Home

TruSeq Stranded mRNA Sample Preparation Guide 15031047 E

1. TruSeq Stranded mRNA Sample Preparation Guide 47 g Jajdeyo High Sample HS Protocol Introduction This chapter describes the TruSeq Stranded mRNA Sample Preparation HS protocol Illumina recommends the following kit sample number and protocol combinations Table 7 Kit and Sample Number Recommendations 48 Number of Samples Recommended Processed Kit At One Time lt 24 ET 24 48 Eron HI gt 48 HT Table 8 Kit and Protocol Recommendations Kit Number of Number of Samples Protocol Samples Supported per Kit Pra LT 48 lt 48 LS gt 48 HS HT 96 lt 24 LS gt 24 HS Follow the protocol in the order described using the specified volumes and incubation parameters Before proceeding review the following Best Practices See Additional Resources on page 9 for information on how to access TruSeq Stranded mRNA Sample Preparation Best Practices on the Illumina website TruSeq Sample Preparation Pooling Guide part 15042173 See Additional Resources on page 9 for information on how to download the guide from the lumina website Part 15031047 Rev E Appendix A Supporting Information To confirm your kit contents and make sure that you have obtained all of the requisite equipment and consumables for the HS protocol TruSeq Stranded mRNA Sample Preparation Guide A 9 UOIJONPOJJUJ High Sample HS Protocol Sample Prep Workflow DO The following illustrates the processes of the TruSeq Stranded mRNA Sample Pr
2. 96 Samples Box 2 of 2 Store as specified This box is shipped on dry ice As soon as you receive it store the components as specified Part 15031047 Rev E Figure 21 TruSeq Stranded mRNA HT Sample Prep Kit 96 Samples Box 2 of 2 part 15032623 Slot Reagent Part Description Storage Temperature 15026779 Bead Binding Buffer 2 C to 8 C 15026780 Elution Buffer 2 C to 8 C 15012925 Bead Washing Buffer 2 C to 8 C 15032067 Fragment Prime Finish Mix 15 C to 25 C TruSeq Stranded mRNA Sample Preparation Guide Q Q SJU9JUOD IM Consumables and Equipment Check to make sure that you have all of the necessary user supplied consumables and equipment before starting the TruSeq Stranded mRNA Sample Preparation protocol The requirement for some supplies is dependent upon the protocol performed LS or HS and these items are specified in separate tables Table 12 User Supplied Consumables Supporting Information Consumable Supplier 1 5 ml RNase DNase free Life Technologies non sticky tubes part H AM12450 10 ul barrier pipette tips General lab supplier 10 ul multichannel pipettes General lab supplier 10 ul single channel pipettes General lab supplier 1000 ul barrier pipette tips General lab supplier 1000 ul multichannel pipettes General lab supplier 1000 ul single channel pipettes General lab supplier 200 ul barrier pipette tips General lab supplier 200 ul multichannel pipettes General lab supplier
3. Part 15031047 Rev E RNA Input Recommendations It is important to follow the TruSeq Stranded mRNA Sample Preparation input recommendations Total RNA Input This protocol is optimized for 0 1 4 ug of total RNA Lower amounts might result in inefficient ligation and low yield The protocol has been tested using 0 1 10 ug of high quality universal human reference total RNA as input Use of RNA from other species tissues or qualities might require further optimization regarding the initial input amount The protocol recommends diluting the in line controls for tracking the steps involved in converting dsDNA into libraries The dilution is optimized for 0 1 4 ug of high quality input RNA When using less RNA or RNA with very low mRNA content these controls might need further dilution If no controls are added use Resuspension Buffer in place of the controls in the protocol It is important to know the quality of the RNA starting material The fragmentation conditions were optimized for high quality RNA Illumina does not recommend the use of low quality or degraded RNA with this protocol Use of degraded RNA can result in low yield over representation of the 3 ends of the RNA molecules or failure of the protocol Illumina recommends that you check total RNA integrity following isolation using an Agilent Technologies 2100 Bioanalyzer for samples with an RNA Integrity Number RIN value gt 8 RNA that has DNA contamination results in an
4. b Shake the CCP plate on a microplate shaker at 1800 rpm for 2 minutes Incubate the CCP plate at room temperature for 2 minutes Centrifuge the CCP plate to 280 x g for 1 minute Remove the adhesive seal from the CCP plate Place the CCP plate on the magnetic stand at room temperature for 5 minutes Transfer 15 ul supernatant ds cDNA from the CCP plate to the new MIDI plate labeled with the ALP barcode SAFE STOPPING POINT If you do not plan to proceed immediately to Adenylate 3 Ends on page 65 you can safely d stop the protocol here If vou are stopping seal the ALP plate with a Microseal B adhesive seal and store at 15 C to 25 C for up to seven days Part 15031047 Rev E Adenylate 3 Ends A single A nucleotide is added to the 3 ends of the blunt fragments to prevent them from ligating to one another during the adapter ligation reaction A corresponding single T nucleotide on the 3 end of the adapter provides a complementary overhang for ligating the adapter to the fragment This strategy ensures a low rate of chimera concatenated template formation Consumables Item Quantity Storage Optional A Tailing Control 1 tube per 48 15 C to 25 C CTA reactions A Tailing Mix ATL 1 tube per 48 15 C to 25 C reactions Resuspension Buffer RSB 1 tube 2 C to 8 C Ice As needed to place a 15 E to 25 C plate on Microseal B Adhesive Seal 1 15 C to 30 C RNase DNase free Eight T
5. 200 ul single channel pipettes General lab supplier 96 well storage plates round well Fisher Scientific 0 8 ml MIDI plate part H AB 0859 96 well 2 ml deep well plates Optional to aliquot reagents Agencourt AMPure XP 60 ml kit Thomson Instrument Company part 951652 Beckman Coulter Genomics part A63881 Part 15031047 Rev E Consumable Certified low range ultra agarose Optional to determine input RNA integrity Ethanol 200 proof absolute for molecular biology 500 ml Microseal B adhesive seals Nuclease free ultra pure water RNaseZap to decontaminate surfaces RNase DNase free eight tube strips and caps RNase DNase free multichannel reagent reservoirs disposable SuperScript II Reverse Transcriptase Tris HCI 10 mM pH8 5 Tween 20 Supplier Bio Rad part 161 3107 Sigma Aldrich part E7023 Bio Rad part MSB 1001 General lab supplier General lab supplier General lab supplier VWR part 89094 658 Invitrogen part 18064 014 General lab supplier Sigma part P7949 Table 13 User Supplied Consumables Additional Items for LS Processing Consumable Supplier 96 well 0 3 ml PCR plates General lab supplier Table 14 User Supplied Consumables Additional Items for HS Processing Consumable Supplier Microseal 96 well PCR plates Bio Rad part HSP 9601 HSP plate Microseal A film Bio Rad part MSA 5001 TruSeq Stranded mRNA Sam
6. a Choose the pre heat lid option and set to 100 C b 25 C for 10 minutes c 42 C for 15 minutes d 70 C for 15 minutes e Hold at 4 C When the thermal cycler reaches 4 C remove the CDP plate from the thermal cycler and proceed immediately to Synthesize Second Strand cDNA on page 61 Part 15031047 Rev E Synthesize Second Strand cDNA This process removes the RNA template and synthesizes a replacement strand incorporating dUTP in place of dTTP to generate ds cDNA The incorporation of dUTP quenches the second strand during amplification because the polymerase does not incorporate past this nucleotide AMPure XP beads are used to separate the ds cDNA from the second strand reaction mix At the end of this process you have blunt ended cDNA Consumables Item Optional End Repair Control CTE Resuspension Buffer RSB Second Strand Marking Master Mix SMM Barcode labels for e ALP Adapter Ligation Plate e CCP cDNA Clean Up Plate e IMP Insert Modification Plate 96 well MIDI Plates AMPure XP Beads Freshly Prepared 80 Ethanol EtOH Microseal B Adhesive Seals RNase DNase free Eight Tube Strips and Caps if using multichannel pipettes RNase DNase free Reagent Reservoirs if using multichannel pipettes TruSeq Stranded mRNA Sample Preparation Guide Quantity 1 tube per 48 reactions 1 tube 1 tube per 48 reactions 1 label per plate 2 90 ul per sample 400 u
7. for the final pool 3 Mix the PDP plate as follows a Seal the PDP plate with a Microseal B adhesive seal b Shake the PDP plate on a microplate shaker at 1800 rpm for 2 minutes 4 Centrifuge the PDP plate to 280 x g for 1 minute 5 Do one of the following Proceed to cluster generation For more information see the cluster generation section of the user guide for your Illumina platform Store the sealed PDP plate at 15 C to 25 C TruSeq Stranded mRNA Sample Preparation Guide 8 5 S9IBJQI OOd pue SZIJEULMON 86 Part 15031047 Rev E Supporting Information IOTFOUCION EEN 88 ACKONYIMS is e e ii cis 89 A 91 Consumables and Equipment Lez nn 100 Indexed Adapter Sequences 103 cnr IDDA px lt KN TruSeq Stranded mRNA Sample Preparation Guide 87 y xipuaddvy Supporting Information Introduction The protocols described in this guide assume that you have reviewed the contents of this appendix confirmed your kit contents and obtained all of the requisite consumables and equipment 8 8 Part 15031047 Rev E Acronyms Table 10 Table 9 TruSeq Stranded mRNA Sample Preparation Acronyms Acronym Definition ALP Adapter Ligation Plate BBB Bead Binding Buffer Clean Up ALP Plate Complementary DNA Clean Up PCR Plate End Repair Control DCT Diluted Cluster Template ELB Elution Buffer FPF Fragment Prime Finish Mix TruSeq Stranded mRNA Sample Preparation Guid
8. performed with a PCR Primer Cocktail that anneals to the ends of the adapters Minimize the number of PCR cycles to avoid skewing the representation of the library jaw NOTE PCR enriches for fragments that have adapters ligated on both ends Fragments with only one or no adapters on their ends are by products of inefficiencies in the ligation reaction Neither species can be used to make clusters Fragments without any adapters cannot hybridize to surface bound primers in the flow cell Fragments with an adapter on only one end can hybridize to surface bound primers but cannot form clusters Consumables Item PCR Master Mix PMM PCR Primer Cocktail PPC Resuspension Buffer RSB Barcode labels for e CPP Clean Up PCR Plate barcode label e TSP1 Target Sample Plate barcode label 96 well HSP Plate 96 well MIDI Plate AMPure XP Beads Freshly Prepared 80 Ethanol EtOH Quantity 1 tube per 48 reactions 1 tube per 48 reactions 1 tube 1 label per plate l 1 50 ul per sample 400 ul per sample Storage 15 C to 25 C 15 C to 25 C 2 C to 8 C IBC me SE 15 C to 30 C IS C Ge SOC 2 C to 8 C IPE w E Supplied By Ilumina Illumina Illumina Illumina User User User User Part 15031047 Rev E Item Quantity Storage Supplied By Microseal A Film 1 15 C to 30 C User Microseal B Adhesive Seals 3 AS O SAS User RNase DNase free Eight Tube 5 15 C t
9. 0223859 Belgium 0800 81102 Norway 800 16836 Denmark 80882346 Spain 900 812168 Finland 0800 918363 Sweden 020790181 France 0800 911850 Switzerland 0800 563118 Germany 0800 180 8994 United Kingdom 0800 917 0041 Ireland 1 800 812949 Other countries 44 1799 534000 MSDSs Material safetv data sheets MSDSs are available on the Illumina website at www illumina com msds Product Documentation Product documentation in PDF is available for download from the Illumina website Go to www illumina com support select a product then click Documentation amp Literature TruSeq Stranded mRNA Sample Preparation Guide 1 1 3 SJUEJSISSV JEdIUUDE L AAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACC SATAACAGTAACACACTTCTGTIAACCTTAAGATTACTTGT TGATCCACTGATTCAACGTACCGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGTTAACCTTAAGAT TACT TGATCCACTGATT CAACGTACCGTA FEE eee eee a A Nos te iAAAAGAAT GATAACAGTAACACACTTCTGTTAACCTTIAAGAT TACTT GATCCACTGAT TCAACGTACCGTAAAGAT TACT TGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACC SATAACAGTAACACACT TCTGTTAACCTIAAGAT TACT TGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGTTAACCT TAAGATTACTT GATCCACTGAT TCAACG TGAGACTAAATAT TAACGTT GTTAACCTIAAGAT TACT TGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT T GAGACTAAATAT TAACGTACCAT TAAGAGCT TCTGT TAACCT TAAGAT TACTT GATCCAC
10. 25 C 15 C to 25 C AC O one 15 C to 25 C IS Ge SOC Supplied By Ilumina Illumina Ilumina Ilumina Ilumina Ilumina 31 siejdepv 91661 O S Item Quantity Storage Supplied By o 96 well 0 3 ml PCR Plates 2 15 C to 30 C User L A AMPure XP Beads 92 ul per sample AC OEE User N Freshly Prepared 80 Ethanol 800 ul per sample 15 C to 30 C User J EtOH or fb Microseal B Adhesive Seals 2 ISAC Ge BOC User Q RNase DNase free Eight Tube 4 28 15 C to 30 C User Strips and Caps G if using multichannel pipettes Y RNase DNase free Reagent 4 28 15 to 30 E User Reservoirs 4 if using multichannel pipettes Preparation Remove the following from 15 C to 25 C storage and thaw them at room temperature Appropriate RNA Adapter tubes depending on the RNA Adapter Indices being used or the RAP NOTE e Review the TruSeq Sample Preparation Pooling Guide part 15042173 See Additional Resources on page 9 for information on how to download the guide from the Illumina website e When indexing libraries using adapter index tubes Ilumina recommends arranging samples that are going to be combined into a common pool in the same row Also include a common index in each column This arrangement facilitates pipetting operations when dispensing indexed adapters and pooling indexed libraries later in the protocol e When indexing libraries with the RAP arrange samples that will be pooled to
11. Add BBB to mRNA Aele RPB amel Mex and Beads and Mix Heat Incubate RNA and RPB Mixture to Rebind Beads Incubate 1X Wash with RNA and RPB Mixture BWB Discard Supernatant Add FPF 1X Wash with Heat to Elute Fragment BWB and Prime Transfer for Resuspend with ELB 1st Strand cDNA Synthesis It is important to follow this procedure exactly to be sure of reproducibility TruSeq Stranded mRNA Sample Preparation Guide 1 b VNHU JU9W EJ4 pue JJUN4 Low Sample LS Protocol 16 NOTE Allow the beads to fully pellet against the magnetic stand 5 minutes Remove the supernatant from the beads immediately while the beads are still pelleted against the magnetic stand Do not allow the pellets to dry NOTE Ilumina recommends that you use 0 14 ug of total RNA and use PCR plates with a magnetic plate stand for this process Alternatively you can start the protocol with 10 400 ng of previously isolated mRNA If you do so the mRNA must be concentrated into 5 ul or less before addition to the Fragment Prime Finish Mix Concentrate by ethanol precipitation or on a Qiagen MinElute column e If ethanol precipitation is used resuspend the pellet in 18 ul Fragment Prime Finish e If a Qiagen MinElute column is used elute the mRNA with 5 ul of molecular biology grade water and add 13 ul Fragment Prime Finish Mix The use of the MinElute column results in a loss of up to 50 of the mRNA due to the low elution volume In either case heat t
12. C Remove the adhesive seal from the RFP plate Place the RFP plate on the magnetic stand at room temperature for 5 minutes Do not remove the plate from the magnetic stand Transfer 17 ul supernatant from each well of the RFP plate to the corresponding well of the new HSP plate labeled with the CDP barcode Centrifuge the thawed First Strand Synthesis Act D Mix tube to 600 x g for 5 seconds Add 50 ul SuperScript I to the First Strand Synthesis Act D Mix tube Mix gently but thoroughly and centrifuge briefly If you are not using the entire contents of the First Strand Synthesis Act D Mix tube add SuperScript II at a ratio of 1 ul SuperScript II for each 9 ul First Strand Synthesis Act D Mix Label the First Strand Synthesis Act D Mix tube to indicate that the SuperScript II has been added TruSeq Stranded mRNA Sample Preparation Guide 5 9 VNCQO pues 18114 98ZIS UJUAS High Sample HS Protocol Add 8 ul of First Strand Synthesis Act D Mix and SuperScript Il mix to each well of the CDP plate Mix thoroughly as follows a Seal the CDP plate with a Microseal B adhesive seal b Shake the CDP plate on a microplate shaker continuously at 1 600 rpm for 20 seconds Return the First Strand Synthesis Act D Mix tube to 15 C to 25 C storage immediately after use Incubate 1 CDP 60 1 Place the sealed CDP plate on the pre programmed thermal cycler Close the lid and then select and run the Synthesize 1st Strand program
13. Hardware that was previously acquired by Purchaser Illumina warrants that Upgraded Components will conform to their Specifications for a period of 90 days from the date the Upgraded Components are installed Upgraded Components do not extend the warranty for the Hardware unless the upgrade was conducted by Illumina at Illumina s facilities in which case the upgraded Hardware shipped to Purchaser comes with a Base Hardware Warranty c Exclusions from Warranty Coverage The foregoing warranties do not apply to the extent a non conformance is due to i abuse misuse neglect negligence accident improper storage or use contrary to the Documentation or Specifications ii improper handling installation maintenance or repair other than if performed by Illumina s personnel iii unauthorized alterations iv Force Majeure events or v use with a third party s good not provided by Illumina unless the Product s Documentation or Specifications expressly state such third party s good is for use with the Product d Procedure for Warranty Coverage In order to be eligible for repair or replacement under this warranty Purchaser must i promptly contact Illumina s support department to report the non conformance ii cooperate with Illumina in confirming or diagnosing the non conformance and iii return this Product transportation charges prepaid to Illumina following Illumina s instructions or if agreed by Illumina and Purchaser grant Illumina s au
14. Resuspension Buffer Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the AMPure XP Beads from storage and let stand for at least 30 minutes to bring them to room temperature Review Best Practices for Handling Magnetic Beads See Additional Resources on page 9 for information on how to access TruSeq Stranded mRNA Sample Preparation Best Practices on the Illumina website Pre heat the microheating system 1 to 30 C Apply a CAP barcode label to a new 96 well MIDI plate Apply a PCR barcode label to a new 96 well HSP plate Add LIG 1 Do one of the following If using RNA Adapter tubes centrifuge the thawed tubes to 600 x g for 5 seconds If using a RAP Thaw the plate for 10 minutes at room temperature on the benchtop Visually inspect the wells to make sure that they all are thawed Remove the adapter plate tape seal Fi O Part 15031047 Rev E Centrifuge the plate to 280 x g for 1 minute to collect all of the adapter to the bottom of the well Remove the plastic cover Save the cover if you are not processing the entire plate at one time If it is the first time using this RAP apply the RAP barcode label to the plate Centrifuge the Ligation Control if using Ligation Control and Stop Ligation Buffer tubes to 600 x g for 5 seconds Immediately before use remove the Ligation Mix tube from 15 C to 25 C storage Remove the adhesive seal from the ALP plate Do one of the fol
15. Seal the CDP plate with a Microseal B adhesive seal and centrifuge briefly 8 Return the First Strand Synthesis Act D Mix tube to 15 C to 25 C storage immediately after use Incubate 1 CDP 1 Place the sealed CDP plate on the pre programmed thermal cycler Close the lid and then select and run the Synthesize 1st Strand program a b c d e Choose the pre heat lid option and set to 100 C 25 C for 10 minutes 42 C for 15 minutes 70 C for 15 minutes Hold at 4 C 2 When the thermal cycler reaches 4 C remove the CDP plate from the thermal cycler and proceed immediately to Synthesize Second Strand cDNA on page 24 TruSeq Stranded mRNA Sample Preparation Guide 2 3 VNCQO pues 18114 9ZISBUJUAG Low Sample LS Protocol Synthesize Second Strand cDNA This process removes the RNA template and synthesizes a replacement strand incorporating dUTP in place of dTTP to generate ds cDNA The incorporation of dUTP quenches the second strand during amplification because the polymerase does not incorporate past this nucleotide AMPure XP beads are used to separate the ds cDNA from the second strand reaction mix At the end of this process you have blunt ended cDNA Consumables Item Quantity Storage Supplied By Optional End Repair Control 1 tube per 48 15 C to 25 C Ilumina CTE reactions Resuspension Buffer RSB 1 tube PAC to E Illumina Second Strand Marking Master 1 tube per 48 15 C to 25 C Illumina Mix S
16. a new 96 well 0 3 ml PCR plate Add LIG 1 Do one of the following If using RNA Adapter tubes centrifuge the thawed tubes to 600 x g for 5 seconds If using a RAP Thaw the plate for 10 minutes at room temperature on the benchtop Visually inspect the wells to make sure that they all are thawed Remove the adapter plate tape seal TruSeq Stranded mRNA Sample Preparation Guide 3 3 Centrifuge the plate to 280 x g for 1 minute to collect all of the adapter to the bottom of the well Remove the plastic cover Save the cover if you are not processing the entire plate at one time If it is the first time using this RAP apply the RAP barcode label to the plate 2 Centrifuge the Ligation Control if using Ligation Control and Stop Ligation Buffer tubes to 600 x g for 5 seconds 3 Immediately before use remove the Ligation Mix tube from 15 C to 25 C storage 4 Remove the adhesive seal from the ALP plate D Do one of the following If using the in line control reagent Dilute the Ligation Control to 1 100 in Resuspension Buffer For example 1 ul Ligation Control 99 ul Resuspension Buffer before use Discard the diluted Ligation Control after use Add 2 5 ul of diluted Ligation Control to each well of the ALP plate If not using the in line control reagent add 2 5 ul of Resuspension Buffer to each well of the ALP plate 6 Add 2 5 ul of Ligation Mix to each well of the ALP plate Low Sample LS Protocol 7 Return the L
17. aje huspy Low Sample LS Protocol Incubate 1 ALP 1 Place the sealed ALP plate on the pre programmed thermal cycler Close the lid then select and run the ATAIL70 program a Choose the pre heat lid option and set to 100 C b 37 C for 30 minutes c 70 C for 5 minutes d Hold at 4 C 2 When the thermal cycler temperature is 4 C remove the ALP plate from the thermal cycler then proceed immediately to Ligate Adapters on page 31 3 O Part 15031047 Rev E Ligate Adapters This process ligates multiple indexing adapters to the ends of the ds cDNA preparing them for hybridization onto a flow cell Consumables Item Optional Ligation Control CTL Choose from the following depending on the kit you are using e TruSeq Stranded mRNA LT Sample Prep Kit contents e RNA Adapter Indices AR001 AR016 ARO18 AR023 ARO25 ARO27 e TruSeq Stranded mRNA HT Sample Prep Kit contents e RAP RNA Adapter Plate Ligation Mix LIG Resuspension Buffer RSB Stop Ligation Buffer STL Barcode labels for e CAP Clean Up ALP Plate e PCR Polymerase Chain Reaction Plate e RAP RNA Adapter Plate if using the HT kit TruSeq Stranded mRNA Sample Preparation Guide Quantity 1 tube per 48 reactions 1 tube of each index being used per column of 8 reactions or 1 RAP 1 tube per 48 reactions 1 tube 1 tube per 48 reactions 1 label per plate Storage 15 C to 25 C 15 C to
18. approximately 260 bp Figure 10 Example of TruSeq Stranded mRNA Sample Preparation Library Size Distribution 100 ng UHR a T T T 5 50 100 150 20 TruSeq Stranded mRNA Sample Preparation Guide 81 Heq SIEPIJEA High Sample HS Protocol 82 TruSeq Stranded mRNA Sample Preparation 260 bp PCR Product g E 3 g E 8 Part 15031047 Rev E Normalize and Pool Libraries This process describes how to prepare DNA templates for cluster generation Indexed DNA libraries are normalized to 10 nM in the DCT plate and then pooled in equal volumes in the PDP plate DNA libraries not intended for pooling are normalized to 10 nM in the DCT plate Consumables Item Barcode labels for e DCT Diluted Cluster Template e PDP Pooled DCT Plate for pooling only 96 well HSP Plate for pooling only 96 well MIDI Plate Microseal B Adhesive Seals Tris HCI 10 mM pH8 5 with 0 1 Tween 20 Preparation Quantity 1 label per plate 1 b Enough to normalize the concentration of each sample librarv to 10 nM Storage 15 C to 30 C 15 C to 30 C 15 C to 30 C 15 C to 30 C 15 C to 30 C Supplied By Ilumina Remove the TSP1 plate from 15 C to 25 C storage if it was stored at the conclusion of Clean Up PCR on page 79 Let it thaw at room temperature Centrifuge the thawed TSP1 plate to 280 x g for 1 minute Remove the adhesive seal from the thawed TSP1 p
19. in the library The PCR is performed with a PCR Primer Cocktail that anneals to the ends of the adapters Minimize the number of PCR cycles to avoid skewing the representation of the library NOTE PCR enriches for fragments that have adapters ligated on both ends Fragments with only one or no adapters on their ends are by products of inefficiencies in the ligation reaction Neither species can be used to make clusters Fragments without any adapters cannot hybridize to surface bound primers in the flow cell Fragments with an adapter on only one end can hybridize to surface bound primers but cannot form clusters Consumables Item Quantity Storage Supplied By PCR Master Mix PMM 1 tube per 48 reactions 15 C to 25 C Illumina PCR Primer Cocktail PPC 1 tube per 48 reactions 15 C to 25 C Illumina Resuspension Buffer RSB 1 tube 2 C to 8 C Ilumina TSP1 Target Sample Plate 1 label per plate 15 me Sun Ilumina Barcode Label 96 well 0 3 ml PCR Plate 1 15 C to 30 C User AMPure XP Beads 50 ul per sample PASOS User Freshly Prepared 80 400 ul per sample 15 C to 30 C User Ethanol EtOH Microseal B Adhesive Seals 2 ISE oE User RNase DNase free Eight 5 15 C to 30 C User Tube Strips and Caps if using multichannel pipettes Part 15031047 Rev E Item Quantity Storage Supplied By RNase DNase free Reagent 5 IFE ue up User Reservoirs if using multichannel pipettes Preparation Remove the PCR Master Mix and PCR P
20. nucleotide The addition of Actinomycin D to First Stand Synthesis Act D mix FSA prevents spurious DNA dependent synthesis while allowing RNA dependent synthesis improving strand specificity These cDNA fragments then have the addition of a single A base and subsequent ligation of the adapter The products are then purified and enriched with PCR to create the final cDNA library The sample preparation protocol offers Strand information on RNA transcript Library capture of both coding RNA and multiple forms of non coding RNA that are polyadenylated Reduced total assay time Optimized workflows for processing low sample LS and high sample HS numbers in parallel Compatibility with low throughput LT and high throughput HT kit configurations The TruSeq Stranded mRNA LT Sample Prep Kit contains adapter index tubes recommended for preparing and pooling 24 or fewer samples for sequencing The TruSeq Stranded mRNA HT Sample Prep Kit contains a 96 well plate with 96 uniquely indexed adapter combinations designed for manual or automated preparation of 96 uniquely indexed samples The protocol is compatible with no indexing or a lower indexing pooling level The libraries generated do not require PCR amplification to enable cluster generation although PCR is recommended in the standard protocol to robustly meet the yield requirements of most standard applications Part 15031047 Rev E Protocol Features This guide documents the sam
21. previously isolated mRNA begin the protocol at the Incubate RFP procedures e Corrected PCR Primer Cocktail part number in LT Kit Contents e Corrected kit name with 96 Sample cDNA Synthesis PCR Box e Reformatted the consumables list at the start of each procedure to a table e After initial thaw for each process that uses Resuspension Buffer added a preparation step to remove it from 2 to 8 C storage Part 4 15031047 15031047 15031047 Revision B A Date July 2012 April 2012 April 2012 Description of Change e Added TruSeq Stranded mRNA HT Sample Prep Kit content and functionality to the following sections e Usage Guidelines e Kit Contents e Indexed Adapter Sequences e Adapter Options e Pooling Guidelines e Ligate Adapters procedures e Enrich DNA Fragments procedures e Normalize and Pool Libraries procedures e Added reagent volume table toUsage Guidelines e Revised Tracking Tools documentation download information e Removed detailed Sample Sheet description from Tracking Tools e Added instructions for which assay to select when using the Illumina Experiment Manager e Corrected storage temperature for Bead Binding Buffer Bead Washing Buffer and Elution Buffer as 2 to 8 C e Specified storage temperature for Resuspension Buffer at 2 to 8 C after initial thaw e Appendix A Alternate Fragmentation Protocol clarified footnote b in Library Insert Fragmentation Time table e TruSeq Stranded mRNA
22. stand add 200 ul freshly prepared 80 EtOH to each well without disturbing the beads Incubate the PCR plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Repeat steps 7 and 8 one time for a total of two 80 EtOH washes With the PCR plate on the magnetic stand let the samples air dry at room temperature for 15 minutes and then remove the plate from the magnetic stand Add 32 5 ul Resuspension Buffer to each well of the PCR plate Gently pipette the entire volume up and down 10 times to mix thoroughly Incubate the PCR plate at room temperature for 2 minutes Place the PCR plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Transfer 30 ul supernatant from each well of the PCR plate to the corresponding well of the new 0 3 ml PCR plate labeled with the TSP1 barcode SAFESTOPPING POINT If you do not plan to proceed immediately to Validate Library on page 42 you can safely stop the protocol here If you are stopping seal the TSP1 plate with a Microseal B adhesive seal and store at 15 C to 25 C for up to 7 days TruSeq Stranded mRNA Sample Preparation Guide A s juauBe14 VNG UOUUZ Low Sample LS Protocol Validate Library Ilumina recommends performing the following procedures for quality control analysis on your sample library and quantification of the DNA library templates Quantify Libraries To achieve the highes
23. to 8 C Remove the adhesive seal from the RBP plate Place the RBP plate on the magnetic stand at room temperature for 5 minutes Remove and discard all of the supernatant from each well of the RBP plate Remove the RBP plate from the magnetic stand Wash the beads by adding 200 ul of Bead Washing Buffer in each well of the RBP plate Mix thoroughly as follows a Seal the RBP plate with a Microseal B adhesive seal b Shake the RBP plate on a microplate shaker continuously at 1000 rpm for 1 minute Store the Bead Washing Buffer tube at 2 C to 8 C Remove the adhesive seal from the RBP plate Place the RBP plate on the magnetic stand at room temperature for 5 minutes Remove and discard all of the supernatant from each well of the RBP plate The supernatant contains residual rRNA and other contaminants that were released in the first elution and did not rebind the beads Remove the RBP plate from the magnetic stand Add 19 5 ul of Fragment Prime Finish Mix to each well of the RBP plate The Fragment Prime Finish Mix contains random hexamers for RT priming and serves as the 1st strand cDNA synthesis reaction buffer Mix thoroughly as follows a Seal the RBP plate with a Microseal B adhesive seal b Shake the RBP plate on a microplate shaker continuously at 1000 rpm for 1 minute Part 15031047 Rev E 15 Remove the adhesive seal from the RBP plate 16 Transfer the entire contents from each well of the RBP plate to
24. to fragment at Incubate RFP on page 20 in this process NOTE For inserts larger than 120 200 bp with a median size of 150 bp see Appendix B Alternate Fragmentation Protocols Consumables Item Quantity Storage Supplied By Bead Binding Buffer BBB 1 tube per 48 15 C to 25 C Ilumina reactions Bead Washing Buffer BWB 1 tube per 48 SISSEtOE255E Illumina reactions Elution Buffer ELB 1 tube per 48 15 C to 25 C Ilumina reactions Fragment Prime Finish Mix 1 tube per 48 15 C to 25 C Ilumina FPF reactions Resuspension Buffer RSB 1 tube 15 C to 25 C Illumina Part 15031047 Rev E Item RNA Purification Beads RPB Barcode labels for e RBP RNA Bead Plate e RFP RNA Fragmentation Plate 96 well HSP Plate 96 well MIDI Plate Microseal B Adhesive Seals RNase DNase free Reagent Reservoirs if using multichannel pipettes RNase DNase free Eight Tube Strips and Caps if using multichannel pipettes Preparation Quantity 1 tube per 48 reactions 1 label per plate Storage AC ma BAC 15 C to 30 C IS me SUE 15 C to 30 C IC me Oe 15 C to 30 C ISS me 20 Supplied By Illumina Illumina User User User User User Remove the following from 15 C to 25 C storage and thaw them at room temperature Bead Binding Buffer Bead Washing Buffer Elution Buffer Fragment Prime Finish Mix Resuspension Buffer law NOTE The Resuspension Buffer can be store
25. underestimation of the amount of RNA used Illumina recommends including a DNase step with the RNA isolation method However contaminant DNA is removed during mRNA purification 1 TruSeq Stranded mRNA Sample Preparation Guide 5 SUOITEPUSLULUOD9Y Indu VNH Overview The following figure shows a Universal Human Reference UHR starting RNA Bioanalyzer trace Figure 1 Starting RNA Bioanalyzer Trace Alternatively you can run a formaldehyde 1 agarose gel and judge the integrity of RNA upon staining with ethidium bromide High quality RNA shows a 285 rRNA band at 4 5 kb that should be twice the intensity of the 185 rRNA band at 1 9 kb Both kb determinations are relative to an RNA 6000 ladder The mRNA appears as a smear from 0 5 kb to 12 kb Purified mRNA Input You can also use previously isolated mRNA as starting material Use the entire fraction of mRNA purified from 0 1 ug to 4 ug of total RNA If you start with isolated mRNA follow the Illumina recommendations for isolated mRNA specified in the introduction of the Purify and Fragment mRNA procedures Begin mRNA fragmentation with Incubate RFP on page 20 for LS processing or Incubate RFP on page 57 for HS processing Positive Control Illumina recommends using Agilent Technologies Human UHR total RNA catalog 740000 as a positive control sample for this protocol 6 Part 15031047 Rev E In Line Control DNA The End Repair Control A Tailing Control and Liga
26. 0 3 ml PCR plate for pooling only if pooling lt 40 samples Microseal B Adhesive Seals Tris HCI 10 mM pH8 5 with 0 1 Tween 20 44 Quantity 1 label per plate 2 second plate for pooling only if pooling gt 40 samples 1 2 Enough to normalize the concentration of each sample library to 10nM Storage 15 C to 30 C ISAC to HOKE 15 C to 30 C JEC me 20 15 C to 30 C Supplied By Illumina User User User User Part 15031047 Rev E Preparation Remove the TSP1 plate from 15 C to 25 C storage if it was stored at the conclusion of Clean Up PCR on page 40 Let it thaw at room temperature Centrifuge the thawed TSPI plate to 280 x g for 1 minute Remove the adhesive seal from the thawed TSPI plate Apply a DCT barcode label to a new 96 well MIDI plate For pooling only Apply a PDP barcode label to a new 96 well 0 3 ml PCR plate if pooling lt 40 samples or a 96 well MIDI plate if pooling gt 40 samples Make DCT 1 Transfer 10 ul of sample library from each well of the TSP1 plate to the corresponding well of the new MIDI plate labeled with the DCT barcode 2 Normalize the concentration of sample library in each well of the DCT plate to 10 nM using Tris HCl 10 mM pH 8 5 with 0 1 Tween 20 4 NOTE Depending on the vield quantification data of each sample librarv the final volume in the DCT plate can varv from 10 400 ul 3 Gently pipette the entire normalized sample l
27. 1 RBP 54 1 Place the sealed RBP plate on the pre heated microheating system Close the lid and incubate at 65 C for 5 minutes to denature the RNA and facilitate binding of the polyA RNA to the beads Remove the RBP plate from the microheating system and place on ice for 1 minute Place the RBP plate on the bench and incubate at room temperature for 5 minutes to allow the RNA to bind to the beads Pre heat the microheating system to 80 C for the subsequent incubation Part 15031047 Rev E Wash RBP 1 Remove the adhesive seal from the RBP plate 2 Place the RBP plate on the magnetic stand at room temperature for 5 minutes to separate the polyA RNA bound beads from the solution 3 Remove and discard all of the supernatant from each well of the RBP plate 4 Remove the RBP plate from the magnetic stand 5 Wash the beads by adding 200 ul of Bead Washing Buffer in each well of the RBP plate to remove unbound RNA Mix thoroughly as follows a Seal the RBP plate with a Microseal B adhesive seal b Shake the RBP plate on a microplate shaker continuously at 1000 rpm for 1 minute Remove the adhesive seal from the RBP plate Place the RBP plate on the magnetic stand at room temperature for 5 minutes VNHU JU9WHEJ4 pue And Centrifuge the thawed Elution Buffer to 600 x g for 5 seconds OO CON ODO Remove and discard all of the supernatant from each well of the RBP plate The supernatant contains most of the ribosomal an
28. 15031047 Rev E Modify RNA Fragmentation Time To modify the fragmentation of the RNA to allow for longer RNA fragments the time of fragmentation can be shortened This can be accomplished during the Purify and Fragment mRNA procedures by modifying the thermal cycler Elution 2 Frag Prime program 94 C for X minutes followed by a 4 C hold for the thermal cycler Determine X based on the length of the desired RNA A range of suggested times and sizes is described in Table 21 Table 22 Table 21 Library Insert Fragmentation Time Time at 94 C Range of Insert Median Insert Average Final Library Size minutes Length bp Length bp Bioanalyzer bp ob 130 350 200 467 1 130 310 190 439 2 130 290 185 410 3 125 250 165 366 4 120 225 160 326 8 120 210 155 309 12 115 180 140 272 a Insert length determined after clustering and sequencing with a paired end sequencing run b Skip the Incubate RFP procedures fragmentation for samples requiring 0 minutes fragmentation time Instead place the sealed plate on the pre heated thermal cycler Close the lid and incubate the plate at 80 C for 2 minutes to elute the primed mRNA from the RNA Purification Beads Then immediately place the plate on the magnetic stand and proceed to the Synthesize First Strand cDNA process TruSeq Stranded mRNA Sample Preparation Guide 1 O 9 au UOUEIUSLUDSI YNY HPOWN Alternate Fragmentation Protocols Figure 22 Shortened Fragmentation Time Results 8 8
29. 4 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 Place the ALP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Transfer 50 ul supernatant from each well of the ALP plate to the corresponding well of the new MIDI plate labeled with the CAP barcode Take care not to disturb the beads Vortex the AMPure XP Beads until they are well dispersed Add 50 ul of mixed AMPure XP Beads to each well of the CAP plate for a second cleanup Mix thoroughly as follows a Seal the CAP plate with a Microseal B adhesive seal b Shake the CAP plate on a microplate shaker at 1800 rpm for 2 minutes Incubate the CAP plate at room temperature for 15 minutes Centrifuge the CAP plate to 280 x g for 1 minute Remove the adhesive seal from the CAP plate Place the CAP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Remove and discard 95 ul supernatant from each well of the CAP plate Take care not to disturb the beads NOTE Leave the CAP plate on the magnetic stand while performing the following 80 EtOH wash steps 27 29 With the CAP plate on the magnetic stand add 200 ul freshly prepared 80 EtOH to each well Take care not to disturb the beads Incubate the CAP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Take care not to disturb the beads Repeat steps 27 and 28
30. 6635 RNA Adapter Index 3 15026641 RNA Adapter Index 8 15026642 RNA Adapter Index 9 15026643 RNA Adapter Index 10 15026644 RNA Adapter Index 11 Resuspension Buffer Ligation Mix End Repair Control A Tailing Control Ligation Control XO CO N BD OT si WD NR Ria jaja ww N o NN Di N CO a e TruSeq Stranded mRNA Sample Preparation Guide 93 SJU9JUOD UN Supporting Information 94 48 Samples Box 1 of 2 Store as specified This box is shipped on refrigerated gel packs As soon as you receive it store the components as specified Figure 14 TruSeq Stranded mRNA LT Sample Prep Kit 48 Samples Box 1 of 2 part 15027078 Slot Reagent Part Description Storage Temperature l 15026778 RNA Purification 2 C to 8 C 2 15026766 CTEDilution Tube Room Temperature a 15026805 CTA Dilution Tube Room Temperature 4 15026807 CTL Dilution Tube Room Temperature Part 15031047 Rev E 48 Samples Box 2 of 2 Store as specified This box is shipped on dry ice As soon as you receive it store the following components as specified Figure 15 TruSeq Stranded mRNA LT Sample Prep Kit 48 Samples Box 2 of 2 part 15032614 Slot Reagent Part Description Storage Temperature 1 BWB 15012925 Bead Washing Buffer 2 C to 8 C 2 BBB 15026779 Bead Binding Buffer 2 C to 8 C 3 ELB 15026780 Elution Buffer 2 C to 8 C 4 FPF 15032067 Fragment Prime Fini
31. AE me SAS User Reservoirs ifusing multichannel pipettes SuperScript II Reverse 1 tube 15 C to 25 C User Transcriptase Y WARNING y First Strand Synthesis Act D Mix contains Actinomycin D a toxin Personal injury can occur through inhalation ingestion skin contact and eye contact Dispose of containers and any unused contents in accordance with the governmental safety standards for your region Refer to the product material safety data sheet MSDS for detailed environmental health and safety information MSDSs are available for this kit on the Illumina website at www illumina com msds Part 15031047 Rev E Preparation Make CDP Remove one tube of First Strand Synthesis Act D Mix from 15 C to 25 C storage and thaw it at room temperature Pre program the thermal cycler with the following program and save as Synthesize 1st Strand Choose the pre heat lid option and set to 100 C 25 C for 10 minutes 42 C for 15 minutes 70 C for 15 minutes Hold at 4 C Make sure that the microplate shaker is properly calibrated to 1000 rpm using a stroboscope Apply a CDP barcode label to a new 96 well HSP plate E NOTE The First Strand Synthesis Mix Act D with SuperScript II added is stable to additional freeze thaw cycles and can be used for subsequent experiments If more than six freeze thaw cycles are anticipated divide the First Strand Synthesis Mix Act D and SuperScript II mix into smaller aliquots and store at 15 C to 25
32. ATT CAACGTACCGTAACGAACGTAT CAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT GCAACGACGAAAAGAAT GATAACAGTAACACACTTCTGTTAACCTT iAAAAGAAT GATAACAGTAACACACTTCTGTTAACCT TAAGAT TACT TGATCCACTGATT CAACGTACCGTAAAGAT TACT Ti GATCCACTGAT I GAACCTACCGTAACGAACGTAT CAME GAGACTAAATALTAASGIRCCATTAN GAG TAGE CCAT TAAGAGCTACCGTGCAACAGTAACACACTTCTGT TAACCT TAAGAT TACTTGATCCACTGAT T CAACGTACCGTAACGAACGTAT CAATTGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT GCAACGACGAAAAGAAT GATAA SATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACT GAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTICTGTTAACCTTAAGAT TACTTGATCCACTGATTCAACG 2TTGATCCACTGATTCAACGT TAAGAT TACTT GATCCACT GATTCAACGTACCGTAACGAACGTATCAAT TGAGCT TCTGT TAACCTTAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT T GAGAC TAGCAACGACGi O E E ee EE GTACCGTAACGAACGTATCAT TAAGATTACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAATT GAGA Ee Oe al pI ACCGTGCAACGACGAAAAGAATGATAACAG TAACACACTTCTGTTAACCTIA STTGATCCACTGATTCAACGT TAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGCTTCTGTTAACCTTAAGAT TACT TGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT TGAGAC TAGCAACGACGi iAAAAGAAT GATAACAGTAACACACTTCTGT TAACCTTAAGAT TACTT GATCCACT GATT CAACGTACCGTAAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACC GATAACAGTAACACACTTCTGTIAACCT TAAGAT TA E ee KALE eee ENS AI IE G ATTACTT O Oe CU IG SACTGATTCAACGTACCAAGAT TACTT GATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT T GAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGI TAACCT TAAGAT TA
33. Adapter 2 Sequences 105 Table 22 Library Insert Fragmentation Time 109 Table 23 Illumina General Contact Information 2 0 0 0 LL 113 TruSeq Stranded mRNA Sample Preparation Guide KA Part 15031047 Rev E Overview RNA Input Recommendations In Line Control DNA 222 2222222 TruSeq Stranded mRNA Sample Preparation Guide e dat D ww iff a5 fi re we e jif G A A rare e e Jeer Overview Introduction This protocol explains how to convert the mRNA in total RNA into a library of template molecules of known strand origin using the reagents provided in the Ilumina TruSeq Stranded mRNA Sample Preparation Kits The library is suitable for subsequent cluster generation and DNA sequencing The first step in the workflow involves purifying the poly A containing mRNA molecules using poly T oligo attached magnetic beads Following purification the mRNA is fragmented into small pieces using divalent cations under elevated temperature The cleaved RNA fragments are copied into first strand cDNA using reverse transcriptase and random primers Strand specificity is achieved by replacing dTTP with dUTP in the Second Strand Marking Mix SMM followed by second strand cDNA synthesis using DNA Polymerase I and RNase H The incorporation of dUTP in second strand synthesis quenches the second strand during amplification because the polymerase used in the assay is not incorporated past this
34. CACACTICTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTA lee UI A AO AACG GTACCATTAAGAGCTACCGTGCAACTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT TGAGACTAAA AA E AAGGTI A a SA CTGTTAACCTIAAGATTACTIGATCCACTP ACGAAAAGAATGATAACAGTAACACACTTCTGT TAACCTT TTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATC AATGATAACAGTAACACACTICTGTTAACCTTAAG TATTOO GACTGAT ICAC ACC MACCAACOTATGAATIGAGACTA EE Ee A AATGATAACAGTAACACACTTCTGTTAACCTT TTGATCCACTGATTCAACGTACCGTAACGAA TCAATTGAGACTA ACS TAC CCT ARCSAACUTATCATIAAGATIACTGATOCAGTOATICAACGTA CO TRACCAACGIATCAATTGAGA CTAAATATT TTACTTGATGCACTGATTCAACGTTAAGATTACTTGATGCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGCTTCTGTTAAG ACGAAAAGAATGATAACAGTAACACACTTCTGTTAACCT TAAGAT TACTT GATCCACTGATT CAACGTACCGTAAAGAT TACTTGATC FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Catalog RS 122 9004DOC Part 15031047 Rev E October 2013 This document and its contents are proprietary to Illumina Inc and its affiliates Illumina and are intended solely for the contractual use of its customer in connection with the use of the product s described herein and for no other purpose This document and its contents shall not be used or distributed for any other purpose and or otherwise communicated disclosed or reproduced in any way whatsoever without the prior written consent of Illumina lumina does not convey any license under its patent trademark copyright or common law rights nor similar rights of any third p
35. CGTAAAGAT TACT TGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACG TACCATTAAGAGOTACCE e Tae AG SOC ARTO TT e E AATGATAACAGTAACACACT TCTGTTAACCTTAAGATTACTTGATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT TGAGACTAAATAT TAACGTACCAT TAAGAGC TACCGTCTTCTGTTAACCTTAAGAT TACTTGATCCACTGATTCAACGTA ITACTTGATCCACTGAT TCAACGTTAAGAT TACTT GAT CCACT GATT CAACGTACCGTAACGAACGTATCAATT GAGCT TCTGT TAACCT TAAGAT TACTT GATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT T GAGACTAGCAACGACGAA ACC G G AACGACGAAAAGAATGAT AGAGTTGTGTTAAGC MIACTTOMCCACTEATTCAACGTTAAGATTACTTGATCCACT GATTCAAGGTACCGTAACGAACGTATCAATIGAGCTICTOLL AACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAGCAACGACGAA e E A a DE AATGATAACAGTAACACACT ICTGTTAACCTTAAGATTIA A E get CTAAATATTAACGTACCAT TAAGAGCTACCGTCTTCTGTTAACCTIAAGAT TACT TGATCCACTGAT TCAACGTACCGTAA TCCACTGAT T CAACGTACCAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAATT GAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGTTAACCT TAAGAT TACTTGAT CCACTGAT TCAACGTACCGTAACGAAC KE ET EE AATGATAACAGTAACACACTTCTGTIAACCTIAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCT TAAGATTACTTGATCCACTGATTCAACGTA VAATTGAGACTAAATAT TAACGTTGTTAACCTTAAGAT TACT TGATCCACTGATTCAACGTACCGTAACGAACGTAT CAAT TGAGACTAAATATTAACGTACCATTAAGAGCT TCTGT TAACCT TAAGAT TACTT GATCCACT GAT TCAACGTACCGTAAC A A ee A G E GAGACTAAATATTAACGTACGATTAAGAGCTACAACCTTAAGA AR GE TCAATTGAGACTAAATATTAACGTACCAT TAAGAGCTACCGTGCAACGACGAAAAGAAT GA ele AATGATAACAGTAA
36. CTGTT pa A ja RE GAGCTACCGTGCAACGAAAATAACCTIAAGAT TACTTGATCCACTGATTCAACGTACTTCTGTTAACCTIAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTA CAATTGAGACTAAGO TACOGTOCAACGA CGAAAAGAATGATA ACEAAAAGAATGATAACAGIAAGACAGTIGTGT IAACCT TAAGATTACT TGATCCACTGATTCAACTACCG AAAGATTAC TGATCCAGTGAT I CAASG ACCGIAACGAACGTAT CATT GAGACIAAATATTAAGGIAGCAT TAA GAGE TACCA AATGATAACAGTAACACACTICTGTTAACCTTAAGA A a E ee CCGTAACGAACGTATCAAT TGAGACT e ANE ES eee CU CGACGAAAAGAA Mr JR GTAQCATTAAGAGCTACCGTGCAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTGAACGTAGCGTAACGAAGGTATCAATTGAGAGCTAAATATTAACGTACCAT TAAGAGCTACCGT GCAACGACGAAAAGAATGATAACA NAT OATAACAGSTAACAGAC TIONG TIAAGGTIAAGATTAC LIGATCCAGTGATI CANCG TACCO TAA GAACGTAT GANTT GAGA TAAATATTAAGGTACCATAAGHOCTASCOTCTTOTC MAACO TIAAGATIACH GATCCACTGATTCARCOTA ACGTACCGTAACGAACGTATCAT TAAGATTA Eeler EE CGAAAAGAATGA a CTICTGTTAACCTTAAC ITACTTGATCCACT DEE CGTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGIATCAATTGAGCTICTGTTAACCTTAAGATTACTTGATCCACT Ee e TCAAT TGAGACTAGCAACGACGAA ACGAAAAGAAT GATAACAGTAACACACTICTGTIAACCTTIAAGATIACTTGATCCACTGATT CAACGTACCGTAAAGATIACTTGATCCACTGAT TCAACG TACCGTAACGAACGTATCAAT TGAGACTAAATATTAACGTACCAT TAAGAGC TACCGT Nee a A a ee a NN fi TTAACGTA SCANTAAGAGCIAGCGTCTTCT GI TACK IAAGATIACT GAT CCACIGATTCAACG TA Ge ea ae ey ape E Ee ACCGTAACGAACGTAT CAAT T GAGACTAAATAT TAACGTACCAT TAAGAGC TACCGT GCAACGACGAAAAGAAT GATAACAGTAACACACT TCT GTTAACCTT ACGAAAAGAAT GATAACAGTAACACACTTCTGTTAACCT TAAGAT TACTT GAT CCACTGATTCAACGTAC
37. CTTGAT CCACTGATTCAACGTACCGTAACGA AAAAGANTGATAACAGTAAGAGAGTIGTGY IAACCLTAAGATIACT TGATCGACT GAT I CAACGTAGCG AAAGATTACT IGATSCAG TAT ICAAGGTACCGTAACGAACGIATCAAI TGAGAG TAAATATTAAUGTAGCATTAAGAGTAGC A GTTAACCTTAAGATTAGTTGATCCACTGATTGAACGTACCGTAACGAACGTATCAA He eege ER GATTACTTGATCCACTGATTCAACG TGAGACTAAATAT TAACGTTGTTAACCTTAAGAT TACT TGATCCACTGATTCAACGTACCGTAACGAACGTAT CAAT TGAGACTAAATA taj ej GCTICTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGIA ATCAATTGAGA CTAANTALT AACGTACTTAACCTIAAGAT TACT TGATCCACTGAT T CAACGTACCGTAACGAACGTCTTCTGTTAACCTTIAAGAT T KETIGMCCACIGATTCAACGT ACCGTAACGAACGTATCAAT TGAGACTAACGACGA SATAACAGTAACAGAG LT CTGLIAAGG TAAGATTACTGATGOAGTGAT GAACGIAGGGTAAGGAAGGTATCAAT TQA AQ AAATAT TAACGTACGA TAAGAGGTAGGGCT TCT GTTAAGG TANGATIACT IGATCUACT GAT IGAAGG GATAACAGTAACACACTT AACCTIAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTA TTCTG CCTTAAGATTACTTGATCCACTGA CCAT TAAGAGCTACCGTGCAACTTAACCTIAAGAT TACTT GATCCACT GAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT GCAACGACGAACTTCTGT TAACCTTAAGAT TACTT GAT 16 TAQ G TGCAACGAAAATAACCTTAAGATTACT IGATCCACTGAT ICAACGTAGTICTG TAAGGTTAAGATTACT IGATCCAGT GAL CAACGACOGTAACGAACG TAI GAAT TGAGAG TAAGO AGCGIGCAACGACGAAAAGAATCAT AAAAGAATGA Ee sea EL AACCTIAAGATTACTT SE Uy AAAGATTACTTGAT eh ACTGATTCAACGTACCGTAACGAACGTA TT GAGAC TAAATAT TAACGTACCAT TAAGAGCTACC GATAACAGTAACACACTTCTGTIAACCT TAAGAT TACT T PORT OCACTGALICAACGT AACCGTAACGAA AC
38. Documentation amp Literature on TruSeq Stranded mRNA HT Sample Prep Kit Support Enables you to create and edit appropriate sample sheets for Ilumina sequencers and analysis software and record parameters for your sample plate To download the software e Click Downloads on TruSeq Stranded mRNA LT Sample Prep Kit Support or e Click Downloads on TruSeq Stranded mRNA HT Sample Prep Kit Support To download the documentation e Click Documentation amp Literature on TruSeq Stranded mRNA LT Sample Prep Kit Support or e Click Documentation amp Literature on TruSeq Stranded mRNA HT Sample Prep Kit Support Part 15031047 Rev E Low Sample LS Protocol Introduchon cc 12 Sample Prep Workflow 00 02 22 cc cece cece cece cece cece cece cece eeeeeeeeeeteeeteeettteteteees 14 Purity and Fragment MRNA vocera dt sacada 15 Synthesize First Strand DNA 21 Synthesize Second Strand CDNA 2 00 2c eee eee cece cccccccceccccccceeeececceeceeeeeecceeees 24 Adenylate SM e coso tarso A RAS t dal 28 MENG ALS Adapter supresor e hae de eee eft ila 31 Enrich DNA Fragments 0 0000220 c cece ccc ns 38 Validate Library 42 Nomnali e and Pool Libraries 02 See ee tipa nia rocio is 44 rar Pa Lif ges y Ia S e Y ES E l a ES T age H A KE gt AA Sak j WAQA jf en A gg INS 44 a i A a WA och a zz A ma d ee ener ai ee a E ta f ane E ttl waste coscirearacasresttl ocr Esc lt ne
39. H WITHOUT LIMITATION THE SALE OF THIS PRODUCT ITS USE ILLUMINA S PERFORMANCE HEREUNDER OR ANY OF THESE TERMS AND CONDITIONS HOWEVER TruSeq Stranded mRNA Sample Preparation Guide ARISING OR CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT TORT INCLUDING NEGLIGENCE STRICT LIABILITY OR OTHERWISE ILLUMINA S TOTAL AND CUMULATIVE LIABILITY TO PURCHASER OR ANY THIRD PARTY ARISING OUT OF OR IN CONNECTION WITH THESE TERMS AND CONDITIONS INCLUDING WITHOUT LIMITATION THIS PRODUCT INCLUDING USE THEREOF AND ILLUMINA S PERFORMANCE HEREUNDER WHETHER IN CONTRACT TORT INCLUDING NEGLIGENCE STRICT LIABILITY OR OTHERWISE SHALL IN NO EVENT EXCEED THE AMOUNT PAID TO ILLUMINA FOR THIS PRODUCT Limitations on Illumina Provided Warranties TO THE EXTENT PERMITTED BY LAW AND SUBJECT TO THE EXPRESS PRODUCT WARRANTY MADE HEREIN ILLUMINA MAKES NO AND EXPRESSLY DISCLAIMS ALL WARRANTIES EXPRESS IMPLIED OR STATUTORY WITH RESPECT TO THIS PRODUCT INCLUDING WITHOUT LIMITATION ANY IMPLIED WARRANTY OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE NONINFRINGEMENT OR ARISING FROM COURSE OF PERFORMANCE DEALING USAGE OR TRADE WITHOUT LIMITING THE GENERALITY OF THE FOREGOING ILLUMINA MAKES NO CLAIM REPRESENTATION OR WARRANTY OF ANY KIND AS TO THE UTILITY OF THIS PRODUCT FOR PURCHASER S INTENDED USES Product Warranty All warranties are personal to the Purchaser and may not be transferred or assigned to a third party including an affiliat
40. LT Sample Prep Kit only e Make RFP added step to centrifuge BBB before adding to samples Initial Release Part 15031047 Rev E Table of Contents Revision History Table of Contents o oooccccccccccccccccccccccccccccccncnnnncnccco List of Tables 22000 Chapter 1 Overview ooooooccccc ccoo coc n nn cccnccccccccccccnn Introduction 2 22 Protocol Features RNA Input Recommendations In Line Control DNA Chapter 2 Low Sample LS Protocol INTOGUCTION 2 24 osc d a dise deck leu ncaa a alta ates cesa Sample Prep Workflow LL Purify and Fragment MRNA Synthesize First Strand DNA Synthesize Second Strand CDNA Adenylate 3 Ends Ligate Adapters 2 2 2 0 ieee nn Enrich DNA Fragments 2 222 e eee eee cece eee ee Validate Library Chapter 3 High Sample HS Protocol Introduction 2 2 2 eee eee nn Sample Prep Workflow Purify and Fragment MRNA Synthesize First Strand DNA Synthesize Second Strand cDNA L Adenylate 3 Ends Ligate Adapters Enrich DNA Fragments 022 2222 eee cece ee eee eee ee Validate Library Normalize and Pool Libraries Appendix A Supporting Information ooo TruSeq Stranded mRNA Sample Preparation Guide troduction EE 88 A A O Sant te dura BA Sr ti 89 Kit Gontentsi ii i a a Ne 91 Consumables and Equipment 6 100 Indexed Adapter Sequences 103 Appendix B Alternate Fragmenta
41. MM reactions ALP Adapter Ligation Plate 1 label per plate IEC me SOE Illumina Barcode Label 96 well 0 3 ml PCR Plate 1 15 C to 30 C User AMPure XP Beads 90 ul per sample NC O AC User Freshly Prepared 80 Ethanol 400 ul per sample 15 C to 30 C User EtOH Microseal B Adhesive Seals 2 AC me SUE User RNase DNase free Eight Tube 5 15 C to 30 C User Strips and Caps if using multichannel pipettes RNase DNase free Reagent 5 ISS me SOXE User Reservoirs if using multichannel pipettes D A Part 15031047 Rev E Preparation Remove the following from 15 C to 25 C storage and thaw them at room temperature End Repair Control ley NOTE The use of the End Repair Control is optional and it can be replaced with the same volume of Resuspension Buffer Second Strand Marking Master Mix Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the AMPure XP beads from storage and let stand for at least 30 minutes to bring them to room temperature Review Best Practices for Handling Magnetic Beads See Additional Resources on page 9 for information on how to access TruSeq Stranded mRNA Sample Preparation Best Practices on the Illumina website Pre heat the thermal cycler to 16 C Choose the thermal cycler pre heat lid option and set to 30 C Apply an ALP barcode label to a new 96 well 0 3 ml PCR plate Add SMM 1 Remove the adhesive seal from the CDP plate 2 Do one of the following If u
42. Mex and Beads and Mix Heat Incubate RNA and RPB Mixture to Rebind Beads Incubate 1X Wash with RNA and RPB Mixture BWB Discard Supernatant Add FPF 1X Wash with Heat to Elute Fragment BWB and Prime Transfer for Resuspend with ELB 1st Strand cDNA Synthesis It is important to follow this procedure exactly to be sure of reproducibility TruSeq Stranded mRNA Sample Preparation Guide BI VNHU JU9W EJ4 pue JJUN4 High Sample HS Protocol 92 NOTE Allow the beads to fully pellet against the magnetic stand 5 minutes Remove the supernatant from the beads immediately while the beads are still pelleted against the magnetic stand Do not allow the pellets to dry NOTE Ilumina recommends that you use 0 14 ug of total RNA and use PCR plates with a magnetic plate stand for this process Alternatively you can start the protocol with 10 400 ng of previously isolated mRNA If you do so the mRNA must be concentrated into 5 ul or less before addition to the Fragment Prime Finish Mix Concentrate by ethanol precipitation or on a Qiagen MinElute column e If ethanol precipitation is used resuspend the pellet in 18 ul Fragment Prime Finish e If a Qiagen MinElute column is used elute the mRNA with 5 ul of molecular biology grade water and add 13 ul Fragment Prime Finish Mix The use of the MinElute column results in loss of up to 50 of the mRNA due to the low elution volume In either case heat the mRNA in Fragment Prime Finish Mix
43. R023 ARO25 ARO27 e TruSeq Stranded mRNA HT Sample Prep Kit contents e RAP RNA Adapter Plate Ligation Mix LIG Resuspension Buffer RSB Stop Ligation Buffer STL Barcode labels for e CAP Clean Up ALP Plate e PCR Polymerase Chain Reaction Plate e RAP RNA Adapter Plate if using the HT kit Quantity 1 tube per 48 reactions 1 tube of each index being used per column of 8 reactions or 1 RAP 1 tube per 48 reactions 1 tube 1 tube per 48 reactions 1 label per plate Storage 15 C to 25 C 15 C to 25 C 15 C to 25 C AC O BAC 15 C to 25 C IPE to SOC Supplied By Illumina Illumina Ilumina Illumina Ilumina Ilumina Part 15031047 Rev E Item Quantity Storage Supplied By 96 well HSP Plate 1 15 C to 30 C User 96 well MIDI Plate 1 15 to 30 C User AMPure XP Beads 92 ul per sample 2 C to 8 C User Freshly Prepared 80 Ethanol 800 ul per sample IS e Sun User EtOH Microseal B Adhesive Seals 7 15 C to 30 C User RNase DNase free Eight Tube 4 28 ISC me SOC User Strips and Caps if using multichannel pipettes RNase DNase free Reagent 4 28 15 C to 30 C User Reservoirs if using multichannel pipettes Preparation Remove the following from 15 C to 25 C storage and thaw them at room temperature Appropriate RNA Adapter tubes depending on the RNA Adapter Indices being used or the RAP NOTE f e Review the TruSeq Samp
44. Seal the CCP plate with a Microseal B adhesive seal b Shake the CCP plate on a microplate shaker at 1800 rpm for 2 minutes 4 Incubate the CCP plate at room temperature for 15 minutes 5 Centrifuge the CCP plate to 280 x g for 1 minute 6 Remove the adhesive seal from the CCP plate 7 Place the CCP plate on the magnetic stand at room temperature for 5 minutes to make sure that all of the beads are bound to the side of the wells 8 Remove and discard 135 ul supernatant from each well of the CCP plate TruSeq Stranded mRNA Sample Preparation Guide 6 3 VNQ9 pues PUOJ8S aziseyju s High Sample HS Protocol 10 11 12 13 14 15 16 17 18 19 64 NOTE Leave the CCP plate on the magnetic stand while performing the following 80 EtOH wash steps 9 11 With the CCP plate on the magnetic stand add 200 ul freshly prepared 80 EtOH to each well without disturbing the beads Incubate the CCP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Repeat steps 9 and 10 one time for a total of two 80 EtOH washes Let the CCP plate stand at room temperature for 15 minutes to dry and then remove the plate from the magnetic stand Centrifuge the thawed room temperature Resuspension Buffer to 600 x g for 5 seconds Add 17 5 ul Resuspension Buffer to each well of the CCP plate Mix thoroughly as follows a Seal the CCP plate with a Microseal B adhesive seal
45. TA TCAAT TGAGACTAAATATTAACGT AC CATAAGAGCTACCGTOGAA AOGA CEAMAAGAA GA TAACAGTAACACACTICTGT1 CCATTAAGAGCTACEGT GU AACAGTAACAGACTTCTGT IAACCT TAAGATTACT GATCCAG AN CAAGGTAGUS IAACGAACG IAT CAAT GAGAG TAAAIAT TAACGTACGAI TAAGAGCTACCG I GCAACGACGAAAGAAT SATAN GATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT T GAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCT AAGATT BOT GAT AG ant OS GTACCGT AACOMACOT ATCATTAAGATTACTTGATCCACTGATT CAACGTACCGTAACGAACGTAT CAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTGCAACGA OGRAAAGNA GAT TAACAGTAACACACTTCTGTTAACCT T STTGATOGAGT GAIT GAACG TAAGATTACTTGATCCACT GATT GAACGTACCGTAACGAACGTATCAATT EE AAGATTACTIGATCCAGTGATTCAAGOTACCGTAACOAACG TA CARTTGAGACTAGGAACGACG AAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACC lllumina San Diego California 92122 U S A 1 800 809 ILMN 4566 1 858 202 4566 outside North America techsupport illumina com www illumina com
46. TGAT TCAACGTACCGTA ATCAATTGAGACTAAATAT TAACGTACTIAACCTIAAGAT TACT TGATCCACTGATT CAACGTACCGTAACGAACGTCTTCTGTTAACCTIAAGAT TACTT GATCCACTGATTCAACGTACCGTAACGAACGTAT CAAT TGAGACTAACGACGA SAC TAAATAT TAACGTACCAT TAAGAGCTACAACCT TAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGC TACCGTGCAACGACGAAAAGAAT GATAACAGTAACACA CCA CGTTAAGATTAGTTI G A TTGAGACTAAATATTAACG A AA CGAAGTTCTGTTAA AC TACCGTGCAACGAAAATAAGGCTTAAGATTACTTGATCCACTGATTGAACGTACTTCTGTTAACGTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAGCTACCGTGCAACGACGAAAAGAATGAT EE GATAACAGTAACACACTTCTGTTAACCT Td Ze TCAATTGAGAGT Fa Sara gn gg eae CGACGAAAAGAATGATAACAGTAACACACTICTGTI CCAT TAAGAGCTACCGTGCAACAGTAACACACTTCTGTTAACCTIAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATATTAACGTACCATTAAGAGCTACCGTGCAACGACGAAAAGAATGATAA GATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACG GTACCGT E ATCAATTG E TTAAGAGC TACCGTGCAACGACGAAAAGAATGATAACAGTAACACACTICTGTTAACCTTA JA a Lae CGTTAAGAT TACTTGATCCACT GATT CAACGTACCGTAACGAACGTATCAATTGAGCTTCTGTTAACCT T A AL EG TAG GS TADA TCAATTGAGACTAGCAACGACG e Je al All RE EEN Elek GTAACGAACGTATCAAT TGAGACTAAATATTAACGTACCAT TAAGAGCTACCG SATAA AQTRACACAC TTCTGTTAACCTTAAGAT TACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAA AN KAGAGC TACCGTCTTCTGTIAACCTIAAGATIACTTGA ee a STACCGTAACGAACGIA T CATTAAGAT TACTTGATCCACT G
47. a Infringement Indemnification by Illumina Subject to these terms and conditions including without limitation the Exclusions to Illumina s Indemnification Obligations Section 9 b below the Conditions to Indemnification Obligations Section 9 d below Illumina shall i defend indemnify and hold harmless Purchaser against any third party claim or action alleging that this Product when used for research use purposes in accordance with these terms and conditions and in accordance with this Product s Documentation and Specifications infringes the valid and enforceable intellectual property rights of a third party and ii pay all settlements entered into and all final judgments and costs including reasonable attorneys fees awarded against Purchaser in connection with such infringement claim If this Product or any part thereof becomes or in Illumina s opinion may become the subject of an infringement claim Illumina shall have the right at its option to A procure for Purchaser the right to continue using this Product B modify or replace this Product with a substantially equivalent non infringing substitute or C require the return of this Product and terminate the rights license and any other permissions provided to Purchaser with respect this Product and refund to Purchaser the depreciated value as shown in Purchaser s official records of the returned Product at the time of such return provided that no refund will be given for us
48. arties by this document The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order to ensure the proper and safe use of the product s described herein All of the contents of this document must be fully read and understood prior to using such product s FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY RESULT IN DAMAGE TO THE PRODUCT S INJURY TO PERSONS INCLUDING TO USERS OR OTHERS AND DAMAGE TO OTHER PROPERTY ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT S DESCRIBED HEREIN INCLUDING PARTS THEREOF OR SOFTWARE OR ANY USE OF SUCH PRODUCT S OUTSIDE THE SCOPE OF THE EXPRESS WRITTEN LICENSES OR PERMISSIONS GRANTED BY ILLUMINA IN CONNECTION WITH CUSTOMER S ACQUISITION OF SUCH PRODUCT S FOR RESEARCH USE ONLY 2012 2013 Illumina Inc All rights reserved Illumina IlluminaDx BaseSpace BeadArray BeadXpress cBot CSPro DASL DesignStudio Eco GAIIx Genetic Energy Genome Analyzer GenomeStudio GoldenGate HiScan HiSeq Infinium iSelect MiSeq Nextera NuPCR SeqMonitor Solexa TruSeq TruSight VeraCode the pumpkin orange color and the Genetic Energy streaming bases design are trademarks or registered trademarks of Illumina Inc All other brands and names contained herein are the property of their respective owners Limited Use Label License This product and its use are the s
49. as follows a Seal the CPP plate with a Microseal B adhesive seal b Shake the CPP plate on a microplate shaker at 1800 rpm for 2 minutes Incubate the CPP plate at room temperature for 15 minutes Centrifuge the CPP plate to 280 x g for 1 minute Remove the adhesive seal from the CPP plate Place the CPP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Remove and discard 95 ul supernatant from each well of the CPP plate NOTE Leave the CPP plate on the magnetic stand while performing the following 80 EtOH wash steps 10 12 With the CPP plate on the magnetic stand add 200 ul freshly prepared 80 EtOH to each well without disturbing the beads Incubate the CPP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Repeat steps 10 and 11 one time for a total of two 80 EtOH washes TruSeq Stranded mRNA Sample Preparation Guide FA 9 s juauBe14 VNG UOUUZ High Sample HS Protocol 80 13 14 15 16 17 18 19 With the CPP plate on the magnetic stand let the samples air dry at room temperature for 15 minutes and then remove the plate from the magnetic stand Add 32 5 ul Resuspension Buffer to each well of the CPP plate Mix thoroughly as follows a Seal the CPP plate with a Microseal B adhesive seal b Shake the CPP plate on a microplate shaker at 1800 rpm for 2 minutes Incubate the CPP plate at r
50. ctices on TruSeq Stranded mRNA HT Sample Prep Kit Support SOSDINOSSY JBUOHIPPV Overview Resource TruSeq Stranded mRNA Sample Preparation Low Sample Experienced User Card and Lab Tracking Form part 15031058 TruSeq Stranded mRNA Sample Preparation High Sample Experienced User Card and Lab Tracking Form part 15031057 TruSeq Sample Preparation Pooling Guide part 15042173 Illumina Experiment Manager IEM Description Provides LS protocol instructions but with less detail than what is provided in this user guide New or less experienced users are advised to follow this user guide and not the EUC and Lab Tracking Form e Click Documentation amp Literature on TruSeq Stranded mRNA LT Sample Prep Kit Support or e Click Documentation amp Literature on TruSeq Stranded mRNA HT Sample Prep Kit Support Provides HS protocol instructions but with less detail than what is provided in this user guide New or less experienced users are advised to follow this user guide and not the EUC and Lab Tracking Form e Click Documentation amp Literature on TruSeq Stranded mRNA LT Sample Prep Kit Support or e Click Documentation amp Literature on TruSeq Stranded mRNA HT Sample Prep Kit Support Provides TruSeq pooling guidelines for sample preparation Review this guide before beginning library preparation e Click Documentation amp Literature on TruSeq Stranded mRNA LT Sample Prep Kit Support or e Click
51. d at 2 C to 8 C after the initial thaw 4 NOTE After use in this procedure store the Bead Binding Buffer Bead Washing Buffer and Elution Buffer at 2 C to 8 C for subsequent experiments Remove the RNA Purification Beads tube from 2 C to 8 C storage and let stand to bring to room temperature TruSeq Stranded mRNA Sample Preparation Guide 53 VNHU JU9W EJ4 pue 4und High Sample HS Protocol Make RBP 1 Pre heat the microheating system to 65 C Pre program the thermal cycler with the following program and save as Elution 2 Frag Prime Choose the pre heat lid option and set to 100 C 94 C for 8 minutes Hold at 4 C Make sure that the microplate shaker is properly calibrated to 1000 rpm using a stroboscope Set the centrifuge to 15 C to 25 C if refrigerated Apply an RBP barcode label to a new 96 well MIDI plate Apply an RFP barcode label to a new 96 well HSP plate Dilute the total RNA with nuclease free ultra pure water to a final volume of 50 ul in the new 96 well MIDI plate labeled with the RBP barcode Vortex the room temperature RNA Purification Beads tube vigorously to resuspend the oligo dT beads Add 50 ul of RNA Purification Beads to each well of the RBP plate to bind the polyA RNA to the oligo dT magnetic beads Mix thoroughly as follows a Seal the RBP plate with a Microseal B adhesive seal b Shake the RBP plate on a microplate shaker continuously at 1000 rpm for 1 minute Incubate
52. d other non messenger RNA 10 Remove the RBP plate from the magnetic stand 11 Add 50 ul of Elution Buffer in each well of the RBP plate Mix thoroughly as follows a Seal the RBP plate with a Microseal B adhesive seal b Shake the RBP plate on a microplate shaker continuously at 1000 rpm for 1 minute 12 Store the Elution Buffer tube at 4 C Incubate 2 RBP 1 Place the sealed RBP plate on the pre heated microheating system Close the lid and incubate at 80 C for 2 minutes to elute the mRNA from the beads This releases both the mRNA and any contaminant rRNA that has bound the beads non specifically 2 Remove the RBP plate from the microheating system and place on ice for 1 minute 3 Place the RBP plate on the bench at room temperature 4 Remove the adhesive seal from the RBP plate TruSeq Stranded mRNA Sample Preparation Guide 5 5 High Sample HS Protocol Make RFP 56 o N A A se 10 11 12 13 14 Centrifuge the thawed Bead Binding Buffer to 600 x g for 5 seconds Add 50 ul of Bead Binding Buffer to each well of the RBP plate This allows mRNA to specifically rebind the beads while reducing the amount of rRNA that non specifically binds Mix thoroughly as follows a Seal the RBP plate with a Microseal B adhesive seal b Shake the RBP plate on a microplate shaker continuously at 1000 rpm for 1 minute Incubate the RBP plate at room temperature for 5 minutes and store the Bead Binding Buffer tube at 2 C
53. dexed adapter 103 104 L lab tracking form LTF 10 LIG 31 68 Low Sample LS 3 M Make CDP 22 59 Make DCT 45 84 Make PCR 40 78 Make PDP vii 46 84 111 Index 112 Make RBP 18 54 total RNA 2 Make REP 20 56 Training 9 micro plate shaker 3 Tris HCl 44 83 microheating system 3 TSP1 38 45 76 83 MIDI 3 mRNA 2 W mRNA Denaturation 18 54 Wash RBP 18 55 P workflow diagram 14 50 PCR 2 31 68 PDP 44 83 PMM 38 76 oly T magnetic beads 2 15 51 GUR 2 51 pooled sample volumes 46 85 E guidelines 10 PC 38 76 Purify CDP 26 63 Q quality control 42 81 quantify libraries 42 81 R RAP 31 68 RBP 16 53 Reagent Reservoirs 17 21 24 28 32 39 53 58 61 65 69 77 RFB 53 RNA Adapter Indices 31 68 RPB 16 53 RSB 16 24 28 31 38 52 61 65 68 76 S SAV 7 8 second strand cDNA 2 SMM 24 61 STL 31 68 stranded mRNA 2 strip tubes and caps 17 21 24 28 32 38 53 58 61 65 69 77 SuperScript II 21 58 T technical assistance 113 thermal cycler 3 Part 15031047 Rev E Technical Assistance For technical assistance contact Illumina Technical Support Table 23 Illumina General Contact Information Illumina Website www illumina com Email techsupport illumina com Table 24 Illumina Customer Support Telephone Numbers Region Contact Number Region Contact Number North America 1 800 809 4566 Italy 800 874909 Austria 0800 296575 Netherlands 0800
54. disturb the beads Incubate the CAP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Take care not to disturb the beads Repeat steps 20 and 21 one time for a total of two 80 EtOH washes With the CAP plate on the magnetic stand let the samples air dry at room temperature for 15 minutes and then remove the plate from the magnetic stand Add 22 5 ul Resuspension Buffer to each well of the CAP plate Gently pipette the entire volume up and down 10 times to mix thoroughly or until the beads are fully resuspended Incubate the CAP plate at room temperature for 2 minutes Place the CAP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Transfer 20 ul supernatant from each well of the CAP plate to the corresponding well of the new 0 3 ml PCR plate labeled with the PCR barcode Take care not to disturb the beads SAFE STOPPING POINT If you do not plan to proceed immediately to Enrich DNA Fragments on page 38 you can safely stop the protocol here If you are stopping seal the PCR plate with a Microseal B adhesive seal and store at 15 C to 25 C for up to seven days TruSeq Stranded mRNA Sample Preparation Guide 37 sjojdepv 91661 Low Sample LS Protocol Enrich DNA Fragments 38 This process uses PCR to selectively enrich those DNA fragments that have adapter molecules on both ends and to amplify the amount of DNA
55. e s UN ee y le A gt i Zorgis Ke gt TruSeq Str anded mRNA Sample Preparation Guide 1 1 GdOoJdeUQ Low Sample LS Protocol Introduction This chapter describes the TruSeq Stranded mRNA Sample Preparation LS protocol Ilumina recommends the following kit sample number and protocol combinations Table 5 Kit and Sample Number Recommendations 12 Number of Samples Recommended Processed Kit At One Time lt 24 ET 24 48 Eron HI gt 48 HT Table 6 Kit and Protocol Recommendations Kit Number of Number of Samples Protocol Samples Supported per Kit Pian l LT 48 lt 48 LS gt 48 HS HT 96 lt 24 LS gt 24 HS Follow the protocol in the order described using the specified volumes and incubation parameters Before proceeding review the following Best Practices See Additional Resources on page 9 for information on how to access TruSeq Stranded mRNA Sample Preparation Best Practices on the Illumina website TruSeq Sample Preparation Pooling Guide part 15042173 See Additional Resources on page 9 for information on how to download the guide from the lumina website Part 15031047 Rev E Appendix A Supporting Information Confirm your kit contents and make sure that you have obtained all of the requisite equipment and consumables for the ES protocol TruSeq Stranded mRNA Sample Preparation Guide 1 3 UOIJONPOJJUJ Low Sample LS Protocol Sample Prep Workflow The following illustrates the proce
56. e 8 9 sw uoIoy Supporting Information 90 Acronym HSP LIG LT PCR PMM RSB STL Definition Hardshell Plate High Throughput Ligation Mix Low Throughput Polymerase Chain Reaction PCR Master Mix RNA Adapter Plate RNA Fragmentation Plate Resuspension Buffer Stop Ligation Buffer Part 15031047 Rev E Kit Contents Check to make sure that you have all of the reagents identified in this section before starting the TruSeq Stranded mRNA Sample Preparation protocol The TruSeq Stranded mRNA LT Sample Prep Kits are available as Set A and B Each TruSeq Stranded mRNA LT Sample Prep Kit contains enough reagents to prepare up to 24 samples When used together TruSeq Stranded mRNA LT Sample Prep Kits A and B allow for pooling up to 24 samples using the 12 different indices in each kit Table 11 TruSeq Stranded mRNA Sample Preparation Kits Kit Name Catalog Number Number of of Samples Indices Supported TruSeq Stranded mRNA LT RS 122 2101 48 12 Sample Prep Kit Set A TruSeq Stranded mRNA LT RS 122 2102 48 12 Sample Prep Kit Set B TruSeq Stranded mRNA HT RS 122 2103 96 96 Sample Prep Kit TruSeg Stranded mRNA LT Sample Prep Kit The TruSeq Stranded mRNA LT Sample Prep Kit contains four boxes an A or B box Box 1 Box 2 and a cDNA Synthesis PCR box 48 Samples 12 Index Set AandB You receive either box A or B in the kit depending on the set ordered Store at 15 C to 25 C Thes
57. e End Repair Control to 1 50 in Resuspension Buffer For example 2 ul End Repair Control 98 ul Resuspension Buffer before use Discard the diluted End Repair Control after use Add 5 ul of diluted End Repair Control to each well of the CDP plate If not using the in line control reagent add 5 ul of Resuspension Buffer to each well of the CDP plate Centrifuge the thawed Second Strand Marking Master Mix to 600 x g for 5 seconds Part 15031047 Rev E 4 Add 20 ul of thawed Second Strand Marking Master Mix to each well of the CDP plate Mix thoroughly as follows a Seal the CDP plate with a Microseal B adhesive seal b Shake the CDP plate on a microplate shaker continuously at 1600 rpm for 20 seconds 5 Return the Second Strand Marking Master Mix tube to 15 C to 25 C storage after use Incubate 2 CDP 1 Place the sealed CDP plate on the pre heated thermal cycler Close the lid and incubate at 16 C for 1 hour 2 Remove the CDP plate from the thermal cycler and place it on the bench 3 Remove the adhesive seal from the CDP plate 4 Let the CDP plate stand to bring it to room temperature Purify CDP 1 Vortex the AMPure XP beads until they are well dispersed 2 Add 90 ul of well mixed AMPure XP beads to each well of the new MIDI plate labeled with the CCP barcode 3 Transfer the entire contents from each well of the CDP plate to the corresponding well of the CCP plate containing AMPure XP beads Mix thoroughly as follows a
58. e boxes are shipped on dry ice As soon as you receive your kit store the following components at 15 C to 25 C TruSeq Stranded mRNA Sample Preparation Guide Of SJU9JUOD UN Supporting Information 92 Set A Figure 12 TruSeq Stranded mRNA LT Sample Prep Kit 48 Samples 12 Index Set A part 15032612 l Slot Reagent Part Description LIG 15026773 Ligation Mix 15012495 A Tailing Mix 15012546 Stop Ligation Buffer 15024655 RNA Adapter Index 13 15024656 RNA Adapter Index 14 15024657 RNA Adapter Index 15 15024658 RNA Adapter Index 16 15024660 RNA Adapter Index 18 15024661 RNA Adapter Index 19 15026634 RNA Adapter Index 2 15026636 RNA Adapter Index 4 15026637 RNA Adapter Index 5 15026638 RNA Adapter Index 6 15026640 RNA Adapter Index 7 15026645 RNA Adapter Index 12 Resuspension Buffer End Repair Control A Tailing Control Ligation Control SYO o NIA OT BH DNA Rinaiaiala A OO NO R Rl kal Rl Re ra O N A O1 Part 15031047 Rev E Set B Figure 13 TruSeq Stranded mRNA LT Sample Prep Kit 48 Samples 12 Index Set B part 15032613 Slot Reagent Part Description ATL 15012495 A Tailing Mix Stop Ligation Buffer 15024662 RNA Adapter Index 20 15024663 RNA Adapter Index 21 15024664 RNA Adapter Index 22 15024665 RNA Adapter Index 23 15024667 RNA Adapter Index 25 15024668 RNA Adapter Index 27 15026633 RNA Adapter Index 1 1502
59. e of Purchaser All warranties are facility specific and do not transfer if the Product is moved to another facility of Purchaser unless Illumina conducts such move a Warranty for Consumables Illumina warrants that Consumables other than custom Consumables will conform to their Specifications until the later of i 3 months from the date of shipment from Illumina and ii any expiration date or the end of the shelf life pre printed on such Consumable by Illumina but in no event later than 12 months from the date of shipment With respect to custom Consumables i e Consumables made to specifications or designs made by Purchaser or provided to Illumina by or on behalf of Purchaser Illumina only warrants that the custom Consumables will be made and tested in accordance with Illumina s standard manufacturing and quality control processes Illumina makes no warranty that custom Consumables will work as intended by Purchaser or for Purchaser s intended uses b Warranty for Hardware Illumina warrants that Hardware other than Upgraded Components will conform to its Specifications for a period of 12 months after its shipment date from Illumina unless the Hardware includes Illumina provided installation in which case the warranty period begins on the date of installation or 30 days after the date it was delivered whichever occurs first Base Hardware Warranty Upgraded Components means Illumina provided components modifications or enhancements to
60. ed up or expired Consumables This Section states the entire liability of Illumina for any infringement of third party intellectual property rights Exclusions to Illumina Indemnification Obligations Illumina has no obligation to defend indemnify or hold harmless Purchaser for any Illumina Infringement Claim to the extent such infringement arises from i the use of this Product in any manner or for any purpose outside the scope of research use purposes ii the use of this Product in any manner not in accordance with its Specifications its Documentation the rights expressly granted to Purchaser hereunder or any breach by Purchaser of these terms and conditions iii the use of this Product in combination with any other products materials or services not supplied by Illumina iv the use of this Product to perform any assay or other process not supplied by Illumina or v Illumina s compliance with specifications or instructions for this Product furnished by or on behalf of Purchaser each of i v is referred to as an Excluded Claim Indemnification by Purchaser Purchaser shall defend indemnify and hold harmless Illumina its affiliates their non affiliate collaborators and development partners that contributed to the development of this Product and their respective officers directors representatives and employees against any claims liabilities damages fines penalties causes of action and losses of any and every kind includ
61. eparation HS protocol to prepare templates using 24 indexed adapter tubes or a RAP Figure 7 TruSeq Stranded mRNA Sample Preparation HS Workflow Prepare for Pooling 0 1 4 ug Total RNA Purify and Fragment mRNA Consumables BBB BWB ELB EPF RPB Water RBP RFP First Strand cDNA Synthesis Consumables FSA SuperScript Il Piate CDP Second Strand cDNA Synthesis Consumables AMPure XP Beads CTE Optional EtOH RSB SMM Piate ccp ALP Adenylate 3 Ends Consumables ATL CTA Optional RSB Plate ALP Ligate Adapters Consumables AMPure XP Beads CTL Optional EtOH UG RNA Adapters or RAP RSB STL Platos CAP PCR d PCR Amplification Consumables AMPure XP Beads EtOH PMM PPC RSB Plate CPP TSP1 i Validate Librarv Consumables Agilent DNA 1000 Kit 3 Normalize and Pool Libraries Consumables Tris HCl 10 mM w Tween 20 Plates DCT PDP indexing only Part 15031047 Rev E Purify and Fragment mRNA This process purifies the polyA containing mRNA molecules using poly T oligo attached magnetic beads using two rounds of purification During the second elution of the polyA RNA the RNA is also fragmented and primed for cDNA synthesis Reference the following diagram while performing the purification procedures Figure 8 TruSeq Stranded mRNA Sample Preparation Purification Workflow Dilute Total RNA Elute mRNA from Beads Add BBB to mRNA Aele RPB amel
62. es With the ALP plate on the magnetic stand let the samples air dry at room temperature for 15 minutes Remove the ALP plate from the magnetic stand Add 52 5 ul Resuspension Buffer to each well of the ALP plate Gently pipette the entire volume up and down 10 times to mix thoroughly or until the beads are fully resuspended Incubate the ALP plate at room temperature for 2 minutes Place the ALP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Transfer 50 ul supernatant from each well of the ALP plate to the corresponding well of the new 0 3 ml PCR plate labeled with the CAP barcode Take care not to disturb the beads Vortex the AMPure XP Beads until they are well dispersed Add 50 ul of mixed AMPure XP Beads to each well of the CAP plate for a second cleanup Gently pipette the entire volume up and down 10 times to mix thoroughly Incubate the CAP plate at room temperature for 15 minutes Place the CAP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Remove and discard 95 ul supernatant from each well of the CAP plate Take care not to disturb the beads Part 15031047 Rev E 20 21 22 23 24 25 26 27 NOTE Leave the CAP plate on the magnetic stand while performing the following 80 EtOH wash steps 20 22 With the CAP plate on the magnetic stand add 200 ul freshly prepared 80 EtOH to each well Take care not to
63. f non Illumina reagent consumables with Illumina s Hardware does not apply if the Specifications or Documentation state otherwise or g is the transfer to a third party of or sub licensing of Software or any third party software All Software whether provided separately installed on or embedded in a Product is licensed to Purchaser and not sold Except as expressly stated in this Section no right or license under any of Illumina s intellectual property rights is or are granted expressly by implication or by estoppel Purchaser is solely responsible for determining whether Purchaser has all intellectual property rights that are necessary for Purchaser s intended uses of this Product including without limitation any rights from third parties or rights to Application Specific IP Illumina makes no guarantee or warranty that purchaser s specific intended uses will not infringe the intellectual property rights of a third party or Application Specific IP 3 Regulatory This Product has not been approved cleared or licensed by the United States Food and Drug Administration or any other regulatory entity whether foreign or domestic for any specific intended use whether research commercial diagnostic or otherwise This Product is labeled For Research Use Only Purchaser must ensure it has any regulatory approvals that are necessary for Purchaser s intended uses of this Product 4 Unauthorized Uses Purchaser agrees a to use each Consumable o
64. f sequencing reads RTA reports the control sequences counts per lane in the controls tab of the RTA status html page For more information regarding the control read out in the SAV see the Sequence Analysis Viewer User Guide part 15020619 Part 15031047 Rev E Additional Resources The following resources are available for TruSeq Stranded mRNA Sample Preparation protocol guidance and sample tracking Access these and other resources on the Illumina website at support illumina com sequencing kits ilmn Then select TruSeq Stranded mRNA LT Sample Prep Kit Support or TruSeq Stranded mRNA HT Sample Prep Kit Support Resource Training Best Practices TruSeq Stranded mRNA Sample Preparation Guide Description Illustrates elements of the TruSeq Stranded mRNA Sample Preparation process Viewing these videos is recommended for new and less experienced users before starting sample preparation e Click Training on TruSeq Stranded mRNA LT Sample Prep Kit Support or e Click Training on TruSeq Stranded mRNA HT Sample Prep Kit Support Provides best practices specific to this protocol Review these best practices before starting sample preparation Topics include e Avoiding Cross Contamination e Handling RNA e Temperature Considerations e Handling Liquids e Handling Master Mix Reagents e Handling Magnetic Beads e Equipment e Click Best Practices on TruSeq Stranded mRNA LT Sample Prep Kit Support or e Click Best Pra
65. g material the controls yield approximately 0 2 of clusters although this can vary based on library yield TruSeq Stranded mRNA Sample Preparation Guide T VNC 011U09 ot tU Overview Table 4 In Line Control Functions Reagent Second Strand Marking Master Mix Second Strand Marking Master Mix A Tailing Mix Ligation Mix Function End repair Generate blunt ended fragments by 3 gt 5 exonuclease and 5 gt 3 polymerase activities End repair Add 5 phosphate groups needed for downstream ligation A tailing Make fragments compatible with adapters and prevent self ligation by adding a 3 A overhang Ligation Join 3 T overhang adapters to 3 A overhang inserts Control End Repair Control Rb End Repair Control 2 A Tailing Control Ligation Control Structure of Control DNA Ends 5 overhang at one end 3 overhang at other end Blunt with 5 OH group Blunt with 5 phosphate group Single base 3 A base overhang End Repair Control 1 and End Repair Control 2 are separate controls included in the End Repair Control reagent The control reagents can be used for various library insert sizes Each is provided in ladders ranging from approximately 150 850 bp in 100 bp increments Each control molecule has a unique DNA sequence indicating both its function and size The RTA software v1 9 and later recognizes these sequences and isolates the control sequences from the main body o
66. gether in the same orientation as the indices in the RAP 3 2 Part 15031047 Rev E law NOTE When indexing libraries with the RAP e Review Handling Adapter Plate in the TruSeq Sample Preparation Pooling Guide part 15042173 See Additional Resources on page 9 for information on how to download the guide from the Illumina website e Illumina recommends that the RAP does not undergo more than four freeze thaw cycles To maximize the use of the RAP process more than 24 samples at a time These samples can then be pooled in any supported configuration Stop Ligation Buffer NOTE Do not remove the Ligation Mix tube from 15 C to 25 C storage until instructed to do so in the procedures sjojdepv o1e6rq Ligation Control Igy NOTE The use of the Ligation Control is optional and it can be replaced with the same volume of Resuspension Buffer Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the AMPure XP Beads from storage and let stand for at least 30 minutes to bring them to room temperature Review Best Practices for Handling Magnetic Beads See Additional Resources on page 9 for information on how to access TruSeq Stranded mRNA Sample Preparation Best Practices on the Illumina website Pre heat the thermal cycler to 30 C Choose the thermal cycler pre heat lid option and set to 100 C Apply a CAP barcode label to a new 96 well 0 3 ml PCR plate Apply a PCR barcode label to
67. he PCR plate a Seal the PCR plate with a Microseal A film WARNING Follow vendor instructions for applying Microseal A sealing films Improper use could lead to inefficient sealing evaporation of sample or cross contamination or too efficient sealing parts of the seal remain in the well after removing the whole seal b Shake the PCR plate on a microplate shaker at 1600 rpm for 20 seconds 3 Centrifuge the PCR plate to 280 x g for 1 minute Amp PCR 1 Place the sealed PCR plate on the pre programmed thermal cycler Close the lid then select and run PCR to amplify the plate a Choose the pre heat lid option and set to 100 C b 98 C for 30 seconds c 15 cycles of 98 C for 10 seconds 60 C for 30 seconds 72 C for 30 seconds T 8 Part 15031047 Rev E d 72 C for 5 minutes e Hold at 4 C Clean Up PCR 1 2 3 oN A OF 10 11 12 Remove the adhesive seal from the PCR plate Vortex the AMPure XP Beads until they are well dispersed Do one of the following depending on the adapter type used If using the RNA Adapter tubes add 50 ul of the mixed AMPure XP Beads to each well of the new MIDI plate labeled with the CPP barcode If using the RAP add 47 5 ul of the mixed AMPure XP Beads to each well of the new MIDI plate labeled with the CPP barcode Transfer the entire contents from each well of the PCR plate to the corresponding well of the CPP plate containing 50 ul of mixed AMPure XP Beads Mix thoroughly
68. he mRNA in Fragment Prime Finish Mix to fragment at Incubate RFP on page 20 in this process Consumables Item Quantity Storage Supplied By Bead Binding Buffer BBB 1 tube per 48 15 C to 25 C Illumina reactions Bead Washing Buffer BWB 1 tube per 48 AAC 1 AC Illumina reactions Elution Buffer ELB 1 tube per 48 15 C to 25 C Ilumina reactions Fragment Prime Finish Mix 1 tube per 48 15 C to 25 C Ilumina FPF reactions Resuspension Buffer RSB 1 tube 15 C to 25 C Illumina RNA Purification Beads RPB 1 tube per 48 2 C to 8 C Ilumina reactions RBP RNA Bead Plate Barcode 1 label per plate 15 C to 30 C Ilumina Label Part 15031047 Rev E Item Quantity 96 well 0 3 ml PCR Plate 1 Microseal B Adhesive Seals 3 RNase DNase free Reagent 6 Reservoirs if using multichannel pipettes RNase DNase free Eight Tube 6 Strips and Caps if using multichannel pipettes Preparation Storage IAC me SOE 15 C to 30 C 15 E to 30 C 15 C to 30 C Supplied By User User User User Remove the following from 15 C to 25 C storage and thaw them at room temperature Bead Binding Buffer Bead Washing Buffer Elution Buffer Fragment Prime Finish Mix Resuspension Buffer i NOTE The Resuspension Buffer can be stored at 2 C to 8 C after the initial thaw A NOTE After use in this procedure store the Bead Binding Buffer Bead Washing Buffer and Elution Buffer at 2 C to 8 C for
69. here is no Index 17 24 or 26 e The base in parentheses indicates the base for the seventh cycle and is not considered as part of the index sequence Record the index in the sample sheet as only six bases For indices 13 and above the seventh base in parentheses might not be A which is seen in the seventh cycle of the index read e For more information on the number of cycles used to sequence the index read reference your instrument user guide TruSeq Stranded mRNA Sample Preparation Guide 1 O 3 s u nb J91depv pexepu Supporting Information Table 17 TruSeq Stranded mRNA LT Sample Prep Kit Set A Indexed Adapter Sequences Adapter Sequence Adapter Sequence AR002 CGATGT A AR013 AGTCAA C vn eem mmm AER vr men er zem vm mm mmm ene CE IC Tec E Table 18 TruSeq Stranded mRNA LT Sample Prep Kit Set B Indexed Adapter Sequences Adapter Sequence Adapter Sequence AROO1 ATCACG A ARO20 GTGGCC T Ms men mmm cO CO E vn men mn mme moo emm e zem mon nemen e mm TruSeq Stranded mRNA HT Sample Prep Kit Indexed Adapter Sequences The RAP in the TruSeq Stranded mRNA HT Sample Prep Kit contains the following indexed adapter sequences via NOTE GC The Index recorded in the sample sheet is the full 8 bases and 8 bases are sequenced per indexed read 1 04 Part 15031047 Rev E Table 19 TruSeq Stranded mRNA HT Sample Prep Kit Indexed Adapter 1 Sequences Adapter Sequence Adapter Seq
70. htfully and legally acquires this Product from Illumina or an Illumina authorized dealer Software means Illumina branded software e g Hardware operating software data analysis software All Software is licensed and not sold and may be subject to additional terms found in the Software s end user license agreement Specifications means Illumina s written specifications for this Product in effect on the date that the Product ships from Illumina 2 Research Use Only Rights Subject to these terms and conditions and unless otherwise agreed upon in writing by an officer of Illumina Purchaser is granted only a non exclusive non transferable personal non sublicensable right under Illumina s Core IP in existence on the date that this Product ships from Illumina solely to use this Product in Purchaser s facility for Purchaser s internal research purposes which includes research services provided to third parties and solely in accordance with this Products Documentation but specifically excluding any use that a would require rights or a license from Illumina to Application Specific IP b is a re use of a previously used Consumable c is the disassembling reverse engineering reverse compiling or reverse assembling of this Product d is the separation extraction or isolation of components of this Product or other unauthorized analysis of this Product e gains access to or determines the methods of operation of this Product f is the use o
71. ibrary volume up and down 10 times to mix thoroughly 4 Depending on the type of library you want to generate do one of the following For non pooled libraries the protocol stops here Do one of the following Proceed to cluster generation For more information see the cluster generation section of the user guide for your Illumina platform Seal the DCT plate with a Microseal B adhesive seal and store at 15 C to 25 C For pooled libraries proceed to Make PDP for pooling only Make PDP for pooling only NOTE Do not make a PDP plate if you are not pooling samples TruSeq Stranded mRNA Sample Preparation Guide 4 5 S9IBJQI OOd pue SZIJEULMON Low Sample LS Protocol 1 Determine the number of samples to be combined together for each pool NOTE Note the sample that is in each well to avoid pooling two samples with the same index 2 Do one of the following If pooling 2 24 samples Transfer 10 ul of each normalized sample library to be pooled from the DCT plate to one well of the new 0 3 ml PCR plate labeled with the PDP barcode The total volume in each well of the PDP plate is 10 X the number of combined sample libraries and 20 240 ul 2 24 libraries For example the volume for 2 samples is 20 ul the volume for 12 samples is 120 ul or the volume for 24 samples is 240 ul If pooling 25 96 samples Using a multichannel pipette transfer 5 ul of each normalized sample library in column 1 of the DCT plate to colum
72. igation Mix tube to 15 C to 25 C storage immediately after use 8 Do one of the following If using RNA Adapter tubes add 2 5 ul of the thawed RNA Adapter Index to each well of the ALP plate Gently pipette the entire volume up and down 10 times to mix thoroughly If using a RAP Place the RAP on the benchtop so that the part number barcode on the long side of the plate is facing you and the clipped corner is on the lower left Figure 4 Correct RAP Orientation 3 A Part 15031047 Rev E 9 Do one of the following to pierce the foil seal If using the entire plate at one time use the bottom of a clean 96 well semi skirted PCR plate to pierce a hole in all of the well seals simultaneously Gently but firmly press the clean plate over the foil seal If using only part of the plate use the bottom of a clean eight tube strip with caps attached to pierce holes in the seals of the wells that will be used for ligation Repeat with a new clean eight tube strip with caps attached for each row or column of adapters that will be used for ligation Using an eight tip multichannel pipette transfer 2 5 ul of the thawed RNA Adapter from the RAP well to each well of the ALP plate Gently pipette the entire volume up and down 10 times to mix thoroughly Seal the ALP plate with a Microseal B adhesive seal 10 Centrifuge the ALP plate to 280 x g for 1 minute Incubate 2 ALP 1 Place the sealed ALP plate on the pre heated ther
73. illumina TruSeq Stranded MRNA Sample Preparation Guide ACGAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGT AATGATAACAGTAACACACT ICTGTTAACCTTAAGATTACTTGT TGATCCACTGATT CAACGTACCGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGTTAACCTTAAGAT TACT TGATCCACTGAT TCAACGTACCGTAA Ae Cre ee REG a Te Gta CA OG AACR CGT o TAN MET eel ACCATTAAGAGCTACCGTCTICTGTT e GATTACTTGATCGACTI Y ACCGTAACGAAC AAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGAT Tr ATCCACTGATTCAACGTACCGTAAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT AAIGATAACAGAACACASTICTGITAACUT TAAGATTAGT I GATGCAGT GAT TCAAGGTAGOGTAACGAACGIATGAAT GAGAC TAAATAT TAACGTAGCAT TAAGAGCTACUGTC TCTGT IARC IAAGATIAC TGAT CCAU GAT GAACGIA AAT TGAGACTAAATATTAACGTTGTTAACCTIAAGAT TACT TGATCCACTGATTCAACGT Pa arei taf Leen VIA a TTAAGAGCT TCTGT TAACCT TAAGAT TACTT GATCCACTGAT TCAACG TACCGTAAC CGTATCAATTGAGACTAAATAT TAACGTACT TAACCTTAAGATTACTTGATCCACT GATT CAACGTACCGTAACGAACGTCTTCTGTTAACCTTAAGAT TACTTGATCCACTGAT TCAACGTACCGIAACGAACGTAT CAAT TGAGACTAACGACGAAA GAGACTAAATAT TAACGTACCAT TAAGAGCTACAACCT TAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGC TACCGT GCAACGACGAAAAGAAT GATAACAGTAACACACT E E e EE A GE e ee ee UNG a Leg E GTACCATTAAGAGCTACCGTGCAACTIAACCTTAAGA TACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCA AE CGACG TT
74. ing without limitation personal injury or death claims and infringement of a third party s intellectual property rights resulting from relating to or arising out of i Purchaser s breach of any of these terms and conditions ii Purchaser s use of this Product outside of the scope of research use purposes iii any use of this Product not in accordance with this Products Specifications or Documentation or iv any Excluded Claim Conditions to Indemnification Obligations The parties indemnification obligations are conditioned upon the party seeking indemnification i promptly notifying the other party in writing of such claim or action ii giving the other party exclusive control and authority over the defense and settlement of such claim or action iii not admitting TruSeq Stranded mRNA Sample Preparation Guide V infringement of any intellectual property right without prior written consent of the other party iv not entering into any settlement or compromise of any such claim or action without the other party s prior written consent and v providing reasonable assistance to the other party in the defense of the claim or action provided that the party reimburses the indemnified party for its reasonable out of pocket expenses incurred in providing such assistance Third Party Goods and Indemnification Illumina has no indemnification obligations with respect to any goods originating from a third party and supplied to Purchaser Third pa
75. l per sample 5 Storage 2 C to 8 C ACE UOC 15 C to 25 C ISS me HOKE 15 C to 30 C ZC O one 15 C to 30 C IS me HOKE 15 C to 30 C ISAT SOME Supplied By Ilumina Ilumina Ilumina Ilumina User User User User User User 61 VNQ9 pues puogas aziseyju s High Sample HS Protocol Preparation Add SMM 3 62 Remove the following from 15 C to 25 C storage and thaw them at room temperature End Repair Control jaw NOTE The use of the End Repair Control is optional and it can be replaced with the same volume of Resuspension Buffer Second Strand Marking Master Mix Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the AMPure XP beads from storage and let stand for at least 30 minutes to bring them to room temperature Review Best Practices for Handling Magnetic Beads See Additional Resources on page 9 for information on how to access TruSeq Stranded mRNA Sample Preparation Best Practices on the Illumina website Pre heat the thermal cycler to 16 C Choose the thermal cycler pre heat lid option and set to 30 C Apply an ALP barcode label to a new 96 well MIDI plate Apply a CCP barcode label to a new 96 well MIDI plate Remove the adhesive seal from the CDP plate Do one of the following If using the in line control reagent Centrifuge the thawed End Repair Control tube to 600 x g for 5 seconds Dilute th
76. late Apply a DCT barcode label to a new 96 well MIDI plate For pooling only Apply a PDP barcode label to a new 96 well HSP plate TruSeq Stranded mRNA Sample Preparation Guide 83 S9IBJQI OOd pue SZIJEULMON Make DCT 1 Transfer 10 ul of sample library from each well of the TSP1 plate to the corresponding well of the new MIDI plate labeled with the DCT barcode 2 Normalize the concentration of sample library in each well of the DCT plate to 10 nM using Tris HCl 10 mM pH 8 5 with 0 1 Tween 20 NOTE 4 Depending on the yield quantification data of each sample library the final volume in the DCT plate can vary from 10 400 ul 3 Mix the DCT plate as follows a Seal the DCT plate with a Microseal B adhesive seal b Shake the DCT plate on a microplate shaker at 1000 rpm for 2 minutes 4 Centrifuge the DCT plate to 280 x g for 1 minute High Sample HS Protocol 5 Remove the adhesive seal from the DCT plate 6 Depending on the type of library you want to generate do one of the following For non pooled libraries the protocol stops here Do one of the following Proceed to cluster generation For more information see the cluster generation section of the user guide for your Illumina platform Seal the DCT plate with a Microseal B adhesive seal and store at 15 C to 25 C For pooled libraries proceed to Make PDP for pooling only Make PDP for pooling only 4 NOTE Do not make a PDP plate if you are not
77. le Preparation Pooling Guide part 15042173 See Additional Resources on page 9 for information on how to download the guide from the Illumina website e When indexing libraries using adapter index tubes Ilumina recommends arranging samples that are going to be combined into a common pool in the same row Also include a common index in each column This arrangement facilitates pipetting operations when dispensing indexed adapters and pooling indexed libraries later in the protocol e When indexing libraries with the RAP arrange samples that will be pooled together in the same orientation as the indices in the RAP TruSeq Stranded mRNA Sample Preparation Guide 6 9 sjojdepv o1e6rq High Sample HS Protocol A NOTE When indexing libraries with the RAP e Review Handling Adapter Plate in the TruSeq Sample Preparation Pooling Guide part 15042173 See Additional Resources on page 9 for information on how to download the guide from the Illumina website e Illumina recommends that the RAP does not undergo more than four freeze thaw cycles To maximize the use of the RAP process more than 24 samples at a time These samples can then be pooled in any supported configuration Stop Ligation Buffer NOTE 4 Do not remove the Ligation Mix tube from 15 C to 25 C storage until instructed to do so in the procedures Ligation Control law NOTE The use of the Ligation Control is optional and it can be replaced with the same volume of
78. lowing If using the in line control reagent Dilute the Ligation Control to 1 100 in Resuspension Buffer For example 1 ul Ligation Control 99 ul Resuspension Buffer before use Discard the diluted Ligation Control after use Add 2 5 ul of diluted Ligation Control to each well of the ALP plate If not using the in line control reagent add 2 5 ul of Resuspension Buffer to each well of the ALP plate Add 2 5 ul of Ligation Mix to each well of the ALP plate Return the Ligation Mix tube to 15 C to 25 C storage immediately after use Do one of the following If using RNA Adapter tubes add 2 5 ul of the thawed RNA Adapter Index to each well of the ALP plate If using a RAP Place the RAP on the benchtop so that the part number barcode on the long side of the plate is facing you and the clipped comer is on the lower left Figure 9 Correct RAP Orientation TruSeq Stranded mRNA Sample Preparation Guide 71 siejdepv b High Sample HS Protocol Do one of the following to pierce the foil seal If using the entire plate at one time use the bottom of a clean 96 well semi skirted PCR plate to pierce a hole in all of the well seals simultaneously Gently but firmly press the clean plate over the foil seal If using only part of the plate use the bottom of a clean eight tube strip with caps attached to pierce holes in the seals of the wells that will be used for ligation Repeat with a new clean eight tube strip with cap
79. mal cycler Close the lid and incubate at 30 C for 10 minutes 2 Remove the ALP plate from the thermal cycler Add STL 1 Remove the adhesive seal from the ALP plate 2 Add 5 ul of Stop Ligation Buffer to each well of the ALP plate to inactivate the ligation Gently pipette the entire volume up and down 10 times to mix thoroughly Clean Up ALP 1 Vortex the AMPure XP Beads for at least 1 minute or until they are well dispersed 2 Add 42 ul of mixed AMPure XP Beads to each well of the ALP plate Gently pipette the entire volume up and down 10 times to mix thoroughly 3 Incubate the ALP plate at room temperature for 15 minutes 4 Place the ALP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear TruSeq Stranded mRNA Sample Preparation Guide 3 5 sjojdepv 91661 Low Sample LS Protocol 36 10 11 12 13 14 15 16 17 18 19 Remove and discard 79 5 ul supernatant from each well of the ALP plate Take care not to disturb the beads NOTE Leave the ALP plate on the magnetic stand while performing the following 80 EtOH wash steps 6 8 With the ALP plate on the magnetic stand add 200 ul freshly prepared 80 EtOH to each well without disturbing the beads Incubate the ALP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Take care not to disturb the beads Repeat steps 6 and 7 one time for a total of two 80 EtOH wash
80. mes to mix thoroughly 3 Seal the PCR plate with a Microseal B adhesive seal 1 Place the sealed PCR plate on the pre programmed thermal cycler Close the lid then select and run PCR to amplify the plate a Choose the pre heat lid option and set to 100 C b 98 C for 30 seconds c 15 cycles of 98 C for 10 seconds 60 C for 30 seconds 72 C for 30 seconds d 72 C for 5 minutes e Hold at 4 C Clean Up PCR 1 Remove the adhesive seal from the PCR plate 2 Vortex the AMPure XP Beads until they are well dispersed 3 Do one of the following depending on the adapter type used If using the RNA Adapter tubes add 50 ul of the mixed AMPure XP Beads to each well of the PCR plate containing 50 ul of the PCR amplified library Gently pipette the entire volume up and down 10 times to mix thoroughly If using the RAP add 47 5 ul of the mixed AMPure XP Beads to each well of the PCR plate containing 50 ul of the PCR amplified library Gently pipette the entire volume up and down 10 times to mix thoroughly 4 Incubate the PCR plate at room temperature for 15 minutes A O Part 15031047 Rev E 10 11 12 13 14 Place the PCR plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Remove and discard 95 ul supernatant from each well of the PCR plate NOTE Leave the PCR plate on the magnetic stand while performing the following 80 EtOH wash steps 7 9 With the PCR plate on the magnetic
81. n 1 of the new 0 3 ml PCR or MIDI plate labeled with the PDP barcode Transfer 5 ul of each normalized sample library in column 2 of the DCT plate to column 1 of the PDP plate Repeat the transfer for as many times as there are remaining columns in the DCT plate The result is a PDP plate with pooled samples in column 1 Gently pipette the entire volume of each well of column 1 up and down 10 times to mix thoroughly Combine the contents of each well of column 1 into well A2 of the PDP plate for the final pool 3 Gently pipette the entire volume up and down 10 times to mix thoroughly 4 Do one of the following Proceed to cluster generation For more information see the user guide for your Ilumina sequencer Seal the PDP plate with a Microseal B adhesive seal and store at 15 C to 25 C A 6 Part 15031047 Rev E High Sample HS Protocol Introduchon cc 48 Sample Prep Workflow llL nn nn nn nn nn n nt nn 50 Purifvvand Fra mentmhRNA stets Btw e ir B EE 51 Synthesize First Strand DNA 58 Svnthesize Second Strand CDNA 2 00 2 cece cece cece cccccceeececcccceceeccccececeeeeeeceeees 61 Adenylate MENS contornos AL tani 65 MENG ALS LOCUS re hat yr ts ne a a ea sisi 68 Enrich DNA Fragments 0 0000200 c cece ccc nos 76 Validate Library 81 Normaliz and Pool Libraries sescca SNE saba dE SE e 83 CATS TEE a ME 2 ey SS See ee Ss a ER pan gt Tr kazi wi SSG lt ia n para nc Soe E ki So
82. n s Application Specific IP excludes all Illumina owned or controlled intellectual property that cover aspects or features of this Product or use thereof that are common to this Product in all possible applications and all possible fields of use the Core IP Application Specific IP and Core IP are separate non overlapping subsets of all Illumina owned or controlled intellectual property By way of non limiting example Illumina intellectual property rights for specific diagnostic methods for specific forensic methods or for specific nucleic acid biomarkers sequences or combinations of biomarkers or sequences are examples of Application Specific IP Consumable s means Illumina branded reagents and consumable items that are intended by Illumina for use with and are to be consumed through the use of Hardware Documentation means Illumina s user manual for this Product including without limitation package inserts and any Part 15031047 Rev E other documentation that accompany this Product or that are referenced by the Product or in the packaging for the Product in effect on the date of shipment from Illumina Documentation includes this document Hardware means Illumina branded instruments accessories or peripherals Illumina means Illumina Inc or an Illumina affiliate as applicable Product means the product that this document accompanies e g Hardware Consumables or Software Purchaser is the person or entity that rig
83. nature the RNA and facilitate binding of the polyA RNA to the beads 2 Remove the RBP plate from the thermal cycler when it reaches 4 C 3 Place the RBP plate on the bench and incubate at room temperature for 5 minutes to allow the RNA to bind to the beads Wash RBP 1 Remove the adhesive seal from the RBP plate 1 8 Part 15031047 Rev E 2 Place the RBP plate on the magnetic stand at room temperature for 5 minutes to separate the polyA RNA bound beads from the solution 3 Remove and discard all of the supernatant from each well of the RBP plate 4 Remove the RBP plate from the magnetic stand 5 Wash the beads by adding 200 ul of Bead Washing Buffer in each well of the RBP plate to remove unbound RNA Gently pipette the entire volume up and down 6 times to mix thoroughly 6 Place the RBP plate on the magnetic stand at room temperature for 5 minutes 7 Centrifuge the thawed Elution Buffer to 600 x g for 5 seconds 8 Remove and discard all of the supernatant from each well of the RBP plate The supernatant contains most of the ribosomal and other non messenger RNA 9 Remove the RBP plate from the magnetic stand 10 Add 50 ul of Elution Buffer in each well of the RBP plate Gently pipette the entire volume up and down 6 times to mix thoroughly 11 Seal the RBP plate with a Microseal B adhesive seal 12 Store the Elution Buffer tube at 4 C Incubate 2 RBP 1 Place the sealed RBP plate on the pre programmed thermal cycler Cl
84. nd Synthesis Act D 1 tube per 48 Mix FSA reactions CDP cDNA Plate Barcode 1 label per plate Label 96 well 0 3 ml PCR Plate 1 Microseal B Adhesive Seal il RNase DNase free Eight Tube 1 Strips and Caps if using multichannel pipettes RNase DNase free Reagent 1 Reservoirs if using multichannel pipettes SuperScript II Reverse 1 tube Transcriptase Storage 15 C to 25 C ISAC O SAS 15 C to 30 C AE me SAS 15 C to 30 C ISAC O HOKE 15 C to 25 C Supplied By Ilumina Ilumina User User User User User a WARNING y First Strand Synthesis Act D Mix contains Actinomycin D a toxin Personal injury can occur through inhalation ingestion skin contact and eye contact Dispose of containers and any unused contents in accordance with the governmental safety standards for your region Refer to the product material safety data sheet MSDS for detailed environmental health and safety information MSDSs are available for this kit on the Illumina website at www illumina com msds TruSeq Stranded mRNA Sample Preparation Guide 21 VNS pues 18114 98ZIS UJUAS Low Sample LS Protocol Preparation Make CDP 22 Remove one tube of First Strand Synthesis Act D Mix from 15 C to 25 C storage and thaw it at room temperature Pre program the thermal cycler with the following program and save as Synthesize 1st Strand Choose the pre heat lid option and set to 100 C 25 C for 10 min
85. nd discard all of the supernatant from each well of the RBP plate The supernatant contains residual rRNA and other contaminants that were released in the first elution and did not rebind the beads Remove the RBP plate from the magnetic stand Add 19 5 ul of Fragment Prime Finish Mix to each well of the RBP plate Gently pipette the entire volume up and down 6 times to mix thoroughly The Fragment Prime Finish Mix contains random hexamers for RT priming and serves as the Ist strand cDNA synthesis reaction buffer Seal the RBP plate with a Microseal B adhesive seal Store the Fragment Prime Finish Mix tube at 15 C to 25 C Incubate RFP 20 1 Place the sealed RBP plate on the pre programmed thermal cycler Close the lid and select Elution 2 Frag Prime 94 C for 8 minutes 4 C hold to elute fragment and prime the RNA Remove the RBP plate from the thermal cycler when it reaches 4 C and centrifuge briefly Proceed immediately to Synthesize First Strand cDNA on page 21 Part 15031047 Rev E synthesize First Strand CDNA This process reverse transcribes the cleaved RNA fragments that were primed with random hexamers into first strand cDNA using reverse transcriptase and random primers The addition of Actinomycin D to the First Stand Synthesis Act D mix FSA prevents spurious DNA dependent synthesis while allowing RNA dependent synthesis improving strand specificity Consumables Item Quantity First Stra
86. nly one time and b to use only Illumina consumables reagents with Illumina Hardware The limitations in a b do not apply if the Documentation or Specifications for this Product state otherwise Purchaser agrees not to nor authorize any third party to engage in any of the following activities i disassemble reverse engineer reverse compile or reverse assemble the Product ii separate extract or isolate components of this Product or subject this Product or components thereof to any analysis not expressly authorized in this Product s Documentation iii gain access to or attempt to determine the methods of operation of this Product or iv transfer to a third party or grant a sublicense to any Software or any third party software Purchaser further agrees that the contents of and methods of operation of this Product are proprietary to Illumina and this Product contains or embodies trade secrets of Illumina The conditions and restrictions found in these terms and conditions are bargained for conditions of sale and therefore control the sale of and use of this Product by Purchaser 5 Limited Liability TO THE EXTENT PERMITTED BY LAW IN NO EVENT SHALL ILLUMINA OR ITS SUPPLIERS BE LIABLE TO PURCHASER OR ANY THIRD PARTY FOR COSTS OF PROCUREMENT OF SUBSTITUTE PRODUCTS OR SERVICES LOST PROFITS DATA OR BUSINESS OR FOR ANY INDIRECT SPECIAL INCIDENTAL EXEMPLARY CONSEQUENTIAL OR PUNITIVE DAMAGES OF ANY KIND ARISING OUT OF OR IN CONNECTION WIT
87. o 30 C User Strips and Caps if using multichannel pipettes RNase DNase free Reagent 5 E me HOKE User Reservoirs if using multichannel pipettes Preparation Remove the PCR Master Mix and PCR Primer Cocktail from 15 C to 25 C storage and thaw them at room temperature Centrifuge the thawed PCR Master Mix and PCR Primer Cocktail tubes to 600 x g for 5 seconds Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the AMPure XP Beads from 2 C to 8 C storage and let stand for at least 30 minutes to bring them to room temperature Remove the PCR plate from 15 C to 25 C storage if it was stored at the conclusion of Clean Up ALP on page 72 Let it thaw at room temperature Centrifuge the thawed PCR plate to 280 x g for 1 minute Remove the adhesive seal from the thawed PCR plate TruSeq Stranded mRNA Sample Preparation Guide T1 s juauBe14 VNG yonug High Sample HS Protocol Pre program the thermal cycler with the following program and save as PCR Choose the pre heat lid option and set to 100 C 98 C for 30 seconds 15 cycles of 98 C for 10 seconds 60 C for 30 seconds 72 C for 30 seconds 72 C for 5 minutes Hold at 4 C Apply a CPP barcode label to a new 96 well MIDI plate Apply a TSP1 barcode label to a new 96 well 0 3 ml PCR plate Make PCR 1 Add 5 ul of thawed PCR Primer Cocktail to each well of the PCR plate 2 Add 25 ul of thawed PCR Master Mix to each well of t
88. one time for a total of two 80 EtOH washes With the CAP plate on the magnetic stand let the samples air dry at room temperature for 15 minutes Remove the CAP plate from the magnetic stand Add 22 5 ul Resuspension Buffer to each well of the CAP plate Mix thoroughly as follows a Seal the CAP plate with a Microseal B adhesive seal b Shake the CAP plate on a microplate shaker at 1800 rpm for 2 minutes Part 15031047 Rev E 33 34 35 36 37 Incubate the CAP plate at room temperature for 2 minutes Centrifuge the CAP plate to 280 x g for 1 minute Remove the adhesive seal from the CAP plate Place the CAP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Transfer 20 ul supernatant from each well of the CAP plate to the corresponding well of the new HSP plate labeled with the PCR barcode Take care not to disturb the beads SAFESTOPPING POINT If you do not plan to proceed immediately to Enrich DNA Fragments on page 76 you can d safelv stop the protocol here If vou are stopping seal the PCR plate with a Microseal B adhesive seal and store at 15 C to 25 C for up to seven days TruSeq Stranded mRNA Sample Preparation Guide v 5 sjojdepv o1e6rq High Sample HS Protocol Enrich DNA Fragments 76 This process uses PCR to selectively enrich those DNA fragments that have adapter molecules on both ends and to amplify the amount of DNA in the library The PCR is
89. oom temperature for 2 minutes Centrifuge the CPP plate to 280 x g for 1 minute Remove the adhesive seal from the CPP plate Place the CPP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Transfer 30 ul supernatant from each well of the CPP plate to the corresponding well of the new HSP plate labeled with the TSP1 barcode SAFESTOPPING POINT If you do not plan to proceed immediately to Validate Library on page 81 you can safely stop d the protocol here If vou are stopping seal the TSPI plate with a Microseal B adhesive seal and store at 15 C to 25 C for up to 7 days Part 15031047 Rev E Validate Library Illumina recommends performing the following procedures for quality control analysis on your sample library and quantification of the DNA library templates Quantify Libraries To achieve the highest quality data on Illumina sequencing platforms it is important to create optimum cluster densities across every lane of the flow cell Optimizing cluster densities requires accurate quantitation of DNA library templates Quantify your libraries using qPCR according to the Illumina Sequencing Library qPCR Quantification Guide part 11322363 Quality Control 1 Load 1 ul of the resuspended construct on an Agilent Technologies 2100 Bioanalyzer using a DNA specific chip such as the Agilent DNA 1000 2 Check the size and purity of the sample The final product should be a band at
90. ose the lid and select mRNA Elution 1 80 C for 2 minutes 25 C hold to elute the mRNA from the beads This releases both the mRNA and any contaminant rRNA that has bound the beads non specifically 2 Remove the RBP plate from the thermal cycler when it reaches 25 C 3 Place the RBP plate on the bench at room temperature 4 Remove the adhesive seal from the RBP plate Make RFP 1 Centrifuge the thawed Bead Binding Buffer to 600 x g for 5 seconds TruSeq Stranded mRNA Sample Preparation Guide 1 9 VNHU juewbes4 pue AJUNH Low Sample LS Protocol N OA OF q CO 10 11 12 13 14 Add 50 ul of Bead Binding Buffer to each well of the RBP plate This allows mRNA to specifically rebind the beads while reducing the amount of rRNA that non specifically binds Gently pipette the entire volume up and down 6 times to mix thoroughly Incubate the RBP plate at room temperature for 5 minutes and store the Bead Binding Buffer tube at 2 C to 8 C Place the RBP plate on the magnetic stand at room temperature for 5 minutes Remove and discard all of the supernatant from each well of the RBP plate Remove the RBP plate from the magnetic stand Wash the beads by adding 200 ul of Bead Washing Buffer in each well of the RBP plate Gently pipette the entire volume up and down 6 times to mix thoroughly Store the Bead Washing Buffer tube at 2 C to 8 C Place the RBP plate on the magnetic stand at room temperature for 5 minutes Remove a
91. ou do not plan to proceed immediately to Adenylate 3 Ends on page 28 you can safely stop the protocol here If you are stopping seal the ALP plate with a Microseal B adhesive seal and store at 15 C to 25 C for up to seven days TruSeq Stranded mRNA Sample Preparation Guide P T VNQ9 pues puogas aziseyju s Low Sample LS Protocol Adenylate 3 Ends A single A nucleotide is added to the 3 ends of the blunt fragments to prevent them from ligating to one another during the adapter ligation reaction A corresponding single T nucleotide on the 3 end of the adapter provides a complementary overhang for ligating the adapter to the fragment This strategy ensures a low rate of chimera concatenated template formation Consumables Item Optional A Tailing Control CTA A Tailing Mix ATL Resuspension Buffer RSB Microseal B Adhesive Seal RNase DNase free Eight Tube Strips and Caps if using multichannel pipettes RNase DNase free Reagent Reservoirs if using multichannel pipettes Preparation Quantity 1 tube per 48 reactions 1 tube per 48 reactions 1 tube il 3 3 Storage 15 C to 25 C 15 C to 25 C 2 C to 8 C IST Ge BOC 15 C to 30 C AE me SAS Supplied By Ilumina Illumina Illumina User User User Remove the following from 15 C to 25 C storage and thaw them at room temperature A Tailing Control e NOTE The u
92. pipette the entire volume up and down 10 times to mix thoroughly 3 Incubate the CDP plate at room temperature for 15 minutes 4 Place the CDP plate on the magnetic stand at room temperature for 5 minutes to make sure that all of the beads are bound to the side of the wells 5 Remove and discard 135 ul supernatant from each well of the CDP plate NOTE Leave the CDP plate on the magnetic stand while performing the following 80 EtOH wash steps 6 8 6 With the CDP plate on the magnetic stand add 200 ul freshly prepared 80 EtOH to each well without disturbing the beads 7 Incubate the CDP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well 8 Repeat steps 6 and 7 one time for a total of two 80 EtOH washes 9 Let the CDP plate stand at room temperature for 15 minutes to dry and then remove 26 the plate from the magnetic stand Part 15031047 Rev E 10 11 12 13 14 Centrifuge the thawed room temperature Resuspension Buffer to 600 x g for 5 seconds Add 17 5 ul Resuspension Buffer to each well of the CDP plate Gently pipette the entire volume up and down 10 times to mix thoroughly Incubate the CDP plate at room temperature for 2 minutes Place the CDP plate on the magnetic stand at room temperature for 5 minutes Transfer 15 ul supernatant ds cDNA from the CDP plate to the new 96 well 0 3 ml PCR plate labeled with the ALP barcode SAFESTOPPING POINT If y
93. ple Preparation Guide 1 01 juaudinby pue sejqeuunsuoy Supporting Information 102 Table 15 User Supplied Equipment Equipment 96 well thermal cycler with heated lid 2100 Bioanalyzer Desktop System Agilent DNA 1000 Kit Magnetic stand 96 Microplate centrifuge Vortexer Supplier General lab supplier Agilent part G2940CA Agilent part 5067 1504 Life Technologies part AM10027 General lab supplier General lab supplier Table 16 User Supplied Equipment Additional Items for HS Processing Consumable High Speed Microplate Shaker MIDI plate insert for heating system Note Two inserts are recommended to support successive heating procedures Stroboscope One of the following Note Two systems are recommended to support successive heating procedures e SciGene TruTemp Heating System e Hybex Microsample Incubator Supplier VWR catalog e 13500 890 110 V 120 V or e 14216 214 230 V Ilumina catalog f BD 60 601 General lab supplier e Illumina catalog e SC 60 503 115 V or e SC 60 504 220 V e SciGene catalog e 1057 30 0 115 V or e 1057 30 2 230 V Part 15031047 Rev E Indexed Adapter Sequences This section details the indexed adapter sequences TruSeq Stranded mRNA LT Sample Prep Kit Indexed Adapter Sequences The TruSeq Stranded mRNA LT Sample Prep Kit contains the following indexed adapter sequences NOTE e The index numbering is not contiguous T
94. ple preparation protocol using the lumina TruSeq Stranded mRNA LT Sample Prep Kit or TruSeq Stranded mRNA HT Sample Prep Kit Chapter 2 Low Sample LS Protocol explains how to perform the TruSeq Stranded mRNA Sample Preparation using the Low Sample Protocol Chapter 3 High Sample HS Protocol explains how to perform the TruSeq Stranded mRNA Sample Preparation using the High Sample Protocol Equivalent results can be expected from either protocol and their distinguishing elements are as follows Table 1 Protocol Features Low Sample High Sample LT Kit Number of samples lt 48 with indexed gt 48 with indexed processed at one time adapter tubes adapter tubes HT Kit Number of samples lt 24 with indexed gt 24 with indexed processed at one time adapter plate adapter plate Plate Type 96 well 0 3 ml PCR 96 well HSP 96 well MIDI 96 well MIDI Incubation Equipment 96 well thermal cycler 96 well thermal cycler Microheating system Mixing Method Pipetting Microplate shaker Illumina recommends the following kit sample number and protocol combinations Table 2 Kit and Sample Number Recommendations Number of Samples Recommended Processed Kit At One Time lt 24 LT 2448 ILI er JSUT gt 48 HT TruSeq Stranded mRNA Sample Preparation Guide 3 S9 M 89 4 0901014 Overview Table 3 Kit and Protocol Recommendations Kit Number of Samples Supported Number of Samples Processed At One Time Protocol ES HS ES HS
95. ples cDNA Synthesis PCR Box Store at 15 C to 25 C This box is shipped on dry ice As soon as you receive it store the following components at 15 C to 25 C Figure 18 TruSeq Stranded mRNA HT Sample Prep Kit 96 Samples CDNA Synthesis PCR Box part 15032621 Slot Reagent Part 1 2 PMM 15026785 34 PPC 15031748 5 6 FSA 15031094 7 8 SMM 15031098 Description PCR Master Mix PCR Primer Cocktail First Strand Synthesis Act D Mix Second Strand Marking Master Mix 96 Samples Adapter Plate Box Store at 15 C to 25 C This box is shipped on dry ice As soon as you receive it store the contents at 15 C to 25 C Figure 19 TruSeq Stranded mRNA HT Sample Prep Kit 96 Adapter Plate Box part 15032622 Slot Reagent Part Description 1 RAP 15016427 RNA Adapter Plate 96plex TruSeq Stranded mRNA Sample Preparation Guide 97 SJU9JUOD YN Supporting Information 96 Samples Box 1 of 2 Store as specified This box is shipped on refrigerated gel packs As soon as you receive it store the components as specified Figure 20 TruSeq Stranded mRNA HT Sample Prep Kit 96 Samples Box 1 of 2 part 15032624 Slot Reagent Part Description Storage Temperature 1 2 RPB 15026778 RNA Purification Beads 2 C to 8 C 3 DTL 15026807 CTL Dilution Tube Room Temperature 4 DTE 15026766 CTE Dilution Tube Room Temperature 5 DTA 15026805 CTA Dilution Tube Room Temperature
96. pooling samples 1 Determine the number of samples to be combined together for each pool NOTE Make a note of which sample goes into which well to avoid pooling two samples with the same index 8 4 Part 15031047 Rev E 2 Do one of the following If pooling 2 24 samples Transfer 10 ul of each normalized sample library to be pooled from the DCT plate to one well of the new HSP plate labeled with the PDP barcode The total volume in each well of the PDP plate should be 10X the number of combined sample libraries and 20 240 ul 2 24 libraries For example the volume for 2 samples is 20 ul the volume for 12 samples is 120 ul or the volume for 24 samples is 240 ul If pooling 25 96 samples Using a multichannel pipette transfer 5 ul of each normalized sample library in column 1 from the DCT plate to column 1 of the new HSP plate labeled with the PDP barcode Transfer 5 ul of each normalized sample library in column 2 from the DCT plate to column 1 of the PDP plate Repeat the transfer for as many times as there are remaining columns in the DCT plate The result is a PDP plate with pooled samples in column 1 Mix the PDP plate as follows Seal the PDP plate with a Microseal B adhesive seal Shake the PDP plate on a microplate shaker at 1800 rpm for 2 minutes Centrifuge the PDP plate to 280 x g for 1 minute Remove the adhesive seal from the PDP plate Combine the contents of each well of column 1 into well A2 of the PDP plate
97. rimer Cocktail from 15 C to 25 C storage and thaw them at room temperature Centrifuge the thawed PCR Master Mix and PCR Primer Cocktail tubes to 600 x g for 5 seconds Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the AMPure XP Beads from 2 C to 8 C storage and let stand for at least 30 minutes to bring them to room temperature Review Best Practices for Handling Magnetic Beads See Additional Resources on page 9 for information on how to access TruSeq Stranded mRNA Sample Preparation Best Practices on the Illumina website Remove the PCR plate from 15 C to 25 C storage if it was stored at the conclusion of Clean Up ALP on page 35 Let it thaw at room temperature Centrifuge the thawed PCR plate to 280 x g for 1 minute Remove the adhesive seal from the thawed PCR plate Pre program the thermal cycler with the following program and save as PCR Choose the pre heat lid option and set to 100 C 98 C for 30 seconds 15 cycles of 98 C for 10 seconds 60 C for 30 seconds 72 C for 30 seconds 72 C for 5 minutes Hold at 4 C Apply a TSP1 barcode label to a new 96 well 0 3 ml PCR plate TruSeq Stranded mRNA Sample Preparation Guide 3 9 s juauBe14 VNQ UOUUZ Low Sample LS Protocol Make PCR 1 Add 5 ul of thawed PCR Primer Cocktail to each well of the PCR plate 2 Add 25 ul of thawed PCR Master Mix to each well of the PCR plate Gently pipette the entire volume up and down 10 ti
98. rty goods are those that are labeled or branded with a third party s name Purchaser s indemnification rights if any with respect to third party goods shall be pursuant to the original manufacturer s or licensor s indemnity Upon written request Illumina will attempt to pass through such indemnity if any to Purchaser Part 15031047 Rev E Revision History Part 4 Revision Date 15031047 E October 2013 15031047 D September 2012 TruSeq Stranded mRNA Sample Preparation Guide VI Description of Change e Corrected Kit Contents box 1 shipping temperature e Corrected the RNA Purification Beads part number in Box 1 of the LT kit e Added bioanalyzer and DNA 1000 Kit to equipment list e Clarified PDP plate tvpe e LS protocol 0 3 ml PCR plate when pooling lt 40 samples or 96 well MIDI plate when pooling gt 40 samples e HS protocol HSP plate e In the Alternate Fragmentation Protocols Appendix clarified instructions for samples requiring 0 minutes fragmentation time e Created new appendix of Supporting Information containing Acronyms Kit Contents Consumables and Equipment and Indexed Adapter Sequences e Replaced Best Practices section with a reference to content on the Illumina website e Replaced Adapter Options and Pooling Guidelines sections with a reference to the TruSeq Sample Preparation Pooling Guide part 15042173 e Added New England Biolabs Inc licensing to notices e Clarified that when starting with
99. s attached for each row or column of adapters that will be used for ligation Using an eight tip multichannel pipette transfer 2 5 ul of the appropriate thawed RNA Adapter from the RAP well to each well of the ALP plate 9 Mix thoroughly as follows a Seal the ALP plate with a Microseal B adhesive seal b Shake the ALP plate on a microplate shaker at 1800 rpm for 2 minutes 10 Centrifuge the ALP plate to 280 x g for 1 minute Incubate 2 ALP 1 Place the sealed ALP plate on the pre heated microheating system Close the lid and incubate at 30 C for 10 minutes 2 Remove the ALP plate from the microheating system Add STL 1 Remove the adhesive seal from the ALP plate 2 Add 5 ul of Stop Ligation Buffer to each well of the ALP plate to inactivate the ligation mix Mix thoroughly as follows a Seal the ALP plate with a Microseal B adhesive seal b Shake the ALP plate on a microplate shaker at 1800 rpm for 2 minutes 3 Centrifuge the ALP plate to 280 x g for minute Clean Up ALP 1 Remove the adhesive seal from the ALP plate 2 Vortex the AMPure XP Beads for at least 1 minute or until they are well dispersed d S Part 15031047 Rev E N A OF A 10 11 12 13 14 15 16 17 Add 42 ul of mixed AMPure XP Beads to each well of the ALP plate Mix thoroughly as follows a Seal the ALP plate with a Microseal B adhesive seal b Shake the ALP plate on a microplate shaker at 1800 rpm for 2 minutes Inc
100. se of the A Tailing Control is optional and it can be replaced with the same volume of Resuspension Buffer A Tailing Mix 28 Part 15031047 Rev E Add ATL 1 2 Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the ALP plate from 15 C to 25 C storage if it was stored at the conclusion of Purify CDP on page 26 Let it thaw at room temperature Centrifuge the thawed ALP plate to 280 x g for 1 minute Remove the adhesive seal from the ALP plate Pre program the thermal cycler with the following program and save as ATAIL70 Choose the pre heat lid option and set to 100 C 37 C for 30 minutes 70 C for 5 minutes Hold at 4 C Do one of the following If using the in line control reagent Centrifuge the thawed A Tailing Control tube to 600 x g for 5 seconds Dilute the A Tailing Control to 1 100 in Resuspension Buffer For example 1 ul A Tailing Control 99 ul Resuspension Buffer before use Discard the diluted A Tailing Control after use Add 2 5 ul of diluted A Tailing Control to each well of the ALP plate If not using the in line control reagent add 2 5 ul of Resuspension Buffer to each well of the ALP plate Add 12 5 ul of thawed A Tailing Mix to each well of the ALP plate Gently pipette the entire volume up and down 10 times to mix thoroughly 3 Seal the ALP plate with a Microseal B adhesive seal TruSeq Stranded mRNA Sample Preparation Guide 2 Q spuz
101. sh Mix 15 C to 25 C 48 Samples cDNA Synthesis PCR Box Store at 15 C to 25 C This box is shipped on dry ice As soon as you receive it store the following components at 15 C to 25 C Figure 16 TruSeq Stranded mRNA LT Sample Prep Kit 48 Samples cDNA Synthesis PCR Box part 15032611 TruSeq Stranded mRNA Sample Preparation Guide 9 5 SJU9JUOD YN Slot 1 2 3 4 Supporting Information Reagent PMM PPC FSA SMM Part Description 15026785 PCR Master Mix 15031748 PCR Primer Cocktail 15031094 First Strand Synthesis Act D Mix 15031098 Second Strand Marking Master Mix 96 Samples Core Box Store at 15 C to 25 C This box is shipped on dry ice As soon as you receive it store the following components at 15 C to 25 C TruSeg Stranded mRNA HT Sample Prep Kit The TruSeq Stranded mRNA HT Sample Prep Kit contains five boxes a core reagent box a cDNA Synthesis PCR box an Adapter Plate box and a Box 1 and Box 2 Figure 17 TruSeq Stranded mRNA HT Sample Prep Kit 96 Samples Core Box part 15032620 o9 Slot 1 2 34 5 6 7 8 9 10 11 12 13 14 96 Reagent Part RSB ATL LIG CTE CTA CTL STL 15026770 15012495 15026773 15026774 15026775 15026776 15012546 000000 CIEMAT kb AAA Description Resuspension Buffer A Tailing Mix Ligation Mix End Repair Control A Tailing Control Ligation Control Stop Ligation Buffer Part 15031047 Rev E 96 Sam
102. sing the in line control reagent Centrifuge the thawed End Repair Control tube to 600 x g for 5 seconds Dilute the End Repair Control to 1 50 in Resuspension Buffer For example 2 pl End Repair Control 98 ul Resuspension Buffer before use Discard the diluted End Repair Control after use Add 5 ul of diluted End Repair Control to each well of the CDP plate If not using the in line control reagent add 5 ul of Resuspension Buffer to each well of the CDP plate 3 Centrifuge the thawed Second Strand Marking Master Mix to 600 x g for 5 seconds 4 Add 20 ul of thawed Second Strand Marking Master Mix to each well of the CDP plate Gently pipette the entire volume up and down 6 times to mix thoroughly TruSeq Stranded mRNA Sample Preparation Guide 2 5 VNQ9 pues puogas aziseyju s Low Sample LS Protocol 5 Seal the CDP plate with a Microseal B adhesive seal 6 Return the Second Strand Marking Master Mix tube to 15 C to 25 C storage after use Incubate 2 CDP 1 Place the sealed CDP plate on the pre heated thermal cycler Close the lid and incubate at 16 C for 1 hour 2 Remove the CDP plate from the thermal cycler and place it on the bench 3 Remove the adhesive seal from the CDP plate 4 Let the CDP plate stand to bring it to room temperature Purify CDP 1 Vortex the AMPure XP beads until they are well dispersed 2 Add 90 ul of well mixed AMPure XP beads to each well of the CDP plate containing 50 ul of ds cDNA Gently
103. sses of the TruSeq Stranded mRNA Sample Preparation LS protocol to prepare templates using 24 indexed adapter tubes or a RAP Figure 2 TruSeq Stranded mRNA Sample Preparation LS Workflow Prepare for Pooling 0 1 4 ug Total RNA Purify and Fragment mRNA Consumables BBB BWB ELB EPF RPB Water Pistes RBP First Strand cDNA Synthesis Consumables FSA SuperScript I Plate CDP Second Strand cDNA Synthesis Consumables AMPure XP Beads CTE Optional EtOH RSB SMM Plate ALP Adenylate 3 Ends Consumables ATL CTA Optional RSB Plate ALP 14 Ligate Adapters Consumables AMPure XP Beads CTL Optional EtOH UG RNA Adapters or RAP RSB STL Platos CAP PCR PCR Amplification Consumables AMPure XP Beads EtOH PMM PPC RSB Piate TSPI i Validate Librarv Consumables Agilent DNA 1000 Kit 3 Normalize and Pool Libraries Consumables Tris HCl 10 mM w Tween 20 Plates DCT PDP indexing only Part 15031047 Rev E Purify and Fragment mRNA This process purifies the polyA containing mRNA molecules using poly T oligo attached magnetic beads using two rounds of purification During the second elution of the polyA RNA the RNA is also fragmented and primed for cDNA synthesis Reference the following diagram while performing the purification procedures Figure 3 TruSeq Stranded mRNA Sample Preparation Purification Workflow Dilute Total RNA Elute mRNA from Beads
104. subsequent experiments Remove the RNA Purification Beads tube from 2 C to 8 C storage and let stand to bring to room temperature TruSeq Stranded mRNA Sample Preparation Guide 17 VNHU juewbes4 pue And Low Sample LS Protocol Pre program the thermal cycler with the following programs Choose the pre heat lid option and set to 100 C 65 C for 5 minutes 4 C hold save as mRNA Denaturation 80 C for 2 minutes 25 C hold save as mRNA Elution 1 94 C for 8 minutes 4 C hold save as Elution 2 Frag Prime NOTE i For inserts larger than 120 200 bp with a median size of 150 bp see Appendix B Alternate Fragmentation Protocols Set the centrifuge to 15 C to 25 C if refrigerated Apply an RBP barcode label to a new 96 well 0 3 ml PCR plate Make RBP 1 Dilute the total RNA with nuclease free ultra pure water to a final volume of 50 ul in the new 96 well 0 3 ml PCR plate labeled with the RBP barcode 2 Vortex the room temperature RNA Purification Beads tube vigorously to resuspend the oligo dT beads 3 Add 50 ul of RNA Purification Beads to each well of the RBP plate to bind the polyA RNA to the oligo dT magnetic beads Gently pipette the entire volume up and down 6 times to mix thoroughly 4 Seal the RBP plate with a Microseal B adhesive seal Incubate 1 RBP 1 Place the sealed RBP plate on the pre programmed thermal cycler Close the lid and select mRNA Denaturation 65 C for 5 minutes 4 C hold to de
105. t 12 min frag 0 2 t 0 frag Covers 4 t 2 min frag O 6 t S min frag 1 No Fragmentaton 3 t 1 mn frag 8 5 ta min frag 7 tal min frag FU t 12 min frag 140 NOTE The discrepancy between the reported insert size using the Agilent Bioanalyzer and the insert size determined after clustering and sequencing with a paired end sequencing run is due to the bias towards clustering smaller fragments To target a specific fragment size a gel size selection step is required after adapter ligation 1 1 O Part 15031047 Rev E Index A Acronyms 89 Add ATL 29 66 Add LIG 33 70 Add SMM 25 62 Add STL 35 72 SE 24 61 PCR 40 78 AM ure XP Beads 24 32 38 61 69 76 ATL 28 65 B BBB 16 52 Best Practices 9 BWB 16 52 C CAP 31 68 CCP 61 cDNA synthesis 15 51 CDP cDNA Plate 21 58 Clean Up ALP a 72 K Clean Ub PCR 40 79 See GE 2 46 85 CTA 28 65 CTE 24 61 CTL 31 68 customer support 113 D DCT 44 83 documentation 113 ds cDNA 24 61 E ELB 16 52 Elution 2 Frag Prime 20 57 109 TruSeq Stranded mRNA Sample Preparation Guide xapul experienced user card EUC 10 F first strand cDNA 2 FPF 16 52 fragment 2 ion time 108 FSA 21 58 H help technical 113 Pa Sample HS 3 IEM 10 IMP 61 in line control DNA 7 Incubate 1 ALP 30 67 Incubate 1 CDP 23 60 Incubate 1 RBP 18 54 Incubate 2 ALP 35 72 Incubate 2 CDP 26 63 Incubate 2 RBP 19 55 index adapter 2 in
106. t quality data on Illumina sequencing platforms it is important to create optimum cluster densities across every lane of the flow cell Optimizing cluster densities requires accurate quantitation of DNA library templates Quantify your libraries using qPCR according to the Illumina Sequencing Library qPCR Quantification Guide part 11322363 Quality Control 1 Load 1 ul of the resuspended construct on an Agilent Technologies 2100 Bioanalyzer using a DNA specific chip such as the Agilent DNA 1000 2 Check the size and purity of the sample The final product should be a band at approximately 260 bp Figure 5 Example of TruSeq Stranded mRNA Sample Preparation Library Size Distribution 100 ng UHR a T T T T T T msi 5 50 100 150 200 300 400 500 700 1500 A D Part 15031047 Rev E Figure 6 TruSeq Stranded mRNA Sample Preparation 260 bp PCR Product D E 3 g E 8 TruSeq Stranded mRNA Sample Preparation Guide 43 Mesq SJEPIJEA Low Sample LS Protocol Normalize and Pool Libraries This process describes how to prepare DNA templates for cluster generation Indexed DNA libraries are normalized to 10 nM in the DCT plate and then pooled in equal volumes in the PDP plate DNA libraries not intended for pooling are normalized to 10 nM in the DCT plate Consumables Item Barcode labels for e DCT Diluted Cluster Template e PDP Pooled DCT Plate for pooling only 96 well MIDI plates 96 well
107. te If not using the in line control reagent add 2 5 ul of Resuspension Buffer to each well of the ALP plate Add 12 5 ul of thawed A Tailing Mix to each well of the ALP plate Mix thoroughly as follows a Seal the ALP plate with a Microseal B adhesive seal b Shake the ALP plate on a microplate shaker at 1800 rpm for 2 minutes Centrifuge the ALP plate to 280 x g for 1 minute Part 15031047 Rev E Incubate 1 ALP 1 Place the sealed ALP plate on the pre heated microheating system 1 Close the lid and incubate at 37 C for 30 minutes Immediately after the 37 C incubation remove the ALP plate from system 1 and place the plate on the pre heated microheating system 2 Close the lid and incubate at 70 C for 5 minutes Set the microheating system 1 to 30 C in preparation for Ligate Adapters Immediately remove the ALP plate from the microheating system 2 and place the plate on ice for 1 minute Proceed immediately to Ligate Adapters on page 68 TruSeq Stranded mRNA Sample Preparation Guide 67 spuq aje huspy High Sample HS Protocol Ligate Adapters 68 This process ligates indexing adapters to the ends of the ds cDNA preparing them for hybridization onto a flow cell Consumables Item Optional Ligation Control CTL Choose from the following depending on the kit you are using e TruSeq Stranded mRNA LT Sample Prep Kit contents e RNA Adapter Indices AR001 AR016 ARO18 A
108. the corresponding well of the new HSP plate labeled with the RFP barcode 17 Seal the RFP plate with a Microseal B adhesive seal 18 Store the Fragment Prime Finish Mix tube at 15 C to 25 C Incubate RFP 1 Place the sealed RFP plate on the pre programmed thermal cycler Close the lid and select Elution 2 Frag Prime 94 C for 8 minutes 4 C hold to elute fragment and prime the RNA 2 Remove the RFP plate from the thermal cycler when it reaches 4 C and centrifuge briefly 3 Proceed immediately to Synthesize First Strand cDNA on page 58 TruSeq Stranded mRNA Sample Preparation Guide 5 T VNHU juewbes4 pue 4und High Sample HS Protocol synthesize First Strand CDNA 58 This process reverse transcribes the cleaved RNA fragments that were primed with random hexamers into first strand cDNA using reverse transcriptase and random primers The addition of Actinomycin D to the First Stand Synthesis Act D mix FSA prevents spurious DNA dependent synthesis while allowing RNA dependent synthesis improving strand specificity Consumables Item Quantity Storage Supplied By First Strand Synthesis Act D 1 tube 15 C to 25 C Ilumina Mix FSA CDP cDNA Plate Barcode 1 label per plate AE me SAS Illumina Label 96 well HSP Plate 1 15 C to 30 C User Microseal B Adhesive Seal il IC me SOK User RNase DNase free Eight Tube 1 15 C to 30 C User Strips and Caps if using multichannel pipettes RNase DNase free Reagent il
109. thorized repair personnel access to this Product in order to confirm the non conformance and make repairs IV Part 15031047 Rev E Sole Remedy under Warranty Illumina will at its option repair or replace non conforming Product that it confirms is covered by this warranty Repaired or replaced Consumables come with a 30 day warranty Hardware may be repaired or replaced with functionally equivalent reconditioned or new Hardware or components if only a component of Hardware is non conforming If the Hardware is replaced in its entirety the warranty period for the replacement is 90 days from the date of shipment or the remaining period on the original Hardware warranty whichever is shorter If only a component is being repaired or replaced the warranty period for such component is 90 days from the date of shipment or the remaining period on the original Hardware warranty whichever ends later The preceding states Purchaser s sole remedy and Illumina s sole obligations under the warranty provided hereunder Third Party Goods and Warranty Illumina has no warranty obligations with respect to any goods originating from a third party and supplied to Purchaser hereunder Third party goods are those that are labeled or branded with a third party s name The warranty for third party goods if any is provided by the original manufacturer Upon written request Illumina will attempt to pass through any such warranty to Purchaser 9 Indemnification
110. tion Control reagents contain DNA fragments used as controls for the enzymatic activities of the Second Strand Marking Master Mix A Tailing Mix and Ligation Mix respectively Each reagent contains dsDNA fragments designed to report the success or failure of a specific enzymatic activity used in the library preparation process Sequencing determines the readout If the sequence of an in line control is in the final sequencing data viewed in the Sequence Analysis Viewer SAV it indicates that its corresponding step was successful If it does not or if it is in substantially diminished numbers it indicates the step failed The controls are intended for troubleshooting and are useful for identifying the specific mode of failure but are uninformative in cases where sequencing data are not generated from a library ley NOTE The use of these controls is optional and they can be replaced with the same volume of Resuspension Buffer The control molecules work through the design of their ends Controls are added to the reactions before their corresponding step in the protocol Their end structures match those of a DNA molecule that has not gone through the step If the step is successful the control molecule will be modified to participate in downstream reactions of library generation and resulting in sequencing data If the step fails the control molecule will not go forward in the process and no sequencing data will be generated Using 1 ug of startin
111. tion Protocols 107 introduction eret B SAE RE EP AP SA 108 Modify RNA Fragmentation Time 109 a L 9 A 111 Technical Assistance nn rna nn 118 X Part 15031047 Rev E List of Tables Table 1 Protocol Features 3 Table 2 Kitand Sample Number Recommendations 3 Table 3 Kit and Protocol Recommendations 0 ee eee cece ccceeeeeee 4 Table 4 In Line Control Functions 8 Table5 Kitand Sample Number Recommendations 2 00 ee 12 Table6 Kit and Protocol Recommendations 12 Table 7 Kitand Sample Number Recommendations 200 48 Table 8 Kit and Protocol Recommendations 48 Table 10 TruSeq Stranded mRNA Sample Preparation Acronyms 89 Table 11 TruSeq Stranded mRNA Sample Preparation Kits occ 91 Table 12 User Supplied Consumables 100 Table 13 User Supplied Consumables Additional Items for LS Processing 101 Table 14 User Supplied Consumables Additional Items for HS Processing 101 Table 15 User Supplied Equipment 0 00000 aonni onoono nnan n2n 102 Table 16 User Supplied Equipment Additional Items for HS Processing 102 Table 17 TruSeq Stranded mRNA LT Sample Prep Kit Set A Indexed Adapter SEQUENCES ele ota sco uuu AE 104 Table 18 TruSeq Stranded mRNA LT Sample Prep Kit Set B Indexed Adapter SS CQUCNCOS cerca dit 104 Table 19 TruSeq Stranded mRNA HT Sample Prep Kit Indexed Adapter 1 Sequences 105 Table 20 TruSeq Stranded mRNA HT Sample Prep Kit Indexed
112. ubate the ALP plate at room temperature for 15 minutes Centrifuge the ALP plate to 280 x g for 1 minute Remove the adhesive seal from the ALP plate sjojdepv 91661 Place the ALP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Remove and discard 79 5 ul supernatant from each well of the ALP plate Take care not to disturb the beads NOTE Leave the ALP plate on the magnetic stand while performing the following 80 EtOH wash steps 9 11 With the ALP plate on the magnetic stand add 200 ul freshly prepared 80 EtOH to each well without disturbing the beads Incubate the ALP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Take care not to disturb the beads Repeat steps 9 and 10 one time for a total of two 80 EtOH washes With the ALP plate on the magnetic stand let the samples air dry at room temperature for 15 minutes Remove the ALP plate from the magnetic stand Add 52 5 ul Resuspension Buffer to each well of the ALP plate Mix thoroughly as follows a Seal the ALP plate with a Microseal B adhesive seal b Shake the ALP plate on a microplate shaker at 1800 rpm for 2 minutes Incubate the ALP plate at room temperature for 2 minutes Centrifuge the ALP plate to 280 x g for 1 minute Remove the adhesive seal from the ALP plate TruSeq Stranded mRNA Sample Preparation Guide F 3 High Sample HS Protocol 1
113. ube 3 15 to 30 C Strips and Caps if using multichannel pipettes RNase DNase free Reagent 3 15 C to 30 C Reservoirs if using multichannel pipettes TruSeq Stranded mRNA Sample Preparation Guide Supplied By Ilumina Ilumina Ilumina User User User User 65 spuz aje huspy High Sample HS Protocol Preparation Add ATL 66 1 Remove the following from 15 C to 25 C storage and thaw them at room temperature A Tailing Control law NOTE The use of the A Tailing Control is optional and it can be replaced with the same volume of Resuspension Buffer A Tailing Mix Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the ALP plate from 15 C to 25 C storage if it was stored at the conclusion of Purify CDP on page 63 Let it thaw at room temperature Centrifuge the thawed ALP plate to 280 x g for 1 minute Remove the adhesive seal from the ALP plate Pre heat two microheating systems system 1 to 37 C and system 2 to 70 C Prepare ice to cool the plate Do one of the following If using the in line control reagent Centrifuge the thawed A Tailing Control tube to 600 x g for 5 seconds Dilute the A Tailing Control to 1 100 in Resuspension Buffer For example 1 ul A Tailing Control 99 ul Resuspension Buffer before use Discard the diluted A Tailing Control after use Add 2 5 ul of diluted A Tailing Control to each well of the ALP pla
114. ubject of one or more issued and or pending U S and foreign patent applications owned by Max Planck Gesellschaft exclusively licensed to New England Biolabs Inc and sublicensed to Illumina Inc The purchase of this product from Illumina Inc its affiliates or its authorized resellers and distributors conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product by the buyer whether the buyer is an academic or for profit entity The purchase of this product does not convey a license under any claims in the foregoing patents or patent applications directed to producing the product The buyer cannot sell or otherwise transfer this product or its components to a third party or otherwise use this product for the following COMMERCIAL PURPOSES 1 use of the product or its components in manufacturing or 2 use of the product or its components for therapeutic or prophylactic purposes in humans or animals Read Before Using this Product This Product and its use and disposition is subject to the following terms and conditions If Purchaser does not agree to these terms and conditions then Purchaser is not authorized by Illumina to use this Product and Purchaser must not use this Product 1 Definitions Application Specific IP means Illumina owned or controlled intellectual property rights that pertain to this Product and use thereof only with regard to specific field s or specific applicatio
115. uence D701 ATTACTCG CTGAAGCT A E E mm ren Table 20 TruSeq Stranded mRNA HT Sample Prep Kit Indexed Adapter 2 Sequences Adapter Sequence Adapter Sequence s u nb Jeldepy pexepu D501 TATAGCCT AGGCGAAG D502 TAATCTIA D503 CAGGACGT D504 GTACTGAC TruSeq Stranded mRNA Sample Preparation Guide 1 O b 1 O 6 Part 15031047 Rev E Alternate Fragmentation Protocols TruSeq Stranded mRNA Sample Preparation Guide qxipueddv Alternate Fragmentation Protocols Introduction 108 Fragmentation of the nucleic acids is required for optimal library preparation clustering and sequencing The TruSeq Stranded mRNA Sample Preparation fragmentation protocol for transcriptome analysis is performed on the RNA after mRNA purification using elevated temperatures The fragmentation results in libraries with inserts ranging from 120 bp to 200 bp in size with a median size of 150 bp The TruSeq Stranded mRNA Sample Preparation fragmentation protocol ensures the best coverage of the transcriptome with efficient library production Illumina recognizes that some customers have different purposes for their sequencing experiments The need for larger inserts is greater than the need for the best coverage for applications such as splice variant analysis studies Two separate options are provided for varying the insert size of your library Modify the fragmentation time Shear the sample after the synthesis of the ds cDNA Part
116. utes 42 C for 15 minutes 70 C for 15 minutes Hold at 4 C Apply a CDP barcode label to a new 96 well 0 3 ml PCR plate E NOTE The First Strand Synthesis Mix Act D with SuperScript II added is stable to additional freeze thaw cycles and can be used for subsequent experiments If more than six freeze thaw cycles are anticipated divide the First Strand Synthesis Mix Act D and SuperScript II mix into smaller aliquots and store at 15 C to 25 C Remove the adhesive seal from the RBP plate Place the RBP plate on the magnetic stand at room temperature for 5 minutes Do not remove the plate from the magnetic stand Transfer 17 ul supernatant from each well of the RBP plate to the corresponding well of the new 0 3 ml PCR plate labeled with the CDP barcode Centrifuge the thawed First Strand Synthesis Act D Mix tube to 600 x g for 5 seconds Add 50 ul SuperScript H to the First Strand Synthesis Act D Mix tube If you are not using the entire contents of the First Strand Synthesis Act D Mix tube add SuperScript Il at a ratio of 1 ul SuperScript H for each 9 ul First Strand Synthesis Act D Mix Mix gently but thoroughly and centrifuge briefly Label the First Strand Synthesis Act D Mix tube to indicate that the SuperScript II has been added Add 8 ul of First Strand Synthesis Act D Mix and SuperScript Il mix to each well of the CDP plate Gently pipette the entire volume up and down 6 times to mix thoroughly Part 15031047 Rev E 7

TruSeq Stranded mRNA Sample Preparation Guide 15031047 E

Contents

Download Pdf Manuals

Related Search

Related Contents