMethyl workflow requires PCR amplification The TrueMethyl 6 Kit employs the use of TrueMethyl DNA polymerase This mutant polymerase has been engineered to be resistant to uracil stalling a common phenomena that affects the activity of proof reading archaeal polymerases Thus TrueMethyl DNA Polymerase is ideally suited for use in the amplification of bisulfite converted libraries Workflow Controls The TrueMethy Detection Kit contains two types of spike in workflow controls The Digestion Control is a control that allows qualitative assessment of conversion prior to committing your sample for sequencing or other analysis method Provides a go no go decision point regarding whether conversion should be repeated The Sequencing Control pool is a set of 6 control duplexes that are spiked into your genomic sample during NGS library prep prior to adapter ligation Each duplex contains C 5mC 5hmC and 5fC bases at Known positions and density and can be interrogated after sequencing to give a quantitative assessment of the efficiency of conversion See Appendix 5 for control sequence information www cegx co uk info cegx co uk technical cegx 50 UK Important Notes Pre oxidation DNA purification e The use of AmpureXP beads or similar DNA precipitation methods to purify DNA
3. from step 3 7 24 24 Oxidant solution 1 Ultra Pure Water 7 1 TOTAL volume 25 25 3 9 Incubate the oxidation reaction mix at 40 C for 30 minutes 16 www cegx co uk info cegx co uk technical cegx co uk IMPORTANT The colour of the oxidation reaction is indicative of a successful oxidation The solution should remain orange after the 30 minute incubation Any other colour green brown black observed implies reaction of the oxidant with traces of other compounds in the oxidation solution e g Tris ethanol or DEPC etc 3 10 Centrifuge mixes at 14000 x g for 10 minutes to pellet any black precipitate If the supernatant remains orange there is an excess of oxidant remaining and oxidation has completed 3 11 Decant the supernatant and use in subsequent steps of the protocol Take care not to carry any precipitate over as this could inhibit downstream steps 3 12 Proceed immediately to the next step IMPORTANT If the solution turns any colour other than orange it is a sign that the oxidation reaction is compromised This may lead to incomplete conversion of hmC gt U and variability in your results To avoid this ensure only Ultra Pure Water provided with the TrueMethyl kit is used in steps containing the oxidant and consider re purification of your sample taking all practicable steps to remove contaminants from the starting DNA sample solution see Table 1 for details op O 2 O or Q Step 4
4. in the Buffer Exchange step oxBS workflow ONLY Sil 3 2 3 3 3 4 3 5 Prepare the BioRad P6 Micro Bio spin column 3 1 1 Resuspend the column matrix by flicking the column Briefly centrifuge at 1000 x gto settle matrix 3 1 2 Remove the top cap and then snap off the bottom tip place the column into the new 2 0 mL wash tube IMPORTANT Ensure a 2 0 mL wash tube is used otherwise the volume of buffer displaced from the column will fill the tube too full and prevent the correct preparation of the spin column gel bed This will lead to dilution or complete loss of DNA template Centrifuge column 1000 x g for 120 seconds to pack the column and remove residual buffer Discard flow through Wash the column To the packed column add 500 uL Ultra Pure Water provided in the kit Centrifuge column 1000 x g for 60 seconds Discard the flow through Repeat step 3 3 three more times Each time discard the flow through For the final Ultra Pure Water wash centrifuge the column for 120 seconds Discard flow through and place column into a new collection tube ready for elution of the sample DNA Add the sample DNA to the washed column The starting concentration of DNA should be 20 50 ng uL and no more than 20 uL of dsDNA should be added to the column otherwise the sample will be too dilute for subsequent steps Centrifuge at 1000 x g for 120 seconds retain the column eluate this should be approximately 22 uL maxim
5. sign that the reagent has become exposed to CO If you suspect that this has occurred please do not use the Oxidant solution and contact CEGX for advice technical cegx co uk Following the oxidation reaction if the colour of the solution has turned from the light orange solution C to green or black this is a sign of contaminating alcohols in the reaction buffer These are likely carried over from the NGS library preparation workflow or from common DNA purification methods ethanol precipitation phenol chloroform extraction column purification If the post oxidation colour looks like solution D it is suggestive of partial decomposition of the oxidant and the oxidation of your DNA samples is likely to be OK However if the post oxidation colour looks like solution E it is likely that the oxidant has been completely consumed by side reaction with the contaminating species In this circumstance it is likely that DNA oxidation will be sub optimal We would recommend re purification of the DNA sample using the prescriptive AmpureXP protocol compatible with the TrueMethyl workflow outlined in Appendix 3 and then repeat the oxidative conversion Cp ui O a LO Q A lt Appendix 3 TrueMethyl optimised AmpurexP clean up protocol In addition to the pre oxidation buffer exchange steps outlined in this TrueMethyl 6 User Guide below is a prescriptive AmpureXP clean up protocol that is compatible with the downstream
6. steps If you have legacy samples whose buffer composition you are unsure of or if your final NGS library clean up was performed using Si membrane precipitation e g Thermo Genejet etc CEGX recommends processing your samples through the following additional AmpureXP cleanup to ensure buffer compatibility with the oxidation reagent CEGX Specific AmpureXP protocol 1 Ina 1 5 mL microcentrifuge tube add AmpurexP to your gDNA sample as outlined in Table 13 Table 13 CEGX specific AmpureXP conditions Component Volume pL NGS adapted sample 20 Ultra Pure Water 30 AmpureXP bead solution 100 TOTAL volume 200 Incubate solution for 5 minutes at RT Magnetize for 10 minutes or until supernatant has cleared Keep tube on magnet rack Withdraw and discard the cleared AmpurexP supernatant The DNA will remain adsorbed to the surface of the magnetized bead pellet 5 Whilst still on the magnetic rack wash with 1 mL 80 Acetonitrile 80 HPLC grade Acetonitrile 20 Ultra Pure water try not to disturb pellet PON IMPORTANT Do not use 80 ethanol for the wash steps Equivalent recoveries are obtained by using Acetonitrile in place of ethanol The oxidation reaction can tolerate Acetonitrile to concentration 1M NOTE The volume of the wash steps is key to diluting out contaminants Do not deviate from using 1 mL volume washes 6 Discard supernatant 7 Wash with a second 1 mL 80 Aceton
7. the vicinity or standing the oxidant solution loosely capped on dry ice can cause irreversible decomposition of the oxidant solution It is strongly advised not to open or use the oxidant solution near a source of carbon dioxide Some 80 C freezers are purged with CO for this reason we do not recommend storage of the oxidant solution or oxBox2 in a 80 C freezer Table 1 Oxidation reaction contamination thresholds Contaminant Threshold concentration Ethanol lt 50 mM Isopropanol lt 50 mM Glycerol lt 2 5 mM Phenol lt 50 mM Acetonitrile up to 1 M Guanidine HCI lt 50 mM EB buffer 10 mM Tris pH 8 0 lt 1X TE buffer 10 mM Tris 1 mM EDTA lt 1X pH 8 0 Concentration in buffer prior to Biorad MicroBio spin P6 buffer exchange www cegx co uk info cegx co uk 2gx co uk Columns Filters and Tubes The TrueMethyl 6 Kit is supplied with a number of columns filters and tubes see Figure 1 as a guide Please ensure the correct components are used in combination with each other as outlined in this document Failure to do so will affect performance Figure 1 Types of Columns Filters and tubes used in this protocol fos BioRad P6 BioRad P6 BioRad P6 Amicon Ultra 0 5 Amicon Ultra 0 5 Micro Bio Spin Micro Bio Spin Micro Bio Spin 30kDa filter collection tube gel filtration WASH tube COLLECTION tube column 2 mL 1 5 mL xX LU ales Shi
8. treatment of the sample as described in step 4 6 allows up to a maximum of 10 uL of template to be added to a 50 uL PCR reaction Procedure Mi oxBS seq workflow ae BS seq workflow 6 1 Thaw reagents on ice 5X TrueMethyl polymerase buffer 10 mM dNTPs PCR primers Mix by vortexing and centrifuge briefly 6 2 Into a 0 2 mL PCR tube prepare the mix outlined in Table 11 Note Add the reagents in order Before adding the TrueMethy DNA polymerase mix the solution by vortexing and then centrifuge Add TrueMethyl DNA polymerase and mix by pipetting only 6 3 Place the PCR reaction in a PCR thermal cycler and amplify the DNA using the thermal cycling regime outlined in Table 12 6 4 PCR cleanup and quantification NGS platform specific follow appropriate protocol www cegx co uk info cegx co uk technical cegx co uk Table 11 PCR reaction composition Component Volume pL Ultra Pure Water 31 5 5X TrueMethyl polymerase Buffer 10 10 mM dNTP 1 PCR primers 10 uM Bisulfite converted DNA from step 4 17 TrueMethyl DNA polymerase 2U uL 0 5 TOTAL volume 50 User supplied NGS library specific Table 12 Thermal cycling conditions for amplification of TrueMethyl treated DNA Number Segment of cycles Temperature Duration 1 1 95 C 120s 95 C 30s 2 15X 60 C 20s 72 C 45s 3 1 4 C Forever NOTE the number of PCR cycles can be lowered
9. 000000000001 000000000001 KEY YY NI NN NN IILIIILILILII LI IL IL LL LI O PIN DA O o a CEGX TrueMethyl 6 Kit User Guide For the base specific detection and quantitation of 5 hydroxymethyl cytosine and 5 methylcytosine in DNA samples Version 3 1 July 2013 OO O 68 OO O O O O O e O Table of Contents Kit Contents OMBOXT and OXBOR2 seneng 2 Oxidation Solution Sensitivity maaa 3 Columns Filters and Tubes Shipping and Storage Safety IN ormatie Additional Equipment and Reagents Required 7 Principle and Procedure ns ns A iiaa 8 Important NOLES are lee ns naa a aa AAA EA Ai 9 Protocols Workflow Overview and Timings aaa 10 Step 1 Spike in Sequencing Controls 12 Step 2 Spike in Digestion Control eee 13 Step S DNA ORICON nn a anna Gan aaa 14 Step 4 Bisulfite Conversion 18 Step 5 Interrogate Digestion CoOntrol 21 Step 6 PCR Amplification nani aa ana 24 Appendices Appendix 1 Troubleshooting Guide aa 26 Appendix 2 Oxidant Colour Change maaa 27 Appendix 3 TrueMethyl Optimised AmpureXP Clean up PYOLOCOl aaa raa EO a 28 Appendix 4 Recommendations for Low Inputs Masses a ba Aa 30 Appendix 5 Spike in Control SequenceS
10. 2 Centrifuge for 5 minutes at 14000 x g Discard eluate 4 14 Add 450 uL of Wash Buffer to the retentate of step 4 13 Centrifuge for 5 minutes at 14000 x g Discard eluate 4 15 Add 450 uL of Wash Buffer to the retentate of step 4 14 Centrifuge for 10 minutes at 14000 x g Discard eluate 4 16 Collect Invert the Amicon filter into a new 1 5 mL Amicon collection tube as shown in Figure 4 Figure 4 Recovery of final converted template from Amicon filter Invert Amicon Centrifuge into new 2000 xg Retain collection tube 2 mins final eluate 4 17 Collect the retentate by centrifuging the inverted Amicon filter at 2000 x g for 2 minutes 4 18 Retain the final eluate This contains the bisulfite converted sample SAFE STOPPING POINT If the purified DNA is to be stored up for 24 hours we recommend storage at 2 8 C For long term storage freeze at 20 C 20 www cegx co uk info cegx co uk technical cegx co uk Step 5 Interrogation of Digestion Control Optional NOTE The TrueMethy kit does not contain the Taqi enzyme or DNA polymerase needed to interrogate this control These components are user supplied The Digestion Control template and PCR primers needed to amplify this control are included in the kit should you choose to use them Overview The purpose of this section is to provide instructions on the interrogation of the digestion control in the TrueMethyl workflow The digestion control all
11. ATT5GAT1GGATTCGS5CGTGATSGTA 3 Sequencing spike in control duplex SQC FWD 5 pTACGATCACGGCGAATCCGATCGAATC5AGAT5GCGCTTTACGAAGTGCGACAGCCTTAG 3 REV 5 pCTAAGGCTGTCGCACTTCGTAAAGCGCGAT 5 TGGATTCGATCGGATTCGCCGTGATCGTA 3 Sequencing spike in control duplex SQmC FWD 5 pTASGAT5SA5GG5GAAT 55GAT5GAAT5STAG5STTGSG5TTTASGAAGTGS5GA5AG55S5TTAG 3 REV 5 pSTAAGGSTGT5G5A5TT5GTAAAG5SGSAAGS5STAGATT 5GAT5GGATT5G55GTGATSGTA 3 Sequencing spike in control duplex SQfC FWD 5 pTACGATCA3GGCGAATCCGATCGAATCGTTT5GGCGCTTTACGAAGTGCGACAGCCTTAG 3 REV 5 pCTAAGGCTGT 3GCACTTCGTAAAGCGC 5GAAA5GATTCGATCGGATTCGCCGTGATCGTA 3 Digestion control duplex DC 100 FWD 5 ST5A5CCASAACSASAAASATASGATCASGGCGAAT5CGAT1GAATCAGTT55GCG5TTT ACGAAGTGCGAS5AGC5TTAGTGATGTGATGGGTGGTATGG 3 REV 5 55ATACSASC5AT5SACAT5A5 TAAGGCTGT5GCACTT5GTAAAGCGS5GGAASTGATTCGA TCGGATTCG5CGTGAT5GTATGTTTGTGGTTGTGGGTGAG 3 Cutting control duplex CC 100 FWD 5 pCTCACCCACAACCACAAACATACGATCACGGCGAATCCGATCGAATCAGTTCCGCGCTT TACGAAGTGCGACAGCCTTAGTGATGTGATGGGTGGTATGG 3 REV 5 pCCATACCACCCATCACATCACTAAGGCTGTCGCACTTCGTAAAGCGCGGAACTGATTCG ATCGGATTCGCCGTGATCGTATGTTTGTGGTTGTGGGTGAG 3 Key 1 5hmC 3 5fC 5 5mC p phosphorylation N u O O Z im Q A lt Trademarks TrueMethyl CEGX Cambridge Epigenetix Limited Millipore Amicon EMD Millipore Corporation Bio Rad
12. Bisulfite Conversion Important points before starting e Each aliquot of Bisulfite Reagent is sufficient for 4 conversion reactions i e 2 OxBS seq reactions plus 2 BS seq reactions e Perform all centrifugation steps at room temperature e Dissolve the Bisulfite Reagent using the Bisulfite Diluent provided ONLY Ensure that the Bisulfite Reagent is fully dissolved before using in the workflow Do not dissolve the Bisulfite Reagent with Ultra Pure Water This will result in an incorrect solution PH resulting in poor DNA recoveries Procedure M oxBS seq workflow VI BS seq workflow Bisulfite DNA conversion 4 1 4 2 4 3 4 4 4 5 Prepare Bisulfite Reagent Solution Dissolve the required number of Bisulfite Reagent aliquots by adding 700 uL Bisulfite Diluent to each aliquot Incubate the solution at 60 C for 15 minutes Vortex until the Bisulfite Mix is completely dissolved NOTE Do not place the Bisulfite Reagent solution on ice Equilibrate the oxidised samples from step 3 12 to room temperature Bisulfite conversion reactions Prepare the bisulfite conversion reaction mix in the same 0 2mL PCR tubes according to Table 5 Add each component in the order listed Table 5 Bisulfite Conversion Reaction Mix Component Volume per reaction pL DNA solution from step 3 11 25 Bisulfite Reagent Solution 170 Bisulfite Additive 5 TOTAL volume 200 Close the PCR tubes and vortex the bisulfite
13. Micro Bio Spin Bio Rad Laboratories Inc Agencourt AMPure Beckman Coulter Inc Invitrogen Qubit Life Technologies Corporation GeneJet Thermo Scientific QlAquick Qiagen New England Biolabs NEB Eppendorf Use of this product signifies the agreement of any customer purchaser or user of the product Customer to the Terms and Conditions of Sale of Cambridge Epigenetix Limited available at http www cambridge epigenetix com en_US about us terms conditions and upon request Permitted Use Cambridge Epigenetix Limited products are sold for use by Customer and its employees agents and contractors for research or laboratory use only and are NOT to be used on humans or for clinical diagnostic or drug purposes The appropriate regulatory agencies in the UK USA and other countries have not approved the products for such purposes Products must be used in line with the product Specification and Handbook and any other applicable manuals and written instructions provided and or published by CEGX Customers are responsible for ensuring that their use of our products conforms to all applicable laws regulations and government policies Any use of products for diagnostic or therapeutic purposes or any purchase of products for resale or distribution alone or as a component requires a separate grant of use from CEGX Prohibited Use Customer and its employees agents and contractors shall NOT dispose of the pr
14. conversion reaction mix thoroughly to mix Briefly centrifuge tubes Place the 0 2 mL tube containing the Bisulfite Conversion Reaction Mix into a thermocycler Perform the bisulfite DNA conversion using the thermal profile shown in Table 6 The complete cycle should take approximately 8 hours to complete This step may be performed overnight if necessary www cegx co uk info cegx co uk Table 6 Bisulfite conversion thermal cycler conditions Step Time Temperature NOTE If using a thermal Denaturation 5 minutes 95 C cycler that does not allow Incubation 20 minutes 60 C you to enter the reaction R volume 200 uL set the Denaturation 5 minutes 95 C instrument to the largest Incubation 40 minutes 60 C volume setting available Denaturation 5 minutes 95 C Incubation 165 minutes 60 C Denaturation 5 minutes 95 C IMPORTANT Since Incubation 20 minutes 60 C the bisulfite reaction is not overlaid with mineral oil Denaturation 5 minutes 95 C only thermal cyclers with Incubation 40 minutes 60 C heated lids are suitable for i 7 this procedure Converted Denaturation minut 95 C een _ DNA can be left in the Hold Indefinite 20 C hold without any loss of performance Clean up of bisulfite converted DNA 4 6 Centrifuge to pellet precipitates Once the bisulfite conversion is complete centrifuge the PCR tubes containing the bisulfite reactions at 14000 x g for 10 minutes T
15. densities of 5mC 5hmC and 5fC bases These controls need to be adapted with the adapters complementary to the sequencing platform of choice For this reason these controls need to be added to the DNA sample during sample prep Reagents and protocols for this sample preparation process are not included in the TrueMethyl kit Sequences of the sequencing spike in controls are provided in Appendix 5 of this user guide IMPORTANT The sequencing spike in control duplexes are only 60bp in length DO NOT PURIFY SAMPLES CONTAINING THESE CONTROLS USING AmpureXP BEADS PRIOR TO ADAPTER LIGATION as the controls will be lost from the sample They are blunt ended so do not require end repair Depending on the platform on which you are sequencing your samples you may need to A tail the duplexes prior to adapter ligation They must only be spiked into sample prior to adapter ligation in the NGS library prep at the A tailing step If your genomic sample requires end repairing perform this step and spike the sequencing spike in controls into the end repaired sample AFTER PURIFICATION Procedure M oxBS seq workflow M BS seq workflow 1 1 Quantify the mass of your fragmented gDNA sample CEGX recommends using the Qubit assay for this purpose 1 2 End repair the fragmented gDNA sample according to particular vendor instructions Reagents and protocols for this process are not provided with the TrueMethyl 6 kit 1 3 Quantify the mass of
16. during the workflow should be avoided e The presence of residual ethanol in the oxidation reaction can lead to the formation of compounds that can inhibit oxidation and downstream reactions e The use of washed gel filtration spin columns supplied with the kit is strongly advised as the sole method to clean up the DNA prior to the oxidation reaction e We acknowledge that it is likely that the input DNA will have been purified using AmpurexP beads If this is the case all care needs to be taken to minimise the amount of EtOH in the final eluted DNA sample We have provided an AmpurexP protocol optimised for compatibility with the TrueMethyl workflow Appendix 3 e The solvent used for the final elution from the beads must be performed in Ultra Pure Water Typical elution buffers are Tris based the presence of Tris in the oxidation reaction will also cause oxidation to fail Complete denaturation e The oxidation of 5hmC to 5fC by the CEGX oxidant is ssDNA specific This means that incomplete denaturation will lead to poor conversion rates of SnmC gt U It is strongly recommended that care be taken when denaturing the DNA to ensure the input to the oxidation reaction is ssDNA Denatured DNA should be prepared as described in this document and used immediately in the oxidation reaction e It should be assumed that storage of denatured DNA for any appreciable amount of time will lead to significant and variable levels of re anneal
17. e in controls Prepare 100 uL of a 200 ng uL solution of salmon sperm gDNA User supplied e g Invitrogen Catalogue No 15632 011 Make the dilution with Ultra Pure Water Spike the NGS adapted sample into the salmon sperm gDNA background as shown in Table 14 Table 14 Carrier DNA spike in for low concentration samples Component Volume pL NGS adapted library e g 20 ng uL 10 Carrier gDNA 200 ng uL 5 e g salmon sperm gDNA Ultra Pure Water to 20 uL TOTAL volume 20 Vortex solution briefly to mix and centrifuge Process this mix through the oxBS seq or BS seq workflows as appropriate The final library can be specifically amplified from the carrier JONA background by using the appropriate set of NGS specific PCR primers www cegx co uk info cegx co uk technical cegx co uk Appendix 5 Spike in control sequences Sequencing spike in control duplex SQ6hmC FWD 5 pTASGATCA1 GGCGAAT11GAT5GAATCAGT 5AAGCG5TTTA1GAAGTG1GA5AGCITTAG 3 REV 5 pSTAAGG1TGT5GCACTT1GTAAAGCG1TTGASTGATT5GAT1GGATTCG51GTGATIGTA 3 Sequencing spike in control duplex SQ3hmC FWD 5 pTASGATCASGGCGAAT51GAT5GAATC5STTGTAGCG5TTTA1GAAGTGCGAS5SAGCITTAG 3 REV 5 pS TAAGGCTGT 5GCACTT1GTAAAGCG5TASAAGGATT5GAT1GGATTCG51GTGATSGTA 3 Sequencing spike in control duplex SQihmC FWD 5 pTASGATCASGGCGAAT 5CGAT 5GAATCAS5SAGTGGCG5TTTA1GAAGTGCGAS5SAGC5TTAG 3 REV 5 pS TAAGGCTGT 5GCACTT5GTAAAGCG5 5A5TGTG
18. eMethyl 6 Kit Oxidant solution Contains inorganic oxidizing agent proprietary formulation oxidant irritant Risk and safety phrases R8 36 37 38 S17 26 37 39 Contains sodium hydroxide corrosive Risk and safety phrases R35 S26 36 37 39 45 Bisulfite Mix Contains sodium bisulfite sensitizer irritant Risk and safety phrases R22 31 41 S13 26 36 37 39 46 R8 Contact with combustible material might cause fire keep away from heat and sources of ignition R20 21 22 Harmful www cegx co uk info cegx co uk technical cegx co uk by inhalation in contact with skin and if swallowed R22 Harmful if swallowed R31 Contact with acids liberates toxic gas R32 Contact with acids liberates very toxic gas R35 Causes severe burns R36 37 38 Irritating to eyes respiratory system and skin R36 Irritating to eyes R41 Risk of serious damage to eyes S13 Keep away from food drink and animal feeding stuffs S17 Keep away from combustible material S26 In case of contact with eyes rinse immediately with plenty of water and seek medical advice S36 37 39 Wear suitable protective clothing gloves and eye face protection S36 Wear suitable protective clothing S45 In case of accident or if you fee unwell seek medical advice immediately show the label where possible S46 If swallowed seek medical advice immediately and show the container or label Additional Equipment and Reagents Required In addition to reagents
19. ease concentration of spike in product for p digestion control concentration DNA polymerase not uracil tolerant Repeat amplification with uracil tolerant DNA poly merase Little or no PCR product for whole genome library Gross loss of template Use of incorrect columns for pre oxidation buffer exchange Incorrect purification post bisulfite workflows Ensure correct usage of Amicon filters Take care not to rupture the filter membrane Bisulfite solution incorrect pH Ensure solution was prepared using Bisulfite Diluent and not Ultra Pure Water DNA polymerase not uracil tolerant Repeat amplification with uracil tolerant DNA poly merase www cegx co uk info cegx co uk technical cegx co uk Appendix 2 Oxidant colour changes Figure 5 Expected oxidant solution colour changes DE GCG D E A Oxidant solution stock concentration supplied by CEGX B 10 fold dilution of the Oxidant solution in alkaline solution C Working oxidant concentration WOC D 5 1 molar excess of WOC ethanol E 20 1 molar excess of ethanol WOC Please inspect the Oxidant solution on receipt of the kit If the colour of the thawed Oxidant solution does not resemble solution A in the figure above or there are visible black precipitates in the solution please contact technical cegx co uk for usage advice If the Oxidant solution looks dark yellow with considerable amounts of black precipitate it is a
20. his will pellet any precipitated salts accumulated during the bisulfite incubation Without disturbing the pellet remove 190 uL of the supernatant and transfer to anew 1 5 mL microcentrifuge tube 4 7 Desulfonation Add 310 uL Desulfonation Buffer to each sample Mix the solutions by vortexing and then centrifuge briefly 4 8 Transfer the 500 uL total volume 190 uL sample plus 310 uL Desulfonation Buffer to an Amicon filter and place the Amicon filter into a new Amicon collection tube as shown in Figure 3 below Figure 3 Using Amicon filters to clean up the bisulfite reactions Amicon filter Cp O 2 O or A Add solution Centrifuge l to Amicon 14000 xg Retentate 500 uL max 5 mins Eluate 1 5 mL Amicon collection tube NOTE Take care not to touch the filter with the pipette tip as this could damage the filter membrane and affect the diafiltration performance 4 9 Place the filled Amicon filter and collection tube in bench top microcentrifuge Centrifuge for 5 minutes at 14000 x g Discard the eluate 4 10 Add 450 uL of Desulfonation Buffer to the retentate of step 4 9 Centrifuge for 5 minutes at 14000 x g Discard eluate 4 11 Add 450 uL of Desulfonation Buffer to the retentate of step 4 10 Incubate for 5 minutes at RT 4 12 Centrifuge for 5 minutes at 14000 x g Discard eluate 4 13 Wash Add 450 uL of Wash Buffer to the retentate of step 4 1
21. if desired but this would require empirical verification and would be sample concentration and application specific The values above have been verified on a 400 ng input of a neutral GC sample into the TrueMethyl workflow op O O or A Appendix 1 Troubleshooting Guide Below are outlined a list potential problems and suggested corrective actions that could affect samples processed through the TrueMethyl workflow Please use this as a guide to troubleshoot any problems encountered If for any reason none of the examples below adequately describe the issue observed please contact technical cegx co uk for additional technical support Problem Reason Solution Oxidation goes DNA sample contami Repeat experiment and make sure to go through the green nation see Table 1 exact DNA purification procedure see Appendix 3 DNA not denatured Ensure NaOH solution is correct and denaturation mix properly is vortexed Consider mixing adapted library with non adapted carrier DNA to minimise annealing Low conversion Oxidation failed Ensure the oxidant has not precipitated and is red rate orange or that no precipitates are carried into down stream steps from the oxidation reaction Bisulfite failed The bisulfite incubation was not long enough or the bisulfite reagent was prepared incorrectly Gross loss of template Incorrect purification for either oxidation or bisulfite Little or no PCR a e Incr
22. ing that will confound downstream analysis e Specific care should be taken when experimenting with oxidation of short synthetic oligonucleotides or PCR products input into the TrueMethyl workflow Incomplete denaturation will adversely affect the level of SnmC conversion For this type of experiment we recommend spiking such synthetic oligos into a carrier DNA genomic background e g salmon sperm DNA at a level lt 5 w w to increase the fragment diversity to minimise the chance of re annealing affecting conversion a LU aes Protocols Workflow Overview and Timings Figure 2 below provides a schematic illustration of the TrueMethyl workflow Figure 2 Workflow overview Spike in Spike in QUERY DIGESTION CONTROL SEQUENCING DIGESTION Amplify and Taqi digest to control control evaluate conversion OXBS sample Buffer exchange i sibs Bisulfite BS BSsample D TIMING Total hands on mins P HAoe_ A 1 2 days 15 5 60 5 480 60 45 5 Platform Platform dependent dependent The overall TrueMethyl workflow takes less than a day but due to the 8 hour bisulfite conversion step we recommend you conduct this step overnight to make the most efficient use of your time Timings given in the Table 2 below are approximate and should be used as an illustrative guide only www cegx co uk info cegx co uk technical cegx co uk Table 2 P
23. it is reactive with a range of compounds We have harnessed this reactivity to allow the selective oxidation of ShmC to 5fC using this reagent However the oxidant will react with other contaminating species in solution if present Following the prescriptive instructions in this manual will allow the user to prepare samples ready for presentation to the oxidation reaction minimising the likelihood of side reactions Reaction of the oxidant with anything but DNA will decrease the active concentration of oxidant in solution and lead to the possibility of suboptimal conversion and also generate products that could inhibit downstream steps of the workflow e g bisulfite conversion and PCR amplification It is critical that the input DNA samples have been prepared with these sensitivities in mind Below we have defined some guidelines that should be adhered to as far as practically possible Solution sensitivities Contaminating compounds in solution known to be incompatible with the working oxidant solution e Alcohols ethanol isopropanol phenol e Alcohol containing compounds Tris EB buffer TE buffer glycerol surfactants e Acidic solutions lt pH 9 0 e Carbon dioxide Care should be taken to remove traces of such compounds from the DNA sample solutions prior to input into the TrueMethyl workflow We include a buffer exchange step in our protocol but the effectiveness of this exchange is dependent on the type and concentration of conta
24. itrile try not to disturb pellet Keep tube on the 28 www cegx co uk info cegx co uk technical cegx co uk 9 10 11 12 magnetic rack Remove carriage return Air dry the washed AmpureXP bead pellet Do not worry if the pellet cracks The important thing is to allow time for all of the Acetonitrile to evaporate This should take no longer than 5 minutes Acetonitrile is more volatile than ethanol The AmpureXP pellet should look cracked and completely dry With the tube still on the magnetic rack add 20 uL ULTRA PURE WATER from the oxBS kit to elute the DNA from the beads Remove the tube from the magnet and completely re suspend the AmpurexXP pellet with the water solvent by pipetting Place the tube back on the magnetic rack and allow the AmpurexP beads to pellet until the solution has cleared Remove and retain the supernatant Use this eluate as the input to the TrueMethyl workflow cp im O O LO Q A lt Appendix 4 Recommendations for low inputs masses 200 ng or less For input masses lower than 200 ng we recommend spiking your library of interest into a carrier DNA background 1 ug This helps to minimise sample losses associated with sample transfer techniques and adsorption of DNA onto filter membranes and spin column matrices J 2 3 O 0 Start with an NGS adapted sample lt 200 ng e g 10 uL of 20 ng uL It is assumed that this sample contains the CEGX Sequencing spik
25. ll as speed RPM you will need to calculate the speed at which your microcentrifuge generates an RCF of 1000 x g unless you are able to set the RCF directly on the microcentrifuge Use the following formula to convert RPM to RCF Equation RCF 1 12 r speed 1000 Where RCF centrifugal force x g r rotor radius mm speed rotor speed RPM Example calculation 1000 g 1 12 73mm speed 1 000 81 76 speed 1000 speed 1000 1000 81 76 speed 3500 RPM www cegx co uk info cegx co uk technical cegx co uk Procedure Vi oxBS seq workflow VI BS seq workflow processed through MOCK oxidation IMPORTANT Ensure that the DNA input into the oxBS seq workflow is free from ethanol and was eluted from the last purification or concentration step in Ultra Pure Water Failure to do so will cause the oxidation to fail Please use the Ultra Pure Water supplied in the TrueMethyl kit for all steps involving the oxidant NOTE Only DNA to be processed through the oxBS seq workflow needs to be buffer exchanged using the BioRad P6 Micro Bio Spin column DNA samples to be processed through the BS only workflow can be used directly in the mock oxidation without prior buffer exchange NOTE This protocol is compatible for sample whose input masses of DNA are with the range 0 4 1 0 ug The starting concentration of DNA should be 20 50 ng L and no more than 20 uL of dsDNA should be added to the column used
26. minating species in solution Samples should be e Fluted from DNA purification method using ONLY Ultra Pure Water rather than EB or TE e Adjusted to the correct pH pH 8 e Preferably processed through AmpurexP clean up regardless of upstream extraction process Taking care to evaporate all ethanol from the bead prior to elution We have defined a compatible workflow see Appendix 3 Contamination thresholds for a selection of commonly used molecular biology reagents are given in Table 1 Environmental sensitivities The oxidation stock solution and working oxidation solution have been shown to react when exposed to a limited number of compounds under specific environmental conditions Care should be taken to acknowledge these sensitivities before removing the oxidant solution from its protective foil shipping bag from the freezer in which it is stored and before uncapping the tube 2 LLI E e Alcohol vapour Exposure of the oxidant solution to alcohol vapour e g after wiping down a bench with 70 ethanol prior to experimentation can cause irreversible decomposition of the oxidant solution If it is your practice to clean surfaces in this manner we recommend doing so at least 2 hours in advance of opening or using the oxidant solution as a precaution e Carbon dioxide Exposure of the oxidant solution to high local concentrations of CO in the air e g leaving a polystyrene shipping cooler containing dry ice on a bench in
27. o your sample please note this must be done before NGS adaption otherwise they will not be represented in your sequence dataset The Oxidant Solution supplied in the TrueMethyl 6 Kit should be dark red in colour Any other colour indicates degradation of the oxidant Appendix 2 gives an example of what the functional Oxidant Solution should look like If on receipt of the kit you notice that this solution is discoloured or has significant amounts of black insoluble precipitate please do not use the solution and contact CEGX technical cegx co uk Dilution of the Oxidant Solution in the oxidation reaction will afford an orange red solution If the colour of the diluted oxidant turns any colour other than orange red then discard and repeat the dilution Only use the Ultra Pure Water supplied in the TrueMethyl 6 kit Other water e g RNAse free water containing DEPC can contain molecules that react with the oxidant This should be avoided as this can cause the DNA oxidation to fail The BioRad P6 Micro Bio Polyacrylamide Spin columns are shipped in sodium azide and SSC buffer It is essential to wash these columns as outlined in the procedure to remove these compounds prior to use in the workflow All centrifugation steps are quoted 1000 x g not RPM For correct and efficient operation preparation of filters and columns must be performed as described in this document Since RCF depends on the radius of the microcentrifuge rotor as we
28. oducts offer the products for resale use the products to provide a commercial service in return for financial remuneration or otherwise distribute or transfer the products to any third party for any purpose except as expressly set out in the Terms and Conditions of Sale None of the products sold by CEGX are intended for human or animal consumption unless otherwise clearly stated and are not for use in the preparation of medicine or food without prior approval Cambridge Epigenetix Www cegx co uk info cegx co uk technical cegx co uk 2013 Cambridge Epigenetix Ltd O O O Ce 800 DA O O oO O oO oO O O oO 0O O OOO O O O 0000000 ee 00 8 O D COO 680008 8000004 BIELILIIILIIILILILILILILI LL LL LL LL LL LL LL LI LL LL LS LL LL LL LILIN JI III 00 68 8 00 0000 LILIILIILILII III OOOO O LI LIN JA DAR DD LI D IT LILIN
29. on to uracil of 5 hydroxymethyl cytosine 6hmC bases in a complex genomic sample as outlined initially in the Science paper of Booth et al Quantitative Sequencing of 5 Methylcytosine and 5 Hydroxymethylcytosine at Single Base Resolution Booth M J et al Science 336 934 2012 It also provides a method to accurately quantify the true level of cytosine methylation 5mC The complete TrueMethyl workflow is simple and intuitive and comprises three distinct procedures namely 1 DNA Oxidation 2 Bisulfite conversion 3 PCR amplification TrueMethyl workflow DNA Oxidation The TrueMethyl 6 Kit uses a specially formulated oxidant solution that ensures quick quantitative conversion of 5hmC bases under mild conditions to its formyl derivative 5fC and reliable recovery of oxidised material compatible with downstream processing bisulfite conversion PCR and Sequencing TrueMethyl workflow Bisulfite conversion In the presence of bisulfite 5fC is deformylated and deaminated to uracil The TrueMethyl 6 Kit employs the use of a bespoke bisulfite conversion kit which comprises a series of simple steps bisulfite mediated conversion of unmethylated cytosines and formylated cytosines to uracil buffer exchange via diafiltration desulfonation of desalted DNA in the ultracentrifuge device desulfonation clean up and final buffer equilibration via diafiltration and elution of the pure converted DNA from the ultrafiltration device
30. ows the qualitative assessment of 5hmC oxidation and bisulfite conversion prior to committing samples to sequencing The digestion control contains a Taq1 restriction site 6 TCGA3 The cytosine within this motif in the digestion control is 5 hydroxymethycytosine Complete conversion of this base to uracil during the TrueMethyl process will render the motif resistant to Taq1 digestion see Table 7 The motif will digest following incomplete conversion or an oxBS seq failure Qualitative analysis by gel electrophoresis demonstrates the extent of conversion and provides a decision point albeit qualitative on whether the converted samples are suitable for sequencing or whether the oxidative bisulfite conversion should be repeated Table 7 Querying the Digestion Control Resulting Control Conversion Motifs post PCR digested oxBS seq TTGA No Complete BS seq TCGA Yes oxBS seq TTGA TCGA Partial Incomplete BS seq TCGA Yes Fail oxBS seq TCGA Yes BS seq TCGA Yes It is assumed that the Digestion Control has been spiked into the sample as described in Step 2 ep O 2 O or A Procedure M oxBS seq workflow VI BS seq workflow Amplification of the Digestion Control 5 1 Amplify out the processed Digestion Control from the template recovered from the TrueMethyl workflow post bisulfite pre PCR 5 2 Prepare the PCR reaction mix shown in Table 8 Table 8 Digestion Con
31. pping and Storage The TrueMethyl 6 Kit is shipped as two separate boxes e oxBox 1 is shipped at ambient temperature 15 25 C e oxBox 2 is shipped frozen 20 C IMPORTANT The oxidant solution is sensitive to carbon dioxide exposure Under no circumstance should the oxidant come into contact with CO or dry ice otherwise performance will be significantly impaired The oxidant is shipped in oxBox 2 on frozen ice packs and not dry ice for this reason Upon arrival e The BioRad MicroBio P6 acrylamide spin columns should be removed from oxBox 1 and stored in the fridge at 2 8 C Short term storage of these components at room temperature does not affect their performance e oxBox 2 and its contents should be stored at 20 C All other buffers and the bisulfite mix should be stored at room temperature and are stable for at least 6 months under these conditions Dissolved Bisulfite Mix should be used immediately and then disposed of appropriately Do not freeze the BioRad P6 spin columns they should only be stored in the fridge on receipt of the kit 2 8 C Safety Information When working with chemicals always wear a suitable lab coat disposable gloves and protective goggles For more information please consult the appropriate material safety data sheets MSDSs These are available on request to CEGX technical support technical cegx co uk The following risk and safety phrases apply to components of the Tru
32. rocess Step Details Timing Starting sample 1 5 pg 200 400 bp fragments Spike in CEGX Sequencing 1 2 Controls recommended SANN days NGS Sample Prep Platform dependent Optional AmpureXP cleanup See Appendix 3 10 min Spike in CEGX Digestion Control R optional 0 5 w w 5 min Decide on input mass 0 4 1 0 ug Sample buffer exchange Remove ethanol and traces of buffer from the DNA 15 min sample Denaturation Ensure sample is ssDNA 30 min Oxidation Oxidation of 5hmC to 5fC 30 min Bisulfite Conversion Deamination of C and 5fC 8 hrs Bisulfite Workup Desulfonation and purification of converted DNA 60 min Interrogate Digestion Control Qualitative assessment of oxidation and bisulfite 90 hrs optional conversion Provides sequencing go no go decision PCR Amplification Amplification of recovered template in preparation for 30 min sequencing experiment Analyze e g sequence User and application specific Variable Components and instruction required for these steps are not provided in the CEGX TrueMethyl 6 Kit Input mass of 400 1000ng is required for both the oxBS seq and BS seq halves of the TrueMethyl workflow In order to analyse the processed samples in parallel we recommend uniquely indexing each input NGS library op O O or A Step 1 Spike in CEGX Sequencing Controls CEGX supply a pool of 6 sequencing spike in controls containing known numbers positions and
33. rol DNA i 5 20 ng uL Ultra Pure Water 5 8 7 8 10 8 TOTAL volume 20 20 20 Digestion Control Digestion of this control will allow qualitative determination of the extent of success of the oxidation and bisulfite conversion Cutting Control Digestion of the Cutting Control will act as a positive control for the Taq1 digestion and be useful for comparison purposes when evaluating the extent of C gt U conversion in your Digestion Control Negative Control Use a no Taq1 digestion mix as a negative control 5 7 Incubate Taqi digestion mixes and controls for 18 hrs at 65 C 5 8 Denature samples at 80 C for 20 minutes 5 9 Run digestion mixes on 2 agarose gel or other gel electrophoresis system 5 10 Based on the extent of Taq1 digestion observed see Table 7 make a decision on whether to proceed and sequence the sample or to stop and repeat the oxBS conversion If digested the 100 bp Digestion Control will cut to yield two bands of approxiamtely 40 and 60 bp op O O or A Step 6 PCR Amplification In order to sequence the oxidised and bisulfite converted DNA amplification must be performed to enrich for NGS adapted bisulfite converted DNA Important points before starting e Failure to centrifuge the reactions after bisulfite conversion as described in step 4 6 will cause contaminants to be carried over into the PCR leading to suboptimal amplification e Correct
34. supplied in the TrueMethyl 6 Kit you will require the use of the following equipment and consumables e Pipettes and pipette tips We recommend the use of pipette tips with aerosol barriers to prevent cross contamination 0 2 mL polypropylene PCR tubes 1 5 mL polypropylene microcentrifuge tubes 2 0 mL polypropylene microcentrifuge tubes Thermal cycler with heated lid Variable speed microcentrifuge suitable for use with 1 5 microcentrifuge tubes and ability to set the rotor speed in both RCF and RPM values to speeds of 14000k RPM e Tube adapters for 0 2 mL thermal cycling tubes e g www labnetinternational com P N C1222 e Heat block thermomixer or heated orbital incubator able to maintain temperatures at 37 C and 60 C and shake up to 1400 RPM e g Eppendorf Thermomixer Comfort e Ice bucket e Plastic microcentrifuge tube holder or rack Optional Equipment and Reagents e Extra 2 mL Amicon Collection Tubes Taq1 Restriction Endonuclease e g NEB P N R0149 dNTPs for Interrogating the Digestion Control DNA polymerase for interrogating the Digestion Control NGS specific PCR amplification primers AmpureXxP beads Beckmann Coulter P N A63881 Magnetic separation rack e g Invitrogen Dynamag 2 magnet P N 12321D HPLC grade acetonitrile xX LU L Principle and procedure The TrueMethyl 6 Kit contains the necessary reagents to perform the quantitative site specific oxidation and conversi
35. trol PCR mix Volume Component pL Ultra Pure Water 39 10X polymerase buffer 5 10 mM dNTP mix user supplied 2 Digestion Control Fwd PCR primer Q3PB 100 uM 0 5 Digestion Control Rev PCR primer Q8 100 uM 0 5 DNA from step 4 17 2 DNA polymerase 5U e g Agilent Pfu Cx Turbo user supplied TOTAL volume 50 5 3 Amplify according to the thermocycling conditions outlined in Table 9 Table 9 Digestion Control Thermocycling conditions Number Segment of cycles Temperature Duration 1 1 95 C 120s 95 C 30s 2 40X 60 C 30s 72 C 15s 3 1 4 C Forever 5 4 Clean up the amplicons using PCR purification kit e g Thermo Scientific GeneJet user supplied 5 5 Determine concentration of the amplicon e g Qubit www cegx co uk info cegx co uk technical cegx 50 Uk Taqi digestion of the Digestion Control amplicon Treat the amplicon 100 bp recovered from step 5 5 with Taqi The extent of digestion correlates with the level of oxidation and bisulfite conversion achieved during the oxBS workflow 5 6 Prepare the following digestion reaction mixes outlined in Table 10 Table 10 Taqi digestion conditions Volume pL Digestion Digestion Cutting Component Control ve Control Control 10X Taqi buffer 2 2 2 Taqi RE 20 U uL 40U 40U BSA 0 2 0 2 0 2 Processed Digestion Control 10 10 amplicon DNA 10 ng uL Cutting Cont
36. um 25 pL ep Q O or A oxBS workflow AND BS only workflow 3 5 Thaw Oxidant Solution Take the Oxidant Solution out of the freezer and thaw on ice 3 6 Denature dsDNA In a new 0 2 mL microcentrifuge tube add the buffer exchanged dsDNA sample Denaturation Solution and Ultra Pure Water according to Table 3 below Mix briefly by vortexing and centrifuge briefly Table 3 dsDNA denaturation mix Volume per reaction pL Component oxBS seq BS seq Buffer exchanged dsDNA from step 3 4 22 75 max dsDNA sample 22 75 max Denaturing Solution 1 25 1 25 Ultra Pure Water Variable Variable TOTAL volume 24 24 3 7 Place the 0 2 mL tube containing the DNA denaturing mix in a PCR thermocylcer and incubate the DNA denaturing solution at 37 C for 30 minutes Place on ice after denaturation and proceed immediately to next step NOTE At this point the denatured DNA should be taken forward to the oxidation reaction immediately Do not store the denatured DNA before using the DNA in the oxidation reaction The oxidation solution does not oxidise dsDNA any re annealing will affect the 5hmC conversion rate 3 8 Oxidation reaction Prepare the solutions shown in Table 4 below Mix the reaction by briefly vortexing centrifuge briefly and place the reactions in a PCR thermocycler Table 4 Oxidation Reaction mixes Volume per reaction pL Component oxBS seq BS seq Denatured DNA
37. versions Procedure Zi oxBS seq workflow VI BS seq workflow processed through MOCK oxidation 2 1 Quantify the mass of your adapted gDNA sample CEGX recommends using the Qubit assay for this purpose 2 2 Thaw out the Digestion Control on ice 2 3 Using the concentration of sample calculated in step 2 1 determine the total mass of DNA in your sample Calculate the mass of Digestion Control you should add to your sample Aim for to spike in the Digestion Control at a level of 0 5 w w An example calculation is given below as a guide Total mass of sample DNA 1 ug Mass of Digestion Control required 0 5 w w 1 ug x 0 5 5 ng Volume of Digestion Control 5 ng uL to add to your sample 1 uL 2 4 Add the required volume of Digestion Control to your sample 2 5 Mix well by vortexing Centrifuge briefly 2 6 Take sample forward for processing through the TrueMethy workflow op O O or A Step 3 DNA Oxidation Important points before starting It is assumed the input sample for the oxidation reaction to be an NGS adapted but not PCR amplified library Performing the oxidation and bisulfite conversion renders the DNA single stranded Performing these reactions prior to library construction will result in a failure to adapt fragments We recommend making the library prior to performing the TrueMethyl workflow If you intend to include the CEGX Sequencing spike in controls int
38. your purified end repaired gDNA sample CEGX recommends using the Qubit assay for this purpose 1 4 Thaw out the Sequencing Control on ice 1 5 Using the concentration of end repaired sample calculated in step 1 8 determine the total mass of DNA in your sample Calculate the mass of Sequencing spike in control pool you should add to your sample Aim for to spike in the controls at a level of 3 w w An example calculation is given below as a guide Total mass of sample DNA 1 ug Concentration of Sequencing spike in Control 8 ng uL 6 control pool Mass of Sequencing spike in Control pool required 3 w w 1 ug x 3 30 ng Volume of Sequencing spike in Control pool 8 ng uL to add to your 1 ug sample 3 8 uL www cegx co uk info cegx co uk technical cegx co uk 1 6 Add the required volume of Sequencing spike in Control pool to your end repaired gDNA sample 1 7 Mix well by vortexing Centrifuge briefly 1 8 Take sample forward and complete the NGS library preparation A tailing adapter ligation Reagents and protocols for this process are not provided with the kit 1 9 For the final elution step in the NGS library preparation ensure to elute the DNA from your preferred purification method in Ultra Pure Water and NOT Tris containing buffer e g EB TE etc Step 2 Spike in CEGX Digestion Control Spike the CEGX Digestion Control into the NGS adapted sample BEFORE you start the oxBS seq or BS seq con
Download Pdf Manuals
Related Search