Recipes, continued - Thermo Fisher Scientific
Contents
1. Before You Start Chemical Transformation 10 At this point you have ligation reactions which you will transform by chemical means or electroporation into competent GI724 For procedures to prepare chemically competent cells see page 23 and for electrocompetent cells see page 25 Plate transformed cells onto RMG Amp plates see Recipes page 19 and select ampicillin resistant colonies Screen these ampicillin resistant colonies by restriction mapping and or sequencing to find the desired clones for the expression and purification experiments Please see the section on Control Reactions page 7 to determine which controls you wish to include GI724 is wild type for restriction and modification of DNA therefore your transformation efficiencies will be much lower than for strains like DH5a JM109 or HB101 Typical transformation efficiencies are 5 x 10 cfw ug DNA for chemically competent cells and 1 x 10 cfu ug DNA for electrocompetent cells You may have to transform with more DNA 1 10 ng plate a larger volume of cells 100 300 ul or increase the number of plates 2 5 plates to obtain a reasonable number of transformants 1 If transforming by electroporation be sure to have on hand sterile glass transfer pipettes electroporation cuvettes and sterile 15 ml polypropylene snap cap tubes 2 Determine the total number of transformations including controls Since you will be plating two different volumes from t2. 10mM CaCl 2H O 100mM_ KCI 3 mM Hexaamminecobalt chloride Sigma Aldrich Catalog no 20309 2 10 1 glycerol Make 100 ml of 1 M potassium acetate by dissolving 9 82 g in 90 ml deionized water Adjust pH to 7 5 with 2 M acetic acid Bring the volume up to 100 ml For 100 ml of FSB transformation solution combine the following ingredients 1 ml 1 M Potassium acetate pH 7 5 890 mg MnCl 4H 0 150mg CaCl 2H 0 750mg KCl 80 mg Hexaamminecobalt chloride 10 ml 100 glycerol 80 ml deionized water Carefully adjust pH to 6 4 with 0 1 N HCl If you go past the correct pH remake solution Do not readjust pH with base Adjust the final volume to 100 ml with deionized water and filter sterilize Store at 4 C It is very important to use fresh analytical grade DMSO If you routinely transform cells by chemical means using the method of Hanahan 1983 you probably have frozen aliquots of DMSO in your laboratory If you do not use this method then follow this procedure 1 Order the smallest amount of analytical grade DMSO you can 2 When the DMSO arrives take about 5 10 ml and aliquot 200 500 ul per microcentrifuge tube You may use the rest of the DMSO for other applications or you may aliquot the remainder for competent cells It depends on whether you plan to use the method described in this manual on a routine basis 3 Freeze these tubes at 20 C and use one tube per preparation of competent cells Discard any rema
3. 5 Centrifuge cells at 2000 x g for 15 minutes at 0 4 C Decant the water and place bottles back on ice 6 Using a prechilled sterile 25 ml pipette resuspend cells in each bottle in 20 ml cold 0 4 C sterile 10 glycerol and transfer each cell suspension to a chilled sterile 50 ml centrifuge tube 7 Centrifuge cells at 4000 x g for 15 minutes at 0 4 C Decant the 10 glycerol and place tubes on ice 8 Resuspend each cell pellet in 1 ml cold 0 4 C sterile 10 glycerol Using a prechilled 5 ml pipette pool the cells into one of the 50 ml tubes Keep on ice 1 Prepare a dry ice ethanol bath 2 For each cell preparation place thirty five 1 5 ml microcentrifuge tubes on ice and pipette 55 ul of the cell suspension into each tube Keep cell suspension and tubes on ice until all of the cell solution is aliquoted 3 After all of the cell suspension is aliquoted quick freeze tubes in the dry ice ethanol bath and store at 70 C until ready for use B Galactosidase Assay Introduction Preparation Important Growth and Induction of Cells This protocol is used to assay the activity of B galactosidase in GI724 cells transformed with pLEX LacZ Sambrook et al 1989 Cells are grown in the Induction Medium then induced with tryptophan Small aliquots of cells are lysed with chloroform and SDS then assayed for B galactosidase using o nitrophenyl P D galactopyranoside ONPG See Recipes page 17 22 for the f
4. carefully when selecting a cloning site Your gene must be in frame with the initiation ATG in order to achieve maximal expression The complete sequence of pLEX is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 30 35 10 oro eal BZ 27 GCGGTGATAA ATTATCTCTG GCGGTGTTGA CATAAATACC ACTGGCGGTG ATACTGAGCA P L pLEX Forward Primer T 1 CATCAGCAGG ACGCACTGAC CACCATGAAG GTGACGCTCT TAAAAATTAA GCCCTGAAGA _ gt RBS NdeI HA AGGGCTTTAT TTGCATACAT TCAATCAATT GTTATCTAAG GAAATACTTA CAT ATG GTA lbMet Val Kpn I Sac I BamH I Spe I Eag I BstX I EcoR I Pst T CCG AGC TCG GAT CCA CTA GTA ACG GCC GCC AGT GTG CTG GAA TTC TGC AGA Pro Ser Ser Asp Pro Leu Val Thr Ala Ala Ser Val Leu Glu Phe Cys Arg EcoR V BstXI Not Eagl Xhol Nsil Sphl Xbal Sall Pst I l _ I oot l TAT CCA TCA CAC TGG CGG CCG CTC GAG CAT GCA TCT AGA GTC GAC CTG CAG Tyr Pro Ser His Trp Arg Pro Leu Glu His Ala Ser Arg Val Asp Leu Gln aspA Transcriptional Terminator r TAA TCGTACAGGG TAGTACAAAT AAAAAAGGCA CGTCAGATGA CGTGCCTTTT TTCTTGTGAG Stop 1 Stop 2 Stop 3 AspA Reverse Primer T 1 CAGTAAGCTT GGCACTGGCC GTCGTTTTAC AACGTCGTGA CTGGGAAAAC CCTGGCGTTA a IO CCCAACTTAA TCGCCTTGCA 2556 These enzymes have two recognition sites both of which are found in the multiple cloning site Continued on next page Cloning into pLEX continued Calculation of Molar Ratios Ligation
5. reagents for tightly regulated high level expression in E coli e The pLEX expression vector for high level production of recombinant protein in E coli see below and page 3 for more details e The specially constructed strain G1724 for proper regulation of expression e Specially formulated media for plasmid growth and proper regulation of expression e The control vector pLEX LacZ to help you evaluate your expression conditions e Forward and reverse sequencing primers to confirm that your insert is in frame with the initiation ATG provided in the vector This table describes the features and benefits of the pLEX vector Feature Benefit P promoter High level expression of recombinant protein Lambda clI ribosome binding site and initiation ATG Efficient translation of recombinant protein E coli aspA transcription terminator Efficient transcription termination of mRNA Ampicillin resistance Selection and maintenance in E coli pUC origin Maintenance in bacteria and high copy number Polylinker region Cloning of the desired gene into the pLEX vector Vectors Map of pLEX The map below describes the pLEX vector The multiple cloning site see page 8 allows in frame fusion with the lambda cII ribosome binding site and the initiation ATG Note that if you do not want non native amino acids fused to your protein you can insert your gene into the Nde I si
6. the cell culture to the incubator to continue growing Centrifuge the 1 ml sample at maximum speed for 2 3 minutes decant the supernatant and freeze the cell pellet at 20 C Repeat at t 2 3 and 4 hours 6 The cell pellets can be kept frozen until ready for analysis by SDS PAGE See the section Analysis by SDS PAGE Gels in the Appendix 1 Before preparing whole cell lysates e Prepare an SDS PAGE gel e Prepare a dry ice ethanol bath e Equilibrate a 37 C bath e Prepare and chill TE Buffer pH 7 5 to 4 C 2 Remove the five samples from Growth and Induction of Cells above from the freezer and keep samples on ice Resuspend each cell pellet in 500 ul cold 4 C TE Buffer pH 7 5 and keep on ice 3 Take a hand held sonicator with a micro tip and sonicate each sample one at a time with two or three 10 second bursts Flash freeze the lysate in a dry ice ethanol bath Continued on next page Expression continued Lysing Cell Samples Day 4 continued Analysis of Samples Quick Alternative Method of Sample Lysis What You Should See Optimization of Expression 4 Quickly thaw the lysates at 37 C and perform two more rapid sonication freeze thaw cycles Repeat steps 3 and 4 until three sonication freeze thaw cycles are completed for all samples 5 After the last thaw centrifuge all tubes at maximum speed for 5 10 minutes at 4 C to pellet cell debris and insoluble matter Decant the supernatants into fre
7. the vector pLEX 3 Prepare RM medium and RMG Amp plates Plan on two plates per each ligation transformation reaction Remember to have additional plates on hand to purify your desired clone Use either of the protocols in the Appendix to make competent cells For the procedure to prepare chemically competent cells see page 23 for electrocompetent cells see page 25 Store the cells at 70 C until ready for use Chemically competent cells appear to be stable and maintain their efficiency for at least three months Resuspend the lyophilized vectors in 20 ul of sterile water such that the final concentration is 1 ug ul Store the resuspended vectors at 20 C The table below gives some suggestions for possible control reactions for the experiments presented in this manual It is useful to have control data available when contacting Invitrogen Technical Service for assistance page 30 Experiment Control Reason Ligation and No DNA Checks for contamination of ligation Transformation reagents Linearized pLEX Checks for uncut or self ligated vector may be dephos phorylated Insert only Checks for plasmid contamination of insert Cells only Checks for the presence of antibiotic in the plates and contamination of competent cells and SOC medium pLEX or Checks the efficiency of the competent pLEX LacZ cells supercoiled See Transformation experiment page 10 Expression pLEX LacZ
8. 88 Reagents and The following reagents and chemicals must be supplied or made by the user Please Chemicals check the Recipes section for instructions on how to make solutions Use reagent or Supplied by User analytical grade chemicals e Media see Recipes page 17 22 e 100 mg ml ampicillin stock solution see Recipes page 17 e FSB Solution see Recipes page 21 e Dimethyl sulfoxide DMSO See Recipes page 21 e Restriction enzymes and buffers e T4 DNA ligase and buffer e Solutions for SDS PAGE gels The size of your recombinant protein will determine what sort of SDS PAGE gel to use Please see Ausubel ef al 1990 Bollag and Edelstein 1991 Sambrook et al 1989 or Sch gger and von Jagow 1987 in the Reference section page 32 for suggestions e Solutions for ONPG assay see Recipes page 22 e Drylce e Technical grade ethanol for dry ice baths e Reagent grade ethanol for use with DNA Equipment The user should have access to the following equipment Supplied by User e 1 5 ml microcentrifuge tubes e 15 ml snap cap polyethylene tubes Falcon 2059 or equivalent e Microbiological equipment to plate cells and grow cultures e Shaking incubator 25 37 C e Incubators 15 C 30 C 37 C e Autoclave e Vacuum pump for filter sterilization e Electroporation device optional e Centrifuge refrigerated low speed 50 500 ml volumes e Autoclavable or sterile 50 ml centrifuge tubes e Autocla
9. Low Salt LB Agar Plates SOB and SOC Medium 20 Composition 1 Tryptone 0 5 Yeast Extract 0 5 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 5 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with 5 M NaOH and bring the volume to 1 liter 3 Autoclave for 20 minutes on liquid cycle 4 Store at room temperature or at 4 C 1 Make LB Medium above and add 15 g liter agar before autoclaving 2 Autoclave for 20 minutes on liquid cycle 3 Let agar cool to 55 C Pour into 10 cm petri plates Let the plates harden then invert and store at 4 C SOB per liter 2 Tryptone 0 5 Yeast Extract 0 05 NaCl 25mM KCl 10mM MgCl 1 2 3 4 Ds SOC SOB Dissolve 20 g tryptone 5 g yeast extract and 0 5 g NaCl in 950 ml deionized water Make a 250 mM KCI solution by dissolving 1 86 g of KCl in 100 ml of deionized water Add 10 ml of this stock KCl solution to the solution in Step 1 Adjust pH to 7 0 with 5 M NaOH and add deionized water to 1 liter Autoclave this solution cool to 55 C and add 10 ml of sterile 1 M MgCh Store at room temperature or 4 C per liter 20 mM glucose l 2 After making SOB medium above add 7 2 ml of 50 glucose Store at room temperature or 4 C Continued on next page Recipes continued FSB Transformation Solution DMSO Composition 10 mM Potassium acetate pH 7 5 45 mM MnCl 4H 0
10. MG Amp Plates Important Appendix Special medium is required for growth and expression of the pLEX and pLEX LacZ plasmids Instructions are provided on pages 17 20 for making media and agar plates Medium Purpose RM Base Medium Plasmid propagation Induction Base Medium Expression If you are using the pre mixed media included in the kit follow instructions on the product label for preparation Note If you use the pre mixed media there s no need to prepare the 10X M9 Salts solution or the 1 M MgCl solution listed below 10X M9 Salts for 1 liter 60 8 Na HPO 30g KH PO 5g NaCl 10g NH Cl 900 ml deionized water 1 Dissolve chemicals in the water and pH to 7 4 with 10 M NaOH 2 Add water to 1 liter and autoclave for 20 minutes on liquid cycle 3 Store at room temperature 1M MgCl 1 Dissolve 20 33 g MgCl in 100 ml deionized water 2 Autoclave for 20 minutes on liquid cycle 3 Store at room temperature 100 mg ml ampicillin 1 Dissolve 1 g ampicillin in 10 ml deionized water 2 Filter sterilize and store at 20 C 50 glycerol v v 1 Dissolve 50 ml glycerol in 100 ml deionized water 2 Filter sterilize and store at room temperature 20 glucose w v 1 Dissolve 20 g glucose dextrose in 100 ml deionized water 2 Filter sterilize and store at room temperature Pre mixed media from Invitrogen are tested to ensure they contain low levels of tryptophan Cont
11. Positive control for expression supercoiled Production of B galactosidase in the Expression experiment page 13 shows the cells and the media are working properly Continued on the next page Cloning into pLEX continued General Considerations Cloning Considerations Multiple Cloning Site of pLEX 2133 2193 2253 2312 2363 2414 2477 2537 Since all constructs will be unique please consult general molecular biology references Ausubel et al 1994 Sambrook et al 1989 for recommendations on restriction digests dephosphorylation of vector ligations and plasmid preparations Follow the instructions of the manufacturer for restriction enzymes T4 DNA polymerase calf intestinal alkaline phosphatase and T4 DNA ligase in order to clone your gene of interest into pLEX Remember that resulting ligations will be transformed into GI724 You cannot use DH5a JM109 or other common E coli strains Your gene will need to be in frame with the lambda clI initiation ATG in order to utilize the PL promoter and ribosome binding site for high level expression If you do not want non native amino acids fused to your protein you may clone into the Nde I site which contains the initiation ATG If you clone in frame with the initiation ATG using any of the other sites your protein will be produced as a fusion protein with an N terminal leader peptide The pLEX multiple cloning site is shown below Choose
12. Reaction To ligate your gene of interest into pLEX you will need to know the concentration of each DNA solution This may be determined by OD 260 agarose gel electrophoresis fluorescence or using the DNA Dipstick Kit from Invitrogen Catalog no K5632 01 The concentration is needed to calculate the volume required to achieve a particular molar ratio of vector to insert 1 Determine the concentration of insert and linearized pLEX in pg ml 2 Use the following formula to calculate the amount of insert needed to give an equimolar 1 1 ratio between insert and linearized pLEX X ng insert bp insert ng linearized pLEX 2886 bp pLEX Amount of pLEX can range from 50 200 ng 3 Based on fs the calculation above compute the volumes needed for the ligation reaction 4 You may wish to consider other ratios of vector to insert i e 1 2 or 1 3 to increase the chances of obtaining the correct clone The following protocol gives a general ligation reaction Linearized pLEX vector 50 200 ng x ul Linearized insert 5 200 ng y ul 10X Ligation Buffer should have ATP 1 pl Sterile Water to 9 ul T4 DNA Ligase 0 5 Weiss Units 1 ul Total Volume 10 ul 1 Incubate for 4 hours at room temperature or 12 16 hours at 15 C 2 At the end of the reaction time transform into competent GI724 E coli cells or store at 20 C Transformation Introduction Controls Transformation Efficiency of GI724
13. aliquot from each sample and mix with 0 97 ml of Z buffer 20 ul of chloroform and 20 ul of 0 1 SDS Vortex for 10 seconds and then equilibrate to 28 C Make a blank reaction with 30 ul of Induction Medium Add 0 2 ml of ONPG to the lysed culture prepared in Step 6 and to the blank After 1 minute stop the reaction by adding 0 5 ml of 1 M sodium carbonate Continued on next page 27 B Galactosidase Assay continued Calculation 28 Read the ODs59 and ODy of the reaction samples Units of B galactosidase activity are calculated as follows 1000 x ODao 1 75 x ODsso t v OD oo where t time in minutes 1 minute and v the volume of culture assayed 0 030 ml Units are typically Cells only lt 5 x 10 Units Uninduced pLEX LacZ lt 5x 10 Units Induced pLEX LacZ gt 1 x 10 Units Time and volume may be varied if the absorbance is too high or too low to be read accurately by the spectrophotometer Analysis by SDS PAGE Gels Introduction Types of SDS PAGE Gels General Procedure for Sample Preparation This section provides references and suggestions for analysis of recombinant protein expression by SDS PAGE sodium dodecyl sulfate polyacrlyamide gel electrophoresis SDS PAGE will allow you to analyze the solubility purity and yield of the recombinant protein We recommend using 10 Tricine gels to analyze cell lysates if the protein is less than 20 kDa This g
14. ation and special offers Contact Us For more information or technical assistance please call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail E mail E mail tech_service invitrogen com jpinfo invitrogen com eurotech invitrogen com Material Data MSDSs are available on our Web site at www invitrogen com On the home page click Safety Sheets on Technical Resources and follow instructions on the page to download the MSDS for MSDSs your product Continued on next page 30 Technical Service continued Limited Warranty Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service please contact our Technical Service Representatives Invitrogen warrants that all of its products will perform accord
15. bility of the plasmid preparation Expression Introduction At this point you should have GI724 containing pLEX with the gene encoding your protein ligated in frame to the initiation ATG In this section you will determine if this construct expresses and then optimize expression conditions by varying the time of induction Stage Action 1 Grow cells containing your construct to mid log at 30 C in Induction Medium 2 Induce by adding tryptophan and transfer to 37 C Take time points from the cell culture and lyse the cells by sonication and freeze thaw 4 Fractionate cell lysate by centrifugation Analyze pellets and supernatant for recombinant protein by SDS PAGE 6 Vary time of induction to increase yield of recombinant protein To analyze expression and eventually purification it is necessary to use SDS PAGE technology There are many different types of SDS PAGE systems Because all proteins Note are different it is difficult to recommend a particular system for your individual appli cation Please see the following references Ausubel et al 1990 Unit 10 Bollag and Edelstein 1991 Sambrook et al 1989 Chapter 18 and Sch gger and von Jagow 1987 Optimizing To achieve maximum levels expression may be optimized The time of induction is the Expression major variable manipulated to achieve optimal expression Expression of We recommend using the pLEX LacZ expression contr
16. cell dies To drive expression of recombinant proteins pLEX uses the major leftward promoter PL from bacteriophage lambda This promoter is one of the most efficient promoters for bacterial expression Buell and Panayotos 1986 It is also tightly regulated Expression from the P promoter is controlled by the cl repressor protein The cl repressor gene was engineered into the bacterial chromosome under the control of the trp promoter Mieschendahl er al 1986 Expression is induced by the addition of tryptophan Transcription In the absence of tryptophan expression of the cl repressor is P Ptrp Acl Repressor ae driven by the trp promoter romosome h No Transcription The cI repressor protein binds to the operator region up stream pLEX of the P promoter and prevents Po PL ATG Gene of Interest Vector transcription of the gene of interest cI Repressor Tryptophan Tryptophan is added to the medium No Transeription and a tryptophan trp repressor complex is formed This complex acl R Bacterial binds tightly to the tp operator Sp Chromosome blocking expression of the cl trp Repressor repressor Transcription The cl repressor falls off of the PL pLEX operator allowing transcrip P PL ATG Gene of Interest Vector tion of the gene of interest cl Repressor Continued on next page Overview continued Contents of the P Expression System Kit Features of pLEX This kit contains all the necessary
17. cubator until the ODsso reaches between 0 55 0 65 2 3 hours 4 Divide the culture between the two cold 0 4 C sterile 250 ml centrifuge bottles and place on ice for 30 minutes Continued on next page 23 Protocol for Chemically Competent Cells continued Preparing the Cells Day 3 Aliquoting and Storage of Cells Day 3 24 Centrifuge the 250 ml bottles at 2000 x g for 10 15 minutes at 0 4 C Decant the medium and resuspend each pellet in 10 ml cold 0 4 C FSB solution and transfer to two cold sterile 50 ml centrifuge tubes Incubate on ice for 15 minutes Centrifuge the tubes at 2000 x g for 10 15 minutes at 0 4 C Decant the buffer and resuspend each pellet in 1 8 ml cold FSB solution using a sterile 5 ml pipette While gently swirling the tubes slowly add 65 ul of DMSO drop by drop to each tube Incubate on ice for 15 minutes While gently swirling the tubes slowly add an additional 65 ul of DMSO drop by drop to each tube Combine the cell suspensions from both tubes into one and incubate on ice for 15 minutes Keep on ice Prepare a dry ice ethanol bath For each cell preparation place approximately thirty 1 5 ml microcentrifuge tubes on ice Keep cell suspension on ice Pipette 110 ul of cell suspension into each tube As soon as all of the cell suspension is aliquoted quick freeze the tubes in the dry ice ethanol bath and store at 70 C Protocol for Electrocompetent Cells Intr
18. d on next page Overview continued Before You Start It is important to read through the entire manual to familiarize yourself with the procedures Some general things you need to check are listed below Step Action 1 Prepare media and plates for expression and transformation based on the amounts required for your particular project 2 Prepare solutions you need 3 Have suitable restriction enzymes T4 DNA ligase and modifying enzymes on hand to ligate your gene of interest into pLEX 4 Prepare competent cells in advance and store at 70 C General Users should be familiar with sterile technique molecular biology techniques and Knowledge standard microbiological practices For information on DNA ligations E coli transformations restriction enzyme analysis purification of single stranded DNA DNA sequencing and DNA biochemistry please refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 Cloning into pLEX Before You Start Preparing Competent Cells Before Cloning General Guidelines for Control Reactions The table below outlines the general steps to consider when cloning your gene of interest into pLEX Step Action 1 Prepare either electrocompetent or chemically competent GI724 cells 2 Develop a cloning strategy to fuse your protein in frame with the initiation ATG in
19. el system resolves differences between low molecular weight proteins A variety of Tricine Gels are available from Invitrogen For details visit www invitrogen com There are many types of SDS PAGE gels Protein Methods by Bollag and Edelstein 1991 describe the basic types The Tricine gels used at Invitrogen are described by Schagger and von Jagow 1987 Citations for these publications are found in the Reference section page 32 There are also sections in Ausubel et al 1990 and Sambrook et al 1989 1 Before lysing the cells and preparing your samples assemble the SDS PAGE gel 2 Lyse the cells and fractionate if necessary Take 10 ul aliquots from fractionated cell lysates and mix with 10 ul of SDS PAGE sample buffer 3 Boil the samples 5 minutes and load all 20 ul onto the SDS PAGE gel If aggregation forms after boiling remake the sample and load without boiling Be sure to include molecular weight standards 4 Electrophorese the gel and process according to your protocol of choice Analyze for the extent of solubility purity and yield 29 Technical Service World Wide Web Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical service contact information e Access to the Invitrogen Online Catalog e Additional product inform
20. he directions on the package to prepare RMG Amp plates Composition 1X M9 Salts 2 Casamino Acids 0 5 glucose 1 mM MgCl 100 ug ml ampicillin 1 5 agar 1 For 1 liter of plating medium mix 20 g Casamino Acids 15 g agar and 875 ml water and autoclave for 20 minutes on liquid cycle 2 Cool autoclaved solution to 55 C and add 100 ml 10X M9 Salts see recipe previous page 1 ml 1 M MgCl see recipe previous page 25ml 20 glucose 1 ml 100 mg ml ampicillin 3 Mix well and pour into 10 cm petri plates Yield 40 plates 4 Let agar harden invert and store plates in the dark at 4 C Plates are good for one month at 4 C Use the pre mixed Induction Base medium included in the kit You will need a 20 sterile glucose dextrose solution and a 100 mg ml ampicillin solution Follow the directions on the package to prepare RMG Amp plates Composition 1X M9 Salts 0 2 Casamino Acids 0 5 glucose 1 mM MgCl 100 ug ml ampicillin 1 For 1 liter of induction medium mix 2 g Casamino Acids with 875 ml water and autoclave for 20 minutes on liquid cycle 2 After the autoclaved solution has cooled add 100ml 10X MO Salts see recipe page 17 1 ml 1 M MgCl see recipe page 17 25ml 20 glucose 1 ml 100 mg ml ampicillin 3 Mix well and store medium containing ampicillin at 4 C Medium is good for 1 month if stored at 4 C Continued on next page 19 Recipes continued Low Salt LB Medium
21. hese reactions you will need two RMG Amp plates per ligation transformation 3 Be sure the lyophilized vectors are resuspended in 20 ul sterile water such that the final concentration is 1 ug ul This will be your stock solution To transform supercoiled pLEX and pLEX LacZ as controls prepare 10 ul of a 10 ng ul solution in water for each vector Keep on ice 4 Make sure the SOC medium is at room temperature 1 Equilibrate a water bath or heat block to 42 C Remove the appropriate number of tubes of frozen GI724 chemically competent cells 100 ul tube and thaw on ice 2 Add 3 5 ul of each ligation reaction to a separate tube of competent cells Mix gently with the pipette tip DO NOT PIPETTE UP AND DOWN Repeat for all ligations 3 For control reactions add 1 ul 10 ng of each supercoiled plasmid pLEX and or pLEX LacZ to a separate tube of cells Incubate tubes on ice 30 minutes 4 Transfer all tubes to 42 C heat block or water bath and incubate for exactly 90 seconds then place on ice for 1 2 minutes 5 Add 800 ul of room temperature SOC medium to each tube and shake at 225 rpm for 45 minutes at 37 C Incubate the tubes horizontally and secure with tape to maximize aeration Incubation at 37 C does not cause rearrangements or deletions in the plasmid for this short amount of time 6 Plate 100 ul and 300 ul of each transformation mix on the RMG Amp transformation plates It may be necessary to increase the number of plate
22. hould see increasing amounts of protein produced If your protein is soluble it will appear in the supernatant fraction of each time point after induction and reach a maximum If you do not see the protein expressed either in the supernatant or the pellet check the pLEX LacZ control GI724 pLEX LacZ can be grown and expressed as a positive control The zero time point from the pLEX LacZ control should show no expression of wild type B galactosidase 117 kDa or very little activity by ONPG assay When induced with tryptophan B galactosidase should be expressed and detected in the crude cell lysate or soluble supernatant fraction If you do not get expression of B galactosidase be sure pLEX LacZ is transformed into GI724 and that you are using the correct medium for expression The time of induction is the major variable to optimize when using the P Expression System Increase or decrease the time to achieve maximum levels of recombinant protein Continued on next page 15 Expression continued Troubleshooting Scale up and Purification 16 If your recombinant protein does not express at all it may be out of frame with the initiation ATG Use the pLEX Forward and the AspA Reverse Sequencing Primers to confirm that your insert is in frame and in the correct orientation In some cases heterologous proteins expressed in E coli will fail to fold properly and will aggregate into inclusion bodies and precipitate out of sol
23. ing to the specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 31 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New Yor
24. ining DMSO in the tube Use a fresh tube for every preparation of competent cells Continued on next page 21 Recipes continued Z Buffer ONPG Solution 1 M Sodium Carbonate 22 Composition 60 mM Na HPO 7H O 40 mM NaH PO H O 10mM KCI 1 mM MgS0 7H 0 50mM _ P mercaptoethanol pH 7 0 1 Dissolve the following 16 1 g Na HPO 7H O 5 5 g NaH PO H O 0 75 g KCl 0 246g MgSO 7H O 2 7 ml B mercaptoethanol in 950 ml deionized water 2 The pH should be 7 0 if made correctly Bring the volume up to 1 liter with water 3 Do not autoclave Store at 4 C 4 mg ml in 100 mM phosphate buffer pH 7 0 1 Dissolve the following 1 61 g Na HPO 7H 0 0 55 g NaH PO H O in 90 ml deionized water 2 The pH should be 7 0 if made correctly 3 Add 400 mg of ONPG Stir to dissolve and bring the volume up to 100 ml with water 4 Store at 20 C away from light Dissolve 12 4 g sodium carbonate in 100 ml of deionized water Store at room temperature Protocol for Chemically Competent Cells Introduction Yield Important Preparation Growth of Cells Day 1 Growth of Cells Day 2 Growth of Log phase Cells Day 3 This protocol is used to make chemically competent cells for transformation with plasmid DNA These cells will not substitute for electrocompetent cells for electroporation The cells are grown to mid log phase then washed with FSB solution and treated with DMSO The cells are froze
25. inued on next page 17 Recipes continued Vendors RM Medium 18 If you are not using the pre mixed media included in the kit you will need to purchase Casamino Acids Please note that Casamino Acids need to be low in tryptophan We recommend the following vendors 1 800 325 3010 Amicase Vendor Chemical Amount Catalog number Difco Casamino Acids 100g 0230 15 5 1 800 521 0851 500 g 0230 17 3 Sigma Aldrich Casamino Acids 250g to 5 kg A 2427 Use the pre mixed RM Base medium included in the kit You will need a 50 sterile glycerol solution and a 100 mg ml ampicillin solution Follow the directions on the package to prepare RM Medium Composition 1X M9 Salts 2 Casamino Acids 1 glycerol 1 mM MgCl 100 pg ml ampicillin 1 For 1 liter of RM medium mix 20 g Casamino Acids 20 ml 50 sterile glycerol and 880 ml water and autoclave 20 minutes on liquid cycle After the autoclaved solution has cooled add aseptically 100ml 10X M9 Salts see recipe previous page 1ml 1M MgCl see recipe previous page 1ml 100 mg ml ampicillin Mix well and store medium containing ampicillin at 4 C Medium is good for 1 month at 4 C Continued on next page Recipes continued RMG Amp Plates Induction Medium Use the pre mixed RMG Agar Base medium included in the kit You will need a 20 sterile glucose dextrose solution and a 100 mg ml ampicillin solution Follow t
26. invitrogen P Expression System A Prokaryotic Expression System Catalog no K450 01 Version H 7 September 2010 25 0080 ii Table of Contents Table of Contents anna naeh aba 111 Important Informatica iv Introducti ar 1 LOAA DAT aE E E tii be nene do duda de a e a EEA had 1 WV CCLOTS ted ne da RENTE ad 3 AAPP aces caus Eaei odara Aao LA aaia d Aaa eA adiad izohini 5 ONTA A APELE A EE A E A T ean eh ee 5 Eloningint PEER a de vis dices ete A T 7 TAO MAN eiii 10 EXpressSioN na IR IR HR INH u ICH IR ceuss E E a n ia ia 13 Appendix nee 17 REP ne I a i OE RES 17 Protocol for Chemically Competent Cells 220220022rnnensenseensennsnnnnennnnn nennen nennen nenn 23 Protocol for Electrocompetent Cells cseesseeseessessnsneennennnenneennennnennsnnnennnnnnnennenne nennen 25 P Galactosidase Assay a Hain Ba Bi BR A eatin oh Mee 27 Analysis by SDS PAGE Gels coocconccnoconocononoconnconccnncon nono nonononcron nono a n rra nr n nro n nro n nro nr nennen nennennse nn 29 A aa EE Ri chien waa AAR 30 A tad Ber Nason abit tad 18 oes hee neta tas onde 32 111 Important Information Storage e Store cell stabs 10 mg ml tryptophan and pre mixed media at room temperature Protect the tryptophan from light e Store lyophilized vectors and primers at 20 C P Expression The Pi Expression System includes vectors primers an coli strain and media System Kit reagents Contents S
27. k Greene Publishing Associates and Wiley Interscience Bollag D M and Edelstein S J 1991 Protein Methods New York Wiley Liss Buell G and Panayotos N 1986 Mechanism and Practice In Maximizing Gene Expression W Reznikoff and L Gold eds Boston MA Butterworth Publishers Deutscher M P 1990 Guide to Protein Purification In Methods in Enzymology Vol 182 J N Abelson and M I Simon eds Academic Press San Diego CA Hanahan D 1983 Studies on Transformation of Escherichia coli with Plasmids J Mol Biol 166 557 580 LaVallie E R DiBlasio E A Kovacic S Grant K L Schendel P F and McCoy J M 1993 A Thioredoxin Gene Fusion Expression System That Circumvents Inclusion Body Formation in the E coli Cytoplasm Bio Technology 11 187 193 Mieschendahl M Petri T and H nggi U 1986 A Novel Prophage Independent trp Regulated Lambda PL Expression System Bio Technology 4 802 808 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Schagger H and Jagow G v 1987 Tricine Sodium dodecyl sulfate Polyacrylamide Gel Electrophoresis for the Separation of Proteins in the Range from 1 to 100 kDa Anal Biochem 166 368 379 1998 2005 Invitrogen Corporation All rights reserved 32 8 invitrogen Corporate Headquarters Invitrogen Corporatio
28. ml sterile culture tube 2 3 10 ml Induction Medium with 100 ug ml ampicillin in a sterile 25 ml small flask 4 Five microcentrifuge tubes labeled t 0 t 1 t 2 t 3 and t 4 Make sure you have extra tubes if you wish to extend the time course Streak out the clone of interest on a RMG Amp plate with 100 ug ml ampicillin and grow at 30 C until single colonies are visible 12 16 hours Using a single colony from the plate from Day 1 inoculate 1 ml of RM medium containing 100 ug ml ampicillin and incubate at 30 C at 200 225 rpm in a shaking incubator overnight 1 Inoculate 10 ml of fresh Induction Medium in a 25 ml culture flask to an OD of 0 1 using the overnight culture Grow this culture at 30 C to an OD of 0 5 approximately 2 3 hours 2 When an OD of 0 5 is reached transfer a 1 0 ml sample to the microcentrifuge tube labeled t 0 and centrifuge the tube for 2 3 minutes at maximum speed to pellet the cells This is the zero time sample Decant the supernatant and freeze the cell pellet at 20 C until ready to assay Return the cell culture to the incubator 3 To your cell culture add tryptophan to a final concentration of 100 ug ml using the 10 mg ml stock solution included in the kit 4 Transfer the culture to 37 C and incubate with shaking 200 225 rpm 5 At time t 1 hour read the OD and record Then take a 1 ml sample and place into the microcentrifuge tube labeled t 1 Return
29. n 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
30. n in a dry ice ethanol bath and stored at 70 C This protocol will yield enough cells for about 30 transformations The expected efficiency of chemically competent GI724 cells is 5 x 10 cfu ug supercoiled DNA The efficiency is low because these strains are essentially wild type for restriction and modification of DNA Some of your plasmid will be degraded before it is modified Sterile technique is absolutely essential to avoid contamination of the competent cells Remember to use sterile solutions medium and supplies For each cell preparation prepare the following solutions see Recipes pages 20 22 5 ml SOB medium in a sterile culture tube 250 ml SOB in a sterile 500 ml or 1 liter culture flask FSB solution 25 ml Fresh reagent grade DMSO Streak GI724 on an LB plate invert the plate and incubate at 37 C overnight LB plates and 37 C incubators are only used for cells without plasmid e Inoculate 5 ml of SOB medium in a sterile culture tube with one colony from the LB plate e Grow overnight 12 16 hours in a shaking incubator 200 225 rpm at 37 C 1 For each cell preparation place the following items on ice or at 4 C Two 250 ml sterile centrifuge bottles Two 50 ml sterile centrifuge tubes Two 5 ml sterile pipettes 2 Inoculate 250 ml of fresh SOB medium in a 500 ml or 1 liter culture flask with 2 5 ml of the overnight culture 3 Grow the culture at 37 C at 200 225 rpm in a shaking in
31. oduction Yield Note Important Growing the Cells Day 1 Growing the Cells Day 2 The purpose of this procedure is to prepare cells for transformation with plasmid DNA by electroporation The procedure describes the growth of cells and subsequent washing and concentrating steps The washing is necessary to ensure that salts are removed to reduce the conductivity of the cell solution High conductivity may result in arcing during electroporation These cells are only to be used for electroporation Do not use them for any other transformation protocol The following procedure will yield enough electrocompetent cells for about 30 transformations Remember to use sterile solutions medium and supplies The expected efficiency of the electrocompetent GI724 cells is 1 x 10 cfu ug supercoiled DNA The efficiency is low because these strains are essentially wild type for restriction and modification of DNA Some of your plasmid will be degraded before it is modified Sterile technique is absolutely essential to avoid contamination of the electrocompetent cells Streak GI724 on an LB plate invert the plate and incubate at 37 C overnight LB plates and 37 C incubators are only used for cells without plasmid 1 For each cell preparation prepare the following a day in advance 50 ml LB medium in a 250 ml sterile culture flask 1 liter of LB medium in a 2 liter or 4 liter sterile culture flask Store at room
32. ol to evaluate growth and pLEX LacZ Control induction conditions You may assay cell lysates from GI724 pLEX LacZ for expression one of two ways SDS PAGE or enzymatic assay For analysis by SDS PAGE GI724 pLEX LacZ can be grown using the same conditions as your construct in pLEX Note that the approximate molecular weight of B galactosi dase is 117 kD To enzymatically assay for P galactosidase activity there is a slight modification to the growth procedure for GI724 pLEX LacZ Please turn to page 27 for this information and the ONPG assay for B galactosidase activity 7 For testing and optimizing expression Invitrogen recommends using small volumes SO 7 5 50 ml then scaling up for large scale expression and purification of the recombinant g a protein 1 liter once optimal conditions have been determined The volume of cell P culture you use depends on how much you need to read the absorbance of the cultures and the number of 1 ml time points that will be taken The instructions that follow are for 10 ml cultures and may be scaled up or down to meet your individual needs Continued on next page 13 Expression continued Preparation Growth of Cells Day 1 Growth of Cells Day 2 Growth and Induction of Cells Day 3 Lysing Cell Samples Day 4 14 See Recipes page 17 22 for the following media and plates You will need 1 One RMG Amp plate 1 ml RM medium with 100 ug ml ampicillin in a 5
33. ollowing media and plates You will need 1 2 3 4 5 One RMG Amp plate 1 ml RM medium with 100 ug ml ampicillin in a 5 ml sterile culture tube 10 ml Induction Medium with 100 pg ml ampicillin in a sterile 25 ml small flask Five microcentrifuge tubes labeled t 0 t 1 t 2 and t 3 Make sure you have Z buffer the ONPG solution and the 1 M sodium carbonate solution made see page 22 Read the culture density at 600 nm This is important for the calculation on the next page Using a single colony of GI724 pLEX LacZ from a RMG Amp plate inoculate 1 ml of RM medium with 100 ug ml ampicillin and incubate at 30 C at 200 225 rpm ina shaking incubator overnight 1 Inoculate 10 ml of fresh Induction Medium in a 25 ml culture flask to an OD of 0 1 using the overnight culture Grow this culture at 30 C to an OD of 0 5 approximately 2 3 hours When an OD of 0 5 is reached transfer 1 ml of the cell culture to the microcentrifuge tube labeled t 0 and place on ice This is the zero time sample To your cell culture add tryptophan to a final concentration of 100 ug ml using the 10 mg ml stock solution included in the kit Transfer the culture to 37 C and incubate with shaking 200 225 rpm At time t 1 hour read the OD and record Then take a 1 ml sample and place into the microcentrifuge tube labeled t 1 Place on ice Repeat at t 2 and t 3 hours After all the time points are collected take a 30 ul
34. or this short amount of time Plate 25 ul and 100 ul of the transformation mix on the RMG A mp transformation plates After the liquid is absorbed invert and incubate at 30 C overnight Remove plates from the incubator There may be a slight background haze but true ampicillin resistant transformants will appear as distinct colonies Pick 10 transformants and inoculate into 2 5 ml RM medium with 100 ug ml ampicillin Grow overnight at 30 C Isolate plasmid DNA by miniprep for restriction analysis and sequencing see below Remember to purify the desired clone by streaking for singles on RMG Amp plates before making a glycerol stock Make a glycerol stock of your desired clone for safekeeping by combining 0 85 ml of a overnight bacterial culture with 0 15 ml of sterile glycerol Mix by vortexing and transfer to a labeled storage tube Freeze the tube in liquid nitrogen or a dry ice ethanol bath and store at 70 C Once the desired clone is isolated proceed to the Expression section page 13 Since it is particularly important to make sure your protein is in frame with the initiation ATG it is strongly recommended that you sequence your construct To sequence pLEX use the pLEX Forward Sequencing Primer and the AspA Reverse Sequencing Primer Continued on next page 11 Transformation continued Estimating Nmoles In order to determine how much oligonucleotide to use in a sequencing reaction you will of Oligonucleo
35. ownloading from our Web site www invitrogen com or by contacting Technical Service page 30 Pst BamH Sac ea Kpn Transcription Nae Termination Comments for pLEX LacZ 5869 nucleotides Ampicillin Resistance Gene bases 201 1061 pUC origin bases 1206 1879 35 Region of P Promoter bases 2159 2164 10 Region of P Promoter bases 2182 2187 pLEX Forward Primer Binding Site bases 2222 2245 Lambda clI Ribosome Binding Site bases 2291 2294 Lambda clI Initiation ATG bases 2306 2308 P galactosidase Gene bases 2327 5386 aspA Transcription Terminator bases 5397 5463 AspA Reverse Primer Binding Site bases 5490 5471 The pLEX LacZ vector is used to evaluate growth and expression conditions in the PL Expression System Successful expression of B galactosidase from the pLEX LacZ vector demonstrates that your cells medium and induction conditions are functioning properly If your gene of interest is not expressed it may suggest that either the recombinant construct is not in frame with the initiation ATG or the expression conditions are not optimal If B galactosidase does not express from pLEX LacZ it suggests there is a problem with either the medium or the host strain You must use GI724 as your host strain otherwise regulation of gene expression with tryptophan will not occur Overview Important Description of Process Flow Chart of Experimental Process Methods Because of the nature of
36. s and plate out more of the transformation mix Let all the liquid absorb invert and incubate at 30 C overnight Proceed to Analysis of Transformants page 11 Continued on next page Transformation continued Electroporation Transformation Analysis of Transformants RECO 7 w N Non Remove the appropriate number of microcentrifuge tubes of GI724 electrocompetent cells from the 70 C freezer and thaw on ice Chill electroporation cuvettes on ice Set up your electroporation device for electroporation of bacteria using the manufacturer s instructions Add 1 2 ul of a ligation reaction to a tube containing 50 ul competent cells Repeat for all ligation reactions For the control reactions add 1 ul 10 ng of each supercoiled plasmid pLEX and or pLEX LacZ to a separate tube of 50 ul competent cells Incubate all tubes on ice for 1 2 minutes Take one sample at a time and transfer the cell DNA mix to an electroporation cuvette Place the cuvette in the chamber and discharge the electrical pulse Remove cuvette and immediately add 800 ul room temperature SOC medium and transfer using a sterile glass pipette to a 15 ml snap cap polypropylene tube Falcon 2059 or similar Place on ice Repeat steps 4 6 until all samples have been transferred to 15 ml tubes Incubate all tubes with shaking 200 225 rpm at 37 C for 45 minutes Incubation at 37 C does not cause rearrangements or deletions in the plasmid f
37. sh microcentrifuge tubes Keep all samples supernatants and cell pellets on ice 6 Resuspend the pellets from Step 5 in 500 ul TE Buffer pH 7 5 Keep on ice You now have two samples per time point a soluble fraction supernatant and an insoluble fraction resuspended pellet 1 Ina fresh microcentrifuge tube take 10 ul from the supernatant fraction and mix with 10 ul of any SDS PAGE sample buffer Likewise take 10 ul of the resuspended pellet and mix with 10 ul SDS PAGE sample buffer 2 Boil samples for 5 minutes and load onto an SDS PAGE gel with molecular weight standards Process and develop the gel as described for the procedure you are using 3 Compare pellets with supernatants for each time point to determine the extent of expression and the solubility of the recombinant protein This method will allow you to quickly determine if your protein is expressed however you will not be able to determine if the protein is soluble or insoluble Resuspend cell pellets from Growth and Induction of Cells page 14 in 1X SDS PAGE Sample Buffer boil for 5 minutes and load 10 20 ul onto an SDS PAGE gel Be sure to resuspend the cell pellets in a volume of sample buffer which is proportional to the ODs59 This will insure that approximately the same amount of protein will be loaded for each sample At the zero time point of induction there should be very little protein expressed At successive time points postinduction you s
38. tab cells and Vectors Name Supplied as Storage pLEX 20 ug supercoiled lyophilized 20 C pLEX LacZ 20 ug supercoiled lyophilized 20 C GI724 a stab room temperature Genotype of GI724 F A lacl4 lacPL8 ampC P cl mcrA merB INV rnnD rnnE This strain is included for growth of pLEX and optimal expression from the P promoter This strain contains the cl repressor under control of the trp promoter Mieschendahl et al 1986 Media Reagents Name Amount Storage RM Base Media 2 pouches room temperature away from moisture RM Agar Base Media 1 pouch room temperature away from moisture Induction Base Media 2 pouches room temperature away from moisture Tryptophan Solution 5 ml 10 mg ml sterile room temperature protect from light each pouch contains reagents to prepare liter of medium Primers Both primers are supplied lyophilized and should be stored at 20 C Sequencing Sequence Amount Primer pLEX Forward 5 GGTGACGCTCTTAAAAATTAAGCC 3 2 ug 0 25 nmole AspA Reverse 5 TGTAAAACGACGGCCAGTGC 3 2 ug 0 30 nmoles Important Information continued Location of The table shows where the two primers bind on the pLEX vector supplied in this kit To Primers see where these primers bind relative to the multiple cloning site please see page 8 Primer Binding site on pLEX pLEX Forward 2222 2245 AspA Reverse 2507 24
39. te The complete sequence of pLEX is available for downloading from our Web site www invitrogen com or by contacting Technical Service page 30 I kE gt z x x x SESS RPMS EERE FLESH Z ZXNQOUQUAUA UxNO zx0D00 Transcription Termination These enzymes have two Comments for pLEX recognition sites both of which are 2886 nucleotides found in the multiple cloning site Ampicillin Resistance Gene bases 201 1061 pUC origin bases 1206 1879 35 Region of P Promoter bases 2159 2164 10 Region of P Promoter bases 2182 2187 pLEX Forward Primer Binding Site bases 2222 2245 Lambda cII Ribosome Binding Site bases 2291 2294 Lambda clI Initiation ATG bases 2306 2308 Multiple Cloning Site bases 2303 2413 aspA Transcription Terminator bases 2414 2480 AspA Reverse Primer Binding Site bases 2507 2488 Continued on next page Vectors continued Map of pLEX LacZ Use as a Control The gene for B galactosidase acZ was cloned into pLEX to make the pLEX LacZ control vector It expresses P galactosidase 117 kD from the P promoter and serves as a positive control for expression The acZ gene was cloned as a BamH I Pst I fragment in frame with the lambda clI initiation ATG galactosidase is expressed as a fusion protein to a seven amino acid N terminal leader peptide This does not appear to affect activity of B galactosidase The complete sequence of pLEX LacZ is available for d
40. temperature 50 ml of sterile 10 glycerol 1 5 liter of sterile water Store at 4 C 2 Inoculate the 50 ml of LB medium in a 250 ml culture flask with a single colony from the LB plate and incubate at 37 C with shaking 200 225 rpm for 12 16 hours overnight Continued on next page 25 Electrocompetent Cells continued Growing the Cells Day 3 Harvesting and Washing the Cells Day 3 Aliquoting and Storage of Cells Day 3 26 1 For each cell preparation prechill on ice or at 4 C Two sterile 500 ml centrifuge bottles Two sterile 50 ml centrifuge tubes Two sterile 25 ml pipettes One sterile 5 ml pipette 2 Inoculate 1 liter of LB medium in a 2 liter or 4 liter flask with the 50 ml overnight culture Grow the 1 liter culture in shaking incubator 200 225 rpm at 37 C until the ODsso is between 0 5 and 0 6 approximately 2 3 hours 3 Transfer the liter culture to the two chilled sterile 500 ml centrifuge bottles and incubate on ice for 30 minutes 1 Centrifuge the cultures at 2000 x g for 15 minutes at 0 4 C Keep the cell pellet and decant the broth Place bottles back on ice 2 Resuspend the cell pellet in each bottle in approximately 500 ml of cold 0 4 C sterile water 3 Centrifuge cells at 2000 x g for 15 minutes at 0 4 C Keep the pellet and decant the water Place bottles back on ice 4 Resuspend the cells in each bottle in approximately 250 ml of cold 0 4 C sterile water
41. tides Important Troubleshooting 12 need to estimate the number of nmoles We have provided this information for each of the oligonucleotides in this kit see page iv However for your convenience we have included a method for estimating the molecular weight of any oligonucleotide and determining the number of nmoles To estimate the number of nmoles of an oligonucleotide assume that each nucleotide in the oligo has an average molecular weight of 330 g mole Multiply by the number of nucleotides in the oligonucleotide This will give you the approximate molecular weight of the oligonucleotide To determine the number of nmoles take the weight in grams and divide by the molecular weight For example the pLEX Forward Primer is 24 nucleotides and we supply 2 ug 24 330 g mole 7 920 g mole Then 2x 10 0 25 nmoles g 7920 g mole Constructs based on pLEX must always be propagated in GI724 in RM medium plus 100 ug ml ampicillin and grown at 30 C Other E coli strains are not suitable for use with pLEX Do not use LB medium with plasmid containing GI724 If plasmid yield is low try growing the cells longer to increase cell density If you get plasmid deletions or rearrangements make sure you are transforming into GI724 Remember to always grow at 30 C and use RM medium with ampicillin If isolating plasmid by alkaline lysis be sure to extract with phenol chloroform to remove exonucleases This will increase the sta
42. transcription regulation with this system cells containing plasmids CANNOT be grown in LB medium or at temperatures above 30 C LB medium contains large amounts of tryptophan which allows transcription from the PL promoter Also growing above 30 C except when inducing will cause some low level transcription through the PL promoter This may cause plasmid rearrangements or deletions Cells without plasmid can be grown using LB medium at 37 C The table below outlines the general steps of constructing and expressing a recombinant protein using the P Expression System Step Action 1 Ligate the gene of interest in frame with the initiation ATG in pLEX and transform the ligation product into GI724 competent cells 2 Select ampicillin resistant transformants and analyze the plasmid DNA by restriction mapping or sequencing for the presence orientation and reading frame of the gene of interest 3 Grow the desired clones and induce for expression of the recombinant protein Analyze expression of the recombinant protein by SDS PAGE gels 4 Optimize growth and induction conditions to maximize the amount of your recombinant protein Ligate Gene Giv24 of Interest into pLEX Transform Cells Y Perform Optimize Restriction Growth of Cells amp Desired C Analysis or and Expression of Clone Sequence Recombinant Protein AO y Amp Transformants Continue
43. ution The insoluble protein will pellet with the unbroken cells and cell debris during the low speed centrifugation of your cell lysate If you do not detect soluble recombinant protein in the supernatant check the pellet for the presence of your protein If your protein is insoluble try the following 1 Solubilize the inclusion bodies with guanidinium chloride or urea and then slowly dialyze against a low ionic strength buffer to refold the protein Techniques for solubilization and refolding of insoluble proteins are described in Chapter 20 of Deutscher 1990 Use the His Patch ThioFusion Expression System Catalog no K360 01 from Invitrogen to produce soluble recombinant protein The His Patch ThioFusion Expression System allows fusion of the heterologous protein to the highly soluble protein thioredoxin Fusion to thioredoxin increases the likelihood of isolating a soluble form of your heterologous protein Digestion with enterokinase will release your native protein from thioredoxin Note that the His Patch ThioFusion Expression System uses the Prr promoter which may not be as tightly regulated as the PL promoter Once you have optimized the time of induction for your protein you can scale up your culture conditions for purification of your protein Bollag and Edelstein 1991 and Deutscher 1990 are very good references for protein purification techniques Recipes Introduction Stock Solutions for RM Medium and R
44. vable or sterile 250 or 500 ml centrifuge bottles e UV Vis Spectrophotometer e Polyacrylamide gel apparatus e Sonicator with microtip Important Information continued Product The pLEX and pLEX LacZ vectors are qualified by restriction digest Restriction digests Qualification must demonstrate the correct banding pattern when electrophoresed on an agarose gel The table below lists the restriction enzymes used to digest the vector and the expected vi fragments Vector Restriction Enzyme Expected Fragments bp pLEX BamHI 2886 Cla 1 uncut Not I 2886 Sac I 2886 Bell 1120 1766 pLEX LacZ BamHI 5869 Cla I 5869 Not I uncut Sac I 1948 3921 Bell 1020 1120 1608 2121 Overview Description Regulation of Expression Introduction The prokaryotic P Expression System Catalog No K450 01 allows expression of heterologous proteins in E coli Foreign genes inserted into the multiple cloning site of the vector pLEX are tightly regulated by a tryptophan inducible expression system utilizing the strong PL promoter from bacteriophage lambda Buell and Panayotos 1986 LaVallie et al 1993 This system is especially useful for the expression of potentially toxic proteins in E coli In addition the P promoter provides high level expression of recombinant proteins This means that even if the recombinant protein in question is toxic significant amounts may be produced before the host
Download Pdf Manuals
Related Search