Home

Combined (Dual) Mode Commands

1. MMMM MMMM 5 F1 F2 F3 CTRL T CTRL R CTRL P CTRL Z CTRL Q TX SETUP RX SETUP RESULTS SETUP RUN STOP PAUSE REFRESH QUIT ST112 gt TEKTRONIX gt STOPPED Figure 5 23 Detailed Event Log for VIEW CHANNEL 3 and 4 From the Dwell Period Event Log press the L key to access the Detailed Event Log Figure 5 23 illustrates the detailed event logs for view channels 3 and 4 respectively Trouble Scan Summary Trouble Scan is both a mode and a function The mode can be set to ON anytime but the function only runs and logs maintenance signals errors and alarms during the test cycle ST112 SONET Transmission Test Set 5 19 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use Trouble Scan Combined Dual Mode Trouble Scan is both a Mode and a Function It was described in detail previously in this chapter Therefore only the differences and some refreshed material will be presented in this section Review Trouble Scan Basics section previously presented using Trouble Scan at the OC 48 rate Terminal ST112 TRM File Edit Settings Phone Transfers Help olx OC48 TROUBLE SCAN SECTION LINE I 1 1 NONE UT1 5 Mapping 11 3 I 1 sT2400 0C48 I I 2 NONE 3 12 1 I 1 Los AIS I l 3 LOS H 7 1 2 II LOF l I 2 1 NONE 2 3
2. SECTION LINE l SONET ERRORS PAYLOAD ERRORS lIl T112 SECTION B1 DS3 PARITY 1 1 Los AIS I IES 1 BER 0 0E 12 ES I I LOF LOP I ISES 1 ERRORS to SES I I OOF RDI l l BER 11 Bl B2 l LINE B2 ERRORS lI l IES 8 BER 0 0E 12 I PATH UT PATH I ISES 0 ERRORS ic DS3 BIT II ars AIS I l ES I I RDI RDI I PATH B3 FEBE to SES I I FEBE FEBE IES 3 BER 0 4E 11 BER l I B3 BIP 2 ISES 0 ERRORS 5 ERRORS 11 LOP I l I 1 _PAYLOAD DS1 DS3 1 STSX 1 BPU 11 AIS I IBER I I LOF RAI I TERRORS I I PAR IDLE l I I CRC YEL I l DD HH MM SS FRAME I I ONES BIT I IElapsed Time 00 00 34 55 ERRORS I I SYNC I 4 5 F1 F2 F3 CTRL T CTRL R CTRL P CTRL Z CTRL Q TX SETUP RX SETUP RESULTS SETUP RUN STOP PAUSE REFRESH QUIT Figure 4 25 Receiver Error Summary Terminal Display Pressing the F3 RESULTS function key will display the read only receiver error summary menu shown in Figure 4 25 The large RX ERROR SUMMARY display area does not list any 4 20 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel other accessible submenus on its upper left side The only keys that can be used to exit this display are F1 F2 or CTRL T The RESULTS screen includes the B1 section B2 line and B3 path errors The totals for B1 B2 and B3 Errored S
3. Iq Input Config 1 1 Ir Error Generation I IBITX_LASER POWER 1 Iw Alarms 1 ON 1 It TOH bytes E a 1 I1 2 4Gb s Laser I E TX LASER WAVELENGTH 1 Ig Event Trigger E l 131 0nm I Is Ia 1 Repetitive Alarm Figure 5 16 Combined Dual Mode TX Setup From the TX Setup main menu select the ST2400 2 4Gb s SDH SONET Test Set TX v Setup menu and the list of menus will change to ST2400 TX SETUP as shown in Figure 5 16 Then select the 2 4Gb s Laser menu which is the OC 48 TX LASER menu shown in Figure 5 16 This menu will be used to power on the ST2400 Laser It also shows that this ST2400 has a TX LASER WAVELENGTH option either 1310nm or 1550nm can be selected The ST2400 2 4Gb s SDH SONET Test Set User Manual describes that option File Edit Settings Phone Transfers Help oC48 Thru DS3 UT1 5 3c 12c lt SETUP A st ecss4Sess SS ee ee ee Og Se Iq Quick Setup lI QUICK SETUP l Iw Time lI l Ir DSX Line Code RATE PAYLOAD l It Store Recall I DSX1 sie I ly Timed Test I 1 DSxX3 sas l lu Report Printing I I STSX1 DS3 UT1 5 l Im Current Cfg I 1 OCI DS3 UT1 5 l l I oc3 DS3 UT1 5 3c l l I I 0C12 DS3 UT1 5 3c 12c I l 1 1 M DS3 WERS 3c 12c I 11 l 11 l Figure 5 17 Quick Setup menu Combined Dual Mode Press CTRL T to access the SETUP main menu Then select the Quick Setup submenu q shown in Figure 5 17 This menu is used to select the rate and payload OC 48 and VT1 5 in this example l T
4. Circuit Pack Figure 5 3 Circuit Pack Testing Figure 5 3 illustrates a Circuit Pack test setup Three STSX 1 signals are used to busy up the circuit pack under test and its OC 3 output is being analyzed by the Test Set receiver input All six STSX 1 outputs could be used with signal splitters to test an OC 12 Circuit Pack Payload and overhead manipulation as detailed in Chapters 3 and 4 can be used to analyze the Circuit Pack ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use VT1 5 Channel Scan ADM and E DCS Testing VT1 5 Structured STS 1 SPE 4x7 mapping numbered in groups of seven 1 29 30 31 32 33 58 59 60 61 62 87 J1 R R B3 R R C2 R R LOIN om OJN st wo st O lt cil O e NINI DI KIN Ole ein aR oOl N R Oje N SH SHE t FE HE HE HE l FE He He Je te Jae se te F2 19 ta a n 19 aea R up jum 12 B up n iQ n meam em lele m 751555151515515 SIEGE IERIE 551515 5 24 R R z5 R R az FA BE 8 es ee VT1 5 Structured STS 1 SPE 1x28 mapping numbered sequential 1 29 30 31 32 33 58 59 60 61 62 87 J1 R R B3
5. ceccceeccesccesecesecececseeceeeeeeneeneeneenseenees 45 ds_bit_rate DS1 DS3 Bit Error Rate Query Command cceceeeccsseseeeseceeeeecneeeeceaeeeeeseeateaeeneees 45 ds _fram_err DS1 DS3 Frame Bit Error Count Query Command ccccescceseeeeeseeeeeeseeeeeeeeeees 45 dsl_cre6_err DSI CRC 6 Parity Error Query Command ccccceecceeseesecesceeeceeeceeeeeecnseeneeneenaees 45 dsl_crce6_rate DS1 CRC 6 Parity Error Rate Query Command cecceeseeseeeeeeteceeceteeeeeneeseensees 45 ds3_bit_es DS3 Bit Errored Seconds Query Command cccccecseeseeeseeesceeeeesecsaeeenecseeeeeeneeees 45 ds3_bit_ses DS3 Bit Severely Errored Seconds Query Command c cecceeseeseeeteeeeeeseeeneeees 46 ds3_par_err DS3 Parity Error Count Query Command eiecesseeseceeeeeeeeeeeceeecnererenaeeeeeaeenees 46 ds3_par_es DS3 Parity Errored Seconds Query Command cccceceecseeseeseeceseceeeeneeeneeeneeeneeees 46 ds3_par_rate DS3 Parity Error Rate Query Command ececeseceseseeceseeeeeseeeeeseceeeseeeneeaeeneeneees 46 ds3_par_ses DS3 Parity Severely Errored Seconds Query Command ccccssceeseeesceteeeteeeeenees 46 elap_time Elapsed Test Cycle Time Query Command ceececescceseseeeeecneeeeceeeeeeeaeeeeeaecaeeeeeneeetes 46 log clear Clear Error Log Execute Command sssini eieiei rieira iesse 46 log_print Print Error Log Execute Command 00 cccceceeseseceseseeeecseeeceeseeceaeeeeesecaeseeenaeerceaseneea
6. cccccceeceesceeseeesceeeeeeeeeseeesecnaeeneeceeeaeeenes 69 alm_vt_yel Alarm VT YEL Query Command ccceescseecesseeeceseeeeesecaeeeesseeaeesecesereeaeeneeaeeaees 69 ds1_alarms ais yel off DS1 Alarm Set Command cccecceccesseeesceeseeeeceeceseenaeenaeeneeeeeeneeenes 69 ds1_alarms DS1 Alarm Query Command 0 ceeesesesceccesesosesensessnenenenessnsssnverssenenenennereseneesanes 70 ds3_alarms ais xbit idle off DS3 Alarm Set Command cceccceeceesceeseceeceeeceeeseeeeeeneeeeeeees 70 ds3_ alarms DS3 Alarm Query Command cc ccesescessessseseceeeeecneeeeceaeesecaeseeesaeeeceaecaeseeeaeeaeeneees 70 ds3_ pth _bur n DS3 Path Burst Alarm Set Command cccccccccssecsccescceseceecsseceseceeeeseeseeeseeenaees 70 ds3_pth bur DS3 Path Burst Alarm Query Command cccecccesceesecsecssesesceeeeeeeceeeneeceeceesneeses 70 ds3_pth tri DS3 Path Trigger Command o cicccecccsieveidsie sues evade coteeceseinesdesieassacdaesseecseddanteecesernesaceas 70 ds3_pth ty frame alarm DS3 Path Alarm Burst Set Command cccecceesceeeceeeeeeeeeneeeees 71 ds3_pth ty DS3 Path Alarm Burst Query Command ccccesccessessseeseeeseseeeeeceseeeaeeeaeeeeeeneeeereees 71 LOSS OF SIGNAL irk csc ce asthe acca te cessee Bed facade ceadenensstinestanetcccecssesiotassteusidsecs 72 los enab Loss Of Signal Enable Command 0 cccccesecesessseesceescescecseeeneeeneeeeeeneeeeeneenseceecnaeenaeenaes 72
7. cccecccesecesessseeseeeseeeeeeeeceseeneeceseeaeeaeceaeeeaeeeseneeeeas 15 date yy yy mm dd Date Set Command 0 0 0 cccecccesecsseesceeseeeseeeeeeeceeeeseensecaeenaecnaeeeecaeeeaeeenes 15 date Date Query Command xc os sosccsecnccve ssh tes sata vers Eeen EAEE A EEEE ENEE EEEE EEEE EAR EEEE NEE 16 dsx1l_code ami b8zs DSX 1 Code Configuration Set Command ssssseseeesesesessreeessessrsesseese 16 dsx1_code DSX 1 Code Configuration Query Command cceccesseeseeesceeeceeeeseessecneeeneeeneeees 16 edit_setup n s Edit Setup Label Set Command eecccccecccesececeenceeeeeeeeeneeeeeeeeeeneeeteeerenrens 16 edit setup n Edit Setup Label Query Command 0 c ce ceeecseeseceeeeeceseseeesecaeeseeneeeceaeeneeaceaseneaeeas 16 gpib_address GPIB Address Query Command 0 ccccecccessceseceseceseceseceeeeeeeeeeeeeeeseenseeeeenaeenaeenaes 16 gpib_ address n GPIB Address Set Command 0 ceceeeseessesesseeeecneeeecaeeeeeseeatesecaeeeeenaesaeeaeeneenees 17 gpib_bus GPIB Bus Query Command ccccecccsseesseeseesseceeceaeccecaeecaeecaeeeeeseeeeeeeerecnaecnsecseeeaeeenes 17 gpib_bus talk listen off bus GPIB Bus Mode Command ee ceeeceeeeeeeneeeecereereneeeeceneeneeneees 17 options Options Query Command posesiei RE A E RE RR Eii 17 print_port Print Port Query Command ce cececeseseessesecseeeecceeeceaeceessecaeeseceeveeesaeeeeeaecateeeeaeenreaeenes 17 print_port parallel
8. petade Iq Input APS BYTES PROTECTION SWITCH Iw Optics Ki 00 K2 00 Ir Mapping It UT1 5 Channel ly UT1 5 DSX1 Cfg lu DS3 DSX3 cfo lo SPE Pointer Ip UT Pointer Is TOH POH Ig J1 Trace Messge Ih APS Bytes lj UT Channel Scan In Trouble Scan Figure 4 22 VFP Automatic Protection Switching APS Bytes APS ARCHITECTURE 1 1 CODE No Request l l l l l DIRECTION Other 0 l l l REQUEST LINE SWITCH LINE 0 I l The letter A in the RX SETUP list accesses the read only display of the APS Automatic Protection Switch bytes At the top of the display are the K1 and K2 bytes in hexadecimal The APS line architecture can be either 1 1 one to one or 1 N one to several allocated lines specified by the number N The line direction can be UNI unidirectional BI bi directional or Other indicating none of the four line types Code 8 Manual Switching is being shown in Figure 4 22 other possible codes are listed below The Request Line the line requesting to be switched and the Switch Line the line that the Request Line wants to switch to can be any decimal number from 0 to 15 4 18 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel 0 No Request 8 Manual Switch 1 Do Not Revert 9 Invalid 2 Reserve Request 10 SD Lo Priority 3 Invalid 11 SD Hi Priority 4 Exercise 12
9. Enter Key See Menu System Part 2 Setup Key Return to QUICK SETUP menu Figure 3 2 Menu System Part 1 e After the power up cycle or when the setup key is pressed the SONET QUICKSET LCD menu shown in Figure 3 2 should be the first menu displayed If not press the setup key one or more times until one of the menus labeled SONET QUICKSET is visible There are four SONET QUICKSET three optical and one electrical one for each of the signal rates OC 12 OC 3 OC 1 and STSX 1 The OC 12 menu has four payload choices DS3 VT 3c and 12c The cursor in Figure 3 2 is positioned around the 3c payload pressing the ENTER key maps four 3c payloads into an OC 12 SONET signal In this mode the ST112 SONET Transmission Test Set will replicate the same 3c signal four times and the appropriate front panel rate and payload LED indicators will illuminate In this example both the receiver and transmitter OC 12 input ST112 SONET Transmission Test Set 3 3 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays and output LEDs and their 3c 12c mapping LEDs will light Use the INC or DEC key to scroll through the other SONET QUICKSET menus and the arrow keys to make your choice Choosing any OC rate will activate the Transmitter Laser Output A WARNING Before activating the LASER its output must be connected to a circuit 3 4 A second press of the SETUP k
10. Laser Classification Class 1 laser complies with Fid A Reg 21 CFR Connectors FC PC Standard ST and SC Optical Connectors are orderable options Payload Mappings STS 3c Standards Compliance Meets the requirements of ANSI T1 105A Section 8 and Bellcore GR 253 CORE Receive Input Optical Input Data Rates OC 1 51 84 Mb s OC 3 155 52 Mb s Maximum Input Power 14 dBm Operating Wavelength 1310 nm and 1550 nm 1100 nm to 1570 nm operating range Signal Sensitivity 30 dBm for BER 10 19 Connectors FC PC standard ST and SC Optical Connectors are orderable options Measurements T1M1 3 Analysis Out of Service Measurements Pattern Bit STS 3c BER Total and ratio Total Error Count Summary Bit only Total error counts ST112 SONET Transmission Test Set Table A 3 lists specifications for additional features when the ST112 is equipped with option 04 A 9 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Appendix A Specifications Table A 3 ST112 Option 04 Optical Specifications OC 1 OC 3 and OC 12 Characteristic Description Generator Output Optical Output Data Rates OC 1 51 84 Mb s OC 3 155 52 Mb s OC 12 622 08 Mb s Signal Level amp Wavelength 1310 nm 8 dBm typical 3 5 dBm Pulse Shape Meets Bellcore GR 253 CORE Eye Pattern Masks Wavelength 1260 to 13
11. T Terminal Setup 4 3 Test Time 3 5 Transmitter Connectors 2 7 V VFP 4 2 VFP Display Current Configuration 4 4 4 6 Quick Setup 4 6 Setup 4 4 Time Setup 4 7 VFP Displays APS 4 18 DSX1 Line Code Setup 4 7 Print Report Setup 4 10 Receiver Error Summary 4 20 Receiver Setup 4 11 Store and Recall Test Setups 4 8 Timed Test Setup 4 9 VFP Displays J1 Trace Message 4 31 VFP Displays Overhead 4 30 VFP Displays Receiver DS3 DSX3 Configuration 4 15 Input Configuration 4 12 Jl Trace message 4 18 Optics 4 13 Overhead Bytes 4 17 Paylosd Mapping 4 13 SPE Pointer 4 16 STS Channel 4 13 STS3C Configuration 4 16 Trouble Scan 4 20 VT Channel Configuration 4 14 VT Pointers 4 17 VT1 5 Channel Scan 4 19 VT1 5 DSX1 Configuration 4 15 VFP Displays SONET Alarms 4 28 VFP Displays SONET Errors 4 29 VFP Displays Transmitter Configuration 4 21 DCC Orderwire Configuration 4 22 DS3 Alarms and Errors 4 37 DS3 Errors and Alarms 4 38 DS3 DSX3 Configuration 4 36 Mapping 4 24 Optical Configuration 4 22 SONET Alarms 4 27 SPE Pointers 4 25 STS12C Configuration 4 40 STS3C Configuration 4 39 VT1 5 Structures 4 14 4 33 Timing 4 23 VT 100 terminal 4 2 VT Errors Alarms 4 35 VT 100 terminal emulation 4 2 VT Pointers 4 26 VFP Displays VT1 5 Channel Configuration 4 32 _w View History Key 2 15 Virtual Front Panel 4 2 Warning and caution labels xi VT Channel Mapping 3 10
12. ai ee re ere ee ea oe Iq Input 1 1 DS3 DSX3 CONFIGURATION Iw Optics I DS3 FRAMING Ir Mapping 1 CBIT UNFRM It UT1 5 Channel lIl l l l l ly UT1 5 DSX1 Cfg PATTERN DS3 PAYLOAD lu DS3 DSX3 Cfg AE 2E23 WORD lo SPE Pointer l Ip UT Pointer I Figure 4 16 DS3 DSX 3 Configuration Menu Receiver The VT100 menu shown in Figure 4 16 is used to configure the receiver to the incoming DS3 or DSX 3 DSX3 payload FRAMING and PATTERN that will be analyzed In this example the M13 M1 3 and 2E15 Pseudo Random Bit Sequence has been selected Additional FRAMING choices include the CBIT C BIT or the UNFRM Unframed configurations Additional Patterns include 2E23 Pseudo Random Bit Sequence and the 8 bit WORD ST112 SONET Transmission Test Set 4 15 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel STS 3c Configuration Menu Receiver Terminal ST112 TRM Eile Edit Settings Phone Transfers Help RX SETUP Iq Input Optics Mapping UT1 5 Channel UT1 57DSX1 Cfg DBDSs DSxXS cfg I STS3C CONFIGURATION ILS TS3C FRAMING I I I I STS3C PATTERN iZE23 Comte Figure 4 17 STS 3c Configuration Menu Receiver The VT100 menu shown in Figure 4 17 is used to configure the receiver to the incoming STS 3c STS3C payload FRAMING and PATTERN that will be analyzed In this example only t
13. Guaranteed 888 88 SOURCE www artisantg com Remote Commands ds1_bit_error DS1 Bit Error Set Command ccceeccecsecsseeseeseeeeeseceeeeeceaeeeceaecaessecaeeecasenenaeeateaes 56 ds3_bit_ rate n DS3 Bit Error Rate Set Command 0 0 eeeeceeceseeeeeseseeeceeeeeceeeeceaeceeeseeateneeneees 56 ds3_ bit rate DS3 Bit Error Rate Query Commmand cccecceccceseesseesseeeeeeeeeeeeeseeeeceeeceeeeseenseenees 56 ds3_bit_random on off DS3 Random Error Rate Set Command cseceeeeeeeeseeeeeeetenecneeerenee 56 ds3_bit_random DS3 Random Error Rate Query Command ccecccsseesseeceeesceeeeeeseceseeneeeeeeaeeenes 56 ds3_bpv_rate n DS3 BPV Error Rate Set Command eee ccesesseeeecneeeseeeeseceeseeeeeerceateneeneees 57 ds3_bpv_rate DS3 BPV Error Rate Query Command eccecccescesecesesseeeeeeeeeeeeeeeeeeseceeceeenaeeenes 57 ds3_bpv_random on off DS3 BPV Random Error Set Command 0 ceeseeeeseseeeneeerceeeeeeeneees 57 ds3_bpv_random DS3 BPV Random Error Query Command ccccceeceeseessceeeeeseeceeeeneeeeeeneeees 57 ds3_ error DS3 Bit Error Set Command 00 ccceecceceeceseeeeeecseeseceeeecneeeeceaeeeeesecaeeeesneveresaeeneeaeeates 57 error_rate on off STS Bit Error Rate Set Command 0 cccecccecceeseceseceeeeeeeeaeeeseeeeeeeeeeeseeerenerens 57 error_rate STS Bit Error Rate Query Command 0 ec eeesessseseceeeereneeeeceaeceeesesaeeseceveneaeeeeeaeeates 58 parity_rate n STS n Parity Rat
14. sssssccsscesssecccesessesscesseseessscessceesessesceessesees 7 73 Appendices Specifications ccsccscsscscsscssssscsssecsessersessessssesssesssessseesssssesssesssesscessssesssessseesseesees A 1 Incoming Inspection Test sccssccsscsssessscsssssssssssssssscssscssssescsesssessssesssesssesseessessess B 1 Calibration V CriflcatiOM ssivesscccssesascsescventess sossvenstvencess sesosesanesetuadevensessssans cOsosssswasetuesooense gt C 1 Cleaning Optical Cables ceeccssseccssessessecseeecneceecasecessecseesecsevsecnaeeeeeaeeeeeseeaeeaeeneees C 9 WON ives sass E E svesconaeiseceoesesssbeosunsooscssacens A T I 1 ST112 SONET Test Set User Manual vil Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Safety Summary General Safety Summary Review the following safety precautions to avoid injury and prevent damage to this product or any equipment connected to it To avoid potential hazards use this product only as specified To avoid potential hazards use this product only as specified Only qualified personnel should perform service procedures While using this product you may need to access other parts of the system Read the General Safety Summary in other system manuals for warnings and cautions related to operating the system Injury Precautions Use Proper Power Cord To avoid fire hazard use only the power cord specified for this product Avoid Electric O
15. INPUT VOLTAGE POWER 115 VAC FREQUENCY 60 Hz TRANSMITTER RECEIVER 52 Mb s 155 Mb s 52 Mb s 52Mbis 8KHz 155 Mb s dl DSX3 52 Mb s CLOCK CLOCK CLOCK DATA SYNC CLOCK CLOCK BITERR DATA DATA INPUT EcLOUT OUT OUTPUT INPUT INPUT ECL OUT TTLOUT 100 OHMDIFF INPUT 800 MV PK PK 50 OHM 2 800 MW TYP 50 OHM 2V 25V i 410 50 OHMAC AC COUPLED 100 OHM 75 OHM ORDERWIRE HANDSET PARALLEL PRINTER eventsynec TTL OUT Figure 2 11 Rear Panel Connectors Transmitter Connectors Rear Panel The rear panel TRANSMITTER section shown in Figure 2 11 has eight connectors The two TX CLOCK INPUT BNC connectors on the left support the STS 1 51 84 MHz and STS 3 155 52 MHz clock sources A maximum of 800 mV peak to peak can be applied to these 50 ohm AC coupled clock inputs The next three BNC connectors are ECL compatible outputs for TX CLOCK DATA and SYNC The clock and data rates are 52 Mb s NRZ formatted The synchronization rate is 8 kHz it identifies the start of each STS 1 frame The next BNC connector is TX 155 Mb s CLOCK output The signal is AC coupled and the amplitude is nominal of 800 MV The last two TX connectors on the right are Digital Signal Cross Connect inputs The BITS DSX 1 input accepts a WECO 310 plug and has a 100 ohm input impedance It is used when BITS framed DS1 all ones is selected as the SONET timing reference or when mapping ST112 SONET Transmission Test Set 2 15 Artisan Technology Group
16. No commands are coupled ANSI IEEE Functional Elements All functional elements GPIB Message Types from the ANSI IEEE 488 2 1987 standard that are supported in Test Set GPIB interface are listed below For more information refer to your computer or controller documentation and the ANSI IEEE 488 2 1987 standard Sections 4 3 7 1 1 7 3 3 and tables 4 2 4 3 l 2 3 4 5 6 7 8 9 10 11 lt DECIMAL NUMERIC PROGRAM DATA gt lt CHARACTER PROGRAM DATA gt lt NON DECIMAL NUMERIC PROGRAM DATA gt lt PROGRAM MESSAGE gt lt PROGRAM MESSAGE TERMINATOR gt lt PROGRAM MESSAGE UNIT gt lt PROGRAM MESSAGE UNIT SEPARATOR gt lt COMMAND MESSAGE UNIT gt lt QUERY MESSAGE UNIT gt lt COMMAND PROGRAM HEADER see note lt QUERY PROGRAM HEADER see note lt PROGRAM HEADER SEPARATOR gt lt PROGRAM DATA SEPARATOR gt lt PROGRAM DATA gt NOTE The ST112 SONET Transmission Test Set cannot process a lt COMPOUND COMMAND PROGRAM HEADER gt or a lt lt COMPOUND QUERY PROGRAM HEADER gt ST112 SONET Transmission Test Set 6 9 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers and Printers Specific Command Implementations Reset Command as defined in the ANSI IEEE 488 2 1987 standard the Test Set reset command rst does the following e Resets all device settings to their default values except remote interface settings e Ignores m
17. SPE Pointer UT Pointer Sonet Alarms Sonet Error TOH POH J1 Trace Messge UT1 5 Channel UT1 5 DSX1 Cfg UT Err Alarms DS3 DSX3 Cfg DS3 Err Alarms DS3X Err Alarms Current Config ST2400 TX Setup F1 F2 TX SETUP RX SETUP Phone Transfers Help IDSX1 PAT QRW IDSX1 FRM UNFRM ISONET ALM OFF l RX AUTOSEEK LINK OFF l I CURRENT CONFIGURATION l TRANSMITTER RECEIVER l IOUTPUT STSX1 INPUT OPTICI IOPTICS 0C3 I Il STS CHANNEL 11 IMAP IN UT BIT FLT MAP UT BIT FLT 1DS1 PAT QRW DS1 PAT ORW IDS1 FRM UNFRM DSI FRM UNFRHI I l l l l B1 ERRORS B2 ERRORS B3 ERRORS Pyld BIT ERRORS Payload BIT BER F3 RESULTS CTRL T SETUP T112 ST2466 Dual Mode x TEKTRONIX x RX ERROR SUMMARY 0 B1 BER 0 0E 09 0 B2 BER 0 0E 09 0 B3 BER 0 0E 08 CTRL R CTRL P RUN STOP PAUSE STOPPED BEE SECTION LINE I ST2400 OCHS l I LOS x AIS l x LOF l I x OOF x RDI l I BI x B2 l x FEBE 1 PATH UT PATH I I AIS AIS l I RDI x RDI l x FEBE x FEBE B3 x BIP 2 l x LOP l lI PAYLOADZDS1 ZD 3 I LOS AIS l I LOF RAI l I PAR IDLE I CRC YEL l I ONES x BIT l I x SYNC l CTRL Z CTRL Q REFRESH QUIT Figure 5 15 Combined Dual Mode Connection VFP Display The Virtual Front Panel VFP display in the combined mode Figure 5 15 is very s
18. ceeseeseesesesenseeeceseeeeesecatesecaeveeenaeeeceaecaeeaesateneeaeeas 19 view_angle Front panel View Angle Query Command cessessesseeseceeceeeceveeceaeeeeeaeeeeeneeas 19 view_angle n Front panel View Angle Set Command csceseecessesseeseceeeercneeeeceaeeaeeseeaeeneeaeens 19 RECEIVER SETUP AND MODE COMMAND ccccccceeeeeeeeeeeeeeeeeeeeeeeeeeeeees 20 dsx_level terminate bridge DSX STSX Level Setup Command c ececeeceseeceeseeseeeeeeeeeeeeneees 20 dsx_level DSX STSX Level Query Command cccceecceseseecsecesecseeceecaeeeaeeeeeeeeceseeeseseeeeereeeeens 20 rx_dec section line Receive Data Comm Channel Set Command e ec eeeseseecceteereeeecneeeeeneees 20 rx_dcc Receive Data Communication Channel Query Command ceeeceeeseeeceeeeeeeeeeeeeeneeeees 20 rx_map ds3 bit fl byte fl 3c 12c Rx Mapping Mode Set Command 21 rx map Receive Mapping Mode Query Command eceeesesssesecseeeeceeeeeceaeeeeesecaeesecevereaeeneeaeenees 21 rx_ocn ocl 0c3 ocl2 Receiver Optical Rate Set Command ceeceeseseesceeeeceeeteeecneeerenee 21 rx_ocn Receiver Optical Rate Query Command ecseceeccseesceeeeceseceeeeecaeeseceeeeecsaeeeeeaecaeeeeeaeeares 21 rx_owire local express Receive Order Wire Set Command cceessessceeseeceseeeceseeeeesecaeeeeneees 21 rx_owire Receive Order Wire Query Command s ssssssseessssreessststsrrsersessrerrssenresesrrsessreenssenees 22 r
19. A rtisan Artisan Technology Group is your source for quality TecmoogyGroup new and certified used pre owned equipment FAST SHIPPING AND SERVICE CENTER REPAIRS WE BUY USED EQUIPMENT DELIVERY Experienced engineers and technicians on staff Sell your excess underutilized and idle used equipment TENS OF THOUSANDS OF at our full service in house repair center We also offer credit for buy backs and trade ins IN STOCK ITEMS www artisantg com WeBuyEquipment 7 EQUIPMENT DEMOS HUNDREDS OF InstraV ea REMOTE INSPECTION LOOKING FOR MORE INFORMATION MANUFACTURERS Remotely inspect equipment before purchasing with Visit us on the web at www artisantg com 7 for more our interactive website at www instraview com information on price quotations drivers technical LEASING MONTHLY specifications manuals and documentation RENTALS ITAR CERTIFIED D a gaa tia Contact us 888 88 SOURCE sales artisantg com www artisantg com User Manual Tektronix ri ST112 SONET Transmission Test Set 070 9398 03 This document supports firmware version 4 4 and above Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Copyright 1998 Tektronix Inc All rights reserved Licensed software products are owned by Tektronix or its suppliers and are protected by United States copyright laws and international treaty provisions Use duplication or disclosure by the Government is sub
20. Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands opc Operation Complete Query Command Returns the ASCII character 1 when all previous commands and queries have been completed Example opc Response OPC n n 1 indicates incomplete n 0 indicates complete Note Used to determine when a group of commands have been completed rst Reset Command Returns the ST112 to its factory default settings and initiates the Operation Complete Idle State and Operation Complete Query Idle State Example rst Response NONE Note This command does NOT change the setup of the RS232C or GPIB ports alter calibration data alter the SESR Standard Event Status Register alter the ESER Event Status Enable Register change power on status Clear flag setting alter stored word patterns sre n Service Request Enable Command Returns the content of the Service Request Enable Register SRER Example sre 51 Response NONE Note decimal 51 indicates the register is set to 00110011 binary Using the IEEE 488 2 GPIB standard register bits are numbered 7 to 0 left to right However the SONET standard labels bits 1 to 8 left to right In either case the MSB is the left most binary bit and the LSB is the right most binary bit sre Service Request Enable Query Command Returns the content of the Service Request Enable Register SRER Example sre Response SRE n
21. Note See last section of instructions for contents General Functionality Verification This section of the User Manual tests the functionality of the unit The procedure consists of eleven sections in which the functionality of the unit is verified Note The procedure assumes you are proceeding in sequential order Before beginning the procedure you must Ram Corrupt the unit to ensure that you are starting the procedure from a known state To Ram Corrupt the unit first press ERROR once on the receiver side of the front panel Then press the LEFT cursor and then ENTER consecutively eleven times When finished power down the unit Power the unit on and the power up sequence on the display should show a Ram Corrupt message after the revision display If you do not see this message then the unit was not Ram Corrupted and the process must be done again STSX1 Quick Set Up ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test This section of the procedure verifies that the Synchronous Transport Signal Cross connect Level 1 STSX1 is functioning properly The quick set up places the unit into a default mode which selects specific settings for the unit These default settings are preprogrammed and therefore consistent from unit to unit There are eight steps in this section of the procedure 1 Connect the transmitter and the rece
22. Optics w Mapping r and VT1 5 Channel e CONFIGURATION VT1 5 DSX 1 Cfg vy DS3 DSX 3 Cfg u STS 3c Cfg i and the Current Cfg m detailed earlier in this chapter e ANALYSIS SPE Pointer 0 VT Pointer p TOH POH s J1 Trace Message g APS Bytes A VT Channel Scan j and Trouble Scan n ST112 SONET Transmission Test Set 4 11 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel Input Setup Menu Receiver File Edit Settings Phone Transfers Help RX SETUP Tis IIL NPG Haale sousimasaasassna gig ena Iq Input INPUT Iw Optics BINPUT SELECTION STSX1 DSX3 DSX1 aed RX AUTOMATIC INPUT MODE Wag AUTOSEEK AUTOLINK Ir Mapping It UT1 5 Channel ly UT1 5 DSX1 Cfg lu DS3 DSX3 Cfg 11 I lI I 11 l lI I 11 l 11 l lo SPE Pointer BIPOLAR TERHINATION l lI I 11 I 11 l lI I lI l l Ip UT Pointer MONITOR Is TOH POH DCC ACCESS Ig J1 Trace Messge LINE Ih APS Bytes ORDERWIRE Ij UT Channel Scan Mna EXPRESS In Trouble Scan ba an wa Figure 4 10 Receiver Drop Configuration The INPUT menu q has five areas INPUT SELECTION RX AUTOMATIC INPUT MODE BIPOLAR TERMINATION DCC ACCESS and ORDERWIRE Use the up and down arrow keys to move the reverse video cursor between menu areas Use the left and right arrow keys and the enter key to position the reverse video cursor on any selection within the m
23. Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers and Printers Using the RS 232 C Port The following section describes the RS 232 C serial port All port setup procedures are detailed in Chapter 4 Menus and Displays Serial Interface Parameters ST112 SONET Transmission Test Set serial port parameters are listed in Table 6 1 along with their available values and default value In addition ECHO and XON XOFF can be changed remotely via the GPIB or RS 232 port Table 6 1 RS 232 C Serial Port Parameters Default Value 9600 None EOL End of Line terminator CR ASCII decimal 13 CRILF LF ASCII decimal 10 CRILF or LF CR XON XOFF Flow control ON enabled or OFF disabled ON ECHO Echo back to the controller each ON enabled or OFF disabled ON character received by the Test Set RS 232 C Connector Pinout The RS 232 C interface is a 9 pin D type socket connector located on the rear panel The pin out of this connector is shown in Table 6 2 below The ST112 SONET Transmission Test Set RS 232 C port is wired as a DCE data communications equipment device it receives on pin 2 and transmits on pin 3 Table 6 2 RS 232 C Connector Pin out NAME o FUNTON k 4 CTS Clear To Send A high level or open applied to this pin indicates to the Test Set that the controller or terminal is ready to receive data A low level indicates that ni the controller o
24. Receiver Description ccsccsssssssssssscsssssssssssscsssssesssscssscsssesessssssssesssessseessceseesssessnees 2 8 Receiver Connectors Front Panel 0 0cccccccccccsssceceescececsssceceesseeecsesseeecssseeceessseeeeaes 2 8 Input Key ReCeiversiccscisdpccvigert aia ecssviorsebshierosscnveniebdiensctees Ea a EROE ah detec 2 8 Configuration Keys RX isecen iiaeie ien r RERE EEEE EEE REEERE 2 9 Receiver Status Indicators cccccccecsssceceessececssseececuceecesssececsneecsecseeeesessececssneeeessaes 2 9 Section Alarms cccccecscccssscesscecssecesscecssecseccecssecesseccsseceeeeecsseceeeecsaeceeeecsaeeseeessaeeeses 2 9 Tene Alaris es cose schist av sdeateed sae it dee escastevvaxsden Hatsasex are vaso 2 10 Path A Varna oss 35d sbsei ea inn cence A aes Peon ea VEG aca vd a a Haneda vada Pea ages eS 2 10 WT PAMAIN MS iee E EE E EE EERIE 2 11 Po int t Indicator Ssni nenene meiner a SEEE AEE ETENE NTG E 2 12 Payload DS1 and DS3 Indicators eccesceseesseeeceeeceeeceeceseceeeceeecnaeceecaeecaeeeaeeneeees 2 12 VICW HIStOTY Key E E E E A A 2 13 Measurement Controls and Indicators sssesessesoseceseessoseoeceessoseoececeeesoseoeceessoseoecesses 2 14 Remote INGICATORS scidecccecicsscesseccoscscsssesusscesecesvecavestess sa tesveceseses seduce scotenssdesusvsdesessseeseousessess 2 14 Rear Panel Description csccsssssscssscsssssssssesssscsssessesssessssesssesssesscssscsssssssesscsseesecess 2 15 Rear Panel
25. SETUP Iq Quick Setup TIMED TEST Iw Time MEASURE CONTROL TIMED REPEAT 11 11 Ir DSX Line Code 11 11 ly Timed Test TEST TIME 11 11 11 It Store Recall lu Report Printing Im Current Cfg l DD HH HH SS 00 00 00 10 Figure 4 7 VFP Timed Test Setup Display The TIMED TEST submenu y is selected by pressing the letter y on the keyboard Use the up and down arrows to move between the MEASURE CONTROL and TEST TIME fields Use the left and right arrows to move within the fields Moving to the end of the TEST TIME field with the left or right arrow will switch to the MEASURE CONTROL field Moving to the end of the MEASURE CONTROL field with the left or right arrow will not switch to the TEST TIME field Use the number keys to change the time that the test will run for in terms of days DD hours HH minutes MM and seconds SS The maximun test time supported is 9 days 23 hours 59 minutes and 59 seconds All changes are immediately entered into a battery backed memory and will be retained even when the Test Set is powered off ST112 SONET Transmission Test Set 4 9 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel Print Report Setup Terminal ST112 TRM File Edit Settings Phone Transfers Help t SETUP s lt s2ss54 s iP Poe sess ess Seesasssesesesseas s s lt Iq Quic
26. UNFRAMED SF ESF SLC96 DS3 UNFRAMED M13 C BIT Payload Mappings VT1 5 BIT FLOAT INT EXT VT1 5 BYTE FLOAT DS3 INT EXT Active Channel DS3 Mapping All STS 1 s are filled with the selected DS3 pattern VT1 5 Mapping Any 1 channel or all channels are filled with a selected VT1 5 pattern If a single channel is selected then the remaining channels are filled with a unique SF 24 bit fixed word pattern Signal Level at Transmit DSX 1 3 0 0 3 volts peak Output DSX 3 0 5 0 2 volts peak Output Amplitude STSX 1 0 5 0 2 volts peak STS 1 ECL Pulse Shape at Transmit DSX 1 Meets TR TSY 000499 Issue 1 December 1987 Output DSX 3 Meets TR TSY 000499 Issue 3 December 1989 See Note STSX 1 Meets TA NWT 000253 Issue 8 October 1993 See Note Note The six STSX1 DSX 3 outputs are provided through three 2 way power splitters Each pair taken side by side must be terminated in 75 ohm resistive to meet the pulse shapes specified Isolation between each pair exceeds 15 dB A slight waveform aberration will occur on an opposite output if it s pair is not terminated but will typically pass pulse shape tests ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Appendix A Specifications Impedance Connectors DSX 1 Balanced 100 ohm WECO 310 jack DSX 3 Unbalanced 75 ohm BNC STSX 1 Unbalanced 7
27. serial Print Port Select Command 00 ei eeeeeeeeeeeeceseeeeeeceeeecneeeecaeeeeeaeenees 17 rs_echo on off RS 232 Echo Control Command ccceccceescessceseceseeceeeeeeeeeeeeeeeeeeeseenaeeeseeeneeenes 18 rs echo RS 232 Echo Control Command ccccccecscesssessceseecececscecseeceeeeneeeeeeeeeseeenseeeaeeeeecseeeaeeenes 18 rs_pmt lf on off RS 232 Prompt Linefeed Set Command 0 ee ceeeeseeeeeeeeeeeeeeeecnereeeneeeeeaeeeres 18 rs_ pmt 1f RS 232 Prompt Linefeed Query Command ecccecccesccesceeseeeeceeeeeeeeeeeeneeeeeeeeeaeeenes 18 rs_prompt s RS 232 prompt command oreroraa iaee ater EE EEEE 18 rs_xon xoff on off RS 232 Flow Control Set Command sssssseeeseeeesseesersessrerssstsrresesseseessesees 18 rs_xon_xoff RS 232 C Flow Control Query Command 0 ceeeseeeseceeceseeeeeeeeeeeeceneeaecateeeeneeeres 19 ST112 SONET Transmission Test Set 7 5 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands save setup n Save Setup Command cccceessessseescesscesceeeceeeceseceaeceaeceaecseecaeecaeeeaeesaeseeeseeeeereetees 19 stored Stored Setup Query Command ccccccccessecsseesceesceseceseceeeceaecaecaeecaeesaeseneseneseeeeseeeeeeeeesereees 19 time hh mm ss J Internal Time Clock Set Command cccecccececscessceseceeceneceeeceeeseeeseeneeenrenes 19 time Internal Time Clock Query Command
28. slc Tx WT Frame Set Command ou ceceeeceseecceecneeeeeeeeeeeeeeees 35 tx_vt_ fram Transmitter VT Frame Query Command cceceseecesseseeeeeceeeeeceaeeevercnaeeneeaeeneeaeens 35 tx_vt_mode all single Tx VT Mode Set Command 000 cee eccecseceseeeeeeceseeeeesecaeesecneveeeaeeeeeaeenees 35 tx_vt_mode Transmitter VT Mode Set Command sssseeeeesesesrseeeterersrsrirretsresrsrstrersrssssrsrereeree 35 tx_vt_patt prbs_23 prbs_15 qrw word Tx VT Pattern Set Command seieeeceeeeeeeeereereeeree 35 tx_vt_patt Transmitter VT Pattern Query Command eececesseesceseeseseeeseceeeeeceeeecaeeeeeeceaseneeaeeas 35 vt_word b1 b2 b3 VT 24 Bit Word Set Command cccccccccccssscesscecssecsescecseseeseeccsseceseeeesaeeses 36 vt_word VT 24 Bit Word Query Command ccseeeceesescsseeeceseceesseceeceaeeeeeaecaeeeesnaereeaseneeaeeas 36 POINTER COMMANDS SPE iic s2 eee eee eee aa 37 burst_state Burst State Query Command isisisi ii iai 37 spe_burst pos neg SPE Burst Pointer Set Command 00 ceeeeceeeeecseeeeceseeeeeeceeeeeeeereeaeeneeaeeas 37 rx _pos_pj Receiver SPE PJ Query Command sseseeseeeeseeseseieresesstsrsrretststsistetrsrerreesessesesrrerees 37 rx_neg_pj Receiver SPE PJ Query Command ccececeeccesesceetecseeeeceeeereaeeeeeaecaeeeenaeenesateaeeneees 37 rx_spe_ndf Receiver SPE NDF Count Query Command eeeseseeereessesrerrrrererssrsrsrerrerersersrseee 38 rx_spe_pntr Receiver SPE
29. 155 622 IN OC 3 OC 12 optical input connector e The ST112 SONET Transmission Test Set Receiver input is connected to the ST2400 155 622 OUT OC 3 OC 12 optical output connector e The OC 48 NE Network Element receives its signal from the ST2400 2 4Gb s OUT OC 48 output connector and sends its signal to the ST2400 2 4Gb s IN OC 48 input connector The Rear Panel connections are NOT illustrated in Figure 5 12 but the following connections are used e Connect the RS 232 cable between the ST112 SONET Transmission Test Set and the ST2400 The cable is a straight through DB 9 socket to DB 25 plug The DB 9 socket connects to the ST2400 plug labeled ST112 SONET Transmission Test Set RS 232 The DB 25 plug connects to the ST112 SONET Transmission Test Set labeled RS 232 e Connect the RS 232 cable between the ST2400 Test Set and a Terminal A straight through cable with a DB 9 plug connects to the ST2400 Test Set RS 232 socket The other end is adapted to the Terminal requirements The hardware configuration and cabling shown in Figure 5 12 can be used to setup and run tests in the Combined Dual Mode A fiber optical cable with a 15 dB fixed value attenuator such as AMP 06 0033 FC is used in place of the OC 48 NE to loop the output of the ST2400 Test Set to its input A CAUTION Always use 15 dB of attenuation when connecting the ST2400 transmitter output to its receiver input Failure to do so will damage the optical det
30. 2 8 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview Configuration Keys Receiver The front panel configuration keys and their menus will be detailed in Chapter 3 LCD Menus and Displays In general six are in the general area and three are in the DS VT 3c area They are as follows OVHD Overhead MAPPING CHANNEL POINTER DCC OW Data Communications Channel Orderwire ERROR PATTERN FRAMING and ERROR Receiver Status Indicators Figure 2 6 Receiver Status Indicators The status indicators Figure 2 6 are divided into six groups that are detailed below The appropriate LED indicator will light for a minimum of 200 milliseconds when a corresponding alarm or error is detected Detected errors and alarms are stored as historical data Section Alarms The Section is a transmission medium that includes termination at both ends Ina SONET transmission system it includes the optical connections between two regenerators or between a Network Element and the adjacent signal regenerator The Test Set has four section alarm LED indicators as follows e The receiver LOS Loss Of Signal alarm indicates an STS n or OC n signal failure in the monitored direction e The receiver LOF Loss Of Frame alarm indicates that more than 3 milliseconds of an out of frame condition has occurred e The OOF Out Of Frame alarm indicate
31. 24 In the receiver s STATUS section of the front panel under the PAYLOAD DS1 DS3 heading observe that the red LEDs for AIS SYNC and BIT remain lit 25 Using the LEFT RIGHT cursors select OFF and then press ENTER 26 Press RUN STOP twice to clear all errors 27 Using the LEFT RIGHT cursors select IDLE and then press ENTER 28 In the receiver s STATUS section of the front panel under the PAYLOAD DS1 DS3 heading observe that the red LEDs for IDLE SYNC and BIT remain lit 29 Using the LEFT RIGHT cursors select OFF and then press ENTER 30 Press RUN STOP twice to clear all errors OC1 Quick Set Up This section of the procedure verifies that the Optical Carrier Level 1 OC1 is functioning properly The quick set up places the unit into a default mode which selects specific settings for the unit These default settings are preprogrammed and therefore consistent from unit to unit This section and the two following sections only apply if the unit contains an optical option For all optical sections an in line 5db optical attenuator is required between the transmitter and receiver optical connectors Before any connections are made use the optical cleaning kit to clean the cable ends the attenuator ends and the optical connectors on the front panel of the unit Note The last section of the procedure provides an equipment list and simple instructions on how to clean the optical connectors Leave everything set up as it was in th
32. 3 The RS 232 C port setup baud rate data bits parity etc may not be compatible with that of the terminal both setups should be the same Protocol The ST112 SONET Transmission Test Set RS 232 C port operates in a terminal mode Received characters are stored in the receive buffer until a line terminator CR LF LF CR or CR LF is received at which point the command is executed Before a line terminator is received the backspace key is used to erase the last right most character in the receive buffer You may use EVEN or ODD parity to perform byte by byte error detection 6 4 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers and Printers Command Format Refer to Chapter 7 Remote Commands for an explanation of the Test Set commands Except for terminator characters the same commands are used on the GPIB port Error Messages The ST112 SONET Transmission Test Set verifies all commands received on the RS 232 C port to make sure that they contain the appropriate mnemonics and parameters All valid commands will be executed The Test Set will issue an error message and discards the command when the mnemonic is invalid or an associated parameter is out of range Error messages are listed in Table 6 3 Table 6 3 RS 232 C Port Error Messages ERROR MESSAGE po MEANING _ O Input Lost The RS 232 C interface
33. Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com A rtisan Artisan Technology Group is your source for quality TecmoogyGroup new and certified used pre owned equipment FAST SHIPPING AND SERVICE CENTER REPAIRS WE BUY USED EQUIPMENT DELIVERY Experienced engineers and technicians on staff Sell your excess underutilized and idle used equipment TENS OF THOUSANDS OF at our full service in house repair center We also offer credit for buy backs and trade ins IN STOCK ITEMS www artisantg com WeBuyEquipment 7 EQUIPMENT DEMOS HUNDREDS OF InstraV ea REMOTE INSPECTION LOOKING FOR MORE INFORMATION MANUFACTURERS Remotely inspect equipment before purchasing with Visit us on the web at www artisantg com 7 for more our interactive website at www instraview com information on price quotations drivers technical LEASING MONTHLY specifications manuals and documentation RENTALS ITAR CERTIFIED D a gaa tia Contact us 888 88 SOURCE sales artisantg com www artisantg com
34. Guaranteed 888 88 SOURCE www artisantg com Remote Commands rs_echo on off RS 232 Echo Control Command Enables or disables the echo on the RS 232 C port Example rs_echo on Response NONE Note When the echo is on the ST112 will echo back each ASCII character sent to the RS 232 C port Full Duplex mode When the echo is off the ST112 will NOT echo back ASCII characters sent to the RS 232 C port Half Duplex mode rs_echo RS 232 Echo Control Command Returns a character string that indicates whether the echo control is enabled or disabled Example rs_echo Response RS_ECHO ON Note Indicates that the echo control is enable Full Duplex Mode The response OFF would indicate that the echo control was disable Half Duplex Mode rs_pmt_lIf on off RS 232 Prompt Linefeed Set Command Enables or disables the current RS 232 EOL end of line terminator Example rs_pmt_If on Response NONE Note The current EOL can be set to CR LF CR LF or LF CR rs_pmt_lf RS 232 Prompt Linefeed Query Command Returns a character string that indicates the current RS 232 EOL end of line terminator status Example rs_pmt_lf Response RS_PMT_LF ON Note The current EOL can be on enabled or off disabled Its value is unknown It may be set to CR LF CR LF or LF CR using the quick setup menu rs_prompt s RS 232 prompt command Set the character string s on the RS 232 prompt Example rs_prompt ST112 Unit A
35. Press RUN STOP twice to clear all errors Transport Overhead Path Overhead This section of the procedure ensures that the editing function is working accurately Leave everything set up as it was in the last section There are seventeen steps in this section of the procedure On the transmitter side of the front panel press OVHD until the top line shows D7 D8 D9 and Z3 Using the LEFT RIGHT cursors select D7 Note The brackets showing the selection do not appear in the OVHD menu The cursor flashes underneath the position of the current selection Using the INC DEC keys and the LEFT RIGHT cursors change D7 to AA and then press ENTER Using the LEFT RIGHT cursors select D8 Using the INC DEC keys and the LEFT RIGHT cursors change D8 to 11 and then press ENTER Using the LEFT RIGHT cursors select D9 Using the INC DEC keys and the LEFT RIGHT cursors change D9 to 05 and then press ENTER On the receiver side of the front panel press OVHD until the top line shows D7 D8 D9 and Z3 On the display observe that D7 D8 and D9 all reflect the values you placed into the transmitter i e D7 AA D8 11 D9 05 and Z3 00 On the transmitter side of the front panel press OVHD Using the LEFT RIGHT cursors select D7 Using the INC DEC keys and the LEFT RIGHT cursors change D7 to 00 and then press ENTER Using the LEFT RIGHT cursors select D8 Using the INC DEC keys and the LEFT RIGHT cursors
36. Response VT_YELLOW CUR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on ST112 SONET Transmission Test Set 7 53 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands Transmitter Error Commands b1_ parity B1 Parity Error Set Command Generates a single STS n section BIP 8 code violation Example b1_parity Response NONE Note Inverts one bit of the b1 byte b2_parity B2 Parity Error Set Command Generates a single STS n line BIP 8 code violation Example b2_parity Response NONE Note Inverts one bit of the b2 byte b3_parity B3 Parity Error Set Command Generates a single STS n path BIP 8 code violation Example b3_parity Response NONE Note Inverts one bit of the b3 byte bip2_error VT BIP 2 Parity Error Set Command Generates a single VT BIP 2 code violation VT1 5 Bit Interval Parity error Example bip2_error Response NONE Note Inverts one of the two parity bits in the V5 byte bip2_rate n VT BIP 2 Parity Error Set Command Generates the VT1 5 Bit Interval Parity error rate Example bip2_rate n Response NONE Note The error rate is a negative exponent from 1 0E 9 to 1 5E 3 bip2_rate VT BIP 2 Error Rate Query Command Returns the VT1 5 Bit Interval Parity error rate settings Examp
37. SF Lo Priority 5 Invalid 13 SF Hi Priority 6 Wait To Restore 14 Forced Switch 7 Invalid 15 Lockout Protect VT1 5 Channel Scan Analysis Display Receiver File Edit Settings Phone Transfers Help RX SETUP hee sea SS S8 Sse SSS ses SS 4 4S55S s Iq Input UT 1 5 CHANNEL SCAN l Iw Optics STS CHANNEL 1 l Ir Mapping I I Valid STS Channels 1 3 l It UT1 5 Channel 1 1 UT UT UT UT l ly UT1 5 DSX1 Cfg 11 1 chol 8 15 22 l lu DS3 DSX3 Cfg I 2 cho2 9 16 23 l lo SPE Pointer 11 3 DZQW 10 17 24 l Ip UT Pointer I I 4 cho4 11 18 25 l Is TOH POH I 5 ch05 12 19 26 l Ig J1 Trace Messge I I 6 chO6 13 20 27 l Ih APS Bytes II f 14 21 28 l Ij UT Channel Scan I ENABLE SCAN OFF W In Trouble Scan SES ian 5355 S 2 ses S eS Figure 4 23 VT1 5 Channel Scan VT1 5 Channel Scan shown in Figure 4 23 can be used to detect the unique channel ID Identification Code in of each of the VT1 5 channels and detect the Framing and Pattern used on one or all of them In this example the first six channels have been scanned The channel ID for each except channel three has been displayed Channel three displays the letters D QW for its framing and pattern indicators as indicated in Table 4 1 VT1 5 Channel Scan cannot be used when Trouble Scan is running VT1 5 Channel Scan Use and Operation is detailed in the Applications Chapter of this manual Table 4 1 VT Channel Scan Framing and Pattern Codes Framing Codes Patt
38. Section B1 ES SES BER Seconds and ratio Total Error Count Line B2 ES SES BER Seconds and ratio Total Error Count Path B3 ES SES BER Seconds and ratio Total Error Count STSX 1 BPV BER Total and ratio Total Error Count VT BIP 2 BER Total and ratio Total Error Count Summary B1 B2 B3 FEBE Total error counts For VT only BIP 2 FEBE LOP STAT Elapsed Time Displayed in hours minutes seconds T1M1 3 Analysis Out of Service Measurements Pattern Bit DS1 and DS3 ES SES BER Second and ratio Total Error Count Pattern Parity DS3 ES SES BER Second and ratio Total Error Count Pattern CRC 6 DS1 ES SES BER Second and ratio Total Error Count Summary For DS3 Frame Parity and Bit Total error counts For DS1 Frame CRC and BIT Elapsed Time Displayed in hours minutes seconds LEDs SECTION Status Indicators LOS LOF OOF B1 LINE Status Indicators AIS LOP RDI B2 PATH Status Indicators AIS RDI FEBE B3 VT PATH Status Indicators AIS RDI FEBE BIP 2 POINTER SPE or VT Status Indicators NDF PJ PJ PAYLOAD DS1 DS3 Status Indicators LOS LOF PAR CRC AIS RAI IDLE YEL DS3 ONES SYNC BIT Measurement Utilities Measurement Control UNTIMED Start Stop TIMED 1 seconds to 9 days with 1 second resolution REPEAT Result Logging All measurements are recorded with start stop time and date The current and previous
39. Test Mode Query Command ccccccseesseesceesceeeceseceaeesnecsaecaeeeseseeeeeeeseeeseeenaeeeaeenaeenaes 27 test_print log prev current off Test Print Set Command ee ececesesseeeecneeeecneeeeceseeeeeaeenees 27 test_report log eot both off Test Report Set Command ceceeeccesesseeneceeeeecneeeeceaseneeaeenteaes 28 test_report Test Report Query Command sissie Rii 28 test_squelch on off Test Squelch Set Command 0 ec cceceeceeceseeeeseeeeeceeseecaeeeceaeeaeeeeeaeeneeneees 28 7 6 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands test_squelch Test Squelch Query Command cccecccescceseceecesecseecseeeseeeeeeeeeeeeaeceaeeaeenseeseeeaeeeaes 28 test_state run stop Test State Set Command 0 cee eeeeecenceeeceseeeeeseceeesecaeeeeeneeercaecatsaeeateneeaeeas 28 test_state Test State Query Command ices cevsecesicscccieciaveescvecechsveccs tanesteachactesinectevsteesscaadivesevsdesceeesse 29 test_time d hh mm ss Test Time Set Command ceccccecsseesseeseeesceeeeeeeeeeceaeeeaecnaecneecaeeaeeenes 29 test_time Test State Query Command ecceccesccesecesecesecseeeseeeseeeeeeseeeseeeeeeeeeeeeeseeeseenseeeaeenaeenaes 29 pause state pause resume Pause State Set Command ceccccecsseeseeesceeeeeeeeeeeceeeeeseesseeeeeseeeaes 29 pause_state Pause State Query Command
40. The display is a two line by twenty four character back lit super twisted Nematic LCD liquid crystal display that provides a sharp image and increased viewing angle in all directions The LCD display is used to present main menus submenus and test results There are five display controls and one LED indicator The right and left arrows are used to position the LCD cursor The INC increment and DEC decrement keys are used to change values The ENTER key is used to insert the selected value The ENTER key houses an LED indicator that flashes whenever an action is requested or required It will continue to flash until the ENTER key is pressed entering a new value or executing the function Tektronix ST112 SONET Transmission Test Set INC B ENTER 0 0 DEC serup m E TRANSMITTER INC P ENTER DEC SETUP Figure 2 2 ST112 SONET Transmission Test Set LCD Display 2 4 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview Setup Menu System The SETUP key is located below the ENTER key on the front panel Pressing the SETUP key at any time will start the menu sequence as Figure 2 3 shows Each additional press represented by the black arrow will access the next menu There are nine main menus some of which have submenus All menus are detailed in Chapter 3 LCD Menus and Displays The SETUP menus are arr
41. Then view channel 4 with its 3c payload would be all of the second STS 3 all three STS 1 channels The last six view channels would be multiplexed into the last two STS 3 channels View channels are numbered sequentially from the first STS 1 1 1 to the last 4 3 l Terminal ST112 TRM OLX File Edit Settings Phone Transfers Help Oc ctertestertestententontentontontententontontontontontentententententeeteereetententententententertententententententeatentententedeateatetereetetententestetententetestestedtedestetedtetateteatetetetetetetetetetetet l DWELL PERIOD EVENT LOG ISTART 1992 02 20 17 37 06 RATE STS12 CHANNEL 3 ENTRY 1 of 1 ISTOP 1992 02 20 17 37 16 l SECTION LINE PATH B1 ERRORS 17901 B2 ERRORS e B3 ERRORS 16966 B1 ES 1 B2 ES 1 B3 ES 1 B1 SES 1 B2 SES 1 B3 SES 1 SUMMARY OF EVENTS DETECTED l l l l l l l IB1 ERR B2 ERR PATH RDI B3 ERR l l l l l l l l FEBE ERRORS 3939 l l l l l l l l l IHIT L KEY TO VIEW DETAIL EVENT LOGS HIT C KEY TO EXIT VIEW LOG esses esses sssn IBUIEW CHANNEL PRINT CURRENT ALL FOR CHANNEL MU I GOTO ENTRY 1 PRINT DETAIL FULL I PAGE UP U PAGE DOWN D STOP PRINT JOB S I nnn F1 F2 F3 CTRL T CTRL R CTRL P CTRL Z CTRL Q TX SETUP RX SETUP RESULTS SETUP RUN STOP PAUSE REFRESH QUIT ST112 TEKTRONIX STOPPED Figure 5 22 Dwell Period Event Log for VIEW CHANNEL 3 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guara
42. e The FEBE Far End Block Error indicates VT1 5 path bit errors in the other direction i e the unmonitored direction In other words the PTE receiving the other direction of the monitored VT1 5 has detected one or more path BIP 2 code violation e The BIP 2 LED indicates that VT 1 5 path code violations were detected indicating an error condition in the monitored VT path between the monitor point and the upstream PTE ST112 SONET Transmission Test Set 2 11 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview Pointer Indicators Three SPE and three VT indicators show the occurrence of Pointer Justifications PJ and New Data Flags NDF Each of these will flash for about 1 second each time the associated event occurs They are not status indicators and they have no history state Under normal network conditions the New Data Flags NDF rarely occur The Pointer Justifications PJ are commonly activated by either the STS n or OC n signal sources The PJ VT pointers are commonly activated by their VT1 5 payloads The function of each POINTER indicator is as follows e The NDF will flash one time when a new data flag indication is detected This condition can occur when bench testing network elements when signal or timing is loss or when a new timing is switched e The PJ will flash one time when a positive pointer adjustment is detected e The PJ will flash on
43. f is shown in Figure 4 13 It is used to configure the VT1 5 channel format It is only accessible when a VT map is selected from the receiver s Mapping Menu r The VT CHANNEL NUMBERING at the top is used to map the virtual tributaries sequentially 1 to 28 or in a four by seven 4x7 matrix in accordance with Bellcore GR 253 CORE illustrated in Figure 4 13 The lower portion of this display shows that 28 channels are accessible 1 28 and that STS Channel 1 in this example is being analyze Use the arrow keys to position the reverse video cursor and the enter key to activate the menu choice VT1 5 Structured STS 1 SPE 4x7 mapping numbered in groups of seven 31 32 33 4 29 30 58 59 60 61 62 J1 R R B3 R R lezl R R ee OIN om ONY te wr Ww T a1 TIE TININI D SHINO eN elon Ny To e N DESEES se te te e e e e F2 AQ 19 ajaja 1 ajaa eaa aajo 19 ig 19 0 ES lela Ce Slee Eee Z Fd gt ed Pel dled ed bl ol call bale gt gt gt Hl 2 le gt gt zal R R Z5 R R yr ae BE E E amp e VT1 5 Structured STS 1 SPE 1x28 mapping numbered sequential 1 29 30 31 32 33 58 59 60 61 62 87 J1 R B3 R R c2 ME ME a fal m AaS NARAS NA
44. i 2 19 B ig jig 2 19 jo 2 9 Py ad nel E lt ire leZ lt ir icc IE lt Has E E gt EIIEJE gt a gt le gt gt l gt gt Z4 R R z5 R R QU Ow Figure 3 8 VT1 5 Structures 3 10 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays Table 3 1 VT1 5 Locations and Channel Numbering Conventions Group VT VT 1 5 VT 1 5 STS 1 SPE Bellcore TA 253 1 x 28 format 4x7 format J Column s 9 38 67 10 39 68 11 40 69 12 41 70 13 42 71 14 43 72 15 44 73 16 45 74 17 46 75 18 47 76 19 48 77 20 49 78 21 50 79 22 51 80 23 52 81 24 53 82 25 54 83 26 55 84 27 56 85 28 57 86 29 58 87 ST112 SONET Transmission Test Set 3 11 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays Pointer Displays Receiver Figure 3 9 Pointer Displays Receiver Pressing the POINTER key will access the RX PTR Receiver Pointer displays shown in Figure 3 9 They are used to monitor the number of pointer adjustments and NDF New Data Flags that occur during the test cycle The SPE and VT pointers keep track of the starting positions of their respective payload envelopes In this example Figure 3 9 the pointer value 522 in the SPE display represents the offset of the first SPE byte J1 The pointer word is located in the H1 and H2
45. los time n Loss Of Signal Time Command sssseseseseseseesseeesssessesestesessteressesesresreseseessesesesseent 72 los_time Loss Of Signal Time Query Command cceeccescesecssesssesseeeseeeeecaeeeeeeeeeseeeeecesseeeeeaees 72 l s SECS AM e RERE ERE eden cxdtute slag E RR md easeuastas tac R deituaracertadasds 72 lOS tena e e E Von eer rerereer terete reese 12 ILOA o rA E EE EE E T2 NOS COME fs ccivevei ch nespsvncnsentehdvecg nara riaa ao EEEN EEEE AEAEE EE Oean T ERRER SA OEPS AE EE Aa a 72 los ACHVE eaei e E RE E beta estes ave teics eats ev ai vik rs RERE HAE EEE AE E AEE E ERa 73 COMBINED DUAL MODE COMMAND c eeeeeeeeeeeeeeeetteteeneneneeeeeeeeees 73 combined_mode on off Combined Mode Set Command 0 0 0 ececeeccesesccesecreeseceeeeecneeeeceneeeeeaeens 73 combined_mode Combined Mode Query Command cc cceessssescseseeceseeecesecseesaeeeceaeceeesecneeenenes 73 ST112 SONET Transmission Test Set 7 11 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands General Commands header on off Header Mode Set Command Enables or disables headers The header is the part of a response that replicates the command Arguments on enables headers in the response to any query command off disables headers Example header on Response NONE Note When the header is on the query command gpib_bus will respond with both the header a
46. n 2 sets the ST112 to the OC 3 factory default settings n 3 sets the ST112 to the OC 12 factory default settings n 4 sets the ST112 to the DSX 1 factory default settings n 5 sets the ST112 to the DSX 3 factory default settings Example quick_setup 3 Response NONE audio_vol n Audio Volume Set Command Sets the audio volume of the internal speaker Example audio_vol n n a decimal integer from 0 to 8 Response NONE Note 0 off 1 minimum and 8 maximum volume audio_vol Audio Volume Query Command Returns a decimal integer from 0 to 8 Example audio_vol Response AUDIO_VOLn Note n a decimal integer from 0 to 8 date yy yy mm dd Date Set Command Sets the instrument s internal calendar Example date 1996 08 30 Response NONE ST112 SONET Transmission Test Set 7 15 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands date Date Query Command Returns a character string indicating the internally stored date Example date Response DATE 1996 08 30 dsx1_code ami b8zs DSX 1 Code Configuration Set Command Configures the DSX 1 code for both the input and output Argument ami Alternate Mark Inversion bipolar b8zs bipolar with 8 zero substitution Example dsx1_code ami Response NONE dsx1_code DSX 1 Code Configuration Query Command Returns a character string that indicates the DSX 1 current Code Config
47. octets to low density octets and rapid 1 0 1 0 transitions e The 1 IN 8 pattern containing strings of seven sequential zeros is used on a circuit equipped with B8ZS to determine the ability of a circuit to handle payload signals having a minimum ones density Use of this pattern will often reveal the existence of timing recovery problem under conditions of low signal density e The 2 IN 8 pattern is used to verify the correct optioning of the circuit for AMI or B8ZS line coding e The 3 IN 24 pattern is used to determine the ability of network equipment to function properly when transporting signal sequences containing both minimum density and a maximum of fifteen consecutive zeros during periods of minimum overall pulse density Valuable for testing AMI circuits the 3 IN 24 pattern is of little use of circuits equipped with B8ZS options for clear channel operation e The AIl ONES pattern consists of a series of consecutive ones For tests of T1 span lines the all ONES pattern causes the span line repeater to consume the maximum amount of power If the DC power delivered to a regenerator is incorrect transmission errors may occur as a result of insufficient pulse power or distorted pulse shapes of the all ONES signal output of a regenerator e The framed all ZEROS pattern is useful as a final confirmation that all network elements in a circuit are properly optioned with B8ZS for clear channel operation The framed all ZEROS pattern
48. prbs_15 prbs_23 word Rx DS3 Pattern Set Command Sets the receiver to the selected DS3 Test Pattern Argument prbs_15 Inverted PRBS Pattern 215 1 prbs_23 Inverted PRBS Pattern 223 1 word an eight bit sequence set with the ds3_word command Example rx_ds3_pat word Response NONE 7 30 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands rx_ds3_pat Receiver DS3 Pattern Query Command Returns a character string indicating the current receiver DS3 Test Pattern Example rx_ds3_pat Response RX_DS3_PAT WORD Note PRBS 15 PRBS 23 and WORD are the three test patterns that can be received rx_stress daly1 daly2 daly3 word_18 word_28 word_324 ones zeros off Receiver Stress Test Set Command Sets the Stress Test Pattern to be compared with the received DSX 1 Payload Pattern Argument daly1 55 octet pattern daly2 55 octet pattern modified version of daly1 daly3 55 octet pattern modified version of daly1 word_18 1 in 8 pattern containing a string of 7 zeros word_28 2 in 8 pattern word_324 3 in 24 pattern ones all ones pattern zeros all zeros pattern off returns to the pattern set by the rx_vt_patt command Example rx_stress word_324 Response NONE Note The Stress Test only functions in the DSX 1 mode to run use quick_setup 4 See tx_stress Transmitter Stress Test Set Command r
49. s STATUS section of the front panel observe that the following error lights appear A Under the SECTION heading the red LEDs for LOF and OOF remain lit B Under the LINE heading the red LEDs for AIS LOP and RDI remain lit The red LEDs for AIS LOP and RDI may flash C Under the PATH heading the red LEDs for RDI FEBE and B3 remain lit The red LED for RDI may flash D Under the PAYLOAD DS1 DS3 heading the red LEDs for LOF PAR SYNC and BIT remain lit E Under the SPE section of the POINTER heading the yellow LED for NDF remains lit and the green LEDs for PJ and PJ remain lit 14 Using the LEFT RIGHT cursors select OFF and then press ENTER 15 Press RUN STOP twice to clear all errors You have now successfully verified that the unit is functional If you had any problems with the unit while performing the tests repeat the procedure paying careful attention to the set up of the units and the directions given If the unit still has a problem please call Tektronix Customer Sales and Support Center CSSC at 1 800 835 9433 x2400 or 503 627 2400 for assistance Cleaning Optical Cables Required Equipment Clean Air Spray Dust Free suggested Chemtronics E Series Ultrajet Isopropyl Alcohol 70 035 Swab suggested Fisher Brand Cat No 14 959 77 Kimwipes Laboratory Wipes suggested PN 34155 Cleaning Procedure for Front Panel Optical Connectors B 16 ST112 SONET Transmission Test Set Artisan T
50. vt_yel sts_oorp Alarm Burst Set Command 65 alm_burst Alarm Burst Query Command 0 00 ceecesescsssescesesseeecseeecneeeeceseesecnesseeeaeeeceaecateaeeneverenes 65 alm_clear Alarm Clear Command serere an Ee ane SKEE EEEE EEEE AKESE NEEE a 65 alm_enab burst multi off Alarm Enable Command esssseseeeeeesssesiseeersrssstsrsrerrsessssrsrerreeeessse 65 alm_enab Alarm Enable Query Command ssseesssesesssiseeeiesessrsrrteietsrsstsrstrerstetssrsteteeretsersrnerrrees 66 alm count n Alarm Count Set Command o 0 cceccececesecssecsceeseeeeceseeeseceeenseenseenaecnaecaeenseceeeaeeenes 66 alm _ count Alarm Count Query Command 00 cecceceseecesseesseeceeeeecneeeeceaeecesaeeatenecaesrenaeeneeaseneeaeeas 66 alm ferf on off Alarm FERF Set Command 0 cee ceeecseseceseeecesecseesecsevsecneeeecaecaeeaeeaeeseeneees 66 alm ferf Alarm FERF Query Command ccessssssesseeescsseeeceaeeceesesatesecaesercnaeeneeaecateaeeaeeneenees 66 alm 1 ais on off Alarm Line AIS Set Command sssssseeeeeseersesieetersssssrstrrierstsssrsrserersreeesrseee 66 alm l ais Alarm Line AIS Query Command ccecceseecsesecneesecneeereaeeeeeeceaeeeeeaecaeeseenaeeeeeaeeneaeeas 67 alm lof on off Alarm LOF Set Command sssrinin iieii 67 alm lof Alarm LOF Query Command cecsescsssesssssecneeerceseeressecaeesecaeeeeenaeenceaecaesseeaeeatesesaeeaeenes 67 alm_oorp on off Alarm OORP Set Commando cece ececceseseecneeeeceseeeces
51. 00 22 00 E2 fF 25 00 Ik UT Err Alarms H1 SSBITS x x x00 US BYTE 000100 lu D 3 D x3 Cfg a ee ee Figure 4 36 TOH POH Transmitter The transmitter overhead byte menu TOH POH J is used to edit various SONET overhead bytes Use the arrow keys to navigate through the Section Line and Path overhead bytes shown in Figure 4 36 The up and down arrow key will move from line to line and the left and right will move horizontally along each line in the matrix Each SONET byte designator is to the left of the equal sign and the byte value is to the right Al F6 in this example 4 30 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel J1 Trace Message Transmitter l Terminal ST112 TRM File Edit Settings Phone Transfers Help H TX SETUP denne n rene nnn nnn ne nnn n nn nncccennnn Iq Output Optics 1 J1 TRACE MESSAGE I Iw Timing CLEAR MESSAGE 66 l Ir Mapping 11 I lo SPE Pointer FILL MESSAGE HEX 00 l Ip UT Pointer 11 l Is Sonet Alarms IBTRACE MESSAGE ASCII l lg Sonet Error I I this is a test Jj l 11 TOH POH 1 l Iz J1 Trace Messge l It UT1 5 Channel I Hit UP ARROW to restore l ly UT1 5 DSX1 Cfg l I TX SETUP MENU selections l Ik UT Err Alarms I I When TRACE MESSAGE is selected l lu DS3 DSX3 Cfg Heese ssesseressssesssessssssess s Figure 4 37 J1 Tra
52. 1 4 Interface Cables RS 232 C GPIB Centronics RS 232 C 012 1379 00 9 pin female to 9 pin male 012 1298 00 9 pin female to 25 pin male 012 1398 00 9 in RS 232 C to plotter printer GPIB 012 0991 00 2m double shielded 012 0991 01 1m double shielded 012 0991 02 4m double shielded 012 1282 00 0 5 m GPIB Centronics 012 1233 00 3 m 4693 to Terminal 012 1214 00 8 ft Male Centronics to PC 25 Pin D 012 1284 00 9 ft Male to Male ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Introduction Safety Instructions A WARNING Read and Follow all of these Safety Instructions Failure to do so can cause injury to the user and damage the instrument AC Power The ST112 SONET Transmission Test Set is designed to sense and switch line voltages between 115 VAC 90 to 132 VAC and 230 VAC 180 to 250 VAC and to operate at a line frequency of either 50 Hz or 60 Hz 47 to 63 Hz range Never connect the Test Set to a line voltage that falls outside these voltage or frequency ranges Ground the Instrument The ST112 SONET Transmission Test Set is grounded through its AC LINE connector Always power the Test Set using a three conductor power cord that is plugged into a grounded three conductor outlet If you operate the Test Set without a proper ground then all metal surfaces of the instrument can become potential shock hazards Use the Proper
53. 1 to 16 3 sequentially View Channels are number from 1 to 48 sequentially Whereas STS STS 3 STS 1 channel 1 1 is equal to View Channel 1 and STS Channel 1 2 is equal to View Channel 2 because the payload is VT1 5 If the STS Channel 1 1 had an OC 3c payload then View Channel 2 would be STS channel 2 1 Figure 5 25 and Figure 5 26 illustrate Dwell Period Event Log and Detailed event Log for VIEW CHANNEL 3 shown with an LOS error in Figure 5 24 5 20 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use File Edit Settings Phone Transfers Help nena l DWELL PERIOD EVENT LOG I ISTART 1992 02 19 16 51 23 RATE STS48 CHANNEL 3 ENTRY 1 of 1 I ISTOP 1992 02 19 16 51 33 DROP RATE STS3 l SECTION LINE PATH l l B1 ERRORS 173170 B2 ERRORS B3 ERRORS 168798 l BIES 6 B2 ES 6 B3 ES 6 l Bl SES 6 B2 SES 6 B3 SES 6 I l FEBE ERRORS 60142 l I oc4s B1 OC48 B2 OC48 FEBE L fC I l l l SUMMARY OF EVENTS DETECTED I ILOS SECT OOF SECT LOF Bl ERR LINE AIS LINE LOP LINE RDI B2 ERR IPATH RDI PATH FEBE B3 ERR SQUELCH ON I l l IHIT L KEY TO UIEW DETAIL EVENT LOGS HIT C KEY TO EXIT VIEW LOG l nes eeea IBUIEW CHANNEL PRINT CURRENT ALL FOR CHANNEL H GOTO ENTRY 1 PRINT DETAIL FULL l PAGE UP U PAGE DOWN D STOP PRINT JOB S I eee F1 F2 F3 CTRL T CTRL R CTRL P CTRL Z CTRL Q TX SETUP RX SETUP RESULTS SETUP RUN STOP PAUSE REFRE
54. 3 22 Fd Rt eae a Pe eee eee 3 22 Alarm Generation Menus cccccccesssesssecessceessecseeecseecesscecseecsueeseaeeceseeeessecseesesaeensees 3 23 Error Generation Menus ccccccccssccssscesscccssscesseecseceeseeccsaeceeeecaeseeeeecaeseeeeecsaeeeeeess 3 24 TGC Oe Wt aeria EEEN E E N ENETEIA E 3 24 DS VT STS 3c and 12c Menus TX vcssccssecsvoosoessvcesocsssessenssasesesssnsvonvscvsssvvossasssscesacoenors 3 25 Pattern M Emis seeren E REE A 3 25 Framme Meniere p en n e aa a Eras 3 27 Paylodd Error Alat nostrae eieren seare REEE E a EROE a E pRa 3 27 Virtual Front Panel VFP sacccccccccs cect sce wc cence ei ddcccecaccsccticecccsecseccecesceccecndcesacen 4 1 Applications amp Uses APPlICAtlOUS cescecscesasenvessvensseesescsseusvconssccsscsvectsocsesdusecossonssctbsonsedsescseetcssonvesussosvestscetserssses 5 2 Passive MOnitorinn gs iss i cccsssasecendeciarssstessnsoxsnosdnsesanscvtsdiganiassasatecbsdsstesnsasnasessusecescnestens 5 2 Active Analysis ssie iirinn iseia eiaeiiai sissi ereire siiin eios 5 3 Circuit Pack Testing 5 4 VT1 5 Channel Scan ADM and E DCS Testing seeseseeeseseressseeoesesoesseeeesonseeeoeseeoesee 5 5 Combined Dual Mode Setup and Verification e sseessesseseoescoescseseesoseseossoessosscesese 5 11 Virtual Front Panel Combined Dual Mode csccsssscssesscesssccesccesssscesceessseesoees 5 14 Trouble Scan Basics ssccsicccsvesssesssenssssusosvsscevscssnsessesseesuss shvese
55. 32 33 reer perrenes eer 59 60 61 62 Perret Fs 87 J1 R R B3 R R c2 R R LOIN om o N s N xt w 61 T PL SIN N oao SN a Hl NTL ol lt AER N LES se ste se Es SHE SE SHE e HE HE e te FE Se LO t t t B2 19 12 42 19 19 19 19 19 19 10 1 minke 19 19 j9 o 9 ma elel elel elel elele elelem elele m le e l wl SIEISIEISIS SE S E EIE SEIS SRI 515 5 Z4 R R Z5 R R OU Qu oT T ge be GA EA VT1 5 Structured STS 1 SPE 1x28 mapping numbered sequential 1 29 30 31 32 33 58 59 60 61 62 87 J1 R R B3 R R c2 col oS aa Se NIT a NTR Ie IN N E e FE lE w t FF te F2 19 19 2 19 F Jig jin 2 19 F ig jin 12 9 mal l E Rit ilo m lele b EJES EJE S Hels z gt gt gt a l gt l gt gt a l gt gt Z4 R R Z5 R R T Ou ow I oe we E eB es Figure 4 39 VT1 5 Structures VT1 5 and DSX 1 Configuration File Edit Settings Phone Transfers Help t T SETUP ss s lt dii aa a a att aaa a Iq Output Optics UT1 5 DSX1 CONFIGURATION lw Timing DS1 FRAMING Ir Mapping TE sF ESF sLC96 lo SPE Pointer Ip UT Pointer Is Sonet Alarms l l l l PATTERN DSX1 UT1 5 l Ig Sonet Error l l l l l l l l l l l
56. 8E ly UT1 5 DSX1 Cfg I I DI 00 D2 00 D3 00 C2 02 lu DS3 DSX3 Cfg I I H1 62 H2 OA H3 00 G1 00 lo SPE Pointer I B2 A8 K1 00 K2 00 F2 00 Ip UT Pointer D4 00 DS 00 DG OO H4 FC Is TOH POH I D7 00 D8 00 D9 00 Z3 00 Ig J1 Trace Messge I D10 00 D11 00 D12 00 24 00 Ih APS Bytes I 1 21 00 22 00 E2 fF 25 00 lj UT Channel Scan I 61001000 US BYTE l In Trouble Scan ee a ey a Figure 4 20 VFP Receiver Overhead display The TOH POH s Receiver Overhead display shown in Figure 4 20 is used to monitor the overhead bytes in the first STS 1 of the SONET frame ST112 SONET Transmission Test Set 4 17 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel J1 Trace Message Analysis Display Receiver Terminal ST112 TRM File Edit Settings Phone Transfers Help RX SETUP e E arena aieeaaaiiaiaal Iq Input J1 TRACE MESSAGE Iw Optics Ir Mapping TRACE MESSAGE It UT1 5 Channel This is a test ly UT1 5 DSX1 Cfo lu DS3 DSX3 Cfg lo SPE Pointer Ip UT Pointer Is TOH POH Ig J1 Trace Messge Ih APS Bytes Ij UT Channel Scan Figure 4 21 J1 Trace Message The JI TRACE MESSAGE g is shown in Figure 4 21 Received ASCH data is being displayed APS Bytes Analysis Display Receiver l Terminal ST112 TRM Eile Edit Settings Phone Transfers Help RX SETUP
57. Arguments on enables the condition off disables the condition Example alm_sts_yel on Response NONE Note Use the alm_enab command to executed the enabled alarm condition alm_sts_yel Alarm STS n Path YEL Query Command Returns the STS n Path Yellow alarm condition as on enabled or off disabled Example alm_sts_yel Response ALM_STS_YEL ON Note See the Alarm STS n Path YEL Set Command alm_vt_ais on off Alarm VT AIS Set Command Enables or disables the VT AIS VT Alarm Indication Signal alarm condition to be generated Arguments on enables the condition off disables the condition Example alm_vt_ais on Response NONE Note Use the alm_enab command to executed the enabled alarm condition 7 68 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands alm_vt_ais Alarm VT AIS Query Command Returns the VT AIS VT Alarm Indication Signal alarm condition as on enabled or off disabled Example alm_vt_ais Response ALM_VT_AIS ON Note See the Alarm VT AIS Set Command alm_vt_lop on off Alarm VT LOP Set Command Enables or disables the VT LOP Loss Of Pointer alarm condition to be generated Arguments on enables the condition off disables the condition Example alm_vt_lop on Response NONE Note Use the alm_enab command to executed the enabled alarm condition alm_vt_lop Alarm VT LOP Query
58. Channel Set Command ee eceeeccsteeceeeeereeeeeneeneenes 24 tx_dcc Transmit Data Communication Channel Query Command ce ceeeceeereeteeeeeeeeseeeeeneenees 25 tx_map int_ds3 ext_ds3 int_bit_fl ext_bit_fl byte_fl 3c 12c Tx Mapping Mode Set Command 25 tx_map Transmitter Mapping Mode Query Command eceecceseeeeseceeeecereeecneeeeceaeceteaceaeeneeaeeas 25 tx_ocn oc1 oc3 oc12 Transmitter Optical Rate Set Command ce ceeeceeeeceteereeteereeeeeneeeres 25 tx_ocn Transmitter Optical Rate Query Command ececeeccseeseeceseeeeeeeeseeseceeserceeeevereaeeeeeaeeaees 25 tx_owire local express off Transmit Order Wire Set Command 00 ceeeceeecceseereeteereeeeeneeeees 26 tx_owire Transmit Order Wire Query Command ceceesesseeseceeeerceseeeceaecaeesecaeeeecevereaeeeeeaeeates 26 tx_signal stsx1 dsx3 Tx Signal Set Command 0 0 cc eeceesescssseeceseeeeeseceeesecneeeceaeneeeeeaeeeeeaeeaees 26 tx_ signal Transmitter Signal Query Command 00 cee ceeecesceeeceeeeeeeeceeeeeeaeeeeeseeaesetesecaeeerenaeaeeeten 26 tx_vt_map map1x28 map4x7 Transmitter VT Mapping Set Command s s s 26 tx_vt_map Transmitter VT Mapping Query Command ecececessescseeeceeeeeeneeeeceaeeeeeaeeaeeneeaeeas 27 TEST CYCLE CONTROL COMMANDS 0 cceeeee ett i ii iii iiiiieeeenennneeeeeeees 27 test_mode untimed timed repeat Test Mode Set Command eee cieeceserceeeeceeeeeeeeeeaeeeeeaeens 27 test_mode
59. Corrupt the unit to ensure that you are starting the procedure from a known state To Ram Corrupt the unit first press ERROR once on the receiver side of the front panel Then press the LEFT cursor and then ENTER consecutively eleven times When finished power down the unit Power the unit on and the power up sequence on the display should show a Ram Corrupt message after the revision display If you do not see this message then the unit was not Ram Corrupted and the process must be done again DS1 Frequency Verification This section of the procedure verifies that the frequency is within proper tolerance for the DS1 level A frequency counter will be needed as well as the special cable It is necessary to have a balanced signal out of the transmitter in order to measure the frequency For this reason a cable with a DS1 WECO 310 compatible patch cord connector on one end separated into two coaxial connectors with male bnc connectors on the other end is needed one of the cables is connected to the Tip and the other is connected to the Ring There are nine steps in this section of the procedure Note Only the DS1 sections of the procedure require the use of the special cable 1 Connect the bnc T adaptor to the frequency counter and terminate on end of it with a 50 ohms to ground terminator 2 Connect the DS1 compatible patch cord end of the special cable to the DS1 connector on the transmitter side of the front panel 3 Terminate one o
60. DAMAGES IRRESPECTIVE OF WHETHER TEKTRONIX OR THE VENDOR HAS ADVANCE NOTICE OF THE POSSIBILITY OF SUCH DAMAGES ST112 SONET Test Set User Manual iii Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com How to Reach Customer Service If you have any questions regarding the operation maintenance repair or application of your Tektronix equipment contact your local sales and service office For a complete list of the Worldwide Sales and Service Offices contact 800 426 2200 Tektronix provides high quality Technical Support on applications operation measurement specifications hardware and software by expert application engineers For Applications Support call the Customer Support Center listed below Mailing Tektronix Inc Attn Customer Service Address Measurement Business Division P O Box 500 Beaverton Oregon 97077 0001 USA Customer 800 TEK WIDE Hours are 6 00 AM to 5 00 PM and Sales or Pacific Time Support 800 835 9433 Ext 2400 Center After hours Voice Mail is available Direct 503 627 2400 Fax 503 627 5695 E Mail tm_app_supp tek com Web Site http www tek com iv ST112 SONET Test Set User Manual Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Table Of Contents General Safety Summary ccccccecscessessceesceeeceecesecaecsseeseeaecaecaaecaeesseseneeeeeeaeesseeaes viii Prelate E ete xi Introducti
61. DS3 Alarm Indication Signal xbit Sets the two X bits in each M Frame to their Alarm Condition 00 idle Sets the DS3 Idle indication off Turns the DS3 AIS X bit and Idle alarm conditions to off Example ds3_alarms xbit Response NONE ds3_alarms DS3 Alarm Query Command Returns a character string indication the current state of the DS1 Alarms AIS and YEL Example ds3_alarms Response DS3_ALARMS XBIT Note see the DS3 Alarm Set Command ds3_pth_bur n DS3 Path Burst Alarm Set Command Sets the DS3 Alarm Burst duration Example ds3_pth_bur n n a decimal number from 1 to 255 frames Response NONE Note See the ds3_pth_tri command ds3_pth_bur DS3 Path Burst Alarm Query Command Returns a character string indicating the current value of the DS3 Alarm Burst duration Example ds3_pth_bur Response DS3_PTH_BUR 40 Note See the DS3 Path Burst Alarm Set Command ds3_pth_tri DS3 Path Trigger Command Triggers the DS3 Path Alarms that were selected for remote operation Example ds3_pth_tri Response NONE Note An execution error will occur if the selected DS3 frame selected for remote operation is not the same as the DS3 frame being transmitted See the ds3_pth_ty Path Alarm Set Command 7 10 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands ds3_pth_ty frame alarm DS3 Path Alarm Burst Set Command Sp
62. Errors and Alarms 3 27 Pointers SPE and VT 3 22 Timing 3 22 3 24 LED Status Indicators Receiver 2 11 LED Test 3 2 Live Traffic Monitoring 5 2 Guaranteed 888 88 SOURCE www artisantg com M Modem Connections 4 3 N New Data Flag 3 22 3 23 New Data Flag NDF 3 12 O Ordering Information 1 2 Outputs DSX 1 2 7 DSX 3 2 7 Optical 2 7 Rear Panel ECL 2 8 Rear Panel Receiver 2 10 STSX 1 2 7 P Pause Resume Key 2 16 Power Requirements 2 4 Printer Port 2 18 Printer Selection 3 5 printer how to use 6 2 Product Codes CLEI CPR 1 3 R Receiver Connectors 2 9 2 10 Receiver Overhead LCD Displays 3 7 Receiver Status Indicators 2 11 remote commands examples 7 4 illegal arguments 7 3 types set and query 7 2 Remote Connections 4 3 remote control 6 2 Report 3 5 Report Reprint 3 5 Report Test Time 3 5 Rev 4 1 Splash Screen Display 3 2 RS 232 port cables 6 4 command format 6 5 error messages 6 5 overview 6 2 parameters overview 6 3 pinout 6 3 protocol 6 4 quick test 6 4 RS 232C Port Storing and Printing Data 6 6 RS 232C Port Setup 3 6 RX Drop Select LCD Display 3 14 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com S Safety practices 1 5 Setting the New Data Flag 3 22 3 23 ST2400 Prompt 4 3 ST 2400 RS 232C Port Settings 4 2 Store Recall 3 4
63. Fuse Always replace the AC LINE fuse using the procedure and fuse rating specified Use a 5 Amp SLOBLO fuse Operating the instrument with an improper fuse will create a fire hazard Do Not Look into the OPTICAL Output The ST112 SONET Transmission Test Set OPTICAL output is equipped with a high powered laser Never look directly into the laser output or into an unterminated optical patch cord connected to this output If you do not follow these precautions permanent eye injury can result Do Not Operate in an Explosive Atmosphere The ST112 SONET Transmission Test Set does not provide protection from static discharges or arcing components and therefore must not be operated in an explosive atmosphere Do Not Remove Instrument Covers To avoid a shock hazard and to maintain proper air flow never operate the Test Set with any of its outside covers removed ST112 SONET Transmission Test Set 1 5 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Introduction Laser Safety 1 6 A wa RNING Read and Follow all of these Safety Instructions To prevent injury ensure the following information is reviewed before operating this equipment The ST112 SONET Transmission Test Set with Options 03 04 and 5R are Class I laser products that comply with the United States Food and Drug Administration FDA Standard 21 CFR Ch 1040 10 The Laser radiation emitted from the ST112 SONET Transmission
64. IN 8 pattern is used to verify the correct optioning of the circuit for AMI or B8ZS line coding e The framed all ZEROS pattern is useful as a final confirmation that all network elements in a circuit are properly optioned with B8ZS for clear channel operation The framed all ZEROS pattern should not be used until all other tests have been successfully completed Transmission of an all ZEROS pattern through some DS3 equipment may cause DS1 failure if the DS3 equipment is not properly optioned for B8ZS clear channel operation e The primary DS1 test pattern for many years the QRW Quasi Random Word is the basic pattern used for testing DS1 circuits and equipment to verify continuity and performance The QRW pattern is also the standard pattern recommended for use when performing jitter measurements at DS1 e the AIl ONES pattern consists of a series of consecutive ones For tests of T1 span lines the all ONES pattern causes the span line repeater to consume the maximum amount of power If the DC power delivered to a regenerator is incorrect transmission errors may occur as a result of insufficient pulse power or distorted pulse shapes of the all ONES signal output of a regenerator ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays e The 3 IN 24 pattern is used to determine the ability of network equipment to function pro
65. MAV Message Available This bit is set to 1 when there is an output available for the controler 0 3 Not defined o O When you use a FA poll to read the SBR bit 6 is the RQS bit When you use the STB query to read the SBR bit 6 is the MSS bit Service Request Enable Register The Service Request Enable Register SRER is the enable register associated with the SBR status register defined above The SRER contains an enable bit for the ESB and MAV bits in the SBR However there is no enable bit for the MSS or RQS bits which are always enabled ST112 SONET Transmission Test Set 6 13 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers and Printers 6 14 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands This chapter explains the general syntax of the ST112 SONET Transmission Test Set remote command language and defines all commands Command definitions are grouped by function In addition an alphabetical list of all Test Set commands is provided with page references to individual command descriptions Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands Command Types and Syntax The ST112 SONET Transmission Test Set command set includes two basic types set and query The set comm
66. Pointer Value Query Command ecceeeceseeeeeeeeerenseeeeeneeaeeeeeneeeeen 38 tx_ ptr ndf n Transmitter STS NDF Setup Command cccccccceseceseceseceeeeseceeeceeeseeeseeeneenneenes 38 ST112 SONET Transmission Test Set 7 7 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tx_ptr_ndf Transmitter STS NDF Setup Query Command ce ecceseeceeceseeeeeeeeeeeeeecaeeeeeeeneeeenes 38 tx_spe_ndf Transmitter SPE NDF Set Pointer Execute Command ceceeeceseeceeeeteeeeeeeeenteeeneees 38 tx_spe_pntr Transmitter SPE Pointer Query Command cccceccccsceesseeseeeeeeeseeeeceseeeeeeeeneenseenaes 38 tx_spe_sing pos neg SPE Single Step Pointer Set Command cc ceeeceeeeeeseeeceeeeeeeeeneeeeneees 39 POINTER COMMANDS VT seeeeeeeeeeeeeeeeeeseeeeeeeeeeeeeeeneeseseeeeeeseeeenaeeeees 39 rx_vt_ndf Receiver VT Count Query Command ecececcesesceesesseeeeceeeercseeeeesecaeeaeeneeeeeeaeeneeaeeas 39 rx_vt_pntr Receiver VT Value Query Command ee eceecsseeeceeeerceseeeeesecaeeeecneeaeeeesnaeereaeeneeaeeas 39 vt_ ptr ndf n Transmitter VT NDF Setup Command 0 cccecceccceceesceeseeeeceeeceeeenseeeeeeneeceeeneeenes 39 vt_ptr_ndf Transmitter VT NDF Setup Query Command ccecseccesesseeseceeeeecneeeeeeeneeereeaeeneeaeens 39 tx_vt_ndf Transmitter VT NDF Set Pointer Execute Command ececsceccsseeceeeeceeeeeeeeaeeeeeneees 40 tx_
67. Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview an external DS1 signal by choosing EXT 1 5 BIT FLOAT map mode from the transmitter mapping menu The DSX 3 BNC 75 ohm input connector on the right is used for a DS3 input when the EXT DS3 map mode is selected Receiver Connectors Rear Panel RECEIVER 52 Mb s CLOCK BITERR DATA DATA ECL OUT TTL OUT 100 OHM DIFF INPUT 50 OHM 2V 2 5V 1V Figure 2 12 Receiver Connectors Rear Panel The rear panel RECEIVER section shown in Figure 2 12 has four BNC connectors The 52 Mb s CLOCK output connector on the left provides the 51 84 MHz ECL compatible 50 ohm output that was recovered from the received STS 1 signal The BIT ERR TTL OUT connector will generate a e DS3 RZ pulse for each bit error e DSI NRZ pulse for each bit error e STS 3c byte wide NRZ pulse for each occurrence of 1 to 8 errors in each byte e STS 12c four byte wide NRZ pulse for each occurrence of 1 to 32 errors in 4 contiguous bytes The last two connectors on the right are optional data measurement inputs that are used for differential 52 Mb s data input Standard Connectors Rear Panel The standard connectors include the following e Orderwire Handset e DCC e GPIB e RS 232 C e Parallel Printer Port and e Event Sync TTL output option 2 16 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Gu
68. R R c2 ol ol ci oao NRIN NTR l Ioe N FE te FE te Jae fae FE F2 o 19 2 9 ip fig 2 19 F fig jig 2 9 JEEE ERIEEE EREE z al Sal Sa 2 gt z4 R R z5 R R 35 gE SE be R EA Figure 5 4 VT1 5 Structures SONET Synchronous Optical Network can carry large payloads above 50 Mb s on most of the existing digital hierarchy signaling equipment To achieve this capacity the Synchronous Transport Signal STS has a Synchronous Payload Envelop SPE that is divided into smaller components shown in Figure 5 4 known as Virtual Tributaries VT They are used for the purpose of transporting and switching payloads smaller than the STS 1 rate 51 84 Mb s for example asynchronous services below the DS3 rate 45 Mb s 2 Terminal ST112 TRM Eile Edit Settings Phone Transfers Help 1 UT1_5 CHANNEL IBUT CHANNEL NUMBERING 11 X 28 Iq Output Optics Iw Timing Ir Mapping lo SPE Pointer Ip UT Pointer Is Sonet Alarms Ig Sonet Error I1 TOH POH i gt t1 Trara Macena 1 Figure 5 5 VT1 5 Channel Configuration VFP Menu Transmitter ACTIVE UT1 5 CHANNEL ALL I I I I I I I I CHANNEL 1 28 1 Routing and provisioning can be verified off line because the Test Set can encode valid data into all 28 VT1 5 channels and user selected data into anyone of them Figure 5 5 shows that channel 1 has been selected for user selected data and that 4x7 channel numbering is being used The 4x7 mapping is
69. Response LOS_TIME n n a decimal quantity from 1 to 127 microseconds los_secs n m Sets the timed LOS event to a duration from 1 0 to 9 9 seconds Example los_secs n m n m a decimal number from 1 0 to 9 9 Response NONE los_tm_enab Enables the LOS event for the amount of time specified by los_secs command Example los_tm_enab Response NONE los_ off Disables the LOS event currently being generated Example los_off Response NONE los_cont Generates a continuous LOS event Example los_cont Response NONE 7 72 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands los_active Queries the current condition of the LOS event Example los_active Response LOS_ACTIVE ON Note ON indicates that the LOS event is currently activated OFF indicates that the LOS event is inactive Combined Dual Mode Commands When the ST112 SONET Transmission Test Set is connected to an ST2400 2 4 Gb s SDH SONET Test Set the combined dual mode on command can be used to initiate the link procedure between the two systems When the link is made the ST2400 2 4 Gb s SDH SONET Test Set will be controlled by the ST112 through its remote serial interface RS 232 C port All remote commands sent to the ST2400 through the RS 232 C port will be passed on to the ST112 for processing The ST112 VT100 menus will include the ST2400 2 4 Gb s
70. SDH SONET Test Set menus When the link is already established the combined Dual mode off command will be handled by the ST112 SONET Transmission Test Set which will terminate the connection between the two systems combined_mode on off Combined Mode Set Command Used to initiate or terminate the combined mode between the ST112 and ST2400 Example combined_mode on Response NONE combined_mode Combined Mode Query Command Used to query the combined mode status between the ST112 and ST2400 Example combined_mode Response COMBINED_MODE OFF ST112 SONET Transmission Test Set 7 713 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands 7 74 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Appendix A Specifications Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Appendix A Specifications This addendix documents the specifications that apply to the latest software release for the ST112 SONET Transmission Test Set Version 4 1 Table A 1 Standard ST112 Electrical Specifications Characteristic Description Generator Output Electrical Output Data Rates DSX 1 1 544 Mb s DSX 3 44 736 Mb s STSX 1 51 84 Mb s Data Formats DSX 1 AMI B8ZS DSX 3 B3ZS STSX 1 B3ZS Frame Formats DS1
71. ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays Error Measurement Displays Receiver Error Key Figure 3 11 SONET Error Measurement Displays Receiver There are two ERROR Keys on the receiver side of the ST112 Test Set This material addresses the ERROR Key in the dark gray area which is used for the SPE Synchronous Payload Envelope error detection The other ERROR Key in the light gray area is used to display payload and asynchronous signal errors It is detailed under the heading Payload Error Display Receiver later in this chapter The ERROR key on the receiver side of the front panel is used to scroll through error displays The eight LCD displays shown in Figure 3 11 are SONET Error Measurement Displays SONET errors that were detected are included in the SECT section LINE PATH VT Virtual Tributary and STSX 1 error summary menus The first three menus in Figure 3 11 include the ES Errored Seconds SES Severely Errored Seconds the BER Bit Error Rate and the TOT Total Count The two VT displays are only present when the VT1 5 payload is selected The total TOT and BER is displayed for the VT BIP 2 Bit Interleaved Parity 2 in the fourth LED display In this example Figure 3 11 the sixth error display provides the the totals for B1 B2 B3 and FEBE Far End Block Error
72. STS_OOF CUR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on vt_ais VT Path AIS Query Command Returns the current state of the VT Path AIS Indicator Clear History or Current Example vt_ais Response VT_AIS CLEAR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on vt_bip2_stat VT Path BIT 2 Query Command Returns the current state of the VT Path BIT 2 Indicator Clear History or Current Example vt_bip2_stat Response VT_BIP2_STAT HIST Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on vt_febe VT Path FEBE Query Command Returns the current state of the VT Path FEBE Indicator Clear History or Current Example vt_febe Response VT_FEBE CUR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on vt_yellow VT Path Yellow RDI Query Command Returns the current state of the VT Path Yellow RDI Indicator Clear History or Current Example vt_yellow
73. Test I Wy Test l lu Report Printing IBSAVE RECALL STORE Im Current Cfg 11 Hit UP ARROW DOWN ARROW I I to restore SETUP MENU selections I When NAME is selected l Figure 4 6 VFP Store Recall Setup Menu The submenu shown in Figure 4 6 is used to STORE and RECALL the Test Set system configurations In this example pressing the F4 function key will recall a previously stored configuration named My Test from memory location number 5 five The F4 function key request will remain hidden until the cursor is moved to the STORE RECALL menu item Then it will be pressed to execute the selected function RECALL in this example Up to 10 individual user setups can be saved in memory location 0 to 9 A unique 10 character label can be stored with each saved setup The arrow keys are used to move the reverse video cursor between variables When the cursor is positioned at the LOCATION menu item the number keys are used to select one of ten possible storage areas If a unique name had been assigned to the location selected it will not be displayed until the cursor is moved to the NAME menu item where the name can be changed or added if none were assigned ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel Timed Test Setup Menu l Terminal ST112 TRM File Edit Settings Phone Transfers Help
74. The next push of the ERROR key will display the BIP 2 total FEBE total and the LOP STAT Loss Of Pointer Status for the Virtual Tributary VT sub channel An eighth press will display ELAPSED TIME of the Test Cycle Each press of the error key will cycle to the next error display in a continuous loop until some other key is pressed ST112 SONET Transmission Test Set 3 13 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays 3 14 Optical Input Select Menu Receiver Figure 3 12 Optical Input Select Menu Receiver The menu display shown in Figure 3 12 is accessed by pressing the receiver Optical Input Selection key located on the front panel in the light gray laser input area Use the arrow and enter keys to select one of the four choices OC 1 OC 3 OC 12 BIPOLAR Input Select Menus and Displays Receiver Figure 3 13 Input Select Menus and Displays Receiver Press INPUT Key to scroll through the menus shown on the left side of Figure 3 13 but the four menus illustrated on the right side are selection dependent The first menu RX INPUT SELECTION offers four choices three electrical cross connects STSX 1 DSX 3 and DSX 1 and one optical OPTIC Positioning the cursor around OPTIC and pressing the enter key will take you to the next menu shown on the right side of Figure 3 13 This RX INPUT SELECTION menu is used to choose one of three o
75. Transmitter Press the transmitter key labeled MAPPING to display the payload mapping choices shown in Figure 3 22 The ST112 SONET Transmission Test Set transmitter mapping conforms to ANSI and Bellcore standards The mapping can be divided into three groups e Concatenated STS 12c or STS 3c e VT1 5 1 544Mb s Virtual Tributary e DS3 44 736 Mb s ASYNC signal The INC increment and DEC decrement keys are used to scroll through the choices The ENTER key is used to select one of the maps The LED indicator in the enter key will flash whenever a selection is requested or required Three yellow LED indicators identify which mapping is active DS3 VT or 3c 12c Additional menus configuration dependent may be accessible with each push of the transmitter MAPPING Key When the OC 3 rate with a VT1 5 payload is selected for example three menus shown in Figure 3 23 will be displayed They are used to select the active VT 1 5 sub channels and configure the payload But when an OC 3 rate with a DS3 payload is configured from the Quick Setup menu then only one map will be displayed INT DS3 for example MAPPING Key Figure 3 23 VT1 5 Mapping Menus Transmitter ST112 SONET Transmission Test Set 3 21 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays 3 22 Timing Transmitter Figure 3 24 Timing The ST112 SONET Transmission Test Set provides for
76. VIEW will not reflect those LEDs Parity and Random Errors STSX1 At this point you have determined that the unit will link error free The next step is to inject some errors to see if the unit will respond correctly There are twenty seven steps in this section of the procedure 1 On the transmitter side of the front panel press ERROR until the top left hand side of the display shows STS1 3 ERR STS1 3 ERR is the name of this menu RX is the receiver s setting and response to what is inputted from the transmitter i e presently the receiver is set for B1 errors B1 is the current selection and the bottom line contains all of the options for the transmitter available in this menu 2 Note that there is a number after B1 in the receiver section of the display Press RUN STOP once and note that the green LED inside the button is no longer on Press RUN STOP again and note that the green LED is now on Also in the receiver s section of the display note that B1 now has a zero after it ST112 SONET Transmission Test Set B 3 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test B 4 Note Make sure that the green LED within the button is lit This is the RUN mode If the green LED is not lit then the RUN mode is not active and no errors will be counted i e a STOP condition exists Using the LEFT RIGHT cursors select B1 and then press ENTER In th
77. a number from 0 to 63 decimal Response NONE Notes The V5 byte bit positions are numbered from 1 msb to 8 Isb bits 1 and 2 are inaccessible bit 3 VT Path FEBE 20 hex 32 decimal bit 4 is Unassigned 10 hex 16 decimal bits 5 6 7 VT Path Signal Label listed below in binary 000 VT SPE Unequipped 00 hex 0 decimal 001 VT SPE Equipped Payload Not Specified 02 hex 2 decimal 010 VT SPE Equipped Unassigned 04 hex 4 decimal 011 VT SPE Equipped Unassigned 06 hex 6 decimal 100 VT SPE Equipped Unassigned 08 hex 8 decimal 101 VT SPE Equipped Unassigned 0A hex 10 decimal 110 VT SPE Equipped Unassigned 0C hex 12 decimal 111 Alarm Indication Signal OE hex 14 decimal bit 8 Yellow Signal 01 hex 1 decimal zwar tx_vt_v5 Transmit V5 Byte Query Command Returns the decimal value of the VT1 5 V 5 overhead byte Example tx_vt_v5 Response TX_VT_V5 14 Note See the Transmit V5 Byte Set Command tx_vt_v5 n 7 64 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands Alarms Transmitter alm_burst lof _ais ferf sts_ais sts_yel vt_ais vt_yel sts_oorp Alarm Burst Set Command Specifies which alarm condition will be generated when the alarm enable is set to burst Argument lof Loss Of Frame loss of the STS n section framing _ais Line Alarm Indication Signal for
78. a unframed 1111 sequence in the DS1 payload e RAI generates a Remote Alarm Indication in the DS1 payload The term YELLOW preceded the RAI designation ST112 SONET Transmission Test Set 3 29 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays NOTE The Bit Error Rate is inserted as a negative exponent An error rate of 1 0E 6 would equate to the decimal number derived from sending one errored bit in a million bits In other words one divided by one million would equal 0 000001 or 1 0E 6 decimal 3 30 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel This chapter describes the use of ST112 SONET Transmission Test Set terminal displayed menu structures accessed by using a VT100 or VT100 terminal emulator These full screen displays provide more information than individual LCD displays and can be used with a remote or local terminal There are separate sections in this chapter that detail setup receiver and transmitter specifics Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel Terminal Type and Setup 4 2 Before reviewing this chapter connect the three ST112 SONET Transmission Test Set front panel receiver inputs one laser and two electrical to their appropr
79. and FEBE 19 On the display the value of B1 equals three However because of the position of the error being injected B1 may equal up to six For the same reason the value of FEBE will be either zero or one and the values of B2 and B3 will be between zero and six 20 Press RUN STOP twice to clear all errors OC12 Quick Set Up This section of the procedure verifies that the Optical Carrier Level 12 OC12 is functioning properly The quick set up places the unit into a default mode which selects specific settings for the unit These default settings are preprogrammed and therefore consistent from unit to unit For all optical sections an in line 5db optical attenuator is required between the transmitter and receiver optical connectors Before any connections are made use the optical cleaning kit to clean the cable ends the attenuator ends and the optical connectors on the front panel of the unit The last section of the procedure provides an equipment list and simple instructions on how to clean the optical connectors Leave everything set up as it was in the last section There are seventeen steps in this section of the procedure 1 On the front panel press SETUP until the display shows the SONET Quickset menu 2 Using the INC DEC keys select OC12 Using the LEFT RIGHT cursors select DS3 and then press ENTER Note that the red LED for LASER ON remains lit 3 Press RUN STOP twice to clear all errors 4 The transmitter and the
80. being carried over the network such as new installation of a network element equipment and network maintenance conformance testing and production test Figure 5 2 shows the NE under test inserted in the optical carrier signal path The Test Set provides electrical outputs and inputs used to test STSX 1 DSX 3 and DSX 1 network elements and networks On the transmitter side the Test Set provides e Four DSX 1 outputs that are always on e Six STSX 1 or DSX 3 outputs that can be activated for testing e One optical output connector that can be switched to OC 12 OC 3 or OC 1 On the receiver side the Test Set provides e One optical input connector that can be switched to OC 12 OC 3 or OC 1 e One STSX 1 or DSX 3 input connector that can accept either normal or a low level monitor input signal e One DSX 1 input connector for either normal or a low level monitor input signal In this application the ST112 SONET Transmission Test Set can be used with the ST2400 transceiver which is actively inserted into the signal path The Test Set provides a variety of signal and analysis options for complete testing of the OC 48 signal ST112 SONET Transmission Test Set 5 3 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use Circuit Pack Testing 5 4 Tektronix ST112 SONET Transmission Test Set
81. between two adjacent devices such as a regenerator and a network element or two adjacent regenerators EXPRESS indicates the connection between two network elements with or without a regenerators in between ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel Optics Setup Menu Receiver File Edit Settings Phone Transfers Help RX SETUP Fda n nner nnn nnn n nn nnn cern nnnecernna Iq Input l OPTICS Iw Optics IBOPTIC RATE Ir Mapping 1 oct 0C12 oc4s It UT1 5 Channel lu D 3 DSX3 Cfg l lo SPE Pointer I Valid STS Channels 1 3 Ip UT Pointer I tanca I I I 1 ly UT1 5 DSX1 Cfg 1 1 STS CHANNEL 1 I I I Figure 4 11 Optics Menu The OPTICS Setup Menu w can only be accessed when the INPUT q is set to OPTIC It provides four choices for OC 1 OC1 OC 3 OC3 OC 12 OC12 and OC 48 OC48 The OC 48 setting is only active when the ST112 SONET Transmission Test Set is used in the Combined Dual Mode with an ST2400 2 4 Gb s SDH SONET Test Set The Combined Dual Mode Operation is detailed in the Applications Chapter of this manual Use the arrow keys to navigate through the menu Figure 4 11 and the enter key to activate the selection The STS CHANNEL area of the menu is used to select a valid STS Channel for analysis The total number of Valid STS Channels will change with the Optical Rate
82. ccscssscsscssscssssscscsssssssssssssscsssssssessscsessssesssesssessseesseees 7 15 Receiver Setup and Mode Commands ssccsssrsssscesscesssccsscesssceesscesssseesceesseeesees 7 20 Transmitter Setup and Mode Command csssssssssssssscsssessscsssssssssssssesseesseessees 7 24 Test Cycle Control Commands scsccssssssssccsssssssesssessesssssssessssssssscsseesssesssssesseees 7 27 Payload Commands ccscccsssscessecsscsssessscssssssssscsssssscsssssscsesesesssessssesssessseesseesseesoess 7 30 Pointer Commands SPE cccssssssscccossssscernssesssscoeessssesseccsssssecctsesnnsssscsocnssceassesannsssscsoess 7 37 Pointer Commands VU sccsccccescscecceecstessseccenssceccessasecccesceccesscoecc esscecseseeesveseacccevsonsssevecnss 7 39 Receiver Overhead Query Commannd esscccscecssssscscecsssecsscessseesssessssesscesesseesoees 7 41 Receiver Measurement CommMands cccccsssssssscsssscesscssssersscessssessccsessersccesesseseees 7 43 Receiver LED Status Commands csscssscssssccscesssseccccessssescesesceescesssceesseseesseeseees 7 48 Transmitter Error Commands csescsscccscssseccsccsessesssssesceesscscescerssecsesesescsessceesoees 7 54 ATAPINS TX CSE EE E E E sedastessesteccsendendsesedcetessedsecsseecesssens 7 65 Loss Of Signal ccscssccssscsscsssesssesseessesssenssssssssssssssssssssssscssscsesesessseesssesssesssessscesseeseess 7 72 Combined Dual Mode Command
83. counter an AC coupler a 75 ohms bnc thru terminator a 75 ohms to ground bnc terminator a 75 ohms ST112 SONET Transmission Test Set C 5 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Calibration Verification Test C 6 bnc cable a 50 ohms bnc thru terminator and a bne 50 ohms cable are needed Leave everything as it was in the last section There are eleven steps in this section of the procedure 1 On the front panel press SETUP until the display shows the SONET Quickset menu 2 Using the INC DEC keys select STSX1 Using the LEFT RIGHT cursors select DS3 and then press ENTER 3 Setting the signal around the center of the scope measure the amplitdue of the signal Note The amplitude of the signal is its peak to peak value The amplitude of the STSX1 signal should equal 1 Vpp 200mV 4 Compare the signal on the screen to the standard STS1 mask Only the scope s vertical adjusment may be moved in order to make the signal fit within the mask Note The CSAS803A oscilloscope contains the standard template in memory 5 Set the vertical adjustment back to the normal position 6 Connect the 50 ohms bnc cable to STS1 CLOCK OUT on the transmitter side of the rear panel 7 Connect the other end of the 50 ohms cable to the AC coupler 8 Connect the AC coupler to one end of the 50 ohms thru terminator 9 Connect the thru terminator to the frequency counter 10 Th
84. current printer port Example print_string This is a test Response This is a test Note The character string s can be up to 80 eighty characters long It begins and ends with quotation marks ST112 SONET Transmission Test Set 7 29 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands Payload Commands ds3_word H 00 FF DS3 Word Set Command Programs the 8 bit DS3 word pattern within the SPE pattern generator Argument any octet from 00 to FF hexadecimal Example ds3_word Haa Response NONE Note Haa sets the ds3 octet to 10101010 binary AA hexadecimal ds3_word DS3 Word Query Command Returns a character string indicating the current ds3 word in hexadecimal Example ds3_word Response DS3_WORD HAA Note Haa sets the ds3 octet to 10101010 binary AA hexadecimal rx_ds3_frm m13 cbit unframed Rx DS3 Framing Format Set Cmd Sets the receiver to analyze the DS3 Framing Format Argument m13 M1 3 28 DS1 channels multiplexed into a DS3 signal cbit C Bit Parity Analysis of the DS3 signal unframed Used to analyze the unframed DS3 payloads Example rx_ds3_frm cbit Response NONE rx_ds3_ frm Rx DS3 Framing Format Query Command Returns a character string indicating the current receiver DS3 Framing Format Example rx_ds3_frm Response RX_DS3_FRM CBIT Note M1 3 m13 C Bit or Unframed DS3 Frames can be analyzed rx_ds3_pat
85. defined used bits and undefined unused bits Each defined bit in a status register corresponds to a given instrument status or event Once cleared set to zero the value of a status bit will remain zero false as long as the corresponding event or status does not occur However if it is enabled the value of a status bit will be set to one true when the corresponding event or status occurs Status bits are latched once a status bit is set to one and will remain in this state even when the corresponding event or status becomes false until the bit is reset by a command or when the ST112 SONET Transmission Test Set is powered off Each status register has an associated enable register Moreover each defined bit in a status register has a corresponding defined bit in the associated enable register When an enable bit is set to zero then the corresponding status bit is ignored by the instrument regardless of the state of the relevant event or instrument status However when an enable bit is set to one the corresponding status bit is enabled ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers and Printers GPIB Commands The contents of any Test Set status or enable register can be read by an external controller using the appropriate query command The contents of any enable register can be set to a particular value using the appropr
86. displayed as a negative exponent from 1 0E 9 to 1 5E 3 ds1_bit _random on off DS1 Random Error Rate Set Command Randomly generates the DS1 VT1 5 error rate Argument on Turns the DS1 VT1 5 error rate generator on and off randomly off Turns the DS1 VT1 5 error rate generator off Example ds1_bit_random on Response NONE Note The error rate is a negative exponent from 1 0E 9 to 1 5E 3 ST112 SONET Transmission Test Set 7 55 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands ds1_bit_random DS1 Random Error Rate Query Command Returns the state of the DS1 VT1 5 Bit error rate random generator Example ds1_bit_random Response DS1_BIT RANDOM ON ds1_bit_error DS1 Bit Error Set Command Generates a single DS1 bit error Example ds1_bit_error Response NONE Notes This error occurs in each DS1 carried as a VT1 5 payload and in each DSX 1 output The error may fall on the DS1 overhead or payload ds3_bit_rate n DS3 Bit Error Rate Set Command Sets the DS3 Bit Error Rate Example ds3_bit_rate n Response NONE Note The error rate is a negative exponent from 1 0E 9 to 1 5E 3 ds3_bit _rate DS3 Bit Error Rate Query Command Returns a character string indicating the current value of the DS3 Bit Error Rate Example ds3_bit_rate Response DS3_BIT_RATE 3 2E 7 Note The error rate is displayed as a negative exponent from 1 0E 9 to 1 5E 3 ds3_bit_
87. five TIMING sources detailed below Switching disconnecting or any other loss of timing can cause a TX LOSS OF SONET CLOCK message to appear momentarily or periodically switch on and off e ASYNC provides internal timing for the test set e The numbers 52 or 155 refers to the respective rear panel transmitter input There is one 52Mb s clock input and one 155 Mb s clock input e BITS extracts the timing from an incoming BITS DSX 1 signal connected to the rear panel 100 ohm input provided A second LCD menu TX V1 5 BITS INPUT will be displayed when BITS is selected It is used to configure this rear panel input for normal termination TERM or a low level input from a network element s MONITOR output e LOOP as the name implies is LOOP timed to the receiver s incoming SONET signal optical or electrical Pointer Transmitter Figure 3 25 Pointers Transmitter Pressing the POINTER key on the transmitter side of the front panel will display the TX PTR Transmitter Pointer menus shown in Figure 3 25 The SPE and VT pointers keep track of the starting positions of their respective payloads In the SPE pointer menu the number 522 under the PTR label represents the current pointer value located in the H1 and H2 bytes It is the offset between the H3 byte and the J1 byte the first byte of the STS SPE The number 522 under the NDF label is a variable value that can be changed to generate a new pointer value When it is changed a NDF
88. flash D Under the PAYLOAD DS1 DS3 heading the red LEDs for LOF PAR SYNC and BIT remain lit E Under the SPE section of the POINTER heading the yellow LED for NDF remains lit and the green LEDs for PJ and PJ remain lit 4 Using the LEFT RIGHT cursors select OFF and then press ENTER 5 Press RUN STOP twice to clear all errors 6 On the transmitter side of the front panel press ALARM until the display shows the Line RDI FERF menu 7 Using the LEFT RIGHT cursors select CONT and then press ENTER 8 On the receiver s STATUS section of the front panel under the LINE heading observe that the red LED for FERF remains lit 9 Using the LEFT RIGHT cursors select OFF and then press ENTER 10 Press RUN STOP twice to clear all errors ST112 SONET Transmission Test Set B 7 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test 11 22 23 24 25 26 27 28 29 30 On the transmitter side of the front panel press ALARM until the display shows the Line AIS menu Using the LEFT RIGHT cursors select CONT and then press ENTER On the receiver s STATUS section of the front panel observe that the following error lights appear A Under the LINE heading the red LED for AIS remains lit B Under the PATH heading the red LEDs for AIS and RDI remain lit C Under the PAYLOAD DS1 DS3 heading the red LEDs for LO
89. gt Response 1112 Unit A gt Note The character string s will be at the start of each new line Quotation marks must be used before and after the character string and the string is limited to 12 characters in length rs_xon_xoff on off RS 232 Flow Control Set Command Enables or disables the RS 232 flow control mode Example rs_xon_xoff on Response NONE 7 18 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands rs_xon_xoff RS 232 C Flow Control Query Command Returns a character string that indicates the current RS 232 C flow control status Example rs_xon_xoff Response RS_XON_XOFF ON Note The current XON XOFF flow control can be on enabled or off disabled save_setup n Save Setup Command Saves the current instrument setup in location n Example save_setup n n a decimal number from 0 to 9 Response NONE stored Stored Setup Query Command Returns the currently stored setup locations saved in memory Example stored Response STORED 0 1 2 Note Stored locations are numbered from 0 to 9 in decimal time hh mm ss Internal Time Clock Set Command Sets the internally stored time of day clock Example time 15 30 45 Response NONE Note Uses 24 hours format HH MM SS Hours Minutes Seconds time Internal Time Clock Query Command Returns the time from the ST112 internal time of day c
90. input gain of the electrical inputs to either terminate or bridge monitor Argument terminate sets the input gain of the electrical ports to be compatible with signals from dsx and stsx cross connect outputs bridge sets the input gain of the electrical ports to be compatible with signals from dsx and stsx cross connect monitors outputs Example dsx_level Response NONE Note The ST112 receiver input jacks are located on the front panel One is a BNC 75 ohm and the other is a 100 ohm input impedance rx_dcc section line Receive Data Comm Channel Set Command Select the DCC to be dropped from the received SONET signal to the rear panel DCC Port Argument Section drops the section DCC D1 to D3 Line drops the line DCC D4 to D12 Example rx_dcc section Response NONE rx_dcc Receive Data Communication Channel Query Command Returns a character string indicating which DCC from the received SONET signal is being dropped Example rx_dcc Response RX_DCC LINE 7 20 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands rx_map ds3 bit_fl byte_fl 3c 12c Rx Mapping Mode Set Command Sets the Receiver Payload Mapping Mode Argument dc3 Asynchronous DS3 bit_fl bit floating synchronous floating VT1 5 byte_fl byte floating synchronous floating VT1 5 3c concatenated STS 3 Synchronous Transport Signal Le
91. is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on 7 50 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands line_ferf Line FERF Query Command Returns the current state of the LINE FERF indicator Clear History or Current Example line_ferf Response LINE_FERF HIST Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on line_lop Line LOP Query Command Returns the current state of the LINE LOP indicator Clear History or Current Example line_lop Response LINE_LOP CUR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on path_ais Path AIS Query Command Returns the current state of the Path AIS indicator Clear History or Current Example path_ais Response PATH_AIS CLEAR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on path_b3 Path B3 Query Command Returns the current state of
92. is used to transfer data between NE network elements and ORDERWIRE is used for voice communications e Voice can be transmitter in either the LOCAL or EXPRESS ORDERWIRE ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays LOCAL refers to the connection between two adjacent devices such as a regenerator and a NE or two adjacent regenerators and EXPRESS indicates that the connection is between two Network Elements with regenerators in between them Communications between two Network Elements NE without any regenerators between them can use either a LOCAL or an EXPRESS connection DS VT STS 3c and 12c Transmitter Menus The three keys in this section PATTERN FRAMING and ERR ALM are used to configure the transmitter payload content Pattern Menus Transmitter en roti ZET 2825 wo i0o0a l PATTERN A o lt lt PATTERN ey Figure 3 29 Pattern Menus Transmitter The LCD menus illustrated in Figure 3 29 are used to generate payload test patterns The actual LCD Menus are configuration dependent This set is accessible when the OC 3 or OC 12 rates and the DS3 VT1 5 OC 3c or OC 12c payloads are selected The top two TX PATTERN menus on the left side of Figure 3 29 are used to test the DSX 1 VT1 5 and the STS 3c payloads The test patterns available DSX 1 VT1 5
93. key to execute the set error rate BIP2 ERROR RATE section is used to set the error rate range from 1 0E 3 to 1 0E 9 and generate ENABLE ON the VT1 5 payload parity errors at that rate The ST112 SONET Transmission Test Set transmitter must be configured for the VT1 5 payload in the SONET signal Use the arrow keys to position the reverse video cursor and the enter key to execute the set error rate TX OCN SINGLE is used to select the STS 1 channel when either the OC 3 or OC 12 rates are being transmitted There are three channels in the OC 3 rate and twelve in the OC 12 rate Type the desired channel number and press the F4 key to change the channel ST112 SONET Transmission Test Set 4 29 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel TOH POH Transmitter File Edit Settings Phone Transfers Help TX SETUP ai aaa eam a EEE Iq Output Optics TOH POH Execute lt F4 gt Iw Timing 11 l Ir Mapping 1 1Ba1 A2 28 C1 JI lo SPE Pointer I I Bl El 7F Fl 00 B3 Ip UT Pointer I I D1 00 D2 00 D3 00 C2 02 Is Sonet Alarms I H1 H2 H3 GI 00 Ig Sonet Error I I B2 K1 00 K2 00 F2 00 11 TOH POH I D4 00 DS 00 DG OO H4 FC Iz J1 Trace Messge I D7 00 D8 00 D9 00 Z3 00 It UT1 5 Channel I I D10 O00 D11 00 D12 00 24 00 ly UT1 5 DSxX1 Cfg I I 21
94. l l l l GG 2E15 2E23 woRD I l l l 11 TOH POH l 440004 l Iz J1 Trace Messge l l It UT1 5 Channel l l ly UT1 5 DSX1 Cfg 1 Ik UT Err Alarms l l lu DS3 DSX3 Cfg DSX1 STRESS PATTERN GLG DALY 1 DALY 2 DALY 3 1 8 2 8 3 24 ONES ZEROES Figure 4 40 VT1 5 DSX 1 Configuration The VT1 5 DSX 1 CONFIGURATION menu y shown in Figure 4 40 has three section that are used to generate payload test patterns The top section is used for DS1 FRAMING Four possible choices are shown UNFRM Unframed SF Super Frame ESF Extended Super Frame and SLC96 Subscriber Loop Carrier 96 The next menu section is used to configure the test patterns for DSX 1 DSX1 and VT1 5 payloads as follows QRW Quasi Random Word 2E15 PRBS Pseudo Random Bit Sequence 2E23 PRBS and a six character hexadecimal word wd440004 in this example The third menu section is used to access the DSX 1 DSX1 STRESS PATTERN that can be used for DSX 1 network testing The selected stress pattern is active during the test cycle ST112 SONET Transmission Test Set 4 33 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel TX Stress Patterns The ST112 SONET Transmission Test Set includes additional patterns to provide more ways to stress test DS1 circuits Telecommunications research notes that the QRW test pattern universally used for out of service testing of DS1 circuits is not up to t
95. n a decimal number between 0 and 255 Note decimal 255 indicates the register is set to 11111111 binary stb Status Byte Query Command Returns the content of the Status Byte Register SBR Example stb Response STB n n a decimal number between 0 and 255 Note decimal 255 indicates the register is set to 11111111 binary tse Test Status Enable Register Set Command Sets the content of the TSER Test Status Enable Register to a decimal number from 0 to 255 Example tse 255 Response NONE Note decimal 255 indicates the register is set to 11111111 binary 7 14 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tse Test Status Enable Register Query Command Returns the content of the TSER Test Status Enable Register Example tse Response TSE n n a decimal number between 0 and 255 Note decimal 255 indicates the register is set to 11111111 binary tsr Test Status Register Command Returns the content of the TSR Test Status Register Example tsr Response TSR n n a decimal number between 0 and 255 Note decimal 255 indicates the register is set to 11111111 binary General Setup Commands quick_setup n Quick Setup Command Used to recall one of the six factory default setups Arguments n 0 sets the ST112 to the STSX 1 factory default settings n 1 sets the ST112 to the OC 1 factory default settings
96. new data flag will be set and the pointer value under the PTR label will change Use the arrow keys to position the cursor the INC and DEC keys to set to any number from 0 to 782 and the enter key to execute the change Moving the cursor to either PJ or PJ and pressing the enter key will generate a change in pointer value The VT pointer menu in Figure 3 25 is only accessible in the ST112 Test Set s VT1 5 mode The value 78 under the PTR label indicates the position of the V5 byte In this Test Set all 28 VT pointers are set to the same value The VT pointer can be set to any value from 0 to 103 Use the arrow keys to position the cursor the INC and DEC keys to change the value and the enter key to execute the change Move the cursor to either PJ or PJ and press the enter key to ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays generate an incremental change in pointer value Changing the pointer value incrementally will not generate a NDF new data flag in the V1 and V2 bytes Alarm Generation Menus Transmitter ALARM Key Figure 3 26 Alarm Generation Menus Transmitter The transmitter ALARM key is used to select one of the following alarm menus shown in Figure 3 26 LOSS OF SIGNAL LOS ERRORED FRAME LINE RDI FERF LINE AIS PATH AIS PATH RDI LOSS OF SPE POINTER OUT OF RANG
97. nisser iioii Reess 29 print string s Print String Command o 0 eee eeeeceeeceeseeseesecaeesecneeseceaeceeaecaeeeeceesateaecevereeaeeneeaeeated 29 PAYLOAD COMMANDS csticiecesterenceta erie teir ate 30 ds3_word H 00 FF DS3 Word Set Command 0 eecceeccesseesseeseeeseeeseeeseeeeceeceseceseeeaeecseeeaeeenes 30 ds3_ word DS3 Word Query Command 0 ec eccesessseseceeesseeeeesecseeseceevecsaeeeeeaececaeenesaeeateaesaeeerenes 30 rx_ds3_ frm m13 cbit unframed Rx DS3 Framing Format Set Cmd ou eeceseeceeeeeneeereeees 30 rx_ds3_ frm Rx DS3 Framing Format Query Command eceeseseseeeeeceeeesceeeeeeceesereaeeneeaeeneeaes 30 rx_ds3_pat prbs_15 prbs_23 word Rx DS3 Pattern Set Command eee eseeseeereeteeeeeeees 30 rx_ds3_ pat Receiver DS3 Pattern Query Command cceeececceseceeeeeeneeeeeneeeeceaeeeeeaecateeeeneeetes 31 rx_stress daly1 daly2 daly3 word_18 word_28 word_324 ones zeros off Receiver Stress Test Set Command 31 rx_stress Receiver Stress Test Query Command 0 ccceeccseesceseeeceseeeeesecseesecneeeeceaeeeeeaecaeeaeeneees 31 rx_vt_chan n Receiver VT Channel Select Command ecceessseesceseeeeeseeeeeseeseeeeeaeseeeeeneeeres 31 rx_vt_chan Receiver VT Channel Query Command ceecsecesesssssecsseeecnereecaeeeceaecaeeeceaeeaeeneens 31 rx_vt_ fram unframed sf esf sle Rx WT Frame Set Command cccecececeeeeeeeeeeeecereeeeneeees 32 rx_vt_ fram Receiver VT Frame
98. or the normal local mode LED off Press the SETUP key to return the instrument to the local mode Local Lock Out GPIB controllers can also put the ST112 SONET Transmission Test Set into the local lock out mode The LLO LED left side corner of front panel indicates whether the Test Set is in the Local Lock Out mode LED on or not LED off In the LLO mode like the REMOTE mode the front panel is disabled However unlike the REMOTE mode there is no key that can disable the LLO mode Instead you must issue the appropriate GPIB command or power off and then on the Test Set ST112 SONET Transmission Test Set 6 7 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers and Printers GPIB Interface Functions The ST112 SONET Transmission Test Set is configured as a GPIB talker listener It does not provide any controller functions Table 6 4 lists the GPIB functions described in the ANSI IEEE Std 488 2 1987 that are supported by the Test Set Table 6 4 GPIB Interface Functions T6 Basic talker serial poll no talk only unaddressed if addressed to listen no extended talker Basic listener no listen only unaddressed if addressed to talk no extended listener PPo No parallel poll capability SSS GPIB Connector An IEEE 488 2 standard GPIB connector is provided for GPIB communication GPIB Command Format Refer to Chapter 7 for a complete explana
99. second push of the output key will switch to the TX ELECTRICAL OUTPUT menu Optical Output Menu Displays Figure 3 20 Optical Output LCD Menu The TX OPTICS menu Figure 3 20 can be accessed by pressing the transmitter optical output key in the LASER ON area It is in the transmitter area to the left of the three yellow LED indicators labeled OC 1 OC 3 and OC 12 respectively Use the arrow keys to move the cursor and the ENTER key to activate the laser The appropriate LED will illuminate indication your selection Units without the OC 12 option will not have an OC 12 on their menu or an OC 12 LED on their front panel ST112 SONET Transmission Test Set 3 19 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays 3 20 Overhead Menus Transmitter SOR SEED Figure 3 21 Transmitter Overhead Menus Protection Request Line Switch Line Message The transmitter overhead byte menus can be used to edit various SONET overhead bytes Pressing the OVHD overhead key will scroll through the Section SECT Line LINE and Path PATH overhead bytes shown on the left side of Figure 3 21 The top line of each display identifies the designated SONET overhead byte The bottom line displays the current value of those bytes Use the arrow keys to position the cursor and the INC and DEC to change values The enter key LED will flash when a byt
100. selected if the terminal consists of seven line cards each having four channels The 1x28 mapping is used for configurations having one or more line cards with sequential numbered channels ST112 SONET Transmission Test Set 5 5 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use l Terminal ST112 TRM File Edit Settings Phone Transfers Help TX SETUP Lk cine SERIE REESE Se Pace Iq Output Optics UT1 5 DSX1 CONFIGURATION lw Timing 5s1 FRAMING Ir Mapping Wilda SF ESF SLC96 lo SPE Pointer Ip UT Pointer Is Sonet Alarms l I I I l PATTERN DSX1 UT1 5 I Ig Sonet Error l l l l l l 2E15 2E23 WORD l 11 TOH POH 440004 Iz J1 Trace Messge It UT1 5 Channel ly UT1 5 DSX1 Cfg Ik UT Err Alarms lu D 3 DS X3 Cfg DSX1 STRESS PATTERN Sailer DALY 1 DALY 2 DALY 3 l l l l l l l l l l l 11 8 2 8 3 24 ONES ZEROES Figure 5 6 Transmitter VT1 5 DSX1 Configuration VFP Menu Figure 5 6 shows that the ST112 SONET Transmission Test Set transmitter is configured to generate the Unframed UNFRH Quasi Random Word QRW mapping into the selected channel The other 27 channels contain a background pattern that has a unique 24 bit embedded channel code It can be recognized by the Test Set receiver and displayed on the VT1 5 Channel Scan VFP display Figure 5 7 ST112 SONET Transmission Test Set ADM
101. settings Example tx_oh_def Response NONE tx_oh_edit on enter esc TX Overhead Edit Command This command is used to start and end with or without saving the changes the TOH editing session Arguments on starts the editing session enter saves all changes and ends the edition session esc ends the editing session without saving any changes Example tx_oh_edit on Response NONE Note This command enables and disables the use of the following commands tx_oh_byte tx_oh_offset tx_oh_pass and tx_oh_write tx_oh_edit TX Overhead Edit Query Command Returns status of the TOH editing session Example tx_oh_edit Response TX_OH_EDIT ON Note The editing session can be either ON or OFF ST112 SONET Transmission Test Set 7 61 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tx_oh_byte s h b TX Overhead Byte Set Command This command is used to set the hexadecimal value s of the selected overhead byte b Arguments s is the mnemonic Table 7 4 label of the overhead byte TOH or POH to be set b is the hexadecimal value that the byte will be set to Example tx_oh_byte e1 hff Response NONE Note This command is enabled and disabled by the tx_oh_edit commands The byte mnemonic must be enclosed in quotation marks and followed by a comma The hexadecimal number must be preceded by a pound sign and the letter h
102. the Error key in the light gray area of the receiver will display the ELAPSED TIME of the test cycle Pressing it a second time will display the payload errors Illustrated in Figure 3 16 are the 12c and DS1 payload error displays The DS3 and 3c error displays are not illustrated but they are the same and only one payload error display will be accessible when its respective payload is selected The payload error display shows the TOT total errors that occurred during the test cycle and the current BER Bit Error Rate NOTE The Bit Error Rate is displayed as a negative exponent An error rate of 1 0E 6 would equate to the decimal number derived from sending one errored bit in a million bits In other words one divided by one million would equal 0 000001 or 1 0E 6 decimal ST112 SONET Transmission Test Set 3 17 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays Error Key Figure 3 17 DSX 3 Payload Error Displays Receiver Figure 3 17 illustrates the DSX 3 Error Measurement Displays Error Key Figure 3 18 DSX 1 Payload Error Displays Receiver Figure 3 18 illustrates the DSX 1 Error Measurement Displays 3 18 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays Transmitter Menus and Displays OUTPUT Menu and Dis
103. the STS n line ferf Far End Receive Failure STS n line failure indication sts_ais STS n Path Line Alarm Indication Signal sts_yel STS n Path Yellow Alarm Indication Signal vt_ais VT1 5 Path Line Alarm Indication Signal vt_yel VT1 5 Path Yellow Alarm Indication Signal sts_oorp STS n Out Of Range Pointer Indication Signal Example alm_burst lof Response NONE Note Only one alarm condition at a time can be generated in the burst mode See the Alarm Enable command alm_burst Alarm Burst Query Command Returns a character string indicating the selected alarm burst condition Example alm_burst Response ALM_ENAB alarm mode Note For a list of burst alarms see Alarm Burst Set Command alm_clear Alarm Clear Command Turns off all alarm conditions in progress and disables all continuous alarm conditions Example alm_clear Response NONE Note This command has the same function as the Alarm_Enable OFF command alm_enab burst multi off Alarm Enable Command Executes or stops the execution of the alarm conditions that were configured by other commands Arguments burst generates one single alarm event set by the alm_count command multi generates continuous alarm events off stops all alarms events including continuous and burst Example alm_enab burst Response NONE Note Alarm events include all continuous alarm conditions and current burst alarm conditions if the burst is in progress ST112 SONET Transmission Test
104. this menu system Setup Enter Increment and Decrement The left and right arrow keys are used to move the cursor The increment and decrement keys can be used to move the cursor and change values The left column of Figure 3 2 shows nine main menus that make up the Setup main menu system It is a continuous loop that begins with the SONET QUICKSET LCD display and ends with the ST2400 COM LINK display menu When power is applied the first three LCD splash screens will display the following 1 The Tektronix MWL Products logo and Copyright notice 2 Performing Self test and Serial Number 3 Test Set logotype and Software Version number and all front panel LEDs will illuminate verifying their operation The third splash screen and all of the illuminated LEDs will continuously be displayed if you press and hold the HISTORY VIEW key before the power key is set to on and continue to hold it in during the power up cycle The OUICKSET LCD will not be displayed until you release the HISTORY VIEW key This feature is only available in version 4 1 software 3 2 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays Setup Menu INC DEC Keys Setup Key Enter lt tla o lt We Setup Key Setup Key lt m e O s tla o lt Setup Key Setup Key Setup A O lt
105. to 95 relative humidity Table A 6 Physical Characteristics Characteristic Description Dimensions Height 152 mm 6 in Width 366 mm 14 4 in Depth 419 mm 16 5 in Weight Net Approximately 10 kg 22 Ib Safety Designed to meet UL CSA safety requirements Power Requirements Line Voltage Line Frequency 110 90 to 130 VAC 47 Hz to 63 Hz Maximum power consumption is 250 Watts Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com ST112 SONET Transmission Test Set Appendix B Incoming Inspection Test Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test Introduction The purpose of this procedure is to allow the customer a means with which to verify that any ST112 Transceiver received from Tektronix is operational upon arrival This procedure is designed to be a brief verification that the general functionality of the unit responds correctly Required Equipment The following equipment will be required in order to verify that the ST112 Transceiver is functioning properly Fiber Optical Cable must be a single mode cable and have connectors matching those on the unit under test In line 5db optical attenuator required if unit has optical options BNC 75 ohms coaxial cable DS1 WECO 310 compatible patch cord Optical cleaning kit required if unit has optical options
106. to set the ST112 SONET Transmission Test Set RS 232C port as follows Baud Rate 9600 b s End of Line CR LF Parity None XON XOFF ON Data Bits 8 Bit Local Echo ON Access the QUICK SETUP menu by pressing the front panel SETUP key Continue pressing the SETUP key until the AUXILIARY SETUP menu is displayed then push the ENTER key Continue pressing the SETUP key until the RS 232 C RS 232 BAUD menu is displayed beginning the RS 232 C port configuration menus Use the arrow keys and the enter key to configure the port as shown above The new settings will be retained when the Test Set is powered off If the selections described above are already set correctly use the setup key to move to the next menu Press any other key to exit the quick setup menu system Use the same settings for your terminal ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel Terminal Set Up After reviewing the documentation that came with your terminal or terminal emulator configure the serial port using the same settings listed above with the following additions Local Echo OFF Stop Bits 1 Function keys that may have been changed by the terminal emulator other software or communication application may need to be reset to their default values Other options such as those that hide or turn off the cursor may also need to be reset Additional settings re
107. total count in decimal sts_fram_err STS n Frame Error Query Command Returns the number of Frame errors counted in the STS n A1 or A2 framing bytes of the SONET signal Example sts_fram_err Response STS_FRAM_ERR 7 ST112 SONET Transmission Test Set 7 47 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands vt_bip2_err VT BIP 2 Error Query Command Returns the number of VT1 5 Bit Interval Parity errors counted during the test cycle Example vt_bip2_err Response VT_BIP2_ERR 12 vt_bip2_rate VT BIP 2 Error Rate Query Command Returns the VT1 5 Bit Interval Parity error rate detected during the test cycle Example vt_bip2_rate Response VT_BIP2_RATE 3 2E 7 Note The error rate is displayed as a negative exponent Receiver LED Status Commands ds_ais DS1 AIS Query Command Returns the current state of the PAYLOAD DS1 DS3 AIS indicator Clear History or Current Example ds_ais Response DS_AIS CLEAR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on ds_crc DS1 CRC Query Command Returns the current state of the PAYLOAD DS1 DS3 CRC indicator Clear History or Current Example ds_crc Response DS_CRC HIST Note CLEAR Indicates that the LED is off and no history is available HIST History Indica
108. upper or lower case It can be any number from 00 to FF in hexadecimal tx_oh_byte s Transmit Overhead Byte Query Command Returns the current hexadecimal value b of the overhead byte s Example tx_oh_byte d3 Response TX_OH_BYTE D3 H00 Note s the byte mnemonic from A1 to Z5 shown in Table 7 4 b the byte content in hexadecimal format such as H22 The byte mnemonic must be enclosed in quotation marks Table 7 4 Byte Mnemonics TOH Section Sec and Line Overhead Bytes POH Bytes V1 V2 V3 Line H1 H2 H3 G1 V4 Line B2 K1 K2 F2 Line D4 D5 D6 H4 Line D7 D8 D9 Z3 Line D10 D11 D12 Z4 Line S1 Z2 E2 Z5 7 62 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tx_oh_offset n h b Transmit Overhead Offset Byte Set Command Sets the overhead byte associated with offset n to the hexadecimal value b from 00 to FF Arguments n is the offset of the mnemonic label shown in Table 7 5 b is the hexadecimal value that the byte will be set to Example tx_oh_offset 26 h00 Response NONE Note The table below list each Overhead Byte mnemonic label and its offset The tx_oh_edit command is used to enabled and disabled this command The offset number must be followed by a comma The hexadecimal number must be preceded by a pound sign and the letter h upper or lower case It can be any number from
109. will be displayed The top line of each RX PATTERN display indicates the payload type VT1 5 DS3 STS 3c or STS 12c The VT1 5 and DS3 payloads require manual selection from the list of available patterns QRW Quasi Random Word Patterns 2E15 PRBS 2E23 PRBS Pseudo Random Bit Sequence and WORD is a payload dependent eight or twenty four bit pattern When the receiver is configured for DS1 or VT1 5 a twenty four bit pattern is expected The DS3 payload configuration expects an eight bit word pattern Use the arrow keys to move the cursor and the enter key to make the selection The second line of the STS 3c and STS 12c displays illustrated in Figure 3 14 indicate the pattern found The word UNKNOWN will be displayed when a pattern search is in progress when live traffic is present or when no pattern can be detected ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays Framing Receiver Figure 3 15 Framing Receiver The four Framing LCD displays shown in Figure 3 15 are payload dependent The top line of each RX FRAME display indicates the payload DS1 DS3 STS 3c or STS 12c The DS1 and DS3 payloads require manual selection from the list of available patterns The STS 3c and STS 12c FRAME is displayed without selections Payload Error Display Receiver Figure 3 16 Payload Error Displays Receiver Pressing
110. www artisantg com LCD Menus and Displays Mapping Menus Receiver or DEC Key All of the ST112 SONET Transmission Test Set receiver payload mapping menus are shown in Figure 3 6 and detailed in the Bellcore GR 253 CORE standard Press the receiver MAPPING key to display one of the five mapping choices shown Then use the INC and DEC keys to display the others The mapping choice that is being displayed is selected by pressing the ENTER key or any other key when leaving the mapping menus e STS 12c STS 12 Concatenated Payload Mapping e STS 3c STS 3 Concatenated Payload Mapping e VT1 5 BIT FLOAT DS1 Asynchronous Payload Mapping Floating Mode e VTI1 5 BYTE FLOAT DS1 Byte Synchronous Payload Mapping Floating Mode e DS3 DS3 Asynchronous Payload Mapping Figure 3 6 Mapping Receiver STS 12c mapping choice is only displayed when that option is installed ST112 SONET Transmission Test Set 3 9 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays Channel Menus Receiver CHANNEL Key Pressing the CHANNEL key will access the LCD menus shown in Figure 3 7 All three menus are present with VT1 5 mapping but only the RX STS CHANNEL menu is available with all STS payload configurations The RX STS CHANNEL menu shows how many channels are accessible 1 12 in this example which STS Channel is being analyzed 5 in this example and its STS positi
111. 00 to FF in hexadecimal Table 7 5 Byte Mnemonic and Offset TOH Section Sec and Line Overhead POH Bytes Bytes H2 13 H3 14 B2 16 K1 17 K2 18 D4 20 D5 21 D6 22 D7 24 D8 25 D9 26 D10 28 D11 29 D12 30 S1 32 Z2 33 E2 34 tx_oh_offset n Transmit Overhead Offset Query Command Returns the overhead byte value b associated with offset n Example tx_oh_offset 26 Response TX_OH_OFFSET 26 H00 Note n the byte mnemonic from A1 to Z5 shown in Table 7 5 b the byte content in hexadecimal format such as H22 tx_sts_chan n STS n Channel Error Set Command Generates a single bit error at random within the selected STS 1 channel Argument n the STS 1 channel number Example tx_sts_chan 2 Response NONE Notes The OC 3 rate has three STS 1 channels numbered 1 to 3 The OC 12 rate has three STS 1 channels numbered 1 to 12 Errors caused by this command result in an STS n section BIP 8 code violation and various STS 1 payload errors mapping mode dependent A single bit error is located at random anywhere in the selected STS 1 channel after the section line and path parity has been calculated ST112 SONET Transmission Test Set 7 63 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tx_vt_v5 n Transmit V5 Byte Set Command Sets the VT1 5 V5 overhead byte to a decimal value from 0 to 63 Example tx_vt_v5 n n
112. 2 View all Line Overhead bytes Add Drop Insert data from the DCC connector into the Line DCC 576 Kb s Insert voice from the Orderwire Handset connector into the Line express orderwire channel Drop data from the Line DCC out to the DDC connector Drop voice from the Line express orderwire channel to the Orderwire Handset connector K1 and K2 APS Set the APS Bytes K1 and K2 to any code defined in ANSI T1 105A Selectable by text description Path Overhead Access Set Path Overhead bytes to any value from hex 00 to FF C2 G1 F2 H4 Z3 Z4 and Z5 View all Path Overhead bytes Path Trace Byte J1 Send user defined 64 byte sequence user defined 62 bytes plus 2 bytes for CR LF inserted automatically or set to any value from hex 00 to FF View Path Trace message J1 Pointer Movement SPE or VT Single Single pointer justification positive or negative Set to Value Set to a new location with the NDF being set The range for SPE pointers is 0 to 782 The range for VT pointers is 0 to 103 A 6 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Appendix A Specifications Measurements STS SPE Pointer Measurements Count New Data Flags NDFs Positive justifications PJs Negative justifications PJs T1M1 3 Analysis In Service Measurements
113. 2 may flash C Under the VT section of the POINTER heading the yellow LED for NDF remains lit 20 Using the LEFT RIGHT cursors select OFF and then press ENTER 21 Press RUN STOP twice to clear all errors DS1 Quick Set Up This section of the procedure verifies that the DS1 is functioning properly The quick set up places the unit into a default mode which selects specific settings for the unit These default settings are preprogrammed and therefore consistent from unit to unit Leave everything set up as it was in the last section There are sixteen steps in this section of the procedure 1 Connect the transmitter and receiver together with a DS1 patch cord Connect one end of the patch cord to the DS1 connector on the receiver side of the front panel Connect the other end of the patch cord to one of the DS1 connectors on the transmitter side of the front panel On the front panel press SETUP until the display shows the Quick DSX Set Up menu Using the LEFT RIGHT cursors select DSX1 and then press ENTER Press RUN STOP twice to clear all errors The transmitter and receiver sides should now be linked error free On the transmitter side of the front panel under the DS3 VT1 5 STS3C 12C heading press ERR ALM until the display shows the Single Error menu Using the LEFT RIGHT cursors select DS1 and then press ENTER three times 8 On the receiver s STATUS section of the front panel under the PAYLOAD DS1 DS3 heading observe th
114. 27 26 ly Timed Test 1 1 l lu Report Printing I l Figure 4 4 VFP Time Setup Menu The date and time sub menu w is selected by pressing the letter w on the keyboard This display is used to enter the year YY month MM day DD hours HH minutes MM and seconds SS The year is four digits all the rest are two All changes are immediately entered into a battery backed memory and will be retained even when the Test Set is powered off DSX 1 Line Code Setup Menu l Terminal ST112 TRM File Edit Settings Phone Transfers Help SETUP ikessess aeee Iq Quick Setup 11 DSX1 LINE CODE SETUP Iw Time IpRDSX LINE CODE Ir DSX Line Code 11 B8ZS l l It Store Recall l ly Timed Test l Figure 4 5 VFP DSX 1 Line Code Setup Menu The DSX 1 DSX1 LINE CODE SETUP menu shown in Figure 4 5 is used to configure the DSX 1 signals with either AMI Alternate Mark Inversion or B8ZS Bipolar 8 Zero Substitution line codes Both can be used to test T 1 compatible networks and network elements ST112 SONET Transmission Test Set 4 7 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel Store and Recall Menu File Edit Settings Phone Transfers Help SETUP denn nnn nn nnn nn nnn nn nnn rence ne nnene Iq Quick Setup l STORE RECALL Iw Time LOCATION Ir DSX Line Code I 5 It Store Recall NAME ly Timed
115. 5 ohm BNC Rear Panel Output Data Rates 52 Mb s CLOCK Tx side 51 84 Mb s 52 Mb s DATA 51 84 Mb s 8 kHz SYNC OUTPUT 8 kHz 52 Mb s CLOCK Rx side 51 84 Mb s Data Formats NRZ Signal Level ECL Connector BNC Termination 50 ohm 2V Other Rear Panel Outputs Pulse Width BIT ERR DS1 One DS1 NRZ pulse for each bit error detected DS3 One DS3 RZ pulse for each bit error detected STS 3c One STS 3c byte wide NRZ pulse for one or more bit error s detected within each byte STS 12c One STS 12c four byte wide NRZ pulse for one or more bit error s detected within any four continguous bytes Note For NRZ pulses the pulse width will depend on the number of consecutive bit errors i e one bit error results in a single pulse two consecutive bit errors results in a pulse width that is twice as wide Transmitter EVENT SYNC OUTPUT option One positive pulse the length of which is the start to the end of an event Signal Level TTL Connector BIT ERR BNC EVENT SYNC OUTPUT BNC ST112 SONET Transmission Test Set A 3 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Appendix A Specifications Internal Pattern Generator Patterns DSX 1 VT1 5 QRW PRBS 219 1 223 1 24 bit programmable word hex DS3 PRBS 219 1 223 1 8 bit programmable word hex 00 to FF STS 3c 223 1 223 4 INV S
116. 522 Ir Mapping IBNEW POINTER NDF QA lo SPE Pointer l Ip UT Pointer Is Sonet Alarms Ig Sonet Error 11 TOH POH Iz J1 Trace Messge It UT1 5 Channel ly UT1 5 DSX1 Cfg Ik UT Err Alarms lu D 3 D X3 Cfa Figure 4 30 VFP SPE Pointer Transmitter POINTER JUSTIFICATIONS Sie SINGLE PJ The SPE POINTER menu 0 shown in Figure 4 30 The SPE Pointers keep track of the starting position of the Synchronous Payload Envelopment The number 522 represents the offset between the pointer word H1 and H2 bytes and first byte of the STS SPE J1 byte The SPE pointer can be set to any value from 0 to 782 The NDF New Data Flag indicates an arbitrary change in the pointer value due to a change in the payload position Change the NEW POINTER NDF number when the reverse video cursor is over it as illustrated Press the F4 key during the test cycle to execute the SPE pointer change Use the arrow keys to move the cursor to either SINGLE PJ or SINGLE PJ and press the F4 key to change the respective pointer values Changing the pointer value will change the CURRENT SPE POINTER number at the top of the display Figure 4 30 ST112 SONET Transmission Test Set 4 25 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel VT Pointer Transmitter l Terminal ST112 TRM File Edit Settings Phone Transfers Help TX SETUP dhe cess ss 2S Sess ses e
117. 60 nm Spectral Width 4 nm Max Laser Classification Class 1 laser complies with Fid A Reg 21 CFR Connectors FC PC Standard ST and SC Optical Connectors are orderable options Payload Mappings STS 12c Standards Compliance Meets the requirements of ANSI T1 105A Section 8 and Bellcore GR 253 CORE Receive Input Optical Input Data Rates OC 1 51 84 Mb s OC 3 155 52 Mb s OC 12 622 08 Mb s Maximum Input Power 8 dBm Operating Wavelength 1310 nm and 1550 nm 1100 nm to 1570 nm operating range Signal Sensitivity 28 dBm for BER 10 710 Note Typically exceeds 30 dBm at dBm for BER 10 10 at 622 MHz Connectors FC PC standard ST and SC Optical Connectors are orderable options Measurements T1M1 3 Analysis Out of Service Measurements Pattern Bit STS 12c BER Total and ratio Total Error Count Summary Bit only Total error counts Table A 4 lists specifications for additional features when the ST112 is equipped with option 5R ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Appendix A Specifications Table A 4 ST112 Option 5R Optical Specifications OC 1 OC 3 and OC 12 Characteristic Description Generator Output Optical Output Data Rates OC 1 51 84 Mb s OC 3 155 52 Mb s OC 12 622 08 Mb s Signal Level amp Wavelength 1550 nm 1 d
118. 8 88 SOURCE www artisantg com Remote Commands ds3_bit_ses DS3 Bit Severely Errored Seconds Query Command Returns the number of bit severely errored seconds counted in the selected DS3 signal Example ds3_bit_ses Response DS3_BIT_SES 314 ds3_par_err DS3 Parity Error Count Query Command Returns the number of C Bit and M Bit Parity Code Violations counted in the selected DS3 signal Example ds3_par_err Response DS3_PAR_ERR 297 ds3_par_es DS3 Parity Errored Seconds Query Command Returns the number of C Bit and M Bit Parity Errored Seconds counted in the selected DS3 signal Example ds3_par_es Response ds3_par_es 28 ds3_par_rate DS3 Parity Error Rate Query Command Returns the rate of C Bit and M Bit Parity Errors calculated in the selected DS3 signal Example ds3_par_rate Response DS3_PAR_RATE 7 8E 7 Note The rate is returned as a negative exponent ds3_par_ses DS3 Parity Severely Errored Seconds Query Command Returns the number of C Bit and M Bit Parity severely errored seconds counted in the selected DS3 signal Example ds3_par_ses Response DS3_PAR_SES 8 elap_time Elapsed Test Cycle Time Query Command Returns the number of elapsed seconds in the current Test Cycle Example elap_time Response ELAP_TIME 120 Note Returns the total duration of the last completed Test Cycle when no Test Cycle is currently running between Test Cycles log_clear Clear Error Log Execute Command Clears all error
119. AIS lj DS3X Err Alarms B1 ERRORS B1 BER 0 0E 09 LOF RAI Im Current Config B2 ERRORS 0 B2 BER 0 0E 09 PAR IDLE li STS3C Cfg B3 ERRORS 0 B3 BER 0 0E 08 CRC YEL I l Pyld BIT ERRORS 0 I ONES BIT l Payload BIT BER 0 0E 06 I SYNC 4 F1 F2 F3 CTRL T CTRL R CTRL P CTRL Z CTRL Q TX SETUP RX SETUP RESULTS SETUP RUN STOP PAUSE REFRESH QUIT Figure 4 26 Virtual Front Panel VFP Transmitter Configuration Use the F1 function key to access the Transmitter setup display Its menu and submenus are used to configure the SONET test signal The main menu is divided into the same six areas previously described in the SETUP Screen section of this chapter The list of submenus on the upper left side of Figure 4 26 now begin with Output Optics q Timing w Mapping r and end with the STS 3c Cfg i ST112 SONET Transmission Test Set 421 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel 4 22 Output and Optics Transmitter l Terminal ST112 TRM File Edit Settings Phone Transfers Help TX SETUP ee Iq Output Optics OUTPUT OPTICS Iw Timing ELECTRICAL OUTPUT Ir Mapping Sea DSx3 lo SPE Pointer Ip UT Pointer Is Sonet Alarms l l l l OPTICS l Ig Sonet Error l l l l l l l OFF OCi OC3 Wari 0048 11 TO
120. Bm typical 3 dBm Pulse Shape Meets Bellcore GR 253 CORE Eye Pattern Masks Wavelength 1480 to 1580 nm Spectral Width 1 nm Max Laser Classification Class 1 laser complies with Fid A Reg 21 CFR Connectors FC PC Standard ST and SC Optical Connectors are orderable options Payload Mappings STS 12c Standards Compliance Meets the requirements of ANSI T1 105A Section 8 and Bellcore GR 253 CORE Receive Input Optical Input Data Rates OC 1 51 84 Mb s OC 3 155 52 Mb s OC 12 622 08 Mb s Maximum Input Power 8 dBm Operating Wavelength 1310 nm and 1550 nm 1100 nm to 1570 nm operating range Signal Sensitivity 28 dBm for BER 10 710 Note Typically exceeds 30 dBm at dBm for BER 10 10 at 622 MHz Connectors FC PC standard ST and SC Optical Connectors are orderable options Measurements T1M1 3 Analysis Out of Service Measurements Pattern Bit STS 12c BER Total and ratio Total Error Count Summary Bit only Total error counts ST112 SONET Transmission Test Set A I1 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Appendix A Specifications Table A 5 Environmental Specifications Characteristic Environmental amp Safety Operating Temperature Description 0 to 40 degrees Centigrade Storage Temperature 40 to 70 degrees Centigrade Humidity 0
121. CLEAR TROUBLE SCAN LOG query menu provides the opportunity to delete existing data Two choices ESC and YES are presented Use the arrow keys to move the cursor and the ENTER key to execute your choice ESC will exit After the choice is made the TROUBLE SCAN MODE will be on The same menu will appear each time a new test cycle is started if the error log contains data e The last display at the bottom of Figure 3 13 shows the trouble scan running The top line provides the STS channel number and the current status of that channel SCANNING in this example The bottom line provides the date and time that the scan began The word SCANNING will change to the words NO TROUBLE when the scan ends without any problems Errors and alarms if they occur during the scan will be displayed The words PAUSE ON will be displayed when the test cycle is interrupted with the PAUSE RESUME key ST112 SONET Transmission Test Set 3 15 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays DS VT STS 3c and 12c Menus Receiver The three keys in this section PATTERN FRAMING and ERROR are used to configure the receiver to the incoming payload content to be analyzed Pattern Menus and Displays Receiver Figure 3 14 Pattern Menus and Displays Receiver The Pattern LCD display is payload dependent Four possible displays are shown in Figure 3 14 but only the relevant one
122. Command Returns the VT LOP Loss Of Pointer alarm condition as on enabled or off disabled Example alm_vt_lop Response ALM_VT_LOP ON Note See the Alarm VT LOP Set Command alm_vt_yel on off Alarm VT YEL Set Command Enables or disables the VT Yellow alarm condition to be generated Arguments on enables the condition off disables the condition Example alm_vt_yel on Response NONE Note Use the alm_enab command to executed the enabled alarm condition alm_vt_yel Alarm VT YEL Query Command Returns the VT Yellow alarm condition as on enabled or off disabled Example alm_vt_yel Response ALM_VT_YEL ON Note See the Alarm VT YEL Set Command ds1_alarms ais yel off DS1 Alarm Set Command Enables or disables the DS1 Alarms Argument ais Activates the DS1 Alarm Indication Signal yel Activates the DS1 Yellow Alarm Condition off Turns both DS1 AIS and YEL alarm conditions Example ds1_alarms yel Response NONE ST112 SONET Transmission Test Set 7 69 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands ds1_alarms DS1 Alarm Query Command Returns a character string indication the current state of the DS1 Alarms AIS and YEL Example ds1_alarms Response DS1_ALARMS YEL Note see the DS1 Alarm Set Command ds3_alarms ais xbit idle off DS3 Alarm Set Command Enables or disables the DS1 Alarms Argument ais Activates the
123. Comme Ctor s ici cic sieves eceees vis iheee seus casa E ERE ase RA RE 2 15 Transmitter Connectors Rear Patel ccccccccecssscceecececessceceesseeeceesseceessseececsseeeeesaas 2 15 Receiver Connectors Rear Panel ccccccccccecsssceceescececsssceceesseeecsessececssseeceesseeecenes 2 16 Standard Connectors Rear Panel cccccccccssscesssecssecesececsseceeeecsueceeeecsaeeseeesesseeesees 2 16 AC Power FUS r sisie ienee teire aise RI R EE EaR EAE EEE E AERES TEREE aE ERREK 2 18 ST112 SONET Test Set User Manual Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays Functional Verification si ccccssscecccsccssnssseccesssensscoseeosseasseosssnssccstenssessecesoossesestceteeutssevteccs 3 2 Setup Menus sccsssssssssssssssscssesssesssecssssessssesssesssessssesscessesssesssssesssessscssscssccsecesesssoes 3 2 Report Test Tame Menu vic sgsees cicceessti nec ales R RE RE EO REEERE 3 5 AWV SED epee cer eee ener E renter E eure eee nett ores 3 6 Receiver Menus amp Displays csssscscscssssssssssssssseessesssessesssssssessssessscsseesseessessees 3 7 Overhedd Displays nr E E E eee cee 3 7 Mapping Menus icscicic nsslnveniei asian R E R E E R 3 9 Channel Menus cccccesceessccssscesseecesseecscecssecesseeceaeceeeecsaeeeeseecsaeceeseecsaeeeeeeeceseseeneese 3 10 P intet Ments csdicivecseesncicneeessoavsetesnaticssetessutescbe
124. Continuous DS3 YEL Yellow DS3 AIS Alarm Indication Signal DS3 IDLE DS1 AIS Alarm Indication Signal DS1 RAI Remote Alarm Indication Simultaneous Alarms Supported A4 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Appendix A Specifications Transmitter Clock Internal Clock Rates Accuracy SONET 51 84 MHz 10 ppm DS3 44 736 Mhz 10 ppm DS1 1 544 MHz 50 ppm for instrument calibrated within 12 months External Clock Reference rear panel Rates Accuracy 52 Mb s 51 84 MHz 100 ppm 155 Mb s 155 52 MHz 20 ppm BITS DSX1 1 544 MHz 5 ppm Recovered Clock Loop timing Clock is recovered from received SONET Line signal Receive Input Electrical Input Data Rates DSX 1 1 544 Mb s DSX 3 44 736 Mb s STSX 1 51 84 Mb s Data Formats DSX 1 AMI B8ZS DSX 3 B3ZS STSX 1 B3ZS Signal Sensitivity Signal Equalization DSX 1 2 7 Vpk min to 3 3 Vpk max DSX 1 Monitor 20 dB of flat loss below DSX 1 DSX 3 0 25 Vpk min to 0 6 Vpk max DSX 3 Monitor 20 dB of flat loss below DSX 3 STSX 1 0 25 Vpk min to 0 6 Vpk max STSX 1 Monitor 20 dB of flat loss below STSX 1 DSX 3 STSX 1 Cross connect equalization for 450 feet of AT amp T 728A cable Impedance Connector DSX 1 Balanced 100 ohm WECO310 jack DSX 3 STSX 1 Unbalanced 75 oh
125. DS1 DS3 I I l RX ERROR SUMMARY I LOS AIS I l B1 ERRORS 0 B1 BER 0 0E 13 I LOF RAI I I I B2 ERRORS 0 B2 BER 0 0E 13 PAR IDLE I 1 B3 ERRORS 0 B3 BER 0 0E 11 l CRC YEL I I I Pyld BIT ERRORS I ONES BIT I I I Payload BIT BER I SYNC I FI F2 F3 CTRL T CTRL R CTRL P CTRL Z CTRL a TX SETUP RX SETUP RESULTS SETUP RUN STOP PAUSE REFRESH QUIT T112 x TEKTRONIX xx STOPPED S aimi Figure 4 2 Virtual Front Panel VFP Setup Display The setup display shown in Figure 4 2 is divided into six areas On the upper left there is a list of submenus in this example the list begins with q Quick Setup w Time r DSX Line Code and the list ends with m Current Configuration Pressing the appropriate key q w r m on the keyboard will access these submenus Menu keys are only active when they are displayed The Current Configuration at the top center of Figure 4 2 is a read only display It shows the transmitter and receiver selections that were made in other menus The m key returns it to the top center display after using any other menu The ST112 SONET Transmission Test Set front panel status LED indicators are replicated on the right side of the display Figure 4 2 The Section Line Path VT Path and Payload indicators are preceded by an asterisk period or the letter H indicating their respecti
126. DS3 Frame menu 11 Using the LEFT RIGHT cursors select UNFRM and then press ENTER 12 The DS3 frequency is 44 736 Mhz The frequency being measured is the full rate data signal which is equal to half the rate of the system clock The frequency shown on the counter should be 22 368 Mhz 22 Hz which is equal to the half rate clock 13 On the transmitter side of the front panel under the DS3 VT1 5 STS3c 12c heading press PATTERN until the display shows the TX Pattern DS3 PAYLOAD menu 14 Using the LEFT RIGHT cursors select WORD 15 Using the INC DEC keys change the word to AA and then press ENTER Sh Mo o a 9 16 Remove the cable and terminator from the frequency counter and connect it to the scope 17 Setting the signal around the center of the scope measure the amplitude of the signal Note The amplitude of the signal is its peak to peak value The amplitude of the DS3 signal should equal 1 Vpp 200mV 18 Compare the signal on the screen to the standard DS3 mask Only the scope s vertical adjustment may be moved in order to make the signal fit within the mask Note The CSAS803A oscilloscope contains the standard template in memory 19 Set the vertical adjustment back to the normal position STS1 Frequency and Signal Mask Verification This section of the procedure verifies that the frequency is within the proper tolerance and that the output signal matches the standard STS1 mask The CSA803A scope a frequency
127. DS3 VT1 5 STS3C 12C heading press ERROR until the top line of the display shows FRM PAR and BIT The values of PAR and BIT should equal three and the value of FRM should equal zero 13 Press RUN STOP twice to clear all errors 14 On the transmitter side of the front panel under the DS3 VT1 5 STS3C 12C heading press ERR ALM until the top line of the display shows DSX3 SINGLE 15 Using the LEFT RIGHT cursors select BPV amp then press ENTER three times ST112 SONET Transmission Test Set B 11 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test 16 On the receiver side of the front panel under the DS3 VT1 5 STS3C 12C heading press ERROR until the lefthand side of the display shows DSX3 on the top line and BPV on the bottom line The value of TOT should equal three 17 Press RUN STOP twice to clear all errors 18 On the transmitter side of the front panel under the DS3 VT1 5 STS3C 12C heading press ERR ALM until the display shows DS3 ALARMS on the top line 19 Using the LEFT RIGHT cursors select YELLOW and then press ENTER 20 In the receiver s STATUS section of the front panel under the PAYLOAD DS1 DS3 heading observe that the red LED for YEL DS3 remains lit 21 Using the LEFT RIGHT cursors select OFF and then press ENTER 22 Press RUN STOP twice to clear all errors 23 Using the LEFT RIGHT cursors select AIS and then press ENTER
128. Display 3 8 3 9 Autolink 3 15 Autoseek 3 15 Auxiliary Setup 3 5 3 6 C Channel Numbering 3 4 Cleaning 2 7 Combined Dual Mode Commands 7 72 Combined Dual Mode Setup 5 13 Connectors Receiver 2 9 Transmitte 2 7 Current Configuration 4 4 D Display LCD 2 5 F Error Display LCD 3 13 F Fuse Replacement 2 18 G GPIB Port 2 18 GPIB port ANSI manual requirements 6 8 command format 6 8 connector pinout 6 8 event status enable register ESER 6 12 interface functions 6 8 local lock out 6 7 overview 6 2 returning to local mode 6 7 service request enable register SRER 6 13 Artisan Technology Group Quality Instrumentation standard event status register SESR 6 11 status and event reporting 6 10 status byte register SBR 6 12 GPIB Port Setup 3 6 J Indicators History 2 15 Payload 2 14 Pointer 2 14 Remote REM LLO 2 16 Inputs Rear Panel 2 8 Rear Panel Receiver 2 10 Interlock AC Power 2 18 K Key Pause Resume 2 16 View History 2 15 _ L LCD Display 2 5 LCD Displays APS 3 8 3 9 DCC Orderwire 3 12 Error 3 13 Framing 3 17 Pattern 3 16 Payload Error 3 17 Receiver Overhead 3 7 RX Drop Select 3 14 LCD Displays Transmitter Alarms 3 23 DSX3 Errors and Alarms 3 28 Electrical Output 3 19 Error 3 24 Framing 3 27 Mapping 3 21 Optical Output 3 19 Overhead 3 20 Pattern 3 25 Payload
129. E SPE POINTER VT PATH AIS VT PATH RDI and LOSS OF VT POINTER The alarm conditions are defined in the Bellcore GR 253 CORE standard LOSS OF SIGNAL can be set to occur for a specified amount of time and will be injected each time that the ENTER key is pressed Use the left and right arrow keys to move the cursor and the INC and DEC keys to increase or decrease the LOS time from 1 to 150 microseconds Moving the cursor to any of the three digits 100 in this example and holding the INC or DEC key will cause the numerical value to scroll Releasing the INC or DEC key or reaching the limit will stop the scroll Each of the other alarm menus have the following parameters The alarm Loss of the SPE Pointer only has the OFF and CONT continuous conditions ST112 SONET Transmission Test Set OFF The alarm is disabled CONT Turns the alarm condition on continuously generating a hard failure Use the right arrow key to move the cursor to CONT and the enter key to activate the alarm Then use the left arrow key to move the cursor back to OFF and the enter key to turn the alarm off Using the alarm key to leave the menu will not turn the alarm off Additional alarms can be activated at the same time simulating multiple failures 3 23 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays 3 24 e BURST Sets the duration of the alarm for the number of frames speci
130. ET Transmission Test Set 3 5 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays Auxiliary Setup Menu System Enter Key gt NGM Setup Key Setup Key y Enter Key To the ST2400 COM LINK menu Setup Key Setup Key Setup Key lt Figure 3 3 Menu System Part 2 The left column of Figure 3 3 shows the auxiliary setup menu which is part of the nine Setup main menus The right side shows the auxiliary submenus Press the enter key to access them 3 6 TIME is the first submenu accessed from the auxiliary setup menu It is used to store the year current YY month MM day DD hours HH minutes MM and seconds SS ina battery backed memory Whenever changes are made the enter key LED will start flashing indicating that the ENTER Key should be pressed to enter the new value Use the setup key to access the GPIB port characteristics menu shown in Figure 3 3 The port address is an integer from 0 to 31 It can be changed with the INC or DEC keys The enter key LED will flash push it before proceeding Either an EOI End Or Identify or EOI LF End Or Identify with a Line Feed can be used to terminate the GPIB message sent by the Test Set Next is the RS 232 C RS 232 SETUP menu Press the setup key to bypass the six nested port configuration submenus or the enter to access them They store the characteristics for BA
131. Example alm_oorp Response ALM_OORP ON Note See the Alarm OORP Set Command alm_sts_ais on off Alarm STS n Line AIS Set Command Enables or disables the STS n Line AIS alarm condition to be generated Arguments on enables the condition off disables the condition Example alm_sts_ais on Response NONE Note Use the alm_enab command to executed the enabled alarm condition ST112 SONET Transmission Test Set 7 67 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands alm_sts_ais Alarm STS n Line AIS Query Command Returns the STS n Line AIS alarm condition as on enabled or off disabled Example alm_sts_ais Response ALM_STS_AIS ON Note See the Alarm STS n Line AIS Set Command alm_sts_lop on off Alarm STS n LOP Set Command Enables or disables the STS n LOP Loss Of Pointer alarm condition to be generated Arguments on enables the condition off disables the condition Example alm_sts_lop on Response NONE Note Use the alm_enab command to executed the enabled alarm condition alm_sts_lop Alarm STS n LOP Query Command Returns the STS n LOP Loss Of Pointer alarm condition as on enabled or off disabled Example alm_sts_lop Response ALM_STS_LOP ON Note See the Alarm STS n LOP Set Command alm_sts_yel on off Alarm STS n Path YEL Set Command Enables or disables the STS n Path Yellow alarm condition to be generated
132. F SYNC BIT and ONES remain lit Using the LEFT RIGHT cursors select OFF and then press ENTER Press RUN STOP twice to clear all errors On the transmitter side of the front panel press ALARM until the display shows the Path AIS menu Using the LEFT RIGHT cursors select CONT and then press ENTER On the receiver s STATUS section of the front panel observe that the following error lights appear A Under the PATH heading the red LEDs for AIS and RDI remain lit B Under the PAYLOAD DS1 DS3 heading the red LEDs for LOF PAR SYNC BIT and ONES remain lit Using the LEFT RIGHT cursors select OFF and then press ENTER 20 21 Press RUN STOP twice to clear all errors On the transmitter side of the front panel press ALARM until the display shows the Path RDI Yellow menu Using the LEFT RIGHT cursors select CONT and then press ENTER On the receiver s STATUS section of the front panel under the PATH heading observe that the red LED for RDI remains lit Using the LEFT RIGHT cursors select OFF and then press ENTER Press RUN STOP twice to clear all errors On the transmitter side of the front panel press ALARM until the display shows the Loss of SPE Pointer menu Using the LEFT RIGHT cursors select CONT and then press ENTER On the receiver s STATUS section of the front panel under the LINE heading observe that the red LED for LOP remains lit Under the SPE section of the POINTER heading o
133. FEBE Path PAR and BIT remain lit These are on going error conditions because the red LEDs remain lit On the display observe that the cursor is flashing under the one Press the RIGHT cursor on the front panel until the display cursor is flashing under the three On the front panel use INC to change the rate on the display to 1 0E 9 and then press ENTER In the receiver s STATUS section of the front panel the red LEDs will flash about every twenty seconds On the front panel use DEC to change the rate to 1 0E 6 and then press ENTER In the receiver s STATUS section of the front panel observe that the red LEDs are lit for B1 B2 B3 PAR and BIT Using the LEFT RIGHT cursors select OFF and then press ENTER In the receiver s STATUS section observe that the red LEDs for B1 B2 B3 PAR and BIT are no longer lit Press RUN STOP twice to clear all errors New Data Flag NDF and SPE Pointer STSX1 This section verifies that the data flags and the Synchronous Payload Envelope SPE pointers are functioning correctly Leave everything set up as it was in the last section There are thirteen steps in this section of the procedure On the transmitter side of the front panel press POINTER Using the LEFT RIGHT cursors select PJ and then press ENTER Under the SPE section of the POINTER heading in the receiver s STATUS section observe that the green LED for PJ flashes once On the display observe that TX PTR now re
134. H POH Iz J1 Trace Messge It UT1 5 Channel ly UT1 5 DSX1 Cfg Ik UT Err Alarms lu D 3 DSX3 Cfg DCC ACCESS SECTION LINE ORDERWIRE Way LOCAL EXPRESS Figure 4 27 VFP Output Optics Transmitter Configuration The OUTPUT OPTICS q configuration menu is shown in Figure 4 27 Use the up and down arrows to move between the four sections and the left and right arrows to move between choices Use the ENTER key to select the choice under the reverse video cursor The first two areas are used to configure the electrical and optical outputs The electrical can be configured to generate either the SONET Synchronous Transport Cross Connect Signal STSX 1 or the Asynchronous Digital Cross Connect Signal DSX 3 from the six front panel connectors Either the STSX 1 or DSX 3 LED indicator will light when the signal is selected DSX 3 can only be activated when the OPTICS are set to the OFF condition The Electrical Asynchronous Digital Cross Connect Signal DSX 1 does not appear on the menu because it is always being transmitted from the four front panel connectors The OPTICS section has five choices OFF and four rates The OC 48 OC48 rate can only be activated when the ST112 SONET Transmission Test Set is being used in the Combined Dual Mode with an ST2400 2 4 Gb s SDH SONET Test Set The Combined Dual Mode is detailed in the Applications Chapter of this manual The other three rates OC 1 OC 3 and OC 12 are detailed in this text OC 12 ha
135. I I OOF RDI I I 2 NONE 3 13 1 11 BI B2 l l 3xSCANNING 8 1 2 l1 FEBE I 3 1 2 3 I PATH__UT PATH I l 2 3 14 1 I1 AIS AIS I I 3 9 1 2 IIl RDI RDI I 4 1 2 3 I I FEBE FEBE l 2 3 15 1 11 B3 BIP 2 l 3 18 1 2 11 LOP I 1 5 1 2 3 I PAYLOAD DS1 DS 3 l 2 3 16 1 I 1 Los AIS I I 3 11 1 2 I 1 LOF RAI I I 6 1 2 3 I 1 PAR IDLE l VIEW LOG I l CRC YEL I CHANNEL DWELL TIME 10 I I ONES BIT l ETROUBLE SCAN MODE OFF i I 1 SYNC l t 42 aMMa t F1 F2 F3 CTRL T CTRL R CTRL P CTRL Z CTRL Q TX SETUP RX SETUP RESULTS SETUP RUN STOP PAUSE REFRESH QUIT T112 ST2488 Dual Mode x TEKTRONIX x RUNNING Figure 5 24 Trouble Scan VFP Combined Dual Mode Trouble Scan can be run at the OC 48 rate when the ST112 SONET Transmission Test Set and the ST2400 2 4Gb s SDH SONET Test Set are connected in the Combined Dual Mode configuration illustrated in Figure 5 12 Figure 5 24 illustrates the Trouble Scan Virtual Front Panel at the OC 48 level with VT1 5 payload mapping The Trouble Scan Mode can be enabled set to ON using the software switch at the bottom of the display The CHANNEL DWELL TIME can also be set from to 99 seconds at the bottom of the same display The VFP display in Figure 5 24 shows 16 STS 3 channels each containing its own set of three STS 1 channels These channels are numbered from 1
136. INGLE ERR menu Figure 3 32 has two fields on the top line The left field has the label SINGLE ERR And the right field contains the number of errors received during the test cycle RX 12c 0 in the top right sample menu The bottom line of the menu has multiple selections For any particular configuration only the active ones are shown Inactive ones are replaced with dashed lines The three dashed lines shown in the top right field of the top left menu in Figure 3 32 indicate that the receiver section of the ST112 Test Set is not configured for a DS1 payload That field will ST112 SONET Transmission Test Set 3 27 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays change to RX DS1 0 when the Test Set is configured for DS1 mapping The top right field of the top right menu indicates that receiver is configured for 12c payload mapping Use the arrow keys to position cursor over either the DS1 or the STS 12c selection and press the enter key to inject a single bit error The RX receiver error count field in the SINGLE ERR menu is limited to three digits An asterisk will be displayed in the left most digit position when the count exceeds 999 telling the operator that the count is not valid This error count field is transmitter independent but it can provide limited immediate feedback when used in conjunction with it during a loop back test for example The to
137. ITO N Zill te te ae FE te lh ae FF Fago 19 ip 8 19 p i 2 9 fa T ele ZRSR E See els Ries eee lee Sls tele H 73 gt gt Sine S Sli e S zal R R Z5 R R w QU Qu Figure 4 14 VT1 5 Structures VT1 5 DSX 1 Configuration Menu Receiver Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com ST112 SONET Transmission Test Set Virtual Front Panel 2 Terminal ST112 TRM File Edit Settings Phone Transfers Help RX SETUP eS SS SSS s O A N R Sa e a ENER Iq Input UT1 5 DSX1 CONFIGURATION I Iw Optics 1ZDS1 FRAMING I SF ESF SLC9S6 Ir Mapping PATTERN DS1 PAYLOAD I I It UT1 5 Channel ly UT1 5 DSX1 Cfg I l QM 2615 2E23 WORD ie lu DS3 DSX3 Cfg lo SPE Pointer Ip UT Pointer Figure 4 15 VT1 5 DSX 1 Configuration Menu Receiver The VT100 menu shown in Figure 4 15 is used to configure the receiver to the incoming VT1 5 or DSX 1 DSX1 payload FRAMING and PATTERN that will be analyzed In this example the UNFRM Unframed QRW Quasi Random Word has been selected Additional DS1 FRAMING choices include SF Super Frame ESF Extended Super Frame and SLC96 Subscriber Loop Carrier 96 Additional Patterns are two Pseudo Random Bit Sequence 2E15 and 2E23 and the 24 bit WORD DS3 DSX 3 Configuration Menu Receiver l Terminal ST112 TRM File Edit Settings Phone Transfers Help RX SETUP
138. In this example OC 12 CHAN STS 1 and VT sub channel 1 are shown on the top of the display VT 1 5 ASYNC and UFM QRW on the bottom The next LCD displays the receiver s input configuration Manual settings for Mapping Pattern and Framing are disabled when either AUTOSEEK or AUTOLINK is active Pressing the receiver keys for Mapping Pattern or Framing will cause a momentary display message Either RX AUTOSEEK ENABLED or RX AUTOLINK ENABLED whichever one is enabled Then the configuration display will return The next LCD menu is used to run the TROUBLE SCAN MODE on the incoming signal A printer should be connected to the rear panel parallel printer port or serial port and the printer and report printing functions should be configured using the SETUP menus that were detailed earlier in this chapter e The cursor has three positions OFF ON and DWELL time in seconds As the name Trouble Scan implies in this mode all channels are scanned for problems DWELL is the length of sample time for each channel 10 seconds in this example Dwell time can be set from 5 to 99 seconds The RUN key must be pressed starting the test cycle before Trouble Scan can be set to ON The test cycle must be stopped before the Trouble Scan Mode can be set to OFF e The CLEAR TROUBLE SCAN LOG menu will supersede the Trouble Scan execution if the log contains data from a previous Trouble Scan When the Trouble Scan Mode is set to ON during a test cycle a
139. NING Before activating the LASER its output must be connected to a circuit Always replace the screw caps when the optical outputs are not in use The QUICK SETUP menu shown in Figure 4 3 offers three electrical and three optical rates DSX 1 DSX1 and DSX 3 DSX3 are two asynchronous cross connect electrical rates STSX 1 STSX1 is the synchronous cross connect electrical rate Either a DS3 or VT1 5 payload can be chosen for the STSX 1 rate DSX 1 is always available at the front panel Either DSX 3 or STSX 1 will be available depending on the QUICK SETUP menu choice made Whenever installed and enabled the optical rates OC 1 OC1 OC 3 OC3 and OC 12 OC12 are also front panel available In addition to the DS3 and VT1 5 payloads for all of the Optical Carrier Rates the 3c payload is available for the OC 3 rate and the 3c and 12c payloads are available for use with the OC 12 rate Signals and payloads that conform to industry standards can be mapped and configured with test patterns using other menus detailed later in this chapter ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel Time Menu File Edit Settings Phone Transfers Help SETUP ete eee ete a aati eee alata Iq Quick Setup 11 TIME SETUP I Iw Time 1 I TIME l Ir DSX Line Code II YY HH DD HH MM SS It Store Recall 1 1 05 05 14
140. NSMITTER RECEIVER I 1 Los AIS l Ir Mapping IOUTPUT STSX1 INPUT OPTICI LOF LOP l It UT1 5 Channel IOPTICS 0C12 I OOF RDI l ly UT1 5 DSX1 Cfg 11 STS CHANNEL 111 BI B2 l lu DS3 DSX3 Cfg IMAP IN UT BYT FLT MAP UT BYTE FLT I I l lo SPE Pointer IDS1 PAT QRW DS1 PAT QRW I PATH UT PATH I Ip UT Pointer IDS1 FRM UNFRM I 1 AIS AIS l Is TOH POH IDSX1 PAT QRW I I RDI RDI l Ig J1 Trace Messge IDSX1 FRM UNFRM l FEBE FEBE Ih APS Bytes ISONET ALM OFF I B3 BIP 2 lj UT Channel Scan I RX AUTOSEEK LINK OFF LOP l In Trouble Scan BesessaSsaesSss5 5 s S5 gt PAYLOAD DS1 DS3 Im Current Cfg S4 25 4 5 RX ERROR SUMMARY I LOS AIS l li STS3C Cfg B1 ERRORS 0 B1 BER 0 0E 07 LOF RAI l l B2 ERRORS 0 B2 BER 0 0E 07 PAR IDLE l B3 ERRORS 0 B3 BER 0 0E 06 CRC YEL l l Pyld BIT ERRORS 0 I ONES BIT l l Payload BIT BER 0 0E 05 I SYNC l Ho F1 F2 F3 CTRL T CTRL R CTRL P CTRL Z CTRL Q TX SETUP RX SETUP RESULTS SETUP RUN STOP PAUSE REFRESH QUIT T112 TEKTRONIX MWL xx STOPPED 7 Figure 4 9 Virtual Front Panel VFP Receiver Setup The F2 key will access the receiver setup display shown in Figure 4 9 It is divided into the same six areas previously described under the SETUP Screen A different set of submenus are listed in the upper left field now included are e SETUP Input q
141. Notes RUN Indicates that the pointer burst is in progress STOP Indicates that the pointer burst is not in progress For details see the spe_burst command spe_burst pos neg SPE Burst Pointer Set Command Sets STSn SPE pointer to a negative or positive burst state Argument pos executes a positive pointer burst neg executes a negative pointer burst Example spe_burst pos Response NONE Notes The Example shows that a positive pointer adjust will occur ever 20 ms for the duration of the burst The duration of the burst is equal to the SPE pointer value time 20 ms 15 68 seconds The burst will return to the STOP state after completing the cycle See the burst_state command Use of any other transmit SPE pointer commands must be avoided while this command is being executed The STSn is selected using the tx_sts_chan command rx_pos_pj Receiver SPE PJ Query Command Returns a character string indicating the number of positive SPE pointer adjustments counted during the test cycle Example rX_pos_pj Response RX_POS_PJ 43 Note SPE Pointer adjustments are counted on the current STSn that was selected using the tx_sts_chan command rx_neg_pj Receiver SPE PJ Query Command Returns a character string indicating the number of negative SPE pointer adjustments counted during the test cycle Example rx_neg_pj Response RX_NEG_PJ 43 Note SPE Pointer adjustments are counted on the current STSn that was selected u
142. Query Command cceccecssecssescessecseeeeceeeeecsaeeeveeceaseeceaeenteaeens 32 rx_vt_patt prbs_23 prbs_15 qrw word Rx VT Pattern Set Command ee eeeeeeeeeeeeeeeeeees 32 rx_vt_patt Receiver VT Pattern Query Command ccceecssseecseeeeceseeeeeseceeesecneeeeceaeceeenecaeeaeeneees 32 sl2c_patt_inv norm invert 12c or 3c Pattern Set Command uu ee eeeeeceeeeecneeeeeeeeneeerceaeeeeeaeens 32 sl2c_patt_inv Receiver 12c or 3c Pattern Query Command ce eeecesccesecseeeecneeeecaeeeeeseeaeeseeneees 33 tx_ds3_frm m13 cbit unframed Tx DS3 Framing Format Set Cmd cece eceeceseeeeeseeneeeeeeees 33 tx_ds3_frm Tx DS3 Framing Format Query Command cceecesessseseceeeeeceeeeeceseeeeesecaeeeeeneeeees 33 tx_ds3_pat prbs_15 prbs_23 word Tx DS3 Pattern Set Command cece eeeeeeeeeeereeeeeeeeeees 33 tx_ds3_ pat Transmitter DS3 Pattern Query Command ececeecesesssesecseeeecneeeeceeeeeeseeaeeeesnereres 33 tx_stress daly1 daly2 daly3 word_18 word_28 word_324 ones zeros off Transmitter Stress Test Set Command 34 tx_stress Transmitter Stress Test Query Command ececesscsseesesseeeseeeceeeeeeeceereeceeceverenaeeeteres 34 tx_vt_chan n Transmitter VT Channel Select Command ceececeescseeeceseeeeeteeseeeeeseceeeeeneeeees 34 tx_vt_chan Transmitter VT Channel Query Command ccceecesseeeseeeeceeeeeeeeeeeceaeeaeenceaeeneeaeeas 34 tx_vt_fram unframed sf esf
143. Response PARITY_RATE 1 3E 6 Note The error rate is a negative exponent from 1 0E 9 to 1 5E 3 pyld_err parameter1 parameter2 Change Displayed Menus Remotely Change Displayed Menus remotely Example Pyld_err ds3_bit Argument DS3_BIT for DS3 bit error menu DS3_PAR for DS3 parity error menu DSX3_BPV for DSX3 bipolar violation error menu CRC6 for CRC 6 error menu DS1_BIT for DS1 bit error menu 3C_BIT for 3C bit error menu 12C_BIT for 12C bit error menu DS1_SUM for DS1 errors summary menu DS3_SUM for DS3 errors summary menu ELAP_TIME for elapsed time menu Note The remote command will change the menu only when the new menu is valid for the current configuration If the menu is not valid an execution error will result There is no space allowed between the two parameters The command and parameters can be either written in either upper or lower cases random_b1 Random B1 Parity Error Set Command Generates a single STS n section BIP 8 code violation Example random_b1 Response NONE Note Errors caused by this command result in a section BIP 8 code violation B1 error because a single bit error is located at random anywhere in the STS n TOH or SPE bytes after the section line and path parity has been calculated ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands s3c_error STS 3c Error Set Command Generates a single
144. S CHANNEL 1 Channel Ir Mapping I I Valid STS Channels 1 12 l Numbering It UT1 5 Channel II UT UT UT UT l ly UT1 5 DSX1 Cfg Iil 1 2 3 4 l lu DS3 DSX3 Cfg II 5 6 7 8 l lo SPE Pointer II 9 10 11 12 l Ip UT Pointer II 13 14 15 16 l Is TOH POH II 17 18 19 20 l Ig J1 Trace Messge I 21 22 23 24 l Ih APS Bytes II 25 26 27 28 l Ij UT Channel Scan I ENABLE SCAN Qg ON l In Trouble Scan SeSaersaSsaSseeSSere esses Figure 5 8 RX Setup VT1 5 Channel Scan Display ST112 SONET Transmission Test Set 5 7 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use l Terminal ST112 TRM File Edit Settings Phone Transfers Help RX SETUP 2MMM Iq Input UT 1 5 CHANNEL SCAN Iw Optics STS CHANNEL 1 Ir Mapping Valid STS Channels 1 12 It UT1 5 Channel UT UT UT UT ly UT1 5 DSX1 Cfg 1 chO1 2 ch02 3 ch03 4 chos lu DS3 DSX3 Cfg 5 ch05 6 chO6 7 chO 8 ch08 ch09 10 ch10 11 chil 12 U QW Ip UT Pointer 13 ch13 14 ch14 15 chi5 16 chi6 Is TOH POH 17 chi 18 ch18 19 ch19 20 ch20 21 ch21 22 ch22 23 ch23 24 ch24 25 ch25 26 ch26 27 ch27 28 ch28 BENABLE SCAN OFF J Ig J1 Trace Messge Ih APS Bytes lj UT Channel Scan In Trouble Scan l l l l l l lo SPE Pointer l l l l l Figure 5 9 ST112 SONET Transmission Test Set ADM and E DOS Testing Figure 5 9 illustrates the ST112 SONET Transmission Test Set
145. SH QUIT T112 ST2466 Dual Mode TEKTRONIX x STOPPED Figure 5 25 Dwell Period Event Log OC 48 Rate l Terminal ST112 TRM Jol x File Edit Settings Phone Transfers Help Pen nnn nnn nnn nnn nnn nnn nn anann I DETAILED EVENT LOG I 11992 02 19 16 51 25 l ILOS SECT OOF SECT LOF B1 ERR LINE AIS LINE LOP B2 ERR PATH RDI IPATH FEBE B3 ERR oc4s LOS l I I 11992 02 19 16 51 26 l ILOS SECT OOF SECT LOF B1 ERR LINE AIS LINE LOP B2 ERR PATH RDI IPATH FEBE B3 ERR oc4s LOS I l I 11992 02 19 16 51 27 l ILOS SECT OOF SECT LOF B1 ERR LINE AIS B2 ERR PATH RDI PATH FEBE IB3 ERR oc4s LOS l I l I HORE DOWN I IHIT L KEY TO VIEW DWELL PERIOD EVENT LOGS HIT C KEY TO EXIT VIEW LOG l Ha nn nn nn nn nn ee UIEW CHANNEL 3 PRINT CURRENT ALL FOR CHANNEL ALL l I GoTo ENTRY 1l PRINT DETAIL Nilul FULL l PAGE UP U PAGE DOWN D STOP PRINT JOB l Oost aelel alent nt aetanl ont aelnTnlantistolenT onl anlenT ol onl nl len Tent onlontontantonTeslonlontonlontontontontentontonientontonteniententniententesienienteniententeentesientententeentetetetenenteteieteteieteteten F1 F2 F3 CTRL T CTRL R CTRL P CTRL Z CTRL Q TX SETUP RX SETUP RESULTS SETUP RUN STOP PAUSE REFRESH QUIT T112 ST2466 Dual Mode x TEKTRONIX x STOPPED Figure 5 26 Detailed Event Log OC 48 Rate ST112 SONET Transmission Test Set 5 21 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use 5 22
146. ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers and Printers This chapter explains how to connect external devices to the RS 232 C GPIB and parallel ports This chapter also includes port setup procedures ST112 SONET Transmission Test Set 6 1 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers and Printers Remote Control Applications The ST112 SONET Transmission Test Set can be remotely operated from its RS 232 C ST112 or GPIB ports in one of the following ways e Use the RS 232 C Port manually from a VT100 terminal or VT100 emulation program using the ST112 SONET Transmission Test Set Virtual Front Panel feature Recommended for field test and short run applications e Use the RS 232 C Port manually from a VT100 terminal or VT100 emulation program entering commands individually Recommended for learning commands and syntax e Use the GPIB or RS 232 C Port Automatically from a PC or engineering workstation using a control program Recommended for factory automation applications Printer Applications 6 2 The ST112 SONET Transmission Test Set can print reports to its e Parallel port using a Centronics printer interface e Serial port using an RS 232 C serial printer interface ST112 SONET Transmission Test Set Artisan Technology Group
147. Selected Mapping Setup Menu Receiver File Edit Settings Phone Transfers Help RX SETUP PS s3 5355595 35555S 55555555 55 55 Iq Input 1 MAPPING Iu Optics I RX MAPPING Ir Mapping I 1 DS3 It UT1 5 Channel 11 ly UT1 5 DSX1 Cfg I UT1 5 BYTE FLOAT lu DS3 DSX3 cfg I I STS3C lo SPE Pointer I stTsi2c Ip UT Pointer 1 Figure 4 12 Receiver Payload Mapping Select Mapping menu 7 to access the ST112 SONET Transmission Test Set receiver payload maps shown in Figure 4 12 and detailed in the Bellcore GR 253 CORE standard Use the arrow keys to position the reverse video cursor on one of the five maps shown Then use the enter key to make the selection The available maps are listed below e DS3 DS 3 Asynchronous Payload Mapping e VT1 5 BIT FLOAT DS 1 Asynchronous Payload Mapping Float Mode e VT1 5 BYTE FLOAT DS 1 Byte Synchronous Payload Mapping Float Mode e STS 3c STS 3 Concatenated Payload Mapping e STS 12c STS 12 Concatenated Payload Mapping ST112 SONET Transmission Test Set 4 13 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel VT1 5 Channel Setup Menu Receiver i Terminal _ S112 UT1_S Ds x1 Cra na2 meee cen UTi Ss CHANNEL i EOT CHANNEL NUMBERING 2 i I CHANNEL 1 2e2 1 Figure 4 13 Receiver VT1 5 Channel Configuration VFP Menu The last receiver setup menu VT1 5 Channel
148. Set 7 65 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands alm_enab Alarm Enable Query Command Returns the current alarm mode Example alm_enab Response ALM_ENAB alarm mode Note Alarm Modes can be MULTI BURST or OFF see Alarm Enable Command alm_count n Alarm Count Set Command Sets the alarm burst duration to a specified number of frames from 1 to 255 Example alm_count 40 Response NONE Note Use the alm_enab burst command to executed the alarm condition alm_count Alarm Count Query Command Returns the number of frames specified by the Alarm Count Set Command Example alm_count Response ALM_COUNT 40 Note Use the alm_enab burst command to executed the alarm condition alm_ferf on off Alarm FERF Set Command Enables or disables the FERF Far End Receive Failure alarm condition to be generated Arguments on enables the condition off disables the condition Example alm_ferf on Response NONE Note Use the alm_enab command to executed the enabled alarm condition alm_ferf Alarm FERF Query Command Returns the FERF Far End Receive Failure alarm condition as on enabled or off disabled Example alm_ferf Response ALM_FERF ON Note See the Alarm FERF Set Command alm_l_ais on off Alarm Line AIS Set Command Enables or disables the L_AIS Line Alarm Indication Signal alarm condition to be generated Arguments on enabl
149. Switching is the capability of the transmission system to detect a failure on a working facility and to switch to a standby facility to recover the traffic In SONET the transmission is protected on optical lines from the Head end the point at which the Line Overhead is inserted to the Tail end the point where the Line Overhead is terminated An APS condition results by selecting the correct byte s from the Transmitter s TOH POH menu and changing the byte for the situation requested Once changed press ENTER As soon as the key is depressed the EVENT SYNC occurs Switching time can be measured from the time the EVENT SYNC output switches from a high to low transition to the time the equipment under test changes to alarmed condition AC Power Fuse Figure 2 11 shows the rear panel controls and connectors The AC power module is located on the right side corner of the rear panel It has a removable fuse panel that can be opened with a small flat blade screw driver after the AC Line Cord has been unplugged The AC power supply can accept 115 VAC input A 5 Amp SLOBLO fuse is used with the AC source voltage A WARNING Always disconnect the AC Power Cord before opening the rear fuse panel ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays This chapter describes the use of the ST112 SONET Transmission Test Set LCD menu stru
150. T 12 B2 ERR COUNT g B3 ERR COUNT 8 BPV COUNT 10 BIT ERR COUNT 7 ELAPSED SECONDS 37 SECT ES 5 SECT SES 0 LINE ES 4 LINE SES 0 PATH ES 3 PATH SES 0 SECT SEFS 0 Figure 6 1 Error Reports Available Example Screen Be sure that the ST112 SONET Transmission Test Set printer function is turned off before activating the VT100 emulator The printer and VT100 cannot work simultaneously through the single Test Set RS 232 port If a parallel printer is connected to the ST112 SONET Transmission Test Set parallel printer port then the printer and VT100 remote screen can function simultaneously 6 6 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers and Printers Using the GPIB Port The following section describes the GPIB port All port setup procedures are detailed in Chapter 4 Menus and Displays GPIB Address and Terminator Use the Auxiliary Setup menu shown in Chapter 4 to set the GPIB address and message terminator They can be set as follows e Address from 0 to 31 Address 31 is off the bus e Message terminator is set to EOI or EOI LF End Or Identify with a Line Feed GPIB Remote and Local Modes The GPIB controllers can be used to put the Test Set into a remote mode disabling all front panel setup controls The REM LED left side corner of front panel will indicate whether the Test Set is in the remote mode LED on
151. TH AIS menu Using the LEFT RIGHT cursors select CONT and then press ENTER 9 In the receiver s STATUS section of the front panel under the VT PATH heading observe that the red LEDs for AIS RDI FEBE and BIP 2 remain lit Under the PAYLOAD DS1 DS3 heading observe that the red LEDs for AIS SYNC and BIT remain lit 10 Using the LEFT RIGHT cursors select OFF and then press ENTER 11 Press RUN STOP twice to clear all errors 12 On the transmitter side of the front panel press ALARM until the display shows the VT Path RDI Yellow menu 13 Using the LEFT RIGHT cursors select CONT and then press ENTER 14 In the receiver s STATUS section of the front panel under the VT PATH heading observe that the red LED for RDI remains lit 15 Using the LEFT RIGHT cursors select OFF and then press ENTER 16 Press RUN STOP twice to clear all errors 17 On the transmitter side of the front panel press ALARM until the display shows the Loss of VT Pointer menu 29 ST112 SONET Transmission Test Set B 9 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test 18 Using the LEFT RIGHT cursors select CONT and then press ENTER 19 In the receiver s STATUS section of the front panel observe that the following error lights appear A Under the PAYLOAD DS1 DS3 heading the red LED for BIT may flash B Under the VT PATH heading the red LED for BIP
152. TS 12c 223 1 223 1 INV Stress Patterns DSX 1 only DALY 1 DALY 2 DALY 3 1 8 2 8 3 24 ONES ZEROS refer to chapter 4 for a complete description of each of these stress patterns Errors Single Section BIP B1 Line BIP B2 STS N Path BIP B3 STS N Payload pattern bit SPE BiPolar Violations BPV if configured for STSX 1 DSX 3 signals NOTE A concatenated signal will only have one B3 byte e g STS 3c or STS 12c payloads single error is placed in B2 byte of each single error is placed in B3 byte of each Errors Continuous SONET Random Error Rate BIP2 Random Error Rate STSX 1 BPV Error Rate Channel Bit Error single bit error injected into selected channel of an STS N signal Error Rate Range and Resolution 1x10 3 to 1x10 9 range varies based on selected error type with 0 1 resolution SONET Alarms Continuous EF Errored Frame AIS Alarm Indication Signal for e Line Line AIS e Path Path AIS e Virtual Tributary VT Path AIS RDI Remote Defect Indication for e Line Line RDI e Path Path RDI e Virtual Tributary VT Path RDI LOP Loss Of Pointer for SPE or VT OORP Out Of Range Pointer for the SPE SONET Alarms Burst EF Line RDI Line AIS Path AIS Path RDI OORP VT AIS and VT RDI number of errored frames selectable from 1 to 255 LOS Loss Of Signal number of microseconds selectable from 1 to 150 Payload Alarms
153. Test Set aperture when the fiber optic cable is disconnected has a wavelength which is in the near infrared spectrum and is invisible Safety Precautions To avoid exposure to hazardous laser radiation it is recommended that the following practices are observed when operating this equipment e Always use service trained personnel who are aware of the hazards involved to work with laser based equipment circuits and networks e Never examine or stare into an open or broken optical fiber when it is connected to any laser output device or equipment whether or not that laser is activated e Always assume that the laser is on whenever it is not connected to a circuit or covered e Always deactivate the laser before connecting or disconnecting optical cables e When connecting or disconnecting the optical cables between this equipment and the circuit network or equipment under test use the following connection sequences e Connecting Before activating the laser output 1 connect all optical cables to the equipment under test circuit network and this equipment 2 ensure that the circuit is complete and properly terminated e Disconnecting Before disconnecting any part or piece of the network circuit or equipment under test 1 ensure that the laser is deactivated as detailed above ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functi
154. The arrow keys are used to position the cursor anywhere in the label area and the INC or DEC key is used to scroll through the ASCII characters including numbers and symbols Moving the cursor to FACTORY DEFAULT and pressing the enter key will access that NO or YES menu that defaults to NO Moving the cursor to YES and pressing the enter key will restore the factory default configuration Pressing the setup key will return to the STORE RECALL SETUP display REPORT TEST TIME is the next setup menu It is used to access a complete set of measurement control test and report submenus that will be detailed in the next section of this chapter Pressing the setup key will move to the next main menu The VIEW ANGLE can be set to one of eight integers 0 through 7 Zero should be the best view angle when the ST112 SONET Transmission Test Set is positioned below the operator and 7 is best when the operator is looking up at the Test Set front panel The change is interactive it is executed whenever the increment or decrement key is pressed In the same menu the VOLUME can be set using integers 0 through 9 Zero is off and 9 is the loudest Errors and alarms activate the beeper unless the volume is set to zero AUXILIARY SETUP is the next setup menus Pressing the enter key will access the auxiliary setup menu system shown in Figure 3 3 and described later in this chapter Pressing the setup key will access the ST2400 COM LINK menu ST112 SONET Tran
155. The value of the pointer is increased or decreased by 1 each time the command is executed vt_pos_pj Receiver VT PJ Query Command Returns a character string indicating the number of positive VT1 5 pointer adjustments counted during the test cycle Example vt_pos_pj Response VT_POS_PJ 122 Note VT Pointer adjustments are counted on the current VT1 5 Channel that was selected using the tx_vt_chan command vt_neg_pj Receiver VT PJ Query Command Returns a character string indicating the number of negative VT1 5 pointer adjustments counted during the test cycle Example vt_neg_pj Response VT_NEG_PJ 78 Note VT Pointer adjustments are counted on the current VT1 5 Channel that was selected using the tx_vt_chan command 7 40 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands Receiver Overhead Query Commands rx_aps_byte Receiver APS Bytes Query Command Return the current value of the APS Automatic Protection Switching bytes K1 and K2 Example rx_aps_byte Response RX_APS_BYTE HFF H55 Note The codes HFF and H55 are the hexadecimal numeric value of the K1 and K2 bytes respectively rx_j1_trace Receive J1 Trace Query Command Returns the value specified in the J1 Trace message Example rx_j1_trace Response RX_J1_TRACE Message Note The message can be any ASCII Text String up to 64 Characters rx_oh_a
156. UD rate PARITY CHAR character SIZE END OF LINE ECHO and XON XOFF flow control ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays e Pressing the setup key again will return to the AUXILIARY menu in the quick setup main menu loop Another press of the setup key will once again return to the ST2400 COM LINK menu display in the main menu system shown in Figure 3 2 Receiver Menus and Displays Overhead Displays Receiver SORE toot OVHD Key Figure 3 4 Receiver Overhead LCD Displays The ten displays shown on the left side of Figure 3 4 are the RX OVHD overhead bytes that are located in the first STS 1 of the SONET frame They can be displayed by pressing the OVHD key on the receiver panel Each time the key is pressed the next group of overhead bytes will be displayed in a continuous loop until some other key is pressed There are nine displays of four bytes each and one APS display The first display screen illustrated in Figure 3 4 shows the cursor around the word DISP display Pressing the ENTER key will display the contents of the JI TRACE which is illustrated on the upper right side of Figure 3 4 ASCII data may be displayed on the second line of that display Pressing the receiver OVHD key returns to the main overhead display The tenth display provides the APS message detailed in the fo
157. VT1 5 Channel Scan test display taken from a NE being tested to verify its provisioning The 4x7 channel numbering is used and the Unframed Quasi Random Word U QW has been detected on channel 12 of the first STS 1 tributary in the OC 12 frame During this test the Test Set transmitter generates the same signal to all its STS SONET tributaries Therefore setting the STS channel to any number from 1 to 12 will display the same information During the VT1 5 Channel Scan test the transmitter is also generating and the receiver is receiving a channel identification ch01 through ch28 on each Virtual Tributary in the selected STS channel If provisioning was done incorrectly the U QRW U QW being generated would appear on another channel and the detected channel identification would be next to some other display number providing a clear indication of the error In our example Figure 5 10 ch05 and ch12 have been incorrectly provisioned l Terminal ST112 TRM File Edit Settings Phone Transfers Help RX SETUP dls shoianehelanenisaieneaneeiguacemmencenaa gemma Iq Input UT 1 5 CHANNEL SCAN I Iw Optics STS CHANNEL 1 Ir Mapping Valid STS Channels 1 12 chO5 It UT1 5 Channel ly UT1 5 DSX1 Cfg lu DS3 DSX3 cfg lo SPE Pointer Ip UT Pointer Is TOH POH Ig J1 Trace Messge Ih APS Bytes lj UT Channel Scan In Trouble Scan I I I I UT UT UT UT I I 1 ch0l 2 ch02 3 ch03 4 cho4fl 1 5 U QW 6 chO6 7 chO7 8
158. YTE_FL 3c or 12c see Tx Mapping Mode Set Command tx_ocn 0c1 oc3 0c12 Transmitter Optical Rate Set Command Sets the Transmitter Optical Rate Argument oc1 optical carrier level 1 51 84 Mb s oc3 optical carrier level 3 155 52 Mb s 0c12 optical carrier level 12 622 08 Mb s Example tx_ocn 0c12 Response NONE Note see Optical Output opt_output and Rx OC n rate tx_ocn commands tx_ocn Transmitter Optical Rate Query Command Returns a character string indicating the current Transmitter Optical Rate Example tx_ocn Response TX_OCN OC12 Note Transmitter optical rate can be OC 1 OC 3 or OC 12 see Receiver Optical Rate Set Command ST112 SONET Transmission Test Set 7 25 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tx_owire local express off Transmit Order Wire Set Command Disables or enables and selects the Order Wire to be used as the transmit input to the rear panel port for the STS n signal Argument local drops the Section Order Wire Channel byte E1 express drops the Line Order Wire Channel byte E2 off fills both Order wire channels with all zeros Neither is available for use Example tx_owire local Response NONE Note The rear panel port is labeled ORDER WIRE tx_owire Transmit Order Wire Query Command Returns a character string indicating which Order Wire is used for the transmit STS n signal E
159. _es B1 Errored Seconds Query Command cccccccscesscessceeeceseceseceneceeeeeeeeeeeeeneeneceaeenaeenaes 43 bl_ses B1 Severely Errored Seconds Query Command 1 0 0 0 ceesceseseceeceseceeeeeeeeeceeeeeeaeeeeeeeeees 43 b2_ber B2 Error Rate Query Command ccccccccscesseesseescesscecceseceseceaecaeceseeseeseeeeeeeseeeseeneenaeenaes 43 b2_err B2 Error Count Query Command seeseseeseesiseesisseesstsrsttrreretssrsisstststretstnstststetrststssrseseeeee 43 b2_es B2 Errored Seconds Query Command cccccceescesscessceseceeceseceeeceeeeeeeeeeseeeneenaeceeenaeenaes 44 b2_ses B2 Severely Errored Seconds Query Command ceeeceeesecerceeeeeeeeeeesecneeeeenaeeeeeneeeees 44 b3_ber B3 Error Rate Query Command ecccecccsccessessseescessceseceecesecesecseceeeeeeeeeeeeeeseenseceeenaeenaes 44 b3_err B3 Error Count Query Command ceseescseseseseeeeceseeeeeseeseesecaeeeaeceessesaeeaecneveeesaeeneeaeeates 44 b3_es B3 Errored Seconds Query Command ccccccecscesscessceesceseceseceeeceeeeeeeeeeeeeeeeeseeeeenaeenaes 44 b3_ses B1 Severely Errored Seconds Query Command cccccescceseeeseeeseeeeeeeeceeceseceseceeenseeeees 44 bpv_err BPV Error Count Query Command ccccccecseescesseeeseceseeeecseecaeeeaeeeeeeeeeeeenaeenseeneeeaeeenes 44 bpv_rate BPV Error Rate Query Command 0 sceccesescesseeseeneceeeeeceaeeecaecaeseecaeenaeeeeeaesateaeeneeates 45 ds bit_err DS1 DS3 Bit Error Count Query Command
160. _j1_trace message Transmit J1 Trace Set Command Sets the value of the J1 Trace message Example tx_j1_trace Tektronix Response NONE Note The message can be any ASCII Text String up to 64 Characters enclosed in quotation marks tx_j1_trace Transmit J1 Trace Query Command Returns the value specified in the J1 Trace message Example tx_j1_trace Response TX_J1_TRACE TEKTRONIX Note The message can be any ASCII Text String up to 64 Characters 7 60 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tx_oh_all Transmit Overhead All Query Command Returns 36 bytes 27 are valid TOH Section and Line overhead bytes and 9 are valid POH Path Overhead bytes Bites Vi through V4 are not displayed Table 7 3 Byte Mnemonics TOH Section Sec and Line Overhead Bytes POH Bytes VT Bytes Example tx_oh_all Response TX_OH_ALL 0 HF6 1 H28 etc Note The first number before the comma is the NR1 byte count format ranging from zero to thirty five for the TOH and POH bytes in the following order A1 A2 C1 J1 B1 B3 D1 Z5 and bytes thirty six through thirty nine are V1 V2 V3 V4 The H code after the comma is corresponding byte value in non decimal numeric hexadecimal tx_oh_def TX Overhead Default Set Command Returns the STS n Overhead Bytes TOH and POH to their factory default
161. acros macros are not implemented in the Test Set e Forces the Test Set into the Operation Complete Command Idle State OCIS and Operation Complete Query Idle State OQIS Overlapped and Sequential Commands All Test Set commands are sequential Operation Complete Message Test Set command operation is always immediate GPIB Status and Event Reporting System The ST112 SONET Transmission Test Set GPIB status and event reporting functions are compatible with the ANSI IEEE 488 2 1987 standard The status and event reporting system can be configured to alert the GPIB controller whenever a status change or event occurs This is accomplished by maintaining two status registers and their associated enable register The four status registers are e Standard Event Status Register SESR general purpose status register e Event Status Enable Register ESER enable register e Status Byte Register SBR general purpose status register e Service Request Enable Register SRER enable register The GPIB bus SRQ service request line is asserted when one or more status bits are set The controller uses a serial poll procedure to find out which instrument initiated the SRQ Specific status bits can be enabled or disabled to control which status changes or events result in an SRQ The Test Set status registers can be read and set from the RS 232 control interface however the SRQ function is only available on the GPIB bus A status register may contain
162. ad When the SINGLE ERROR INJECT heading is selected the word F4 in reverse video will appear on its right side indicating that each push of the F4 function key will insert one bit error into the DS1 payload The last menu heading DS1 VT BIT ERROR RATE has two selections The one on the left is used to set the error rate from 1 0E 9 to 1 5E 3 And the other is used to ENABLE the flow of BIT Errors Use the up and down keys to move the cursor between heading and sections use the left and right arrow keys to move within each section Use the Enter key to active individual sections ST112 SONET Transmission Test Set 4 35 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel DS3 DSX 3 Configurations l Terminal ST112 TRM File Edit Settings Phone Transfers Help TX SETUP Iq Iw Ir lo Ip Is Ig I1 Iz It ly Ik lu Output Opti Timing Mapping SPE Pointer UT Pointer Sonet Alarm Sonet Error TOH POH Ji Trace Messge UT1 5 Chann UT1 5 DSX1 UT Err Alar DS3 DSX3 cs el Cfg ms cfa Figure 4 42 DS3 DSX 3 Configuration The DS3 DSX 3 Cfg u menu shown in Figure 4 42 is used to configure the DS3 or DSX 3 payload FRAMING and PATTERN to be transmitted In this example the M13 M1 3 and 2E15 Pseudo Random Bit Sequence has been selected Other FRAMING choices include CBIT C BIT and UNFRM Unframed configurations A
163. ads 523 Using the LEFT RIGHT cursors select PJ and then press ENTER Under the SPE section of the POINTER heading in the receiver s STATUS section observe that the green LED for PJ flashes once On the display observe that TX PTR now reads 522 Using the LEFT RIGHT cursors select 522 under NDF and then press ENTER Under the SPE section of the POINTER heading in the receiver s STATUS section of the front panel observe that the yellow LED for NDF flashes once Using the INC DEC keys and the LEFT RIGHT cursors set the NDF to 500 and then press ENTER In the receiver s STATUS section of the front panel observe that the yellow LED for NDF flashed once and that under the PAYLOAD DS1 DS3 heading the red LEDs for LOF PAR SYNC and BIT flashed once Also on the display observe that the number after SPE is now equal to 500 On the receiver side of the front panel press POINTER ST112 SONET Transmission Test Set B 5 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test B 6 On the display observe that SPE is at 500 PJ has a one under it PJ has a one under it and NDF has a two under it Press RUN STOP twice to clear all errors On the transmitter side of the front panel press POINTER Using the LEFT RIGHT cursors select 500 under NDF Using the INC DEC keys and the LEFT RIGHT cursors set the NDF to 522 and then press ENTER
164. ailed below Switching disconnecting or any other loss of timing can cause a TX LOSS OF SONET CLOCK message to appear momentarily or periodically switch on and off e ASYNC provides internal timing for the test set e The numbers STS 1 or STS 3 refers to the respective rear panel transmitter inputs There is one 52 Mb s STS 1 clock input and one 155 Mb s STS 3 clock input e BITS extracts the timing from an incoming BITS DSX 1 signal connected to the rear panel 100 ohm input provided The second menu item TX V1 5 BITS INPUT TERMINATION is used to configure this rear panel input for normal termination TERM or a low level input from a network element s MONITOR output e LOOP as the name implies is LOOP timed to the RECEIVER incoming SONET signal optical or electrical Use the arrow keys and the enter return key on the VT 100 keyboard to navigate through the menu and activate your choice ST112 SONET Transmission Test Set 4 23 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel Mapping Transmitter File Edit Settings Phone Transfers Help TX SETUP eA a a a Iq Output Optics 11 MAPPING Iw Timing 1 TX MAPPING Ir Mapping INT DS3 EXT DS3 l lo SPE Pointer BEINT UT1 5 BIT FLOAT l Ip UT Pointer EXT UT1 5 BIT FLOAT l Is Sonet Alarms INT UT1 5 BYTE FLOAT l Ig Sonet Error INT STS3C l 11 TOH POH I INT T 12C
165. ake the can during use If a mist appears from the can the cleaning process must be performed again 7 Do not reuse the swab Dispose of it immediately Cleaning Procedure for Unconnected Fiber Cables Note This procedure should be performed each time the fiber cables are to be used to prevent scraching the fiber and ultimately destroying the cables 1 Hold the fiber optic connector to be cleaned in your hand 2 Try not to put unnecessary strain on the fiber 3 Take a clean Kimwipe from the box and dab it into the clean Alcohol 4 Wipe the Alcohol soaked Kimwipe over the ends of the fiber optic cable gently ST112 SONET Transmission Test Set C 9 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Calibration Verification Test 5 Using the clean air spray spray the air into the end of fiber for at least three seconds Note Hold the can in an upright position DO NOT tilt invert or shake the can during use Ifa mist appears from the can the cleaning process must be performed again 6 Dispose of the used Kimwipe immediately Do not reuse it C 10 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Index A AC Interlock 2 18 AC Power 2 18 AC Power Requirements 1 5 2 4 Accessories 1 4 Active 5 3 Alarms Line 2 12 Payload 2 14 Section 2 11 VT Path 2 13 APS LCD
166. alue of the New Data Flag that will become the active transmit VT pointer value when the next tx_vt_ndf command is executed Example vt_ptr_ndf n n a decimal number from 0 to 103 Response NONE Note See the tx_vt_ndf command vt_ptr_ndf Transmitter VT NDF Setup Query Command Returns a character string indicating the New Data Flag value associated with the tx_vt_ndf Set Command that will become the VT NDF value when the tx_vt_ndf command is executed Example vt_ptr_ndf Response VT_PTR_NDF 70 Note There is one NDF for each VT1 5 Channel received in the SONET signal ST112 SONET Transmission Test Set 7 39 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tx_vt_ndf Transmitter VT NDF Set Pointer Execute Command Sets the New Data Flag Pointer Value to the value that was specified by the vt_ptr_ndf Set Command Example tx_vt_ndf Response NONE Note See the vt_ptr_ndf command tx_vt_pntr Transmitter VT NDF Pointer Query Command Returns a character string indicating the current value of the New Data Flag VT1 5 pointer Example tx_vt_ndf Response TX_VT_NDF 500 Note There is one NDF for each VT1 5 Channel received in the SONET signal tx_vt_sing pos neg J VT Single Step Pointer Set Command Increments or decrements the VT pointer value Argument pos increments the value neg decrements the value Example tx_vt_sing pos Response NONE
167. and W DCS Testing The test setup illustrated in Figure 5 7 is used to verify provisioning The test setup can be done with a single ST112 SONET Transmission Test Set and Terminal because each Test Set has both the Transmitter and Receiver Sections required to analyze the NE Network Element under test In this example the ADM Add Drop Multiplexer or W DCS Wideband Digital Cross Connect System has four OC 3 inputs and one OC 12 output The Test Set transmitter section generates the OC 3 with Unframed Quasi Random Word U QRW U QW mapping into VT1 5 Channel 1 of the STS 1 Not shown in Figure 5 7 are the equipment provisioning requirements of the Network Element under test because they are installation dependent After setting up the NE use the VT Channel function mode to make a Provisioning Analysis 5 6 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use VT Channel Scan Setup Before running the VT Channel Scan mode the ST112 SONET Transmission Test Set Receiver Section Mapping r VT1 5 Channel t and VT1 5 DSX1 Configuration y must be configured for the incoming signal Error indications such as BIT SYNC and LOF may occur when these settings are incorrect The VT Channel Scan display will confuse numbering and data when VT Channel Numbering is set incorrectly Autoseek and Autolink are not used set to off to avo
168. ands are used to change current status values or states to start or stop a test for example While query commands ask the instrument to respond with the contents of a status register the value of a given setup parameter a measurement result or a current state Remote commands are directly related to setup parameters and results rather than to front panel keys or setup menus For example there is no remote command used to press the SETUP Key Some commands may only have a query form or only a set form however many have both forms When a command has both a set and query form the mnemonic header used for the query form will be identical to its corresponding set command form except for an added question mark The following examples use the mnemonics for the view angle query and set commands view_angle query command view_angle n set command The view angle query command uses the header view_angle with a question mark and no space The view angle set command uses the same header with a the veritable n which represents an integer from 0 to 7 with a space Command Symbols and Delimiters 7 2 Symbol Meaning lt CR gt Carriage return ASCII decimal 13 lt LF gt Line Feed ASCII decimal 10 numbers and integers Decimal 10 Hexadecimal HFA Octal Q377 Binary B11111111 NOTE Unless otherwise indicated all numbers and integers are decimal lt string gt A character string Enclosed argument is required E
169. anged in a continuous loop Press any other key to exit the setup mode A WARNING Before activating the LASER its output must be connected to a circuit ENTER o SETUP Figure 2 3 Setup Main Menus ST112 SONET Transmission Test Set 2 5 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview Transmitter Description This section describes the transmitter inputs outputs controls and indicators Figure 2 4 shows the ST112 SONET Transmission Test Set transmitter front panel area A WARNING Before activating the LASER its output must be connected to a circuit TRANSMITTER DS3 VT1 5 STS3C 12C PATTERN MAPPING ps3 DCC OW Ovr O3c TIMING 12C ERROR LASER ON Ooc1 O Cos A O 0c12 Figure 2 4 Transmitter Front Panel Transmitter Connectors Front Panel The front panel has eleven output connectors In the DSX 1 section there are four connectors either Bantam or WECO 310 jacks They provide the industry standard Digital Signal cross connect Level 1 DSX 1 100 ohm balance output The OUTPUT section has six 75 ohm output connectors either WECO 560 or BNC The Output Key is used to switch between STSX 1 and DSX 3 providing either the Synchronous Transport Signal cross connect Level 1 STSX 1 output or Digital Signal cross connect Level 3 DSX 3 output Two yellow LEDs indicate the selected signal STSX 1 or DSX 3 On the l
170. annel Select Command 7 34 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tx_vt_fram unframed sf esf sic Tx VT Frame Set Command Sets the transmitter DS 1 Frame Format Argument unframed sf super frame esf extended super frame slc SLC 96 Subscriber Loop Carrier 96 Example tx_vt_fram esf Response NONE tx_vt_fram Transmitter VT Frame Query Command Returns a character string indicating the selected receiver VT Frame Format Example tx_vt_fram Response TX_VT_FRAM ESF Note For Arguments see tx_vt_fram Tx VT Frame Set Command tx_vt_mode all single Tx VT Mode Set Command Sets the transmitter VT1 5 Mode Argument all set the mode to use all 28 VT1 5 Channels single sets the mode to the one channel set by the tx_vt_chan command Example tx_vt_mode single Response NONE tx_vt_mode Transmitter VT Mode Set Command Returns a character string indicating the selected VT1 5 Channel Mode Example tx_vt_mode Response TX_VT_MODE SINGLE Note For Arguments see tx_vt_mode Tx VT Mode Set Command tx_vt_patt prbs_23 prbs_15 qrw word Tx VT Pattern Set Command Sets the transmitter DS 1 Pattern Argument prbs_23 223 1 Pseudo Random Bit Stream prbs_15 215 1 Pseudo Random Bit Stream qrw Quasi Random Word word 24 Bit Word Pattern auto configuration Example tx_vt_patt prbs_23 Respon
171. ansmitter l Terminal ST112 TRM File Edit Settings Phone Transfers Help TX SETUP fee sc eeenns ee nnananennsaaesenasess l STS3C CONFIGURATION l STS3C PATTERN 2E23 INU SINGLE ERROR INJECT UZE Iq Output Optics l Iw Timing l Ir Mapping l lo SPE Pointer l Ip UT Pointer l Is Sonet Alarms l Ig Sonet Error l l l l l l l 11 TOH POH Iz J1 Trace Messge It UT1 5 Channel ly UT1 5 DSX1 Cfg Ik UT Err Alarms lu DS3 DSX3 cfg Figure 4 45 STS 3c Configuration Menu Transmitter The STS 3c CONFIGURATION i shown in Figure 4 45 is output dependent It is only accessible when either the OC 12 or OC 3 rate is selected with 3c payload mapping Press CTRL T and the q key to access the Quick Setup menu Use this menu to configure the STS 3c payload PATTERN that will be transmitted and to inject a single bit error in that pattern Under the STS 3c STS3C PATTERN heading either the 2E23 Pseudo Random Bit Sequence or the 2E23 INV Inverted can be selected Use the arrow keys and enter key to change selections Pressing the F4 function key will inject a single error when the SINGLE ERROR INJECT heading is selected as shown in this example ST112 SONET Transmission Test Set 4 39 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel STS 12c Configuration Menu Transmitter l Terminal ST112 TRM File Edit Settin
172. aranteed 888 88 SOURCE www artisantg com Functional Overview The Orderwire Handset port provides handset access to the local section or express line ORDERWIRE channel in the selected STS n setup dependent The DCC Data Communications Channel connector is a 15 pin DB socket that can be used with a protocol analyzer or related test set to access V 11 compatible data and clock signals External data can be carried by the section DCC D1 to D3 bytes at a 192 Kb s rate or the line DCC bytes D4 to D12 at a 576 Kb s rate In each case the Test Set supplies a smooth clock source at the appropriate rate and expects a return data bit within 500 ns after each rising edge of the clock The pin numbers and functions are listed in Table 2 1 Figure 2 12 shows the transmit data input pins 2 and 9 They are differentially terminated with a 100 ohm input impedance All other signals are high impedance differential outputs Pins 1 and 8 are signal ground Table 2 1 Data Communications Channel DCC Pinouts Pin Pin Transmit Clock True 6 Receiver Clock True Transmit Clock Compliment Receiver Clock Compliment i Transmit Data True Receiver Data True 9 Transmit Data Compliment Receiver Data Compliment 4 Goud EB Ground _____ Pin 7 Pin 14 DCC Clock Pin 2 100 ohm Pin 9 Figure 2 12 I O Circuit Logic ST112 SONET Transmission Test Set 2 17 Artisan Technology Group Quality Instrumentat
173. art the VFP software NOTE Some communication software packages and VT100 emulators allow the user to define special keys such as function control arrow and others These unique settings may cause VFP problems disable them before starting the VFP ST112 SONET Transmission Test Set 4 5 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel Configuration Submenus 4 6 After starting the ST112 SONET Transmission Test Set Virtual Front Panel software press the CTRL T keys to access the SETUP menu list shown on the left side Figure 4 2 The CURRENT CONFIGURATION and RX ERROR SUMMARY displays center of Figure 4 2 will change with the selections made in the appropriate setup menus and described later in this chapter Other setup submenu selections are made from the upper left side of the display by typing the appropriate letter q w r t y or u The letter m will return to the Current Configuration display Quick Setup File Edit Settings Phone Transfers Help SEIUP PSS e Sarees SessesesessassaSess s2 Iq Quick Setup 11 QUICK SETUP l Iw Time 11 l Ir DSX Line Code RATE PAYLOAD l It Store Recall I D X1 sus l ly Timed Test I 1 DSX3 wan l lu Report Printing I I STSX1 DS3 UT1 5 l Im Current Cfg 1 1 OCI DS3 UT1 5 l l I I OC3 DS3 UT1 5 3c l 1 1 AF DS3 UT1 5 3c eg 11 l l Figure 4 3 VFP Quick Setup Display Menu A WAR
174. artisantg com Remote Commands Transmitter Setup and Mode Commands opt_output on off Optical Output Set Command Enables or disables the Optical Output for OC 1 OC 3 and OC 12 Arguments ON enables the Optical Output OFF disables the Optical Output Example opt_output on Response NONE Note Only valid when an optical option is installed The STS 1 signal must be set using the tx_signal sts1 command opt_output Optical Output Query Command Returns a character string that indicates the current optical output status Example opt_output Response OPT_OUTPUT ON Note The optical output can be on enabled or off disabled sts_sync sts1 sts3 async bits loop Transmit Timing Set Command Sets the STS n Clock Synchronization Source for the Transmit STS n Frame Argument sts1 use the rear panel STS 1 clock input sts3 use the rear panel STS 3 clock input async use the internal STS 1 51 84 Mb s clock bits use the rear panel BITS TIMING input framed DS1 all ones signal loop use the receive recovered clock Example sts_sync loop Response NONE sts_sync Transmit Timing Query Command Returns a character string indicating the current STS n Clock Synchronization Source Example sts_sync Response STS_SYNC LOOP Note see Transmit Timing Set Command tx_dcc off section line Tx Data Comm Channel Set Command Enables and disables the rear panel DCC Port signal insertion Argument section ena
175. at SPE now equals six On the receiver side of the front panel press ERROR until the lefthand side of the display reads SECT on the top line and B1 on the bottom line The value of TOT should equal six and the value of SECT ES should be equal to or less than six On the receiver side of the front panel press ERROR until the lefthand side of the display reads LINE on the top line and B2 on the bottom line The value of TOT should equal six and the value of LINE ES should be equal to or less than six On the receiver side of the front panel press ERROR until the lefthand side of the display reads PATH on the top line and B3 on the bottom line The value of TOT should equal six and the value of PATH ES should be equal to or less than six On the receiver side of the front panel press ERROR until the top line shows B1 B2 B3 and FEBE The values of B1 B2 and B3 should all equal six Press RUN STOP twice to clear all errors On the transmitter side of the front panel press ERROR until the display shows the STSX1 Random Error Rate menu Using the LEFT RIGHT cursors select 1 0E 3 and then press ENTER ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com 20 21 22 23 24 25 26 21 Incoming Inspection Test In the receiver s STATUS section of the front panel observe that the red LEDs for B1 B2 B3
176. at the red LED for BIT flashed three times Also in the receiver s section of the display observe that the value of DS1 is three 9 On the receiver side of the front panel under the DS3 VT1 5 STS3C 12C heading press ERROR until the lefthand side of the display shows DS1 on the top line and BIT on the bottom line NO ee ee m 10 On the display observe that the value of BIT equals three 11 Press RUN STOP twice to clear all errors 12 On the transmitter side of the front panel under the DS3 VT1 5 STS3C 12C heading press ERR ALM until the top line of the display shows DS1 ALARMS 13 Using the LEFT RIGHT cursors select AIS and then press ENTER ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test 14 On the receiver s STATUS section of the front panel under the PAYLOAD DS1 DS3 heading observe that the red LEDs for AIS SYNC and BIT remain lit 15 Using the LEFT RIGHT cursors select OFF and then press ENTER 16 Press RUN STOP to clear all errors DS3 Quick Set Up This section of the procedure verifies that the DS3 is functioning properly and that errors can be injected correctly The quick set up places the unit into a default mode which selects specific settings for the unit These default settings are preprogrammed and therefore consistent from unit to unit Leave everything set up as it was in the la
177. at was specified by the tx_ptr_ndf Set Command Example tx_spe_ndf Response NONE Note See the tx_ptr_ndf command tx_spe_pntr Transmitter SPE Pointer Query Command Returns a character string indicating the current value of the New Data Flag STS n SPE pointer Example tx_spe_pntr Response TX_SPE_PNTR 500 Note There is one pointer value for each STS 1 Channel received in the SONET signal 7 38 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tx_spe_sing pos neg SPE Single Step Pointer Set Command Increments or decrements the STSn SPE pointer value Argument pos increments the value neg decrements the value Example tx_spe_sing pos Response NONE The value of the pointer is increased or decreased by 1 each time the command is executed Pointer Commands VT rx_vt_ndf Receiver VT Count Query Command Returns a character string indicating the number of New Data Flag adjustments counted in the selected VT1 5 channel in the received SONET signal Example rx_vt_ndf Response RX_VT_NDF 310 Note There is one NDF for each VT Channel received in the SONET signal rx_vt_pntr Receiver VT Value Query Command Returns a character string indicating the value of the VT Pointer in the selected VT1 5 Channel Example rx_vt_pntr Response RX_VT_PNTR 522 vt_ptr_ndf n Transmitter VT NDF Setup Command Sets the v
178. ator alarm indicates that bits 6 7 and 8 of the K2 byte have been a binary 110 respectively for five or more consecutive frames This condition indicates or emulates an downstream LTE failure The B2 error indicates that line parity errors were detected Path Alarms The Path is a logical connection between the point of frame origin and the point of frame destination These points can be further defined as the point where the frame of a specified rate OC 12 OC 3 OC 1 DS1 or DS3 is assembled and the point where the frame of that same rate is disassembled The Test Set has four Path LED indicators as follows The AIS Alarm Indication Signal indicates an upstream STS 1 STS 3c or STS 12c path failure in the monitored direction The STS 1 and STS 3c paths may travel across multiple STS n transmission facilities and a failure in any one of them will result in a path AIS at all downstream points The RDI Remote Defect Indicator alarm indicates an upstream STS 1 STS 3c or STS 12c path failure in the unmonitored direction In other words the PTE Path Terminating Element receiving the monitored STS n path has entered a failure state or is receiving a line AIS failure indication The FEBE Far End Block Error indicates that there are upstream STS 1 STS 3c or STS 12c path bit errors in the unmonitored direction In other words the PTE receiving the other direction of the monitored STS n path has detected one or more path BIP 8 c
179. bit error in the STS 3c synchronous payload Example s3c_error Response NONE Note Bit errors caused by this command result in section line and path BIP 8 code violation because a single bit error is located at random anywhere in the STS 3c payload after the section line and path parity has been calculated sts_err parameter1 parameter2 Change Displayed Menus Remotely Change Displayed Menus remotely Example sts_err oc48_b2 Argument B1 for B1 error menu B2 for B2 error menu B3 for B3 error menu STS_SUM for STSn errors summary menu 0C48_B1 for OC48 B1 error menu O0C48_B2 for OC48 B2 error menu 0C48_SUM for OC48 errors summary menu STSX_BPV for STSX bipolar violation error menu BIP2 for BIP 2 error menu DS1_SUM for DS1 errors summary menu ELAP_TIME for elapsed time menu Note The remote command will change the menu only when the new menu is valid for the current configuration If the menu is not valid an execution error will result There is no space allowed between the two parameters The command and parameters can be either written in either upper or lower cases stx_bpv_rate n STSX 1 BPV Rate Set Command Sets the STSX 1 BPV Error Rate Generator to a number n from 1 0E 9 to 1 5E 3 Example stx_bpv_rate 1 0E 6 Response NONE Note The errors will be generator when the stx_bpv_rand on command is executed stx_bpv_rate STSX 1 BPV Rate Query Command Returns the current STSX 1 BPV Rate settings Example stx_bpv_
180. ble HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on ds3_xbit DS3 Yellow DS3 Query Command Returns the current state of the PAYLOAD DS1 DS3 DS3 YEL DS3 indicator Clear History or Current Example ds3_par_sta Response DS3_PAR_STA CLEAR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on led_stat LED Status Query Command Returns a summary the current state of all receiver front panel indicators Clear History or Current Example led_stat Response LED_STAT HIST Note CLEAR Indicates that all LEDs are off and no history for any is available HIST History Indicates that all LEDs are off and some historical data is available CUR Current Indicates that some LEDs are on line_ais Line AIS Query Command Returns the current state of the LINE AIS indicator Clear History or Current Example line_ais Response LINE_AIS CUR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on line_b2 Line B2 Query Command Returns the current state of the LINE B2 indicator Clear History or Current Example line_b2 Response LINE_B2 CLEAR Note CLEAR Indicates that the LED
181. ble Test Report Type Arguments log enable event log reports eot enable end of test reports both enable both log and eot reports off disables reports Example test_report both Response NONE test_report Test Report Query Command Returns a character string indicating the report status Example test_report Response TEST_REPORT BOTH Note See the Test Report Set Command test_squelch on off Test Squelch Set Command Enables or disables the Squelch Arguments on 1 logs 10 consecutive events 2 waits for 10 event free seconds off logs every event Example test_squelch on Response NONE Note When the Squelch is enabled error logging is limited to ten consecutive reports Then Error logging is resumed after 10 event free seconds test_squelch Test Squelch Query Command Returns the current status of the Squelch Example test_squelch Response TEST_SQUELCH ON Note See the Test Squelch Set Command test_state run stop Test State Set Command Sets the test state to either run or stop Arguments run clears all counters clears the history and starts the test cycle stop suspends the test cycle Example test_state run Response NONE Note See pause_state command The Trouble Scan Mode must be OFF before the Test State can be enabled 7 28 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tes
182. bles insertion into the section DCC D1 to D3 line enables insertion into the line DCC D4 to D12 off disables insertion Example tx_dec section Response NONE 7 24 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tx_dcc Transmit Data Communication Channel Query Command Returns a character string indicating the status DCC insertion Example Tx_dec Response TX_DCC LINE Notes The DCC insertion can be set to SECTION LINE or OFF see tx_dcc and rx_dcc set commands tx_map int_ds3 ext_ds3 int_bit_fl ext_bit_fl byte_fl 3c 12c Tx Mapping Mode Set Command Sets the Transmitter Payload Mapping Mode Argument int_ds3 Asynchronous DS3 Internally Generated ext_ds3 Asynchronous DS3 signal applied to the rear panel DSX 3 input int_bit_fl bit floating synchronous floating VT1 5 Internally Generated ext_bit_fl bit floating synchronous applied to the rear panel BITS DSX 1 input byte_fl byte floating synchronous floating VT1 5 3c concatenated STS 3 Internally Generated 12c concatenated STS 12 Externally Generated Payload Required Example tx_map 12c Response NONE tx_map Transmitter Mapping Mode Query Command Returns a character string indicating the current Transmitter Payload Mapping Example tx_map Response TX_MAP 12C Note Transmitter Mapping can be INT_DC3 EXT_DC3 INT_BIT_FL EXT_BIT_FL B
183. bserve that the yellow LED for NDF remains lit Using the LEFT RIGHT cursors select OFF and then press ENTER Press RUN STOP twice to clear all errors ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test 31 On the transmitter side of the front panel press ALARM until the display shows the Out of Range SPE Pointer menu 32 Using the LEFT RIGHT cursors select CONT and then press ENTER 33 On the receiver s STATUS section of the front panel under the LINE heading observe that the red LED for LOP remains lit 34 Using the LEFT RIGHT cursors select OFF and then press ENTER 35 Press RUN STOP twice to clear all errors Virtual Tributary VT Payload This section of the procedure verifies that the VT payload is functioning properly Leave everything set up as it was in the last section There are twenty one steps in this section of the procedure 1 On the transmitter side of the front panel press MAPPING Using the INC DEC keys select INT VT1 5 BIT FLOAT and then press ENTER On the receiver side of the front panel press MAPPING Using the INC DEC keys select VT1 5 BIT FLOAT and then press ENTER Press RUN STOP twice to clear all errors The transmitter and receiver sides should now be linked error free aN aE ek On the transmitter side of the front panel press ALARM until the display shows the VT PA
184. bytes of the STS frame The SPE pointer can be any value from 0 to 782 Also in this example the counts for PJ and PJ are zero They change each time the pointer value changes during the measurement period The VT pointer display is only accessible in the VT1 5 mode The VT pointer value 78 indicates the position of the first payload V5 byte in the sub channel The pointer word is located in the V1 and V2 bytes of the VT frame The VT pointer can be any value from 0 to 103 Data Communications Channel Orderwire Menus Receiver Figure 3 10 DCC Order Wire Menus Receiver Data or voice can be received on a device connected to the rear panel DCC OW connector on the Section or Line DCC or Order Wire channels Pressing the receiver DCC OW key one or more times will access the configuration menus shown in Figure 3 10 Using the arrow and enter keys The DCC Data Communications Channel can be configured for OFF SECTION or LINE e DCC is used to transfer data between NE network elements and ORDERWIRE is used for voice communications e The data can be received in either the SECTION or LINE DCC channel e LOCAL refers to the connection between two adjacent devices such as a regenerator and a NE or two adjacent regenerators and EXPRESS indicates the connection is between two NE with regenerators in between Communications between two Network Elements NE with no regenerators can use either a LOCAL or an EXPRESS connection 3 12
185. ccccesessceeseeeeceeecesecesecaecseecaeeeseeeeeeneeseeeseeneeeeeneenaeenaes 48 ds_sync DS1 SYNC Query Command 0 0 0 ccceecceecceseceeceseccecaeecseeeseseeeeeeeeeeeseeeaeeeaeenaecsaesaeeenes 49 dsl_ yellow DS1 YEL DS3 Query Command 00 ceccceccceseceseesceeseeeseeeeceeeeseenseenaeensecnseeeeeaeeeaes 49 ds3_bit_sta DS3 BIT Indicator Query Command ceessseseceeeeeeeseeeceseeeessecaeeseceverseaeeeeeaeeates 49 ds3_idle DS3 IDLE Indicator Query Command 2 0 0 0 cecceccceseesceeseeeseeeeeeeeeeecesecnseenseensecseeeneeeaes 49 ds3_ ones DS3 All Ones Query Command cecccecceescessceeeceeceecaecseecaeecseseseeeeesersseeeeseenaeenaeentes 49 ds3_par_sta DS3 Parity Query Command sissien i ties R aie 50 ds3_xbit DS3 Yellow DS3 Query Commmand cceeccesceseessecseeeseeeseeeeeeeeeeeeesecseeeeaeensecseeeaeeenes 50 led_ stat LED Status Query Command cccccccecscesscesscesecesecesecseecaeesaecaaecaeeeaeseaeseeeeeeeeeeeaeeneeerenaees 50 line_ais Line AIS Query Command 000 ceeeeseesesceseeeseseseceesecesesecaeseeesecsnesaecasenesaeeaseaesaeesesseteeeneees 50 line_b2 Line B2 Query Command ess cecesaeciees ccveccsesacs descends tsacievs aaeeaeacseadedaasevees ta REEERE 50 line_ferf Line FERF Query Command cceceecesceseceseeeeeeceseeeeesecaeeseceeseeesaeseceaecaeseeenaeereeaeeneeaeeas 51 line_lop Line LOP Query Command 0 ccccccccccsesceesceecceeensecesecasecseecseeeseeeeeeeeeeeenseenseeeaeenaeenaes 51 path_ais Pa
186. ce Message Transmitter The JI TRACE MESSAGE z shown in Figure 4 37 is used to add and edit the ASCII data being generated Press the up arrow key to move to that display field The TRACE MESSAGE ASCI can now be entered from the VT100 keyboard as shown in the this is a test example Press the up arrow one time to move to the FILL MESSAGE HEX section The F4 execute key will be displayed next to it Any hexadecimal code can be entered but only those within the ASCII range can be displayed Press the up arrow one more time and the F4 key will appear next to the selection labeled CLEAR MESSAGE 00 Press the F4 key to clear the trace message Actually the trace message will be filled with all zeros ST112 SONET Transmission Test Set 4 31 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel VT1 5 Channel Transmitter l Terminal ST112 TRM File Edit Settings Phone Transfers Help TX SETUP a T Iq Output Optics I UT1 5 CHANNEL l Iw Timing I UT CHANNEL NUMBERING l Ir Mapping l 11 X 28 lo SPE Pointer 1 l Ip UT Pointer I ACTIVE UT1 5 CHANNEL l Is Sonet Alarms 11 ALL l Ig Sonet Error ll l 11 TOH POH CHANNEL 1 28 1 l Iz J1 Trace Messge l It UT1 5 Channel 1 l ly UT1 5 DSX1 Cfg I 1 l Ik UT Err Alarms 11 l lu DS3 DSX3 Cfg SSS SaHSsaSSSSSS5S4SS S5S Figure 4 38 VT1 5 Channel Configuration Me
187. cessenvesesnsssosccsecsvsssecesudecouessses 5 17 Trouble Scan Combined Dural Mode ssccssssccssssseecsssssccsssceccsssscessssccesssceesesosces 5 20 vi ST112 SONET Test Set User Manual Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers amp Printers Remote Control Applications scsscsssscssssscsssesssessessssssssssssssssssssesssesssesssssesseees 6 2 Printer Applications scsscccscssssssssssscssscsssesssesssessseesnsesssessesssenesenessssssscssssssessessess 6 2 Using the RS 232C Port sscsssssssssscsssssssssscsssesssessssssesscesscssssssssscssensesnsessssesssesenesees 6 3 Using the GPIB Port ssscsssscssssssssscscssesesscessssssssssscssnesssscssscsaeesseessssesesssessesaseessaeees 6 7 Remote Commands Command Types amp Syntax ccscsscssecsscssscsssssssssscssssssssssesssesssssssssssssssssssssessnesees 7 2 Command Symbols and Delimiter ccscesscssssssscsssscssscscssssesssesssesssessssssssessessees 7 2 Multiple Commands csccsccsssssssssesssssssscscsssesscsessssssesnsessssessnessssssessneseseesssssecsssesenees 7 3 Table Of Comma dS 0 cs ccasscssvoscassossoevsses dosesseescssvesevsuscviesesesesshssoenssosowsssubicoevecetuvesesvessess 7 5 Standard Register CoOMmmManGs sescssccsscssecssscsssssssssesesssesssssessssssssesssesssessesssesees 7 13 General Setup Command
188. change D8 to 00 and then press ENTER ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test 15 Using the LEFT RIGHT cursors select D9 16 Using the INC DEC keys and the LEFT RIGHT cursors change D9 to 00 and then press ENTER 17 On the receiver side of the front panel press OVHD and observe that the values of D7 D8 and D9 are once again zero Continuous Alarms STSX1 This section of the procedure ensures that the continuous alarm settings are functioning properly Leave everything set up as it was in the last section There are thirty five steps in this section of the procedure 1 On the transmitter side of the front panel press ALARM until the display shows the Errored Frame menu 2 Using the LEFT RIGHT cursors select CONT and then press ENTER 3 On the receiver s STATUS section of the front panel observe that the following error lights appear Note If a red LED remains lit then the error or alarm is still occuring Ifa LED under the POINTER heading remains lit then the condition is still occuring A Under the SECTION heading the red LEDs for LOF OOF and B1 remain lit B Under the LINE heading the red LEDs for AIS LOP RDI and B2 remain lit The red LEDs for AIS LOP and RDI may flash C Under the PATH heading the red LEDs for RDI FEBE and B3 remain lit The red LED for RDI may
189. chos I I 9 ch09 10 ch10 11 ch11 12 chO5 I 13 ch13 14 ch14 15 ch15 16 chi6 I 17 ch17 18 ch18 19 ch19 20 ch20 I 21 ch21 22 ch22 23 ch23 24 ch24 I I 25 ch25 26 ch26 27 ch27 28 ch28 IRENABLE SCAN OFF M I Figure 5 10 ST112 SONET Transmission Test Set ADM and E DOS Testing 5 8 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use Table 5 1 VT1 5 Locations and Channel Numbering Conventions Group VT VT1 5 VT1 5 STS 1 SPE Bellcore TA 253 1 x 28 format 4x7 format J Column s 9 38 67 10 39 68 11 40 69 12 41 70 13 42 71 14 43 72 15 44 73 16 45 74 17 46 75 18 47 76 19 48 77 20 49 78 21 50 79 22 51 80 23 52 81 24 53 82 25 54 83 26 55 84 27 56 85 28 57 86 29 58 87 When testing provisioning or mapping 1x28 or 4x7 avoid using channels 1 10 19 and 28 because they are in the same logical VT slot in both configurations as can be seen in Figure 5 8 and Table 5 1 ST112 SONET Transmission Test Set 5 9 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use End to End Path Verification Outputs STSX 1 Inputs Loopback Connections Figure 5 11 End to End Path Verification The same VT1 5 Channel Scan feature can be used to verify facility assignments or trace a particular VT through a
190. commended for the Windows 3 1 Terminal Software or other communication packages may be available from Tektronix Customer Support Remote Modem Connections Remote connections using modems should use the same configuration and will operate identically with the addition of the modem set up and dialing commands The recommended speed between the ST112 SONET Transmission Test Set and its local modem and the VT100 and its local modem is 9600 baud though lower baud rates are supported Communications Initiation Pressing the enter key on the terminal or PC should cause the Test Set prompt to appear on the terminal screen ST112 gt If it does not or if a message appears indicating that the input was lost verify the port parameter settings for the ST112 SONET Transmission Test Set and the terminal Verify that the Test Set RS 232 ECHO is enabled using the setup LCD menu Verify that the RS 232C interface cable is properly connected When the Test Set prompt appears on the screen type either VT100 when using a VT100 compatible terminal PC100 when using an IBM compatible PC The difference between the VT 100 and the PC100 commands are the character sets used to draw lines and boxes Standard ASCII characters are used when the PC is running a V7T 00 emulator Special PC graphic characters are used in the PC100 mode After entering either command the ST112 SONET Transmission Test Set will draw the VFP on your terminal or PC screen as illus
191. ctures and displays In addition to the general displays and menus there are separate sections that detail setup receiver and transmitter specifics Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays Functional Verification A functional verification of the ST112 SONET Transmission Test Set can be performed while reviewing this chapter To do so connect the three front panel receiver inputs one laser and two electrical to their appropriate front panel outputs as shown in Figure 3 1 To avoid overdriving the receiver and avoid erroneous errors and readings use a 10 to 15 dB attinuator for the OC n Loopback connection Any one of the electrical outputs for DSX 1 and DSX 3 will work Be sure to read and observe all of the appropriate safety rules in chapters 1 and 2 Tektronix ST112 SONET Transmission Test Set TRANSMITTER OC n Loopback STSX 1 DSX 1 Loopback DSX 1 Loopback Figure 3 1 Functional Verification Test Setup Setup Menu System Pressing the setup key at any time will cause the ST112 SONET Transmission Test Set to enter the Setup Menu System accessing the menus and submenus shown in Figure 3 2 and Figure 3 3 Four keys are used to navigate through
192. d 888 88 SOURCE www artisantg com Applications and Use l Terminal ST112 TRM File Edit Settings Phone Transfers Help RX SETUP iol a a a Iq Input lI TROUBLE SCAN DS3 Mapping l Iw Optics 11 CHANNEL STS3 STS1 Numbering l Ir Mapping I1 1 1 NONE 3 1 l It UT1 5 Channel lI 2 NONE 2 l ly UT1 5 DSX1 Cfg II 3 B1 ERR H 3a l lu DS3 D X3 Cfg II 2 1 LOS H 4 1 l lo SPE Pointer lI 2 NONE 2 se l Ip UT Pointer Il 3xSCANNING lt oa l Is TOH POH lI l Ig J1 Trace Messge II UIEW LOG l Ih APS Bytes 11 CHANNEL DWELL TIME 10 l Ij UT Channel Scan II TROUBLE SCAN MODE OFF W l In Trouble Scan a a an aaa aaa a Figure 5 21 Receiver Trouble Scan Mode In Figure 5 21 the Trouble Scan display where all the STS 1 channels in each of the four STS 3 channel groups are being scanned because DS3 mapping is being used at the OC 12 rate It also illustrates errors that were detected on two view channels 3 and 4 1 3 and 2 1 and that view channel 6 2 3 is currently being scanned VIEW CHANNEL numbers shown in Figure 5 22 are used in the log because any particular rate can contain several different payloads The first STS 3 can be mapping DS3 payloads the second STS 3 can be mapping a 3c payload and the other two STS 3 channels can have entirely different payloads VT1 5 for example Such an example would provide ten view channels The first three 1 2 and 3 would be multiplexed into the first STS 3
193. d Returns 40 bytes 27 are valid TOH Section and Line overhead bytes 9 are valid POH Path Overhead bytes And 4 are valid VT Virtual Tributary overhead bytes Whereas the argument n is the corresponding offset value for the byte mnemonic using the format byte mnemonic offset value listed in Table 7 2 Table 7 2 Byte Mnemonic and Offset TOH Section Sec and Line Overhead Bytes POH Bytes H1 12 H2 13 B2 16 K1 17 K2 18 D4 20 D5 21 D6 22 D7 24 D8 25 D9 26 D10 28 D11 29 D12 30 1 32 Z2 33 E2 34 Example rx_oh_offset 18 Response RX_OH_OFFSET 18 H22 Note The number 18 in the example and the response corresponds to the K2 byte s offset value The number H22 in the response is the non decimal numeric hexadecimal value of the K2 byte The label K2 is not entered or displayed 7 42 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands Receiver Measurement Commands b1_ber B1 Error Rate Query Command Returns the rate of STS n Section BIP 8 Code Violations Measured in the received SONET signal Example b1_ber Response B1_BER 1 7E 5 Note The rate is returned as a negative exponent b1_err B1 Error Count Query Command Returns the number of STS n Section BIP 8 Code Violations counted in the received SONET signal Example b1_err Response B1_ERR 43234 b1_es B1 Errored Secon
194. d for e Passive Monitoring e Active Analysis e Circuit Pack Testing e VT Channel Scan ADM and E DCS Testing e Combined Dual Mode e Virtual Front Panel Combined Dual Mode e Trouble Scan Basics e Trouble Scan Combined Dual Mode Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use Applications 5 2 The ST112 SONET Transmission Test Set basic applications include Passive Monitoring Active Analysis Circuit Pack Testing ADM Add Drop Multiplexer Testing and E DCS Electronic Digital Cross connect System Testing The Advanced Applications include the Combined Dual Mode and Trouble Scan in the Combined Dual Mode Specific applications for field service troubleshooting engineering analysis production test and maintenance test are the same or similar Passive Monitoring Tektronix ST112 SONET Transmission Test Set Passive Coupler Figure 5 1 Passive Monitoring The passive monitoring application can be used to monitor optical and electrical SONET sources OC 12 OC 3 OC 1 STSX 1 and asynchronous electrical sources DSX 3 and DSX 1 Using a passive coupler such as an 80 20 or 90 10 splitter coupler as illustrated in Figure 5 1 to connect and disconnect the Test Set without disrupting live traffic T
195. d generator for tributary and network testing DSX 1 and DSX 3 Asynchronous Cross Connect Testing capabilities can be used independently or integrated with the SONET testing capabilities Designed for both field and lab use the Test Set extends SONET Testing Technology by delivering a clear channel STS 3c and STS 12c concatenated mappings in addition to the standard DS3 and VT1 5 mappings The front panel design is shown in Figure 1 1 When Ordering the ST112 SONET Transmission Test Set use the following numbers ST112 SONET Transceiver Test Set ORDERING INFORMATION Opt 1C Replace the BNC Connectors with WECO 560 Connectors 1 2 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Introduction ST112 SONET Transmission Test Set Factory Upgrades ST112 a ST11F03 Add the OC 1 OC 3 and OC 3c to the Electrical Unit ST11F04 Add the OC 12 to the OC 1 OC3 and OC 3c Unit ST11F08 Add the OC 12c to the OC 1 OC 3 OC 3c OC 12 Unit Bellcore CLEI and CPR Product Codes The ST112 SONET Transmission Test Set has been assigned the following Bellcore COMMON LANGUAGE Product Codes CLEI SNTQAB36AA CPR 674662 ST112 SONET Transmission Test Set Features and Capabilities e OC 12c OC 12 OC 3c OC 3 SONET Section Line Path and VT Path Testing B1 B2 and B3 Error Measurement Section Line Path and VT Path Alarm Detection Line Layer Alarm and Erro
196. dditional patterns include 2E23 Pseudo Random Bit Sequence and the 8 bit WORD This menu screen is only accessible when the DSX 3 Rate or DS3 Payload is selected Make the appropriate choices from the QUICK SETUP menu CTRL T ee ee ee ee ee ee ee ee ee ee ee ee ee a ee ee a DS3 DSX3 CONFIGURATION I DS3 FRAMING l CBIT UNFRM l I PATTERN DS3 PAYLOAD l 2E23 WORD l l l AA l l l l l me e e e e ee ee ee ee s s ee ee s s ee ee ee ee ee ee a menu q Use the arrow keys to navigate through the menu and the enter key to enable the selections ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel DS3 Alarms and Errors l Terminal ST112 TRM File Edit Settings Phone Transfers Help TX SETUP P opasna Iq Output Optics DS3 ALARMS Iw Timing DS3 ALARMS Ir Mapping YEL AIS IDLE lo SPE Pointer Ip UT Pointer Is Sonet Alarms l l l l BURST ALARH l Ig Sonet Error l l l l l l l I I I ae SEF VEL NUMBER OF BURST FRAMES EY l 11 TOH POH I I I Iz J1 Trace Messge SINGLE ERROR INJECT It UT1 5 Channel ly UT1 5 DSX1 Cfg DS3 BIT ERROR RATE Ik UT Err Alarms 9E 3 ENABLE ON lu D 3 DS X3 Cfg Figure 4 43 DS3 Alarms and Errors The DS3 Err Alarms 4 menu shown in Figure 4 43 is only accessible when DS3 Payload Mapping is selected with on
197. ds Query Command Returns the number of errored seconds counted in the received SONET signal Example b1_es Response B1_ES 42 Note Errored seconds are for the STS n Section BIP 8 Code Violations counted b1_ses B1 Severely Errored Seconds Query Command Returns the number of severely errored seconds counted in the received SONET signal Example b1_ses Response B1_SES 22 Note Errored seconds are for the STS n Section BIP 8 Code Violations counted b2_ber B2 Error Rate Query Command Returns the rate of STS n Line BIP 8 Code Violations Measured in the received SONET signal Example b2_ber Response B2_BER 2 4E 06 Note The rate is returned as a negative exponent b2_err B2 Error Count Query Command Returns the number of STS n Line BIP 8 Code Violations counted in the received SONET signal Example b2_err Response B2_ERR 22325 ST112 SONET Transmission Test Set 7 43 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands b2_es B2 Errored Seconds Query Command Returns the number of errored seconds counted in the received SONET signal Example b2_es Response B2_ES 77 Note Errored seconds are for the STS n Line BIP 8 Code Violations counted b2_ses B2 Severely Errored Seconds Query Command Returns the number of severely errored seconds counted in the received SONET signal Example b2_ses Response B2_SES 1229 Note Errored seconds are for the STS n Li
198. e This manual describes how to use the Tektronix ST112 SONET Test Set This manual is your primary source of information about how the ST112 SONET Test Set functions This manual is divided into eight sections Chapter 1 Introduction Describes the test set and provides a list of standard and optional accessories Chapter 2 Functional Overview Describes controls indicators connectors display elements and menu structures Includes sections that detail receiver and transmitter specifics and general sections that apply to both Chapter 3 LCD Menus and Displays Describes the use of LCD menu structures and displays In addition to general displays and menus there are separate sections that detail setup receiver and transmitter specifics Chapter 4 Virtual Front Panel Describes the use of terminal display menu structures accessed by using a VT 100 terminal emulator These full screen displays provide more information than individual LCD displays and can be used remotely or with a local terminal Chapter 5 Applications and Use Provides common examples of telecommunication network applications Details how to use the test set for Passive Monitoring Active Analysis and Test Signal Generation Chapter 6 External Controllers and Using Printers Explains how to connect external devices to the RS 232C GPIB and parallel ports Chapter 7 Remote Commands Explains the general syntax of the remote command language and defines al
199. e STS1 frequency is 51 8400 Mhz 51 Hz The frequency shown on the counter should be 51 8400 Mhz 51 Hz 11 Remove all cables and terminators from the unit and scope Note For further information regarding the standard masks for DS1 DS3 and STSI refer to the ANSI technical standard T1 102 The masks supported by the _CSA803A scope are direct representations of these standard masks OC1 Signal Mask Verification This section of the procedure verifies that the output signal matches the standard OC1 mask The CSA803A scope a single mode optical cable an in line 5db optical attenuator an Optical Electrical converter and a 50 ohms bnc cable are needed For all optical sections an in line 5db attenuator is required between the transmitter and receiver optical connectors Before any connections are made use the optical cleaning kit to clean the cable end the attenuator end and the optical connectors on the front panel of the unit The last section of the procedure provides an equipment list and simple instructions on how to clean the optical connectors There are seven steps in this section of the procedure 1 Connect the bnc cable from the electrical end of the Optical Electrical converter to the scope 2 Connect one end of the optical cable to the optical connector on the transmitter side of the front panel 3 Connect the other end of the optical cable to the optical end of the Optical Electrical converter ST112 SONET Transmis
200. e Set Command seseeseseeseeeieessstsrsrrrretsssstrrstsssstsrstrersesessrseeereree 58 parity_rate STS n Parity Rate Query Command ccescseeeesseeeceseeeeeeceaeeeeeseeaeeseceevereeeeeetes 58 pyld_err parameterl parameter2 Change Displayed Menus Remotely ceeceseeteeeteeneeees 58 random b1 Random B1 Parity Error Set Command eceeseceeseeceseeeeeeeceeeeseeeeesecaeeesneeeeesaeeneeneees 58 s3c_error STS 3c Error Set Command ccccceceesseescesscesececeeseceseeeecesecnaecaecaaecaeeeaeeeseeeeeeeeeeeeeas 59 sts_err parameterl parameter2 Change Displayed Menus Remotely eesecsseeceeseeeeeeeeneeees 59 stx_bpv_rate n STSX 1 BPV Rate Set Command ccccccesccesecesecseecseecseeeseeeeeeseeseseeereneees 59 stx_bpv_rate STSX 1 BPV Rate Query Command 0 eceeceseececeeeeeceseeecesecaeesecaeeseceveeseaeeeeeaeeates 59 stx_bpv_rand on off STSX 1 BPV Random Set Command 00 ccc eeceeecseeeseceeeeecneeeeecseeseeneees 60 stx_bpv_rand STSX 1 BPV Random Query Command eececcssesceesererceseeeeeeceeseesneeerceaseeeeneees 60 spe_error SPE Error Set Command serein gcin n e R E in ieee eae eels 60 tx_jl_ fill h nn Transmit J1 Trace Set Command ee eceseseescesseeeseceeeeceeeeecaeeeceaeeeserceaeeneeaeeas 60 tx_jl_trace message Transmit J1 Trace Set Command eee eeeeecseeeeceecneeeecneeeeceseeeeeaeenees 60 tx_jl_trace Transmit J1 Trace Query Command 00 cceeeeeseeeceseeeeeeeeseeseceveeeeaeeecaecaeeac
201. e last section There are twenty two steps in this section of the procedure 1 Connect the transmitter and the receiver together with an optical cable with an attenuator attached to one end Connect one end of the optical cable to the optical connector on the B 12 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test transmitter side of the front panel Connect the other end of the optical cable to the optical connector on the receiver side of the front panel 2 On the front panel press SETUP until the display shows the SONET Quickset menu 3 Using the INC DEC keys select OC1 Note that the red LED for LASER ON now remains lit 4 Press RUN STOP twice to clear all errors 5 The transmitter and the receiver should now be linked error free 6 Remove the bnc cable from the STSX connector on the receiver side of the front panel The units should still be linked error free 7 On the transmitter side of the front panel press ERROR until the display shows the STS1 3 ERR menu 8 Using the LEFT RIGHT cursors select SPE amp then press ENTER three times 9 On the receiver s STATUS section of the front panel observe that the red LEDs for B1 B2 and B3 flashed three times 10 On the receiver side of the front panel press ERROR until the top line of the display shows B1 B2 B3 and FEBE 11 On the display the value o
202. e number of parity errored frames FRM can be set from to 511 and will be injected each time the enter key is pressed during the test cycle Use the arrow keys to position the cursor and the INC increment and DEC decrement keys to change the number of frames e DS3 PATH ALARMS SEF is used to inject a burst of severely errored frames with either M13 or CBIT framing The number of frames FRM can be set from to 511 and will be injected each time the enter key is pressed during the test cycle Use the arrow keys to position the cursor and the INC increment and DEC decrement keys to change the number of frames e DS3 PATH ALARMS YELLOW is used to inject a burst of the yellow alarm The number of frames FRM can be set from 1 to 511 and will be injected each time the enter key is pressed during the test cycle Use the arrow keys to position the cursor and the INC increment and DEC decrement keys to change the number of frames e DSX 3 LOSS OF SIGNAL is used to generate a loss of the DSX 3 cross connect signal for a period of 1 to 150 microseconds each time the enter key is pressed during the test cycle Use the arrow keys to position the cursor and the INC increment and DEC decrement keys to change the period of the LOS e DSI ALARMS is used to generate the AIS or RAI payload alarms Use the arrow keys to position the cursor and the enter key to inject the alarm during the test cycle e AIS the Alarm Indication Signal generates
203. e of the supporting transfer rates Make the appropriate choices in the QUICK SETUP menu CTRL T menu q The menu has four main areas as follows e The first main heading DS3 ALARMS is used to generate a continuous alarm during the test cycle YEL AIS and IDLE are the three alarms that can be selected Only one continuous alarm can be enabled at a time OFF disables any set alarm e The second main heading BURST ALARM will generate the selected alarm PARITY SEF or YEL for the number of frames set in the subheading 44 in this example The F4 key is press during the test cycle to insert the burst alarm PARITY in this example e The next main heading SINGLE ERROR INJECT will insert a single bit error into the DS3 payload each time the F4 function key is pressed The F4 key command is hidden until the reverse video cursor is moved to this selection e The bottom main heading DS3 BIT ERROR RATE is used to insert a bit error rate When the reverse video cursor is positioned on this main menu the error rate can be set from 1 0E 9 to 1 5E 3 Pressing the down arrow will move the cursor to the ENABLE subheading Where the left and right arrow keys and the enter key can be used to enable ON or disable OFF this error generator Errors will only be counted during the test cycle ST112 SONET Transmission Test Set 4 37 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Fr
204. e receiver s STATUS section of the front panel observe that the red LED for B1 flashes once Also observe in the receiver section of the display that B1 has a one after it Note The STATUS section of the receiver refers to the error lights on the receiver side of the front panel Press ENTER twice and in the receiver s STATUS section of the front panel observe that the red LED for B1 flashes twice Also in the receiver section of the display observe that B1 has a three after it Using the LEFT RIGHT cursors select B2 and then press ENTER three times In the receiver s STATUS section of the front panel observe that the red LED for B2 flashes three times Also observe in the receiver section of the display that B2 has a three after it Using the LEFT RIGHT cursors select B3 and then press ENTER three times In the receiver s STATUS section of the front panel observe that the red LED for B3 flashes three times Also in the receiver section of the display observe that B3 has a three after it Using the LEFT RIGHT cursors select SPE Observe in the receiver s section of the display that SPE already equals three These resulted from the three B3 errors injected in Step 8 On the front panel press ENTER three times On the receiver s STATUS section of the front panel observe that the red LEDs for B1 B2 and B3 flash each time the ENTER key is pressed Also on the receiver section of the display observe th
205. e screen if the error log buffer is full ERROR LOG IS gt THAN 95 FULL TO CLEAR IT HIT KEY Y OTHERWISE HIT KEY N Select Y for yes or N for no when prompted When the error log is full no additional data can be stored Pressing CTRL R while a test is running will stop the test and disable the error log CTRL P is used to pause the test and maintain the current error log Pressing CTRL P again will restart the test in progress The words STOPPED RUNNING or PAUSED will appear under the appropriate control key indicating the test status Test cycles stopped with CTRL R may be restarted with the pause run resume sequence saving previously stored data Press CTRL P CTRL R and CTRL P in that order Stored data can be seen in the RX Error Summary or by pressing the F3 function key CTRL T returns to the setup menu Figure 4 2 The last two control keys interrupt the VFP The CTRL Z is used to refresh the VT100 display and CTRL Q exits the Virtual Front Panel program Refreshing the display or exiting the VFP will not alter any of the ST112 SONET Transmission Test Set settings If the receiver test cycle was running when the VFP session ended it will still be running the same test cycle when the VT100 Virtual Front Panel is reentered Avoid using the front panel controls and LCD menus whenever the Virtual Front Panel is in use because those changes may not be updated in the VFP display If this situation occurs quit and rest
206. e time when a negative pointer adjustment is detected Payload DS1 and DS3 Indicators The receiver front panel shown in Figure 2 7 has eleven red LED payload indicators They are arranged in three individual columns under the heading PAYLOAD DS1 DS3 The function of each are as follows e LOS indicates the loss of the DSX 1 or DSX 3 signal e LOF indicates the loss of the DS1 or DS3 payload framing e PAR indicates a parity error in the DS3 M13 or Cbit frame formatted payload e CRC indicates one or more errored bits in a DS1 frame e AIS isa DS1 or DS3 payload Alarm Indication Signal It shows the detection of an unframed 1111 sequence in a DS1 payload and a framed 1010 sequence in a DS3 payload e RAI Remote Alarm Indication shows the detection of a SF SLC 96 or ESF Yellow in a DS1 payload e IDLE shows the detection of a framed 1100 sequence in a DS3 payload e YEL DS3 shows the detection of both x bits within a DS3 frame being zero e ONES shows the detection of a 1111 sequence in a DS3 payload e SYNC shows the detection of a PRBS or fixed word test pattern loss of sync condition in the current payload DS1 DS3 VT1 5 OC 3c or OC 12c e BIT shows the detection of a test pattern bit error condition in the current payload 2 12 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview View Hist
207. e value is changed Press the ENTER key to set the new value Three menus in of Figure 3 21 show the words TRACE EDIT J1 H1 EDIT and APS EDIT They have short arrows pointed to their respective edit menus In each one use the arrow keys to move the cursor to the word EDIT and press the enter key to began the edit session e The J1 Trace Edit menu is used to add an ASCII message clear the J1 Trace Field or fill it with any hexadecimal code Use the arrow INC and DEC and ENTER keys to select change and store values Press the OVHD key to return to the LINE APS menu e The H1 SS Bits bits 5 and 6 of the H1 byte can be changed to either a binary one or zero Use the arrow INC and DEC and ENTER keys to select change and store values Press the OVHD key to return to the LINE APS menu e The LINE APS menu is used to access and change the Automatic Protection Switching bytes Position the cursor over the word EDIT Figure 3 21 LINE APS menu and press the enter key The APS menu illustrated on the lower right side of Figure 3 21 will be displayed Use the arrow INC and DEC and ENTER keys to select change and store values Press the OVHD key to return to the LINE APS menu ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays Mapping Menus Transmitter no eM wns BYRE FLORIS or DEC Figure 3 22 Mapping Menus
208. eaeeneeaeeas 60 tx_oh_all Transmit Overhead All Query Command ccceceeccseeccesessceeceseceeesecseeeecnaeeecaeeneeneens 61 tx_oh def TX Overhead Default Set Command ssesesseeseeeiesesssrsrrerressrestsrsrrrstnsssrerernssrsterreessens 61 tx_oh edit on enter esc TX Overhead Edit Command sseseeesseeseessereresessesrsrrereessesrsrsereeee 6l tx_oh edit TX Overhead Edit Query Command 00 ececcesescessecseeeeceseeeeseeeeesecaeeeesnaeeeeeaeeneeaeeas 6l tx_oh byte s h b TX Overhead Byte Set Command seseeseeeseeessseseessesersessersrssesessseseeses 62 tx_oh_ byte s Transmit Overhead Byte Query Command ssesessesreseeieserssrsrserrrsrerssrsrrerererseess 62 tx_oh_offset n h b Transmit Overhead Offset Byte Set Command ssssssesssesessesersrssesersseseesee 63 tx_oh_offset n Transmit Overhead Offset Query Command ssesesseseeseeiessersrsrsrrersrsrsrrrrereresrsreee 63 tx_sts_chan n STS n Channel Error Set Command 0 ee ceceeccssseeceseeseeeceseceeesecseveecneeeeceaeeneeaeens 63 tx_vt_v5 n Transmit V5 Byte Set Command ceeseseecseeseceseeeceseeeeesecseseecneeeecaeeeesseeateaeeneeas 64 tx_vt_v5 Transmit V5 Byte Query Command cc eeceesccsesseceseseeeeceseeeceaeceeesecaeveeenaseeeeaeeeeeaeeates 64 ALARMS TRANSMITTER cccccccee eee e eee e eee e eee e ee eeeeeeeeeeeeeeeeeeeeseeesaasasaaeaeeeeeeaeeaeaea 65 alm_burst lof 1 ais ferf sts _ais sts_yel vt_ais
209. ecaeesecneveeenaseeceaeeateneeas 67 alm_oorp Alarm OORP Query Command ccecceseeccesessseeceeeeeceeeeceaeeeessecaeeeecaeseesnaeeneeaseneeaeeas 67 7 10 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands alm sts ais on off Alarm STS n Line AIS Set Command 0 ccceeceesceeseeseeeeceeeceseeeeenseenees 67 alm_sts_ais Alarm STS n Line AIS Query Command 0 cc ececcesesceeeeceeeeeceeeereeecnerereaeeeeeaeeaees 68 alm_sts lop on off Alarm STS n LOP Set Command 0 cccccecsseesseeseeeseeeeeeseeeeceeeeeeceeenseenaes 68 alm_sts_lop Alarm STS n LOP Query Command cceceeeecseceesereeseeeceseeeeesecaeeesneeeeenaeeeeeaeeaees 68 alm _sts_yel on off Alarm STS n Path YEL Set Command cee eeeceseeceeeceeeeeeeeaeeeeeneees 68 alm_sts_yel Alarm STS n Path YEL Query Command ee ecesesceesesseeceeseseeesecaeeeeneeerceaeenees 68 alm vt ais on off Alarm VT AIS Set Command cccccccceesseeceesceeseeeeeeeceeeensecnseeseenseenseenaes 68 alm_vt_ais Alarm VT AIS Query Command cceessesscssescesseeserceeeeeceaeceeseeeaeeeesnesereaeeneeaeeates 69 alm _vt_lop on off Alarm VT LOP Set Command 00 ccccceccccseceeessceeeceeeeeeceeeenaecnaeeneeeeeeaeeenes 69 alm_vt_lop Alarm VT LOP Query Command cceccesssessseseceeeereeeeeecaecaeesecateeeceeverenaeeeeeaeeaees 69 alm_vt_yel on off Alarm VT YEL Set Command 000
210. echnology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test Note This procedure should be performed each time the fiber assemblies are to be used to prevent scratching the fiber and ultimately destroying optical connectors 1 Remove the protective optical cover from the connector to be cleaned 2 Take a swab from the package and dip it into the clean Alcohol solution 3 Gently insert the swab into the barrel ferrule opening of the fiber optic connector until it stops 4 Gently spin the swab clockwise and the counter clockwise 5 Remove the swab 6 Using the clean air spray spray the air into the barrel opening for at least three seconds Note Hold the can in an upright position DO NOT tilt invert or shake the can during use If a mist appears from the can the cleaning process must be performed again 7 Do not reuse the swab Dispose of it immediately Cleaning Procedure for Unconnected Fiber Cables Note This procedure should be performed each time the fiber cables are to be used to prevent scraching the fiber and ultimately destroying the cables l Gree P Hold the fiber optic connector to be cleaned in your hand Try not to put unnecessary strain on the fiber Take a clean Kimwipe from the box and dab it into the clean Alcohol Wipe the Alcohol soaked Kimwipe over the ends of the fiber optic cable gently Using the clean air spray spray the air
211. ecifies the DS 3 Path alarm condition to be generated when the ds3_pth_tri command is executed Frame m13 When the frame is set to M 13 the parity sef and xbit alarms are valid cbit When the frame is set to C Bit all four alarms are valid Alarms parity Enables P Bit or C Bit parity errors sef Enables 4 out of 16 F bit errors on each DS1 frame xbit Sets the two X bits in each M Frame to their Alarm Condition 00 febe Enable a Far End Block Error C Bit format only Example ds3_alarms xbit Response NONE Note See the ds3_pth_tri command ds3_pth_ty DS3 Path Alarm Burst Query Command Returns a character string indication the current state of the DS1 Alarms AIS and YEL Example ds3_pth_ty Response ds3_pth_ty CBIT FEBE Note see the DS3 Path Alarm Burst Set Command ST112 SONET Transmission Test Set 7 71 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands Loss Of Signal los_enab Loss Of Signal Enable Command Enables the LOS event for the amount of time specified by los_time Example los_enab Response NONE los time n Loss Of Signal Time Command Set Loss of Signal event to a specific amount of time from 1 to 127 microseconds Example los_time 50 Response NONE Note In the example the LOS will last for 50 microseconds los_time Loss Of Signal Time Query Command Returns the LOS time duration in microseconds Example los_time
212. econds ES Severely Errored Seconds SES Bit Error Rate BER and the total number of Line FEBE ERRORS can be read NOTE The Bit Error Rate BER is displayed as a negative exponent An error rate of 1 0E 6 would equate to the decimal number derived from receiving one errored bit in one million In other words one divided by one million would equal 0 000001 or 1 0E 6 decimal Transmitter VFP Menus and Displays Transmitter Current Configuration l Terminal ST112 TRM op x File Edit Settings Phone Transfers Help TX SETUP Ee ee SECTION LINE Iq Output Optics l CURRENT CONFIGURATION l T112 Iw Timing TRANSMITTER RECEIVER l LOS AIS Ir Mapping OUTPUT STSX1 INPUT OPTICI LOF LOP lo SPE Pointer IOPTICS 0C12 l Ip UT Pointer l STS CHANNEL 5 Is Sonet Alarms IMAP IN UT BYT FLT MAP UT BYTE FLT l l l l OOF RDI l l Ig Sonet Error IDS1 PAT QRW DS1 PAT ORW l l l l l l B1 B2 11 TOH POH IDS1 FRM UNFRM Iz J1 Trace Messge IDSX1 PAT QRW It UT1 5 Channel IDSX1 FRM UNFRM ly UT1 5 DSX1 Cfg ISONET ALM OFF I l l l l l l AIS AIS I RDI RDI I FEBE FEBE B3 BIP 2 I l l l l l l l I l l l l l l I PATH UT PATH l l l l l l Ik UT Err Alarms l RX AUTOSEEK LINK OFF LOP lu D 3 DSX3 Cfg e A a aa aan PAYLOAD DS1 DS3 Ih DS3 Err Alarms ere sesso RX ERROR SUMMARY I LOS
213. ector VT100 Initialization Combined Dual Mode File Edit Settings Phone Transfers Help ST2400 gt xxx TEKTRONIX MUL ST2400 0 1 70 1996 03 12 ST2400 gt Link Rejected ST2400 must be configured for SONET ST2400 gt xxx TEKTRONIX MUL ST2400 0 1 70 1996 03 12 T2400 gt S T112 ST2400 Link Enabled T112 2400 gt fj Figure 5 13 VT100 Initialization Combined Dual Mode After connecting the attenuator apply the power and the ST2400 2 4Gb s SDH SONET Test Set prompt shown in Figure 5 13 should be seen on the Terminal display Then the remote commands combined_mode combined_mode on and combined_mode off can be used to respectively query enable and disable the Combined Mode The figure also shows that the The word Terminal can be a VT100 terminal PC Personal Computer running a VT100 emulator or other compatible VT 100 terminal types 5 12 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use ST2400 2 4Gb s SDH SONET Test Set prompt changes to ST 2 ST2400 gt when the link is enabled After which the VT100 command can be used to activate the VFP Virtual Front Panel The ST112 ST2400 Link may be rejected also shown in Figure 5 13 or an existing link may be broken Error messages on the terminal or LCD display should assist the diagnosis Figure 5 14 ST112 SONET Transmission Test Set Dual Mode Connect
214. ed as the DSX 1 Payload Pattern Argument daly1 55 octet pattern daly2 55 octet pattern modified version of daly1 daly3 55 octet pattern modified version of daly1 word_18 1 in 8 pattern containing a string of 7 zeros word_28 2 in 8 pattern word_324 3 in 24 pattern ones all ones pattern zeros all zeros pattern off returns to the pattern set by the rx_vt_patt command Example tx_stress word_324 Response NONE Note The Stress Test only functions in the DSX 1 mode to run use quick_setup 4 See tx_stress Transmitter Stress Test Set Command tx_stress Transmitter Stress Test Query Command Returns a character string indicating the selected transmitter Stress Test Pattern Example tx_stress Response TX_STRESS WORD_324 Note The Stress Test only functions in the DSX 1 mode See rx_stress Receiver Stress Test Set Command tx_vt_chan n Transmitter VT Channel Select Command Selects the VT1 5 Channel Number that will contain the user specified DS 1 Payload Example tx_vt_chan n n a decimal number from 1 to 28 Response NONE Note The VT1 5 channel is selected from the currently selected STS 1 channel See tx_sts_chan Transmitter STS Channel Select Command tx_vt_chan Transmitter VT Channel Query Command Returns a character string indicating the current transmitter VT1 5 Channel selected Example tx_vt_chan Response TX_VT_CHAN N N a decimal number from 1 to 28 Note See rx_vt_chan Receive VT Ch
215. eeaeenaeentes 13 opc Operation Complete Command oicis c iscceecscescescsscacsacccsadeccscueseecscencatesceaseustdesdecstcedevsaceadesseeende 13 opc Operation Complete Query Command c ceccceeceseceseessecseeeseeeseeeeeseeenseeeseceaeeeaeenaeeseeeaeeeaes 14 rst R s t Command sessment ee e aa eNe E e iee E e Rae eiie 14 sre n Service Request Enable Command ccccccceesseesceesceeecesecesecesecaecneecaeecaeecseeeseseeeseeeeeeeeas 14 sre Service Request Enable Query Command c cccecccesccsseceseceseceeeceecaeeeeeeneeeeeeeeeeneeeneeeteenaees 14 stb Status Byte Query Command ccceccceescesscesseeeseeeeeseceaecaecsaecsaecaeeeaeseeeseeeeseseaeeeeeseneeeeseeeees 14 tse Test Status Enable Register Set Command cccccccessesseesseeseeeeeeeeeeeceeensecnseenseenaeeeeneenaeenaes 14 tse Test Status Enable Register Query Commmand ccesccesesseeseeeseeeeeeeeceeeeeeceaeesseesaeesaeeaeenaes 15 tsr Test Status Register Command cssecsccissivacsccs coscecsscsseiieideccsciosbecs cevcancscvasaceseea decal acatvins caatsiatensse 15 GENERAL SETUP COMMANDS eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeaeeeeeeeeeeeees 15 quick setup n Quick Setup Command ee ceeccescesecssecseeseeeneeeseeseeeseeseeseeeeeeeseeeseseseeeaeenseenaeenaes 15 audio_vol n Audio Volume Set Command cccccccssccssscesssecsseceescecsseceeseeceeeseseecsseeeeseecnsesseseeens 15 audio_vol Audio Volume Query Command 0
216. eeas 47 7 8 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands s3c_bit_err STS 3c Bit Error Count Query Command cccceecceseeeecseecseeeseeeseeeeeeeeeeeesenteeeeees 47 s3c_bit_rate STS 3c Bit Error Rate Query Command ceeeeccseeecnseeeceeeceeeecseeeeeeeveesnaeeeeeaeeaees 47 s12c_bit_err STS 12c Bit Error Count Query Command ccceceesecseesseeeeeeeeeeeeeeeeeesenteenteensees 47 sl12c_bit_rate STS 12c Bit Error Rate Query Command ceeceeseeceteeeeeeeeeeeecseeeecneeeeceaeeneeaeeas 47 sts _febe_err FEBE Total Error Count Command cccccesccesecesecesecseeeseeeseeeeeeeeeeeeseeneenseenaeenaes 47 sts_fram_err STS n Frame Error Query Command ccesecssscesceseceeeeeceseeeceaeceeeeceeercneveeeeaeeateaes 47 vt_bip2_ err VT BIP 2 Error Query Command ccccecccesccesecssecseeeseeeeceneenseensecnaecnaeceeeaeeeaeenes 48 vt_bip2_rate VT BIP 2 Error Rate Query Command ceceeeecseeeseeeeceeeeseeeessecaeeeceeseeesaeeeeeaeeaees 48 RECEIVER LED STATUS COMMAND 2 ccccccceeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeees 48 ds_ais PDS LATS Qtiery Command 2 ccciscstevenssiecossesesevensendensessegeovasvivesniossnovesn te vobistessuanscesoeohs 48 ds_crc DSI CRC Query Command ccceccceeccsecceseeeeceeecesecaecsaecsecaecaaecaaecaeeeaesesecaeseseseneseeeeereeas 48 ds_lof DS1 LOF Query Command cc
217. el 3 OC3 is functioning properly The quick set up places the unit into a default mode which selects specific settings for the unit These default settings are preprogrammed and therefore consistent from unit to unit For all optical sections an in line 5db optical attenuator is required between the transmitter and receiver optical connectors Before any connections are made use the optical cleaning kit to clean the cable ends the attenuator ends and the optical connectors on the front panel of the unit The last section of the procedure provides an equipment list and simple instructions on how to clean the optical connectors Leave everything set up as it was in the last section There are twenty steps in this section of the procedure 1 On the front panel press SETUP until the display shows the SONET Quickset menu 2 Using the INC DEC keys select OC3 Using the LEFT RIGHT cursors select DS3 and then press ENTER Note that the red LED for LASER ON remains lit 3 Press RUN STOP twice to clear all errors 4 The transmitter and the receiver should now be linked error free 5 On the transmitter side of the front panel press ALARM until the display shows the Errored Frame menu 6 Using the LEFT RIGHT cursors select CONT and then press ENTER 7 On the receiver s STATUS section of the front panel observe that the following error lights appear A Under the SECTION heading the red LEDs for LOF OOF and B1 remain lit B Und
218. enu area and select it e The INPUT SELECTION menu area has three electrical cross connect modes STSX 1 DSX 3 and DSX 1 The OPTIC selection will activate the laser output OC 1 OC 2 OC 3 OC 12 that is configured in the Optics Setup Menu w described later in this chapter e The RX AUTOMATIC INPUT MODE is used to configure the receive to either the incoming payload AUTOSEEK or to the transmitter s payload configuration AUTOLINK AUTOSEEK obtains payload Mapping Pattern and Framing from the incoming signal AUTOLINK obtains that same information from the Test Set transmitter configuration When either AUTOLINK or AUTOSEEK is on the VT100 menus for Mapping Pattern and Framing are inaccessible e The BIPOLAR TERMINATION menu area is used to configure the receiver s electrical inputs for either TERM termination or MONITOR mode The TERM input terminates the electrical cross connect input signal The MONITOR input configures the appropriate Test Set electrical input to accept a low level input from a network element s monitor output e DCC ACCESS is used to transfer data to and from a device connected to the ST112 Test Set s rear panel DCC connector and to and from network elements The data can be transferred in either the SECTION or LINE DCC channel e ORDERWIRE is used to communicate with a handset connected to the Test Set s rear panel ORDERWIRE connector from and to network elements LOCAL refers to the connection
219. er 2 Terminal ST112 TRM File Edit Settings Phone Transfers Help RX SETUP Iq Input 1 RX UT POINTER Iw Optics UT POINTER Ir Mapping NEW POINTER NDF o It UT1 5 Channel Ily UT1 5 DSX1 Cfg Iu DS3 DSxXS cfg lo SPE Pointer Ip UT Pointer POINTER JUSTIFICATIONS PJ o PJ Figure 4 19 VT Pointer Display Receiver The RX VT POINTER p display shown in Figure 4 19 is used to view the pointer processing that accommodates differences caused by adjusting the starting position of the VT payload The VT pointer display is only accessible in the VT mode There are 28 VT pointers within the SPE Synchronous Payload Envelope The VT pointer value 78 indicates the position of the V5 byte and its location in the active channel one of the 28 Virtual Tributaries Channels are selected in the Receiver VT1 5 Channel Setup Menu t The NDF New Data Flag indicates the total number of arbitrary changes in the VT pointer value recorded during the test cycle The POINTER JUSTIFICATION values for PJ and PJ are zero in this example They show the total count of the positive and negative justifications recorded during the test cycle TOH POH Overhead Analysis Display Receiver File Edit Settings Phone Transfers Help RX SETUP P esacssaasesasseesseseesasesss 555 Iq Input I TOH POH l Iw Optics 1 l Ir Mapping I I Al FG A2 28 C1 01 l It UT1 5 Channel B1 50 E1 7F F1 00 B3
220. er the LINE heading the red LEDs for AIS LOP B2 and RDI remain lit The red LEDs for AIS LOP and RDI may flash C Under the PATH heading the red LEDs for RDI FEBE and B3 remain lit The red LED for RDI may flash D Under the PAYLOAD DS1 DS3 heading the red LEDs for LOF PAR SYNC and BIT remain lit E Under the SPE section of the POINTER heading the yellow LED for NDF remains lit and the green LEDs for PJ and PJ remain lit 8 Using the LEFT RIGHT cursors select OFF and then press ENTER 9 Press RUN STOP twice to clear all errors 10 On the transmitter side of the front panel press MAPPING 11 Using the INC DEC keys select INT STS3c and then press ENTER 12 On the receiver side of the front panel press MAPPING 13 Using the INC DEC keys select STS3c and then press ENTER 14 Press RUN STOP twice to clear all errors 15 On the transmitter side of the front panel press ERROR until the display shows the Tx OC3 Single Error menu ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test 16 Using the LEFT RIGHT cursors select 1 and then press ENTER three times 17 In the receiver s STATUS section of the front panel observe that the red LEDs for B1 B2 B3 and BIT flashed once 18 On the receiver side of the front panel press ERROR until the top line of the display shows B1 B2 B3
221. erminal ST112 TRM File Edit Settings Phone Transfers Help RX SETUP eat atl eat atatlatettatetatal Iq Input I ST112 ST2466 RX Dual Mode Cfg Iw Optics I Ir Mapping IEST2460 Drop Select Ee 622Mb s It UT1 5 Channel Section Line LED Display I I I I ly UT1 5 DSX1 Cfg I lu DS3 DSX3 Cfg l l ST2400 T112 Drop I I I I lo SPE Pointer Ip UT Pointer Is TOH POH Ig J1 Trace Messge Ih APS Bytes B1 B2 Error Data Display ST2400 T112 Figure 5 18 Quick Setup menu Combined Dual Mode ST112 SONET Transmission Test Set 5 15 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use The RX SETUP main menu now has a Dual Mode Configuration Combined Dual Mode submenu It is used to select the ST2400 2 4Gb s SDH SONET Test Set Tributary that will be dropped out to the Test Set either 155Mb s OC 3 or 622Mb s OC 12 The Section and Line LED Display and the B1 B2 Error Data Display can be viewed either on the ST2400 2 4Gb s SDH SONET Test Set at the OC 48 Rate or on the ST112 SONET Transmission Test Set at the drop rate l Terminal ST112 TRM File Edit Settings Phone Transfers Help H ST2400 TX SETUP Iq Input Config 11 CURRENT CONFIGURATION l Ir Error Generation TRANSHITTER RECEIVER l Iw Alarms JOUTPUT STSX1 INPUT OPTICI It TOH bytes I1 2 4Gb s Laser Ig Event Trigge
222. ern Codes U Unframed FX 24 Bit Fixed Word D D4 SF 1o 2E15 PRBS E ESF 23 2E23 PRBS S SLC96 QW Quasi Random Word i Unknown Signal a Unknown probably Live Traffic AIS DS1 Alarm Indication Signal ST112 SONET Transmission Test Set 4 19 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel Trouble Scan Analysis Display Receiver File Edit Settings Phone Transfers Help RX SETUP Piss cesses sss Srses ssessrs s5 SS Iq Input lI TROUBLE SCAN UT1 5 Mapping l Iw Optics I1 CHANNEL S TS3 STS1 Numbering I Ir Mapping 11 1 1 NONE 3 1 l It UT1 5 Channel lI 2 NONE 2 l ly UT1 5 DSX1 Cfg I1 3xSCANNING J 3 I lu DS3 DSX3 Cfg Ui 2 1 lt gt 4 1 l lo SPE Pointer II 2 2 28s l Ip UT Pointer il 3 ss 3 See I Is TOH POH II l Ig J1 Trace Messge I UIEW LOG l Ih APS Bytes 11 CHANNEL DWELL TIME 10 l Ij UT Channel Scan I TROUBLE SCAN MODE oF N l In Trouble Scan ln aaa a cna Figure 4 24 Trouble Scan Trouble Scan shown in Figure 4 24 can be used to examined STS channels for errors and alarms In this example the first two STS1 channels have been scanned and the third is being scanned Trouble Scan is detailed in the Applications Chapter of this manual Receiver Error Summary Analysis Display l Terminal ST112 TRM olx File Edit Settings Phone Transfers Help aS SSSS ss SSS SST RX ERROR SUMMARY
223. es the condition off disables the condition Example alm_ _ais on Response NONE Note Use the alm_enab command to executed the enabled alarm condition 7 66 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands alm_ _ais Alarm Line AIS Query Command Returns the FERF Far End Receive Failure alarm condition as on enabled or off disabled Example alm_ _ais Response ALM_L_AIS ON Note See the Alarm Line AIS Set Command alm_lof on off Alarm LOF Set Command Enables or disables the LOF Loss Of Frame alarm condition to be generated Arguments on enables the condition off disables the condition Example alm_lof on Response NONE Note Use the alm_enab command to executed the enabled alarm condition alm_lof Alarm LOF Query Command Returns the LOF Loss Of Frame alarm condition as on enabled or off disabled Example alm_lof Response ALM_LOF ON Note See the Alarm LOF Set Command alm_oorp on off Alarm OORP Set Command Enables or disables the OORP Out Of Range Pointer alarm condition to be generated Arguments on enables the condition off disables the condition Example alm_oorp on Response NONE Note Use the alm_enab command to executed the enabled alarm condition alm_oorp Alarm OORP Query Command Returns the OORP Out Of Range Pointer alarm condition as on enabled or off disabled
224. ey will access the QUICK DSX SETUP menu used to configure the asynchronous cross connect signals Selecting either DSX 1 or DSX 3 from this menu will enable its respective electrical output and disable the optical output When DSX 1 is selected the receiver DSX 1 LED will illuminate DSX 3 will illuminate the receiver DSX 3 LED and the transmitter DSX 3 LED Another push of the setup key will access the DSX 1 LINE CODE menu It is used to select a line code for the DSX 1 signals Either AMI Alternate Mark Inversion or B8ZS Bipolar 8 Zero Substitution as the case may be can be used to test T1 compatible networks and network elements Another push of the setup key will access the OC 12 CHANNEL NUMBERING menu STANDARD uses the STS 3 STS 1 channel numbering scheme starting with 1 1 1 2 1 3 2 1 2 2 2 3 3 1 and detailed in the Bellcore GR 253 CORE Standard The C1 ID numbers the channels in sequence from 1 to n according to their appearance on the high speed line Standard indicates which tributary STS n the channel came from and C1 ID does not The STORE RECALL SETUP menu is next It is used to access either the USER stored setup or the FACTORY DEFAULT setup Pressing the enter key will access the submenu from which one of the ten LOC locations can be RCLL recalled or STOR stored Up to ten individual user setups can be saved in memory locations 0 through 9 A unique 10 character label can be stored with each saved setup
225. ey will clear all the continuous alarms Using the left and right arrow will move through the list of continuous alarms and pressing the enter key will select the alarm under the cursor Use the down arrow key to move the cursor to the CONT ALARMS heading and the right arrow and enter keys to move the cursor to the ON position and activate the selected continuous alarms More than one continuous alarm can be activated during the test cycle The CONTINUOUS ALARMS include EF Errored Frame AIS Alarm Indication Signal and RDI Remote Defect Indication for the Line Path and Virtual Tributary LOP Loss Of Pointer for the Path and Virtual Tributary and OORP Out Of Range Pointer for the Synchronous Payload Envelope ST112 SONET Transmission Test Set 4 27 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel SONET ALARMS CONTINUOUS ALARMS EF L AIS L RDI P AIS P RDI P LOP OORP UT AIS UT RDI UT LOP CONT ALARMS ON BURST ALARH EF L RDI L AIS P AIS P RDI OORP UT AIS IENUMBER OF BURST FRAMES LOSS OF SIGNAL 100 uSec Figure 4 33 SONET Alarms Burst Example Transmitter The next section of the SONET ALARMS menu Figure 4 33 is used to generate a BURST ALARM condition for some but not all of the same alarm conditions The up and down arrow keys are used to move between the two headings BURST ALARM and NUMBER OF BURST FRAMES When the cursor is positio
226. f FEBE should equal zero The values of B1 B2 and B3 should all equal three 12 Press RUN STOP twice to clear all errors 13 On the transmitter side of the front panel press POINTER 14 Using the LEFT RIGHT cursors select NDF and then press ENTER 15 On the receiver s STATUS section of the front panel under the SPE section of the POINTER heading observe that the yellow LED for NDF flashes once 16 Using the LEFT RIGHT cursors select PJ and then press ENTER 17 On the receiver s STATUS section of the front panel under the SPE section of the POINTER heading observe that the green LED for PJ flashes once Also on the display observe that the value of SPE is now 523 18 Using the LEFT RIGHT cursors select PJ and then press ENTER 19 On the receiver s STATUS section of the front panel under the SPE section of the POINTER heading observe that the green LED for PJ flashes once Also on the display observe that the value of SPE is 522 once again 20 On the receiver side of the front panel press POINTER 21 On the display observe that SPE has a value of 522 and that PJ PJ and NDF all have values equal to one 22 Press RUN STOP twice to clear all errors OC3 Quick Set Up ST112 SONET Transmission Test Set B 13 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test This section of the procedure verifies that the Optical Carrier Lev
227. f the coax cables with a 50 ohms to ground terminator 4 Connect the other coax cable to the open end of the T connector attached to the frequency counter 5 On the front panel press SETUP until the display shows the Quick DSX Set Up menu 6 Using the LEFT RIGHT cursors select DSX1 and then press ENTER 7 On the transmitter side of the front panel under the DS3 VT1 5 STS3c 12c heading press ERR ALM until the display shows the DS1 Alarms menu 8 Using the LEFT RIGHT cursors select AIS and then press ENTER Note This sets the pattern to unframed ALL 1 s 9 The DS1 frequency is 1 544 Mhz The frequency being measured is the full rate data signal which is equal to half the rate of the system clock The frequency shown on the counter should be 772 Khz 7 72 Hz which is equal to the half rate clock DS1 Signal Mask Verification ST112 SONET Transmission Test Set C 3 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Calibration Verification Test The frequency for the DS1 signal has been verified so the signal mask must now be checked For this section of the procedure a CSA803A scope will be needed as well as the special cable Disconnect the coax cable and remove the bnc T adaptor from the frequency counter There are fourteen steps in this section of the procedure 1 Disconnect the 50 ohms to ground terminator from the end of the coax cable Connect one of
228. fied nnn FRAMES ten in the Figure 3 26 example Position the cursor using the left and right arrow keys Use the INC and DEC keys to change the value from to 255 frames Pressing the enter key while the test is running generates the alarm condition Only a single burst can be generated at a time Error Generation Menus ERROR Figure 3 27 Error Generation Menus Pressing the transmitter ERROR key will scroll through the menus shown in Figure 3 27 when the OC 12 rate and the VT1 5 Payload is selected Each configuration made from the Quick Setup Menu will provide a similar set of Error Menus The arrow keys are used to move the cursor when selecting menu items The INC and DEC keys are used to change values The ENTER key is used to execute the function Enabling any error will disable all other active errors The error rate ranges from 1 0E 3 to 1 0E 9 The ERROR RATE OUT OF RANGE message will be displayed whenever an error rate greater or smaller than the range is inserted Data Communications Channel Orderwire DCC OW Figure 3 28 DCC Order Wire Configuration Menus Transmitter Data or voice can be transmitted from a device connected to the rear panel DCC OW connector on the Section or Line DCC or Order Wire channels Pressing the transmitter DCC OW key one or more times will access the configuration menus shown in Figure 3 28 The DCC Data Communications Channel can be configured for OFF SECTION or LINE Generally e DCC
229. framed Tx DS3 Framing Format Set Cmd Sets the transmitter to generate the DS3 Framing Format Argument m13 M1 3 28 DS1 channels multiplexed into a DS3 signal cbit C Bit Parity Analysis of the DS3 signal unframed Used to analyze the unframed DS3 payloads Example tx_ds3_frm cbit Response NONE tx_ds3_frm Tx DS3 Framing Format Query Command Returns a character string indicating the current transmitter DS3 Framing Format Example tx_ds3_frm Response TX_DS3_FRM CBIT Note M1 3 m13 C Bit or Unframed DS3 Frames can be analyzed tx_ds3_pat prbs_15 prbs_23 word Tx DS3 Pattern Set Command Sets the transmitter to the selected DS3 Test Pattern Argument prbs_15 Inverted PRBS Pattern 215 1 prbs_23 Inverted PRBS Pattern 228 1 word an eight bit sequence set with the ds3_word command Example tx_ds3_pat word Response NONE tx_ds3_pat Transmitter DS3 Pattern Query Command Returns a character string indicating the current transmitter DS3 Test Pattern Example tx_ds3_pat Response TX_DS3_PAT WORD Note PRBS 15 PRBS 23 and WORD are the three test patterns that can be transmitted ST112 SONET Transmission Test Set 7 33 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tx_stress daly1 daly2 daly3 word_18 word_28 word_324 ones zeros off Transmitter Stress Test Set Command Sets the Stress Test Pattern to be transmitt
230. gs Phone Transfers Help TX SETUP pese Se seede ee ee ennnen Iq Output Optics 11 TS12C CONFIGURATION l Iw Timing lIl l Ir Mapping STS12C PATTERN l lo SPE Pointer lI 2E23 INU l Ip UT Pointer IRBSINGLE ERROR INJECT l Is Sonet Alarms lI l Ig Sonet Error lI l 11 TOH POH 11 l Iz J1 Trace Messge I l It UT1 5 Channel i l ly UT1 5 DSX1 Cfg Ill I Ik UT Err Alarms 11 l lu DS3 DSX3 Cfg A a Figure 4 46 STS 12c Configuration Menu Transmitter The STS 12c STS12C CONFIGURATION i menu shown in Figure 4 46 is output dependent It is only accessible when the OC 12 rate is selected with 12c payload mapping Press CTRL T and the q key to access the quick setup menu Use this menu to configure the STS 12c payload PATTERN that will be transmitted and to inject a single bit error in that pattern Under the STS 12c STS12C PATTERN heading select either the 2E23 Pseudo Random Bit Sequence or the 2E23 INV Inverted Use the arrow keys and enter key to change selections Pressing the F4 function key will inject a single error when the SINGLE ERROR INJECT heading is selected as shown in this example 4 40 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use This section provides common examples of telecommunication network applications It details how the ST112 SONET Transmission Test Set can be use
231. hardware has detected one or more lost or corrupted characters Input Buffer Overflow More than 80 characters are received without a line terminator Command Mnemonic Not Found Unknown command mnemonic received Invalid Command For Interface Command mnemonic found but it is not valid for the RS 232 C interface Invalid Command Type Command mnemonic found but it has a missing or added 2 at the end Too Many Parameters Too many parameters were received or unknown pTeleyfoess seaoeuc tnd vannag re commana gt Parameter Out of Range Parameter value is not in the range specified for the command Parameter Not In Set Parameter value is not in the set of allowed values for the command Invalid String Length Parameter character string is too long for the command Parameter Separator An expected semicolon between two parameters is missing or a command line is terminated immediately after a semicolon Invalid Non decimal Parameter Parameter is not in a valid non decimal format or the value aaraa Paar arrek eta ne ng 0 28 tema ST112 SONET Transmission Test Set 6 5 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers and Printers Storing and Printing Data Most Terminal Emulation packages have the ability to capture data to a file or direct it to a printer These functions are usually listed as File Capture and P
232. he UNFRM Unframed and 2E23 Pseudo Random Bit Sequence are accessible SPE Pointer Analysis Display Receiver 2 Terminal ST112 TRM File Edit Settings Phone Transfers Help RX SETUP catnietabatataiataiatabababetabatatatatabatatasamatamatasaate Iq Input RX SPE POINTER Iw Optics SPE POINTER 522 NEW POINTER NDF e Ir Mapping It UT1 5 Channel ly UT1 5 DSX1 Cfg Iu DS3 DSX3 Cfg lo SPE Pointer Ip UT Pointer PJ e PJ e I I I I POINTER JUSTIFICATIONS I I I Figure 4 18 SPE Pointer Analysis Display Receiver The RX SPE POINTER o display shown in Figure 4 18 is used to view the pointer values that accommodate differences caused by adjusting the starting position of the payload The SPE POINTER displays the current pointer value The number 522 in this example represents the value extracted from the H1 and H2 bytes It is the offset between the H3 byte and first byte J1 of the STS SPE The NDF New Data Flag indicates the total number of arbitrary changes in the pointer value recorded during the test cycle The POINTER JUSTIFICATION values for PJ and PJ are zero in this example They show the total count of the positive and negative justifications recorded during the test cycle 4 16 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel VT Pointer Analysis Display Receiv
233. he task of determining the true performance of DS1 circuits used for the transport of digital services The span line repeater continues as a major component of the North American T Carrier networks For this reason the majority of tests that have evolved were designed to ensure the performance of span line and office repeaters under live traffic conditions Since most network equipment contains regeneration and timing recovery functions similar to those of a repeater the tests originally developed for repeater span line testing have proven suitable for testing all network equipment STANDARD is a switch that is used to activate the previously selected test pattern from the PATTERN submenu As shown in Figure 4 40 the QRW pattern would become active when the word STANDARD is selected from the DSX 1 STRESS PATTERN submenu The other choices are the following Stress Test patterns that can be generated e The Daly patterns DALY 1 DALY 2 and DALY 3 is a version of the 55 octet pattern developed by Tom Daly that has been modified to meet pulse density standards when framed on octet boundaries The Daly pattern has been found useful for stressing the timing recovery circuits of line cards and the preamplifier equalizer circuits of repeaters utilizing discrete component ALBOs Automatic Line Build Outs A Daly pattern stresses a circuit by introducing rapid transitions from long sequences of low density octets to high density octets high density
234. his setup is used for non intrusive network monitoring applications It is perfect for LEC IXC local exchange carrier inter exchange carrier cross boundary or other long term passive performance monitoring It does not allow line error injection testing This installation splits the optical signal through a passive coupler which can be mounted in an optical or electrical cross connect bay or other convenient location Since there is no active regeneration of the line signal the system under test must have adequate margin to accommodate the coupler insertion loss Therefore measurements should be made close to the transmitter The Test Set accommodates the electrical monitor output capabilities of common network elements for STSX 1 DSX 3 and DSX 1 signals Measurements are made with the Test Set as required ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use Active Analysis Tektronix ST112 SONET Transmission Test Set w e om maor ol t Wwe lo ma n se m Figure 5 2 Active Analysis The Active Analysis application inserts the Network Element into the active signal path Figure 5 2 provided by the ST112 SONET Transmission Test Set This configuration is suitable for test or operation where live traffic is not
235. hms to ground terminators Fiber Optical Cable must be a single mode cable and have connectors matching those on the unit under test required if unit has optical options an in line 5db optical attenuator required if unit has optical options m m bnc 75 ohms coaxial cable f m bnc 75 ohms thru terminator male bnc 75 ohms to ground terminator f f m bnc T adaptor DS1 WECO 310 compatible patch cord f m bnc AC coupler adaptor suggested Tektronix Blocking Capacitor PN 015 1013 00 optical electrical converter suggested Tektronix P6703A Optical cleaning kit required if unit has optical options see last section of the procedure for contents special cable DS1 WECO 310 compatible patch cord connector on one end separated into two coaxial cables with male bnc connectors on the other end one of the cables is connected to the Tip and the other is connected to the Ring Note These instruments must have the current N LS T traceable calibrations C2 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Calibration Verification Test General Calibration Verification This section of the User Manual tests the calibration of the unit The procedure consists of seven sections in which the calibration of the unit is verified Note The procedure assumes you are proceeding in sequential order Before beginning the procedure you must Ram
236. iate front panel transmitter outputs Any one of the electrical outputs for DSX 1 and DSX 3 will work Be sure to read and observe all of the appropriate safety rules in chapters 1 2 3 and 4 The Test Set can display its Virtual Front Panel VFP on a VT100 terminal that has a 24 line 80 column display or on a personal computer PC running VT100 emulation software Standalone communication applications such as Procomm Crosstalk or the Terminal software bundled with Windows will run the Test Set VFP Some applications may not have a VT 100 selection Crosstalk 2 0 for Windows offers a VT 102 terminal selection that is VT100 compatible The communication software documentation should identify their VT100 compatible emulators All references to the word terminal in this manual mean any VT100 compatible terminal or PC running VT100 emulation software Figure 4 1 ST112 SONET Transmission Test Set Terminal Connection Use an RS 232 C modem cable to connect the serial port of the terminal and the Test Set as shown in Figure 4 1 The cable must have a 25 pin D type plug for the Test Set and the appropriate mating connector for the terminal or selected PC port Chapter 6 External Controllers and Printers provides ST112 SONET Transmission Test Set port pinouts this chapter and Chapter 3 LCD Menus and Displays details the port settings RS 232 C Port Settings Use the Quick Set up menus detailed in Chapter 3 LCD Menus and Displays
237. iate set command The contents of the SESR register can be cleared using the Clear Status CLS command The SESR is automatically cleared reset after being queried For more information on Test Set remote commands see Chapter 7 The correspondence between ST112 SONET Transmission Test Set status registers enable registers and commands is summarized in Table 6 5 Table 6 5 Status Registers Enable Registers and Related Commands Status Register Status Register Query Enable Register Enable Register Commands Commands Set Standard Event ESR Event Status Enable ESE ESE Status Register Register ESER SESR Status Byte STB Service Request SRE SRE Register SBR Enable Register SRER e The CLS command to clear reset the SESR and return the instrument to the Operation Complete Command Idle State and the Operation Complete Query Idle State In this state the instrument has no data in its input or output buffers and is not executing a command e The ESR query command also clears resets to zero the SESR status register Standard Event Status Register The Standard Event Status Register SESR is a status register that indicates errors in command syntax and related occurrences The name of each bit in the SESR is shown in Table 6 6 The function of each bit in the SESR is defined in Table 6 7 Table 6 6 Standard Event Status Register SESR 7 6 5 4 3 2 1 0 PON URQ CME EXE DDE QYE RQC OPC ST112 SONET Transmis
238. id obtaining information about the incoming signal or the Test Set Transmitter configuration Autoseek would detect the configuration including channel numbering from the incoming signal and Autolink would obtain the Test Set Transmitter configuration except channel numbering Both would interfere with the Provisioning Verification There are two types of VT1 5 channel numbering The top of Figure 5 8 shows the VT1 5 Channel Scan display with 1x28 sequential channel numbering and the bottom shows 4x7 matrix numbering The 1x28 display counts VT channels from top to bottom and the 4x7 display counts them from left to right l Terminal ST112 TRM File Edit Settings Phone Transfers Help RX SETUP Psa SSS Ssess see ssSseeSSseseSessee 1x28 Iq Input lI UT 1 5 CHANNEL SCAN l lw Optics I STS CHANNEL 1 Channel Ir Mapping I Valid STS Channels 1 12 Numbering It UT1 5 Channel III UT UT UT UT l ly UT1 5 DSX1 Cfg II 1 8 15 22 l lu D 3 D X3 Cfg 11 2 9 16 23 l lo SPE Pointer II 3 10 17 24 l Ip UT Pointer II 4 11 18 25 l Is TOH POH II 5 12 19 26 l Ig J1 Trace Messge I I 6 13 20 27 l Ih APS Bytes II 7 14 21 28 l Ij UT Channel Scan IBENABLE SCAN gg ON l In Trouble Scan hl Sere te eae See ae ee l Terminal ST112 TRM File Edit Settings Phone Transfers Help RX SETUP P PSSSs Se see Sass SSS SSS Ses Siete ee eee 4x7 Iq Input ll UT 1 5 CHANNEL SCAN l Iu Optics ST
239. imilar to that described in Chapter 4 of this manual It too is divided into six areas On the upper left there is a list of submenus under the heading TX Setup The list begins with q Output Optics w Timing r Mapping and the list ends with m Current Configuration and v ST2400 2 4Gb s SDH SONET Test Set TX Setup Chapter 4 in this manual and Chapter 4 in the ST2400 2 4Gb s SDH SONET Test Set User Manual describes and details all of the VFP menus listed in the SETUP TX SETUP and RX SETUP menu list The reader should be familiar with them before proceeding with the Combined Dual Mode setup A WARNING Always avoid exposure to the laser beam Before power is applied to the ST2400 2 4 Gb s SDH SONET Test Set be sure that all laser outputs are either covered with the screw cap provided or connected to the appropriate circuit Be sure to read understand and follow all of the Laser Safety instructions in the ST2400 2 4Gb s SDH SONET Test Set documentation A CAUTION Figure illustrates the front panel cabling connections not the positioning of the equipment Always allow for adequate air flow when installing positioning or mounting equipment ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use Eile Edit Settings Phone Transfers Help sT24ee TX SETUP ocss TX LASER
240. into the end of fiber for at least three seconds Note Hold the can in an upright position DO NOT tilt invert or shake the can during use Ifa mist appears from the can the cleaning process must be performed again Dispose of the used Kimwipe immediately Do not reuse it ST112 SONET Transmission Test Set B 17 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test B 18 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Appendix C Calibration Verification Test Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Calibration Verification Test Introduction The purpose of this procedure is to allow the customer a means with which to verify that any ST112 Transceiver is within calibration This procedure is designed to be a brief verification that the calibration of the unit is within the required specifications Note The optical sections only apply if the unit has optical options Required Equipment The following equipment will be required in order to verify that the ST112 Transceiver is calibrated properly Tektronix CSA803A oscilloscope with sampling head freqency counter with a Khz to Mhz range suggested Tektronix CMC251 m m bnc 50 ohms coaxial cable f m bnc 50 ohms thru terminator two male bnc 50 o
241. ion Guaranteed 888 88 SOURCE www artisantg com Functional Overview The GPIB receptacle is an IEEE 488 2 standard connector provided for remote operation The RS 232C serial interface connector is a 25 pin socket that can be used with the ST2400 in the dual mode It can also be used with a VT100 terminal or PC running VT 100 terminal emulation software or with a serial printer The Parallel Printer interface is a Centronics DB 25 socket Event SYNC is a BNC connector Event SYNC results when an alarmed condition SONET is detected by the ST112 The signal is a negative TTL pulse during the alarmed period For example if you were to send a LOS Loss of Signal condition alarm lt 1 us gt when the button is pressed to send the event there would be a us negative pulse representing the start to end of the LOS alarm duration This connection is optional If the alarm is selected for lt x gt number of frames the pulse will occur for that period of time If you were to send a LOF Loss of Frame condition BURST of lt 1 gt frame there will be a 125 us negative pulse representing frame event for the Loss of Frame alarm time This would occur as soon as the button is pressed to send the BURST EVENT 1 frame 125 us 2 frames 250 Us 3 frames 375 us The same condition would continue for lt x gt amount of frames This also is the start to end time that the event will occur An APS Automatic Protection
242. ion LCD Menu The ST112 SONET Transmission Test Set has an LCD setup menu shown in Figure 5 14 and detailed in Chapter 3 that can be used to OPEN the COM LINK between the two units Use the right arrow key to move the cursor to OPEN and the enter key to enable the link The ST2400 2 4Gb s SDH SONET Test Set must be configured for SONET operation before it can be used in the dual mode If it is not the Test Set will display a LINK FAILED CHANGE ST2400 TO SONET MODE message After the mode is changed the ST2400 2 4Gb s SDH SONET Test Set must receive a power cycle then the link can be opened When the link is established remote commands sent through the RS 232 port will be handled by the Test Set until the combined mode off command terminates the connection between the two systems The ST2400 2 4Gb s SDH SONET Test Set will process remote commands sent through the ST2400 2 4Gb s SDH SONET Test Set GPIB port even if the ST2400 2 4Gb s SDH SONET Test Set is in the combined dual mode The ST2400 can be used to test both SONET and SDH networks The ST112 ST2400 Link can only be used when the ST2400 is in the SONET mode ST112 SONET Transmission Test Set 5 13 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use Virtual Front Panel Combined Dual Mode l Terminal ST112 TRM File Edit Settings TX SETUP Iq Output Optics Iw Timing Ir Mapping
243. isantg com Remote Commands rx_owire Receive Order Wire Query Command Returns a character string indicating which Order Wire from the received STS n signal is being dropped Example rx_owire Response RX_OWIRE LOCAL rx_signal stsx1 dsx3 dsx1 optic Rx Signal Set Command Selects the signal to be received by the applicable front panel connector Argument stsx1 select the stsx1 electrical input from the front panel 75 ohm connector dsx3 select the dsx3 electrical input from the front panel 75 ohm connector dsx1 select the dsx1 electrical input from the front panel 100 ohm connector optic select the optical input from the front panel optical connector Example rx_signal optic Response NONE Note see Rx Optical Rate Set Command rx_ccn commands rx_signal Receiver Signal Query Command Returns a character string indicating the current signal type being received Example rx_signal Response RX_SIGNAL STSX1 Note The receiver signal can be used to indicate which port is selected The STSX 1 and DC3 signals use the 75 ohm front panel port the DSX 1 is received by the 100 ohm front panel port and the optical port receives all of the OC n signals rx_sts_chan n Receiver STS 1 Channel Set Command Sets the Receiver STS 1 Channel number within the OC 3 or OC 12 channel Argument n a decimal number from 1 to 12 OC 12 rate n a decimal number from 1 to 3 OC 3 rate Example rx_sts_chan 3 Response NONE r
244. isantg com Virtual Front Panel SONET Alarms Transmitter File Edit Settings Phone Transfers Help TX SETUP Sk catatatatatatatatatatatetatetetateatatatetatstetstetetaetatatetats Iq Output Optics I 1 SONET ALARMS I Iw Timing IBCONTINUOUS ALARMS I Ir Mapping 1 IKEF L AIS L RDI l lo SPE Pointer I 1 P AIS P RDI P LOP OORP l Ip UT Pointer I UT AIS UT RDI UT LOP l Is Sonet Alarms CONT ALARMS ON Ig Sonet Error 1 l 11 TOH POH BURST ALARH l Iz J1 Trace Messge L RDI L AIS P AIS l It UT1 5 Channel I 1 P RDI OORP UT AIS UT RDI l ly UT1 5 DSX1 Cfg 1 NUMBER OF BURST FRAMES 10 l Ik UT Err Alarms I LOSS OF SIGNAL 100 uSec l lu DS3 DSX3 Cfg I Figure 4 32 SONET Alarms Transmitter The SONET ALARMS menu s shown in Figure 4 32 is used to select and generate continuous or burst alarm conditions during the test cycle There are five headings in three areas Use the up and down arrow keys to move between the menu headings and the left and right arrow keys to move within a section For example in Figure 4 32 the reverse video cursor is positioned on the CONTINUOUS ALARMS heading Press the down arrow to move to the CONT ALARMS heading Then press the up arrow to return to the CONTINUOUS ALARMS heading The continuous alarm section has two headings CONTINUOUS ALARMS and CONT ALARMS When the reverse video course is at the CONTINUOUS ALARMS heading pressing the F4 k
245. it Status indicator Clear History or Current Example ds3_bit_sta Response DS3_BIT_STA CUR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on ds3_idle DS3 IDLE Indicator Query Command Returns the current state of the PAYLOAD DS1 DS3 DS3 IDLE indicator Clear History or Current Example ds3_idle Response DS3_IDLE CLEAR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on ds3_ones DS3 All Ones Query Command Returns the current state of the PAYLOAD DS1 DS3 DS3 ONES indicator Clear History or Current Example ds3_ones Response DS3_ONES HIST Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on ST112 SONET Transmission Test Set 7 49 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands ds3_par_sta DS3 Parity Query Command Returns the current state of the PAYLOAD DS1 DS3 PAR indicator Clear History or Current Example ds3_par_sta Response DS3_PAR_STA CUR Note CLEAR Indicates that the LED is off and no history is availa
246. itional commands until all pending operations are completed Example wai Response NONE Standard Register Commands cls Clear Status Register Command Clears the Standards Events Status Register SESR and the Event Status Bit ESB in the Status Byte Register SBR initiates the Operation Complete Idle State and Operation Complete Query Idle State Example cls Response NONE Note after execution the ST112 will have no data in its input and output registers and will not be executing any command ese n Event Status Enable Register Set Command Sets the Event Status Enable Register ESER to the argument n Argument n a decimal number between 0 and 255 Example ese 255 Response NONE Note decimal 255 sets the register to 11111111 binary ese Event Status Enable Register Query Command Sets the Event Status Enable Register ESER to the argument n Example ese Response ESER n n a decimal number between 0 and 255 Note decimal 255 sets the register to 11111111 binary esr Event Status Register Query Command Returns the content of the Event Status Register ESR Example esr Response ESR n n a decimal number between 0 and 255 Note decimal 255 indicates the register is set to 11111111 binary opc Operation Complete Command Enables Sets the OPC bit to 1 Example opc Response NONE Note Used to determine when a group of commands have been completed ST112 SONET Transmission Test Set 7 13
247. iver If you had any problems with the unit while performing the tests repeat the procedure paying careful attention to the set up of the units and the directions given If the unit still has a problem please call Tektronix Customer Sales and Support Center CSSC at 1 800 835 9433 x2400 or 503 627 2400 for assistance ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Calibration Verification Test Cleaning Optical Cables Required Equipment Clean Air Spray Dust Free suggested Chemtronics E Series Ultrajet Isopropyl Alcohol 70 035 Swab suggested Fisher Brand Cat No 14 959 77 Kimwipes Laboratory Wipes suggested PN 34155 Cleaning Procedure for Front Panel Optical Connectors Note This procedure should be performed each time the fiber assemblies are to be used to prevent scratching the fiber and ultimately destroying optical connectors 1 Remove the protective optical cover from the connector to be cleaned 2 Take a swab from the package and dip it into the clean Alcohol solution 3 Gently insert the swab into the barrel ferrule opening of the fiber optic connector until it stops 4 Gently spin the swab clockwise and the counter clockwise 5 Remove the swab 6 Using the clean air spray spray the air into the barrel opening for at least three seconds Note Hold the can in an upright position DO NOT tilt invert or sh
248. iver together with the BNC 75ohm cable Connect one end of the cable to the input connector on the right side or receiver section of the front panel Connect the other end of the cable to one of the output connectors on the left side or transmitter section of the front panel 2 Power on the unit After the power up sequence the display should show the SONET QuickSet menu 3 Using the INC DEC keys select STSX1 Note The option with the brackets surrounding it is the current selection 4 Using the LEFT RIGHT cursors select DS3 and then press ENTER Note The green LED within the RUN STOP switch should be lit 5 The transmitter and the receiver sides should now be linked error free Note Error free means that you see no lit LEDs on the receiver side of the front panel 6 Remove the 75 ohm coax cable from the transmitter output connector Note that there are now error light lit on the receiver side of the front panel 7 Reconnect the 75 ohm cable to one of the output connectors on the transmitter side of the front panel Note that the error lights are no longer lit on the receiver side 8 On the receiver side of the front panel press and hold down HISTORY VIEW Observe that certain red LEDs on the receiver side of the front panel are now lit HISTORY VIEW reflects the last errors which occured Note HISTORY VIEW reflects past history in the red LEDs only If any condition occurs causing the POINTER section LEDs to light HISTORY
249. ject to restrictions as set forth in subparagraph c 1 ii of the Rights in Technical Data and Computer Software clause at DFARS 252 227 7013 or subparagraphs c 1 and 2 of the Commercial Computer Software Restricted Rights clause at FAR 52 227 19 as applicable Tektronix products are covered by U S and foreign patents issued and pending Information in this publication supersedes that in all previously published material Specifications and price change privileges reserved Printed in the U S A Tektronix Inc P O Box 1000 Wilsonville OR 97070 1000 TEKTRONIX and TEK are registered trademarks of Tektronix Inc ST112 SONET Test Set User Manual Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Warranty Tektronix warrants that this product will be free from defects in materials and workmanship for a period of one 1 year from the date of shipment If any such product proves defective during this warranty period Tektronix at its option either will repair the defective product without charge for parts and labor or will provide a replacement in exchange for the defective product In order to obtain service under this warranty Customer must notify Tektronix of the defect before the expiration of the warranty period and make suitable arrangements for the performance of service Customer shall be responsible for packaging and shipping the defective product to the service cen
250. k Setup lI PRINT REPORT SETUP Iw Time IZPRINT CONTROL Ir DSX Line Code ON ERROR END TEST BOTH It Store Recall PRINT SQUELCH ly Timed Test Qaa ON lu Report Printing PRINT PORT Im Current Cfg 1 RS232 lI lI lI lIl lI l CLEAR ERRORS YES REPRINT CONTROL ON ERROR PREU EOT CURR Figure 4 8 VFP Print Report Setup Display Letter u is the PRINT REPORT SETUP submenu Use the up and down arrow keys to move between fields Use the left and right arrow keys to move within the field The fields are used as detailed below PRINT CONTROL Use the left and right arrow keys to select one of four settings OFF will not print any reports ON ERROR will print a report when an error is detected END TEST prints a report summary at the end of the test cycle Or BOTH will print a report when an error occurs and a summary at the end off the test cycle Leaving the menu will enter the new value PRINT SQUELCH Is used to reduce the total number of errors being logged When squelch is ON the errors will be logged for 10 consecutive seconds then stop Error logging will resume when ten consecutive seconds have passed without error Squelch ON saves memory and reduces lengthy error reports The left and right arrows are used to position the reverse video cursor Leaving the menu will enter the new value PRINT PORT is used to set the printer port to either parallel or RS232 serial The printer may be connected to the
251. l Iz J1 Trace Messge I l It UT1 5 Channel TX UT1 5 BITS INPUT TERMINATION ly UT1 5 DSX1 Cfg Il MONITOR Ik UT Err Alarms 1 l lu D 3 D X3 Cfo SERS SS SS aa e a E a e e a a e a ate saa a ia aa as a Figure 4 29 VFP Mapping Transmitter Figure 4 29 shows the transmitter payload MAPPING r menu The Test Set transmitter mapping conforms to ANSI and Bellcore standards The mapping can be divided into three groups e DS3 44 736 Mb s ASYNC signal e VT1 5 1 544Mb s Virtual Tributary e Concatenated STS 3c or STS 12c A DS 1 input can be applied to the rear panel BITS DSX 1 connector and mapped into the VT1 5 payload The second menu item TX V1 5 BITS INPUT TERMINATION is used to configure this rear panel input for normal termination TERM or a low level input from a network element s MONITOR output Use the up and down arrow keys to move between menu areas and the left and right arrow keys to position the cursor within either menu area The ENTER key is used to activate menu items One of the three yellow LED indicators DS3 VT or 3c 12c identify which mapping is active 4 24 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel SPE Pointer Transmitter File Edit Settings Phone Transfers Help TX SETUP Bo a nnn nanan Iq Output Optics SPE POINTER Iw Timing CURRENT SPE POINTER
252. l l l SONET RANDOM ERROR RATE l l Ig Sonet Error l l l l l l l 9E 3 ENABLE ON STSX1 BPU ERROR RATE 0 9E 3 ENABLE ON BIP2 ERROR RATE l 11 TOH POH oE 3 ENABLE gq ON l Iz J1 Trace Messge It UT1 5 Channel ly UT1 5 DSX1 Cfg Ik UT Err Alarms lu DS3 DSX3 Cfa TX OCN SINGLE ERROR CHANNEL 1 Figure 4 35 SONET Error Transmitter Figure 4 35 illustrates the SONET ERROR menu g2 its makeup is configuration dependent This is an example of the menu that will be seen when the transmitter is configured for the OC 12 rate with a VT1 5 payload The menu has five sections that can be accessed with the arrow keys as follows STS1 3 SINGLE ERROR INJECT section is used to inject a single bit error on the B1 B2 B3 PYLD VT1 5 Payload Pattern and BPV Bipolar Violation Use the arrow keys left and right to position the reverse video cursor and press the F4 key to generate the error SONET RANDOM ERROR RATE section is used to set the error rate range from 1 0E 3 to 1 0E 9 and generate ENABLE ON it on the optical rate OC 1 OC 3 and OC 12 Use the arrow keys to position the reverse video cursor and the enter key to execute the set error rate STSX 1 BPV ERROR RATE section is used to set the error rate range from 1 0E 3 to 1 0E 9 and generate ENABLE ON it on the electrical cross connect rate STSX 1 Use the arrow keys to position the reverse video cursor and the enter
253. l commands Command definitions are grouped by function In addition an alphabetical list of all ST112 commands is provided with page references to individual command descriptions Appendices A Specifications B Incoming Inspection Test C Calibration Verification Test xi Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Safety Summary Conventions This manual uses the following conventions e The names of front panel controls and menus appear in all upper case letter for example TRANSMIT and HELP e Names appear in the same case in this manual as they appear on the display of the ST112 for example Test Duration and USER DEFINED e Within a procedure a specific button to be pressed or a parameter to be selected appears in boldface print xii ST112 SONET Test Set User Manual Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Introduction This chapter describes the ST112 SONET Transmission Test Set and provides a list of standard optional and general safety information Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Introduction Product Description Tektronix ST112 SONET Transmission Test Set Figure 1 1 ST112 SONET Transmission Test Set The ST112 SONET Transmission Test Set is an extensive SONET STSX 1 OC 1 OC 3 OC 12 signal analyzer an
254. le bip2_rate Response BIP2_RATE 3 2E 7 Note The error rate is displayed as a negative exponent 7 54 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands bip2_random on off VT BIP 2 Random Error Rate Set Command Rendomly generates the VT1 5 Bit Interval Parity error rate Argument on Turns the VT BIP 2 error rate generator on and off randomly off Turns the VT BIP 2 error rate generator off Example bip2_random on Response NONE Note The error rate is a negative exponent from 1 0E 9 to 1 5E 3 bip2_random VT BIP 2 Random Error Rate Query Command Returns the state of the VT1 5 Bit Interval Parity error rate random generator Example bip2_random Response BIP2_RANDOM ON bpv_error STSX 1 BPV Error Set Command Generates a single bipolar violation in the STSX 1 electrical cross connect B3ZS signal Example bpv_error Response NONE Notes Zero substitution codes are NOT impacted Bit errors are NOT caused ds1_bit_rate n DS1 Bit Error Rate Set Command Sets the DS1 VT1 5 Bit Error Rate Example ds1_bit_rate n Response NONE Note The error rate is a negative exponent from 1 0E 9 to 1 5E 3 ds1_bit rate DS1 Bit Error Rate Query Command Returns a character string indicating the current value of the DS1 VT1 5 Bit Error Rate Example ds1_bit_rate Response DS1_BIT_RATE 3 2E 7 Note The error rate is
255. ll Receive Overhead All Query Command Returns 40 bytes 27 are valid TOH Section and Line overhead bytes 9 are valid POH Path Overhead bytes And 4 are valid VT Virtual Tributary overhead bytes Table 7 1 Byte Mnemonics TOH Section Sec and Line Overhead Bytes POH Bytes VT Bytes Example rx_oh_all Response RX_OH_ALL 0 HF6 1 H28 etc Note The first number before the comma is the NR1 byte count format ranging from zero to thirty five for the TOH and POH bytes in the following order A1 A2 C1 J1 B1 B3 D1 Z5 and bytes thirty six through thirty nine are V1 V2 V3 V4 The H code after the comma is corresponding byte value in non decimal numeric hexadecimal ST112 SONET Transmission Test Set 7 41 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands rx_oh_byte s Receive Overhead Byte Query Command Returns the value of the specified TOH byte Whereas the argument s is a byte mnemonic listed in Table 7 1 Example rx_oh_byte K2 Response RX_OH_BYTE K2 H22 Note The argument K2 in the example corresponds to the K2 byte It must be enclosed in quotation marks as shown The K2 before the comma in the response is the corresponding byte label The code H22 after the comma is the hexadecimal non decimal numeric value of the K2 byte rx_oh_offset n Receive Overhead Offset Query Comman
256. llowing section of this chapter ST112 SONET Transmission Test Set 3 7 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays 3 8 Automatic Protection Switching APS Figure 3 5 illustrates the APS message display From the top line The direction can be UNI unidirectional BI bi directional FERF L Far End Receive Failure Line AIS Alarm Indication Signal or four asterisks indicating none of the four line types The Protection can either be 1 1 one to one or 1 N several unallocated lines specified by the number N The Request Line the line requesting to be switched and the Switch Line the line that the Request Line wants to switch to can be any decimal number from 0 to 15 Protection Request Line Switch Line Direction Message Figure 3 5 Automatic Protection Switching APS The bottom line of the APS will display one of sixteen possible messages 0 No Request 8 Manual Switch 1 Do Not Revert 9 Invalid 2 Reserve Request 10 SD Lo Priority 3 Invalid 11 SD Hi Priority 4 Exercise 12 SF Lo Priority 5 Invalid 13 SF Hi Priority 6 Wait To Restore 14 Forced Switch J Invalid 15 Lockout Protect The nomenclature SD Lo Priority means Signal Degrade Low Priority and SF Lo Priority means Signal Failure Low Priority ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE
257. lock Example time Response TIME 15 30 45 view_angle Front panel View Angle Query Command Returns a decimal integer that indicates the display angle of view Example view_angle Response VIEW_ANGLE 2 Note View angle is an integer from 0 to 7 Zero should be the best view angle when the ST112 is positioned below the operator view_angle n Front panel View Angle Set Command Sets the view angle to an integer from 0 to 7 decimal Example view_angle 1 Response NONE Note View angle is an integer from 0 to 7 Zero should be the best view angle when the ST112 is positioned below the operator ST112 SONET Transmission Test Set 7 19 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands Receiver Setup and Mode Commands dsx_level terminate bridge DSX STSX Level Setup Command Sets the input gain of the electrical inputs to either terminate or bridge monitor Argument terminate sets the input gain of the electrical ports to be compatible with signals from dsx and stsx cross connect outputs bridge sets the input gain of the electrical ports to be compatible with signals from dsx and stsx cross connect monitors outputs Example dsx_level terminate Response NONE Note The ST112 receiver input jacks are located on the front panel One is a BNC 75 ohm and the other is a 100 ohm input impedance dsx_level DSX STSX Level Query Command Sets the
258. log reports stored in the non volatile memory Error Log Example log_clear Response NONE 7 46 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands log_print Print Error Log Execute Command Prints all error log reports stored in the non volatile memory Error Log Example log_print Response NONE s3c_bit_err STS 3c Bit Error Count Query Command Returns the number of Test Pattern Bit errors counted in the selected STS 3c payload Example s3c_bit_err Response 3C_BIT_ERR 813 s3c_bit_rate STS 3c Bit Error Rate Query Command Returns the rate of Test Pattern Bit errors calculated in the selected STS 3c payload Example s3c_bit_rate Response 3C_BIT_RATE 4 1E 9 Note The rate is returned as a negative exponent s12c_bit_err STS 12c Bit Error Count Query Command Returns the number of Test Pattern Bit errors counted in the selected STS 12c payload Example 12c_bit_err Response 12C_BIT_ERR 813 12c_bit_rate STS 12c Bit Error Rate Query Command Returns the rate of Test Pattern Bit errors calculated in the selected STS 12c payload Example 12c_bit_rate Response 12C_BIT_RATE 4 1E 9 Note The rate is returned as a negative exponent sts_febe_err FEBE Total Error Count Command Returns the number of path Far End Block Errors counted in the received signal Example sts_febe_err Response STS_FEBE_ERR n n the
259. m BNC Rear Panel Input Input for an external STS 1 or STS 3 clock source Rates accuracy listed under the External Clock Reference Input for an external DS1 or DS3 to be mapped into a higher level SONET signal Rates Accuracy DSX3 INPUT 51 84 MHz 20 ppm Data Line Code BITS DSX1 INPUT AMI B8ZS DSX3 INPUT B3ZS Clock for transmitter 52 Mb s INPUT 800 MV pk pk 155 Mb s INPUT 800 MV pk pk Impedance Connector 52 Mb s INPUT AC coupled 50 ohm BNC 155 Mb s INPUT AC coupled 50 ohm BNC BITS DSX1 INPUT Balanced 100 ohm WECO310 jack DSX3 INPUT Unbalanced 75 ohm BNC ST112 SONET Transmission Test Set A 5 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Appendix A Specifications Transmit and Receive Functional Specifications Section Overhead Access Set overhead bytes to any value from hex 00 to FF A1 A2 E1 F1 D1 D3 View all Section Overhead bytes Insert data from the DCC connector into the Section DCC 192 Kb s Insert voice from the Orderwire Handset connector into the Section local orderwire channel Add Drop Drop data from the Section DCC out to the DDC connector Drop voice from the Section local orderwire channel to the Orderwire Handset connector Line Overhead Access Set overhead bytes to any value from hex 00 to FF K1 K2 D4 D12 Z1 Z2 E
260. menu illustrated in Figure 3 29 are QRW Quasi Random Word two Pseudo Random Bit Sequences 2E15 and 2E23 and a six character hexadecimal word wd440004 in this example Use the arrow keys to select the pattern and the ENTER key to enable the chosen pattern before or during the test cycle Two test patterns are available from the STS 3c menu 2E23 and 2E23 INV inverted They are Pseudo Random Bit Sequences The third menu on the left side of Figure 3 29 is used to access the TX STRESS PATTERN menus for DSX 1 network testing Press the ENTER key to access the first of nine TX STRESS ST112 SONET Transmission Test Set 3 25 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays 3 26 PATTERN menus and the pattern key to scroll through them to the desired test pattern Then press the ENTER key to make it active When a stress pattern is active the word ACTIVE preceded by an asterisk can be seen in the lower right side of the menu Such as the one illustrated in the STANDARD PATTERN of this example TX Stress Patterns The ST112 SONET Transmission Test Set includes additional patterns to provide more ways to stress test DS1 circuits Telecommunications research notes that the QRW Quasi Random Word test pattern universally used for out of service testing of DS1 circuits is not up to the task of determining the true performance of DS1 circuits used for the t
261. nd that the output signal matches the standard DS3 mask The CSA803A scope a frequency counter a 75 ohms bnc thru terminator a 75 ohms to ground bnc terminator and a 75 ohms bnc cable are needed There are nineteen steps in this section of the procedure 1 Connect one end of the cable to the bottom left output connector on the transmitter side of the front panel C4 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Calibration Verification Test 2 Connect the 75 ohms to ground terminator to the bottom right output connector The outputs are ganged together with isolated signal splitters While measuring accuracy it is wise to terminate the unused end of the split signal Connect the other end of the cable to the 75 ohms thru terminator Connect the other end of the thru terminator to the frequency counter On the front panel press SETUP until the display shows the Quick DSX Set Up menu Using the LEFT RIGHT cursors select DSX3 and then press ENTER On the transmitter side of the front panel under the DS3 VT1 5 STS3c 12c heading press PATTERN until the display shows the TX Pattern DS3 PAYLOAD menu Using the LEFT RIGHT cursors select WORD 9 Using the INC DEC keys change the word to FF and then press ENTER 10 On the transmitter side of the front panel under the DS3 VT1 5 STS3c 12c heading press FRAMING until the display show the Tx
262. nd the status GPIB_BUS TALK_LISTEN When the header is off the query command gpib_bus will respond with the status only TALK_LISTEN header Header Mode Query Command Returns a response string indicating the headers are enabled or disabled Example header Response HEADER ON Note See the Header Mode Set Command logo Logo Query Command Returns a character string that includes company name instrument model number current software version and software date Example logo Response TEKTRONIX MICROWAVE LOGIC ST112 v w yyyy mm dd Note v w will be replaced by the software version number yyyy mm dd will be replaced by the software date idn Identify Returns a character string that includes company name instrument model number and current software version Example idn Response TEKTRONIX ST112 0 v w Note v w will be replaced by the software version number Irn Learn Query Command List the ST112 current setup except for RS 232 C port information Example Irn Response AUTO_VOL 0 PRINT_PORT PARALLEL VIEW_ANGLE 1 Note The response is a series of commands headers and parameters separated by semicolons They can be stored in the controller and used to restore the same setup later 7 12 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands wai Wait Command Stop processing any add
263. ne BIP 8 Code Violations counted b3_ber B3 Error Rate Query Command Returns the rate of STS n Path BIP 8 Code Violations Measured in the received SONET signal Example b3_ber Response B3_BER 4 0E 09 Note The rate is returned as a negative exponent b3_err B3 Error Count Query Command Returns the number of STS n Path BIP 8 Code Violations counted in the received SONET signal Example b3_err Response B3_ERR 5280 b3_es B3 Errored Seconds Query Command Returns the number of errored seconds counted in the received SONET signal Example b3_es Response B3_ES 9477 Note Errored seconds are for the STS n Path BIP 8 Code Violations counted b3_ses B1 Severely Errored Seconds Query Command Returns the number of severely errored seconds counted in the received SONET signal Example b3_ses Response B3_SES 58 Note Errored seconds are for the STS n Path BIP 8 Code Violations counted bpv_err BPV Error Count Query Command Returns the number of Bipolar Violations counted in the received STSX 1 DSX 3 or DSX 1 signal Example bpv_err Response BPV_ERR 1234 7 44 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands bpv_rate BPV Error Rate Query Command Returns the rate of Bipolar Violations Measured in the received STSX 1 DSX 3 or DSX 1 signal Example bpv_rate Response BPV_RATE 4 0E 09 Notes The rate is returned a
264. ned over BURST ALARM the left and right arrow keys are used to maneuver the reverse video cursor over the alarm condition to be activated for the number of frames specified 12 in this example One and only one alarm condition can be generated in a burst When the down arrow is used to move the cursor to the NUMBER OF BURST FRAMES heading the F4 key can be pressed to generate the selected burst condition VT RDI in this example oe SONET ALARMS l CONTINUOUS ALARMS l EF L AIS L RDI l P AIS P RDI P LOP OORP UT AIS UT RDI UT LOP l CONT ALARMS ON l I l BURST ALARH l EF L RDI L AIS P AIS l P RDI OORP UT AIS l NUMBER OF BURST FRAMES 12 I LOSS OF SIGNAL uSec Figure 4 34 SONET Alarms LOS Example Transmitter The last SONET ALARMS selection is LOSS OF SIGNAL shown in Figure 4 34 It can be set from 1 to 150 microseconds Pressing the F4 key during the test cycle will execute the alarm 4 28 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel SONET Error Transmitter l Terminal ST112 TRM File Edit Settings Phone Transfers Help TX SETUP dace nnn nnn n nn nn nn nnnnnnnennnncennne Iq Output Optics I SONET ERROR lw Timing ea SINGLE ERROR INJECT Ir Mapping I B2 B3 PYLD BPU lo SPE Pointer Ip UT Pointer Is Sonet Alarms
265. network of several network elements such as ADMs or Terminals at different locations Figure 5 11 shows one CO Central Office Location that is multiplexing and demultiplexing STSX 1s into an OC 12 rate Just as cross connects can be verified through an individual network element it is possible to verify the complete path mapping thought the network The setup illustrated Figure 5 11 can be used to verify the end to end channel provisioning and can be used for troubleshooting Summary VT1 5 Channel Scan Setup The following summarizes the setup used for the Test Set VT Channel Scan feature Setup Transmitter Receiver Select the Payload and the Rate for both the transmitter and the receiver sections The payload must be VT1 5 but the Rate can be STSX 1 OC 1 OC 3 or OC 12 Set the mapping 7 to INT VT1 5 Bit Float VT Channel t select the numbering 1x28 or 4x7 set the active VT Channel to Single and select the Channel Number 1 of 28 for the U QRW U QW Under VT1 5 DSX1 Cfg y Set the Framing for UNFRM and the Pattern for QRW Set the mapping r to VT1 5 Bit Float VT Channel t select the numbering 1x28 or 4x7 Under VT1 5 DSX1 Cfg y set the Framing for UNFRM and the Pattern for QRW ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use Combined Dual Mode Setup and Verification Thi
266. nteed 888 88 SOURCE www artisantg com Applications and Use 2 Terminal ST112 TRM Biles File Edit Settings Phone Transfers Help l DETAILED EVENT LOG 11992 02 20 17 37 16 IB1 ERR B2 ERR PATH RDI B3 ERR l l l l l l l l l l l HIT L KEY TO UIEW DWELL PERIOD EVENT LOGS HIT C KEY TO EXIT VIEW LOG Mut ceceresaassesuetae soe veuleecee oe esae ee eee ces EEEE IBUIEW CHANNEL PRINT CURRENT ALL FOR CHANNEL EE I GOTO ENTRY 1 PRINT DETAIL NMa FULL I PAGE UP U PAGE DOWN D STOP PRINT JOB S l 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 F1 F2 F3 CTRL T CTRL R CTRL P CTRL Z CTRL Q TX SETUP RX SETUP RESULTS SETUP RUN STOP PAUSE REFRESH QUIT ST112 TEKTRONIX xx STOPPED Terminal ST112 TRM of File Edit Settings Phone Transfers Help I DETAILED EVENT LOG I 11992 02 20 17 37 17 l ILOS SECT OOF SECT LOF B1 ERR B2 ERR PATH FEBE B3 ERR l l l l l 11992 02 20 17 37 18 l ILOS SECT OOF SECT LOF B1 ERR LINE LOP B2 ERR PATH RDI PATH FEBE 1B3 ERR l l l 11992 02 20 17 37 19 l IB1 ERR B2 ERR PATH FEBE B3 ERR l l l l l l l I MORE DOWN IHIT L KEY TO UIEW DWELL PERIOD EVENT LOGS HIT C KEY TO EXIT UIEW LOG 5 5 5 5 oo oe MMM MMMM MM MMMM MMM MMMM IBUIEW CHANNEL PRINT CURRENT ALL FOR CHANNEL MM 1 GOTO ENTRY 1 PRINT DETAIL AUMEN FULL PAGE UP U PAGE DOWN D STOP PRINT JOB S
267. nu Transmitter The menu shown in Figure 4 38 is used to configure the VT1 5 channel format It is only accessible after selecting VT mapping from the transmitter s Mapping Menu r The VT CHANNEL NUMBERING at the top of the display is used to map the virtual tributaries sequentially 1 to 28 or in a four by seven 4x7 matrix similar to Bellcore GR 253 CORE and illustrated in Figure 4 38 The ACTIVE VT1 5 CHANNEL can be set to SINGLE number 1 in this example or ALL of the 28 VT channels that will be configured before mapping them into the Synchronous Payload Envelopment The lower portion of this display Figure 4 38 shows that 28 channels are accessible 1 28 to and that VT channel number in this example is being configured with the settings from the VT1 5 DSX 1 Configuration menu Figure 4 40 detailed later in this chapter Use the arrows keys to position the cursor and the enter key to activate your selection The Input Not Accepted message will appear in the lower left corner of the display if the CHANNEL is set to number larger than 28 When this happens the CHANNEL number will reset and the message will remain until the enter key is pressed 4 32 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel VT1 5 Structured STS 1 SPE 4x7 mapping numbered in groups of seven LERNT Peres Serre eye PIN PETF TTEA 29 30 31
268. ode violations The B3 error indicates that STS 1 STS 3c or STS 12c path BIP 8 code violations were detected STS path BIP 8 is carried in the B3 POH byte Path code violations indicate an error condition in the monitored path between the monitor point and the upstream PTE ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview VT Path Alarms Figure 2 7 Receiver Status Indicators The Virtual Tributary VT Path is a logical connection between the point of frame origin and the point of destination The structure is designed for the transport and switching of DS1 sub payloads These points can be further defined as the point where the frame of a specified rate OC 12 or OC 3 is assembled and the point where the frame of that same rate is disassembles The Test Set has four VT Path LED indicators Figure 2 7 as follows e The AIS Alarm Indication Signal indicates an upstream VT 1 5 path failure in the monitored direction The VT1 5 may travel across multiple STS n or OC n transmission facilities and a failure in any one of them will cause a VT path AIS at all of the downstream points e The RDI Remote Defect Indicator indicates a VT1 5 path failure in the other direction unmonitored direction In other words the PTE receiving the other direction of the monitored VT1 5 has entered a failure state or is receiving a line AIS
269. om Functional Overview Receiver Description This section describes the ST112 SONET Transmission Test Set receiver front panel inputs outputs controls and indicators shown in Figure 2 S DS3 VT1 5 STS3C 12C Figure 2 5 Receiver Front Panel Receiver Connectors Front Panel The front panel has three input connectors Figure 2 5 On the lower left side of the receiver section is an industry standard FC PC optical output connector ST and SC connectors are available as options The maximum input is 10 dBm The optical output key is used to switch between OC 1 OC 3 and OC 12 input signals three yellow LEDs indicate which is selected On the lower right side of the receiver front panel is a 75 ohm input connector either a WECO 560 or a BNC and a 100 ohm input connector either bantam or WECO 310 The STSX 1 or DSX 3 signal can be applied to the 75 ohm input The DSX 1 signal can be applied to the 100 ohm input Input Key Receiver The receiver INPUT select key and four associated yellow LED indicators are on the lower right side of the receiver front panel Figure 2 5 The key is used to select between the STSX 1 DSX 3 DSX 1 and MON monitor inputs The monitor input accepts a low level input from a network element s monitor MON output The INPUT LCD menu detailed in Chapter 3 LCD Menus and Displays provides the four selections Both the STSX DSX and MON LEDs are illuminated when the monitor mode is selected
270. om Error Query Command Returns the state of the DS3 BPV error rate random generator Example ds3_bpv_random Response DS3_BPV_RANDOM ON ds3_error DS3 Bit Error Set Command Generates a single DS3 bit error Example ds3_error Response NONE Notes This error occurs in each DS3 carried as an STS n payload and each DSX 3 output The error may fall on the DS3 overhead or payload error_rate on off STS Bit Error Rate Set Command Generates random bit errors in any bit position within the STS n frame Example error_rate on Response NONE Note These errors cause STS n BIP 8 code violations in the line section and path and VT1 5 BIP 2 code violations ST112 SONET Transmission Test Set 7 57 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands error_rate STS Bit Error Rate Query Command Returns a character string indicating the state of the STS Bit Error Rate Generator Example error_rate Response ERROR_RATE ON Note the STS Bit Error Rate Generator can be on enabled or off disabled parity_rate n STS n Parity Rate Set Command Sets the STS n Bit Error Rate Generator to a number n from 1 0E 9 to 1 5E 3 Example parity_rate 1 3E 6 Response NONE Note The parity error generator will be enabled by the error_rate on command parity_rate STS n Parity Rate Query Command Returns the current STS n Bit Error Rate Generator Example parity_rate
271. on Product Description sccccsscsssssssssssscsssssssesssessssssseessesssessssssesesesessssssssssesssessssseess 1 2 Ve CEA TIN E CE EEEE E 1 4 Safety Instructions ssssssssesressesssvessiessvssssessorsv sos vovon sepure Serov SKos svv povra onora K ESV operose Se 1 5 Laser Safety scsccssssssssscsssessscssscssssssssessssssssssssssssssesscssscsesnsessssesssesssessseesscssecssoessnees 1 6 Functional Overview Panel Connectors Controls Indicators sccsssscccssssscsssssscssccccccssseesssssccessssccessseees 2 2 Front Panel Overview ccccccccceesssceceescececssseececsseecsessececsseececsaeeecessaeecesseseseesineeesenaes 2 2 Rear Panel OvervieW ccccccccccssssssscecssceessccsscceeseecsseceeseecseeeeseecsuecseseecsaeeeeeeecaeseeaeecss 2 2 Gettin Started sesssiessniseessesousdcnsssegstencesesons cons osts ossos uo Soressi osese soosoo orso S sees reo eSEE SSES 2 3 Display Display Controls and Indicators e essseseseseseeoeseeeeesoeseeeoeseeoesoeeeesonsereoeeeeonsee 2 4 Setup Menu Systems c sccssvessiecsdsansvescvsncesscossvesesbencenssvensdsacusevussscuusesoauens sbonssosanatesssoeues gt 2 5 Transmitter Description cscssccssssssssssscsssssssesssessssessesssessssssesesessssscesssssessseesseesoees 2 6 Transmitter Connectors Front Panel ccccccccscccesscccecssececeesseeeceessececssseeeessneeeeenaes 2 6 Configuration Keys TX sireci iaeiei R rie i E EARE AERE EE E RERE ERE ERSE 2 7
272. on 2 2 in this case when using the GR 253 CORE numbering format The STS channel can be changed using the INC DEC and ENTER keys The ACTIVE VT CHANNEL menu is used to choose one VT 1 5 sub channel from the chosen STS Channel There are twenty eight 1 28 VT1 5 sub channels in this example number nine 9 is selected In the VT CHANNEL MAP menu the virtual tributaries can be mapped sequentially from 1 to 28 or in a 4x7 matrix in accordance with Bellcore GR 253 CORE see Figure 3 8 and Table 3 1 Figure 3 7 Channel Menus Receiver VT1 5 Structured STS 1 SPE 4x7 mapping numbered in groups of seven 1 29 30 31 32 33 58 59 60 61 amp N a g J1 R R B3 R R C2 R R LOIN om o MN S wo w Ww wt G1 T OL TIN IN Bl HINO lPeK IN 2 r oO N Rp TT OS N SR RY FRE RE E RE HE HE HE HE EE HE FO B2 1 te 1 19 19 19 aaja anaa Eae 19 F tg g io 9 Se ENE E E N N E NE PSS Pass S ASSIS SSS SaS Sle lE ES gt Z4 R R z5 R R ky QU Ow g ze B VT1 5 Structured STS 1 SPE 1x28 mapping numbered sequential 41 29 30 31 32 33 58 59 60 61 62 87 J1 R R B3 R R 2 ole ole ee NARI TIANO ATR I NS N EENE Ell az L lap Jap F2 19
273. onal Overview This section describes ST112 SONET Transmission Test Set controls indicators connectors and display elements It includes separate sections that detail the transmitter and receiver specifics for the front and rear panels Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview Panel Connectors Controls and Indicators Front Panel Overview Tektronix ST112 SONET Transmission Test Set m L Figure 2 1 ST112 SONET Transmission Test Set Front Panel Illustrated in Figure 2 1 a complete view of the front panel The front panel can be divided into five functional sections e Display and Display Controls e Transmitter Controls Connectors and Status LED e Receiver Controls Connectors and Status LEDs e Measurement Controls and Indicators e GPIB LED Status Indicators A WARNING Always avoid exposure to the laser beam Before power is applied to the ST112 SONET Transmission Test Set be sure that all laser outputs are either covered with the screw cap provided or connected to the appropriate circuit 2 2 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview Getting Started Be sure to read and understand all of the Front and Rear Panel hardware details and descriptions in this chapter and all of the Safety Instruction
274. ont Panel DSX 3 Errors and Alarms File Edit Settings Phone Transfers Help TX SETUP denn n nnn nnn nnn nnn nnn nneeeeeeceeene Iq Output Optics DSX3 ERRORS Iw Timing DSX3 BPU ERROR RATE Ir Mapping 9E 3 ENABLE gg ON lo SPE Pointer Ip UT Pointer Is Sonet Alarms l l l l DSX3 BPU SINGLE ERROR INJECT l Ig Sonet Error l l I l I l l l l l l l I DSX3 LOSS OF SIGNAL 11 TOH POH l 100 uSec Iz J1 Trace Messge l It UT1 5 Channel l ly UT1 5 DSX1 Cfg l Ik UT Err Alarms lu DS3 DSX3 Cfg Figure 4 44 DSX 3 Errors and Alarms Transmitter The DSX 3 DSX3 Error and Alarm menu shown in Figure 4 44 is accessible when the Test Set is configured to transmit the DSX 3 asynchronous cross connect signal The first heading DSX 3 DSX3 BPV ERROR RATE is used to set the error rate to a number from 1 0E 9 to 1 5E 3 and enable Bipolar Violations The next main heading DSX 3 DSX3 BPV SINGLE ERROR INJECT is used to inject one Bipolar Violation at a time When selected the hidden F4 function key will be displayed The DSX 3 DSX3 LOSS OF SIGNAL alarm can be set for a period from 1 to 150 microseconds The hidden F4 key will be displayed and used to execute this function when pressed 4 38 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel STS 3c Configuration Menu Tr
275. ory Key Figure 2 8 History View Key The HISTORY VIEW key is used to review past alarms and errors A history status bit is set and the status LED built into the key will flash once an alarm or error has been detected during the test cycle Pressing this key will display the history status of the alarm and error LED indicators instead of the current status Releasing this key will return to the current status display within 500 milliseconds History is cleared when a new test cycle starts ST112 SONET Transmission Test Set 2 13 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview Measurement Controls and Indicators Figure 2 9 shows the ST112 SONET Transmission Test Set measurement controls and indicators The RUN STOP key provides duration control over the test cycle RUN clears all counters clears history data and starts the test cycle STOP halts the test cycle without effecting counter values The LED indicator inside the RUN key is on during the RUN cycle The PAUSE RESUME key permits a temporary stop of the test cycle The LED indicator is on when the test cycle is in the pause mode Pressing the key once again extinguishes the LED and resumes the test All counters are suspended in the PAUSE mode and continue from that point when the test cycle is resumed RESUME The LED indicators continue to operate while the test cycle is in a paused state but no da
276. ower right side of the transmitter section in the LASER ON area is an industry standard FC PC optical output connector ST and SC connectors are available as options The optical output key is used to switch between OC 1 OC 3 and OC 12 signals Three yellow LEDs are used to indicate which is selected There is a red LED that illuminates when the laser is on The optical connector is equipped with a screw cap to protect the optics from airborne contamination such as dust Optical devices can be cleaned by using compressed air or with a Microtip Medium Swab dipped in isopropyl alcohol that has greater than 70 percent alcohol Fiber optic cables should also be cleaned with a lint free wipe and isopropyl alcohol before connecting them ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview Configuration Keys Transmitter The transmitter front panel configuration keys and their menus will be detailed in Chapter 3 LCD Menus and Displays In general seven are in the general area and three are in the DS3 VT1 5 STS 3c STS 12c area They are as follows OVHD Overhead MAPPING TIMING ALARM POINTER DCC OW Data Communications Channel Orderwire ERROR PATTERN FRAMING and ERR ALM Error Alarm ST112 SONET Transmission Test Set 2 7 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg c
277. parallel port on the Test Set rear panel Or the VT100 emulator can be used to set up the Test Set then use CTRL O to exit the VT100 program and use the remote run command fest_state run to initialize the test This allows the test data to be fed back and made available for capture by a terminal emulator program Many communications software programs support this procedure The Test Set will still accept remote commands such as test_state stop or test_state and VT100 commands such as VT100 to restart the VFP CLEAR ERRORS Is used to clear the error log by moving the cursor to YES and pressing the enter key It immediately clears the error log and returns to NO after execution The error log should be cleared before a test run because when the error log is full new errors will be discarded Clearing the error log while the test is running will stop the test REPRINT CONTROL Is used to print the previous error log ON ERROR the previous end of test summary PREV EOT or the current error log CURR if it exist ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Receiver Screens Receiver Setup and Current Configuration Virtual Front Panel Terminal ST112 TRM of x File Edit Settings Phone Transfers Help RX SETUP i assess Saseseaesserssesss 5 575 SECTION LINE Iq Input CURRENT CONFIGURATION T112 l Iw Optics TRA
278. perly when transporting signal sequences containing both minimum density and a maximum of fifteen consecutive zeros during periods of minimum overall pulse density Valuable for testing AMI circuits the 3 IN 24 pattern is of little use of circuits equipped with B8ZS options for clear channel operation Framing Menu Transmitter Figure 3 30 Framing Menu Transmitter The FRAMING menus illustrated in Figure 3 30 are used to select framing for the DSX 1 VT1 5 and DS3 payloads The TX DS1 FRAME DSX 1 VT1 5 top menu has four possible choices are UNFRM Unframed SF Super Frame ESF Extended Super Frame and SLC96 Subscriber Loop Carrier 96 The TX DS3 FRAME menu offers three choices M13 M1 3 CBIT C BIT UNFRM Unframed Payload Error Alarm Menu Transmitter Press the ERR ALM key located in the light gray transmitter area to display the available payload Error and Alarm menus They are rate and payload dependent The top one on the left and the two center ones illustrated in Figure 3 32 will become accessible when the test set is configured for the OC 12 rate with a 3c payload The top one on the right and the two center ones Figure 3 32 will become accessible when the test set is configured for the OC 12 rate with a 3c payload Other menus some of which are shown in Figure 3 32 will become accessible with other rate and payload configurations or NO MIS RAD Figure 3 31 Payload Error Alarm Menu Transmitter Each S
279. play The transmitter has two output keys one for the electrical selections and one for the optical selections Pressing the key labeled OUTPUT will access the TX ELECTRICAL OUTPUT menu shown at the top of Figure 3 19 Use the arrow keys to move the cursor between the two cross connect transmitter electrical outputs STSX 1 or the DSX 3 The LED in the ENTER key will flash whenever the cursor is moved Press the ENTER key to activate the selection Figure 3 19 Output Menu and Display Pressing the OUTPUT key a second time will display the current configuration shown at the bottom of Figure 3 19 This two line display will change whenever the configuration changes On the top left it indicates that the signal is an electrical STSX 1 rate On the bottom left it indicates that VT1 5 Bit mapping is the selected payload The top right side of the same display shows that the CHAN VT Virtual Transport Channel sub channel selected is number one in this example On the lower right side of the display is the Framing Pattern UFM and the Test Pattern QRW are shown Use this display to see the transmitted configuration at a glance Configuration changes made in the quick setup menus will be displayed whether or not they are electrical Both displays shown in Figure 3 19 TX ELECTRICAL OUTPUT and the Current Configuration are accessed by pressing the OUTPUT key Sometimes when the output key is pressed the configuration display will be first A
280. ple tx_vt_map Response TX_VT_MAP MAP4x7 Note VT1 5 channel numbering mapping can be either sequential MAP1x28 or 4x7 interleaved MAP4x Test Cycle Control Commands test_mode untimed timed repeat Test Mode Set Command Sets the test measurement mode Arguments untimed sets the continuous measurement mode timed sets the timed measurement mode repeat sets the repeat timed measurement mode Example test_mode timed Response NONE Note See the test time test_time set command The timed test runs for the duration of time set by the test_time command The repeat test runs for the duration of time set by the test_time command test_mode Test Mode Query Command Returns the current status of the test measurement mode Example test_mode Response TEST_MODE TIMED Note See the Test Mode Set Command test_print log prev current off Test Print Set Command Used to print or stop printing the test results Arguments log prints the content of the error log prev prints an end of test report at the end of the previous test interval current prints an end of test report from the current test interval off disables report printing Example test_print off Response NONE ST112 SONET Transmission Test Set 7 27 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands test_report log eot both off Test Report Set Command Enable or disa
281. position OC12 Signal Mask Verification This section of the procedure verifies that the output signal matches the standard OC12 mask The CSA803A scope a single mode optical cable an in line 5db optical attenuator an Optical Electrical converter and a 50 ohms bnc cable are needed Leave everything set up as it was in the last section There are six steps in this section of the procedure 1 On the front panel press SETUP until the display shows the SONET Quickset menu 2 Using the INC DEC keys select OC12 3 Using the LEFT RIGHT cursors select DS3 and then press ENTER 4 Compare the signal on the scope screen to the standard OC12 mask Only the scope s vertical adjustment may be moved in order to make the signal fit within the mask Note The CSAS803A oscilloscope contains the standard template in memory 5 Set the vertical adjustment back to the normal position 6 Remove all cables and attenuators from the unit and the scope ST112 SONET Transmission Test Set C 7 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Calibration Verification Test Note For further information regarding the optical standard masks for OCI OC3 and OC12 refer to the Bellcore technical standard GR 253 CORE The masks supported by the CSA803A scope are direct representations of these standard masks You have now successfully completed the verification of the calibration of the ST112 Transce
282. ptical rates OC 1 OC 3 and OC 12 or BIPOLAR Selecting the word BIPOLAR in that menu will return the display the first RX INPUT SELECTION menu that offers three electrical input and access to the OPTIC optical menu Selecting any of the three electrical cross connects from the first RX INPUT SELECTION menu and pressing the enter key will access the RX INPUT TERMINATION menu shown on the lower right side of Figure 3 13 It has two choices TERM Terminate and MONITOR The TERM input terminates the electrical cross connect input signal The MONITOR input configures the appropriate electrical input to accept a low level input from the monitor output of the a network element or a DSX Digital Signal Cross Connect panel ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays The next LCD menu is used to obtain a configuration for the ST112 Test Set receiver The two choices in the AUTOMATIC INPUT MODE menu are used to query and configure the receiver each in its own way e AUTOSEEK searches for the Mapping Pattern and Framing from the incoming input signal and configures the receiver accordingly e AUTOLINK searches for the transmitter s Mapping Pattern and Framing whether or not the receiver has an input and configures the receiver accordingly The next LCD display in Figure 3 13 shows the receiver s configuration
283. r Is Repetitive Alarm ly Error Rate Cycle Im Current Config lu T112 TX Setup l l l Figure 5 19 TX Setup Combined Dual Mode IOPTICS oc48 l l STS CHANNEL 1 I IMAP IN UT BIT FLT MAP UT BIT FLT IDS1 PAT QRW DS1 PAT QRW IDS1 FRM UNFRM DS1 FRM UNFRH I IDSX1 PAT QRW l IDSX1 FRM UNFRM l ISONET ALM OFF l l l l l l l l l l l lI RX AUTOSEEK LINK OFF l l The ST112 SONET Transmission Test Set TX SETUP v menu list has a ST2400 2 4Gb s SDH SONET Test Set TX SETUP v menu the letter v key is used to switch between the them These menus are detailed in the ST2400 2 4Gb s SDH SONET Test Set Manual Summary of Combined Dual Mode Verification The following summaries the steps used to setup and verify of the Combined Dual Mode after the hardware cabling and terminal configuration has been completed 1 Use the Combined Mode ON command to initiate the combined Dual mode 2 Use the V7 00 command to access the VFP 3 Access the ST2400 2 4Gb s SDH SONET Test Set TX SETUP v submenu and activate the OC 48 laser 4 Press CTRL T to access the SETUP menu 5 Access the Quick Setup q menu and select the rate and payload After which all of the errors and alarms should clear except for some residual history indications that should clear when the next test cycle begins 5 16 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www ar
284. r Generation e Truly portable 22 pounds 10 kilograms maximum weight e A simple menu system e Integrates with the ST2400 2 4 Gb s SDH SONET Test Set for complete full rate up to OC 48 SONET analysis e Optical Capability e Intermediate Reach 1310 nm e Long Reach 1550 nm e Direct user download of software updates e GR 253 CORE framing e Complete Remote Control e RS 232 and GPIB ports and standard printer interfaces e VT100 Virtual Front Panel Functions e Remote Command Interpreter e Standard tributary output interfaces e Four DSX 1 electrical e Six DSX 3 or STSX 1 electrical e One OC 1 OC 3 or OC 12 optical ST112 SONET Transmission Test Set 1 3 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Introduction Interface to STE LTE and other test equipment The ST112 SONET Transmission Test Set meets the needs of development network design and service engineers by providing the capabilities for System Interrogation and Conformance Testing Manufacturing Production Testing Network Integrity Testing Network Performance Monitoring Network Troubleshooting Accessories Some accessories are included with the ST112 SONET Transmission Test Set If you wish to purchase optional accessories contact your local Tektronix Representative Standard Accessories User Manual Certificate of Traceable Calibration Front Cover Power Cord Optional Acccessories
285. r terminal is not ready The Test Set pulls this pin high internally with 27 kohms to 12V 6 DTR__ Data Terminal Ready The Test Set always sets this pin high ST112 SONET Transmission Test Set 6 3 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers and Printers Cables Use a straight through modem cable when connecting the Test Set to a DTE data terminal equipment device or a null modem cable when connecting to another DCE device Cables are listed in Chapter 1 Getting Started Quick Test RS 232 C Port You can perform a quick test of the ST112 SONET Transmission Test Set RS 232 C port using a terminal or a PC running terminal emulation software as follows 1 Verify that the Test Set echo mode is on 2 Power off the Test Set 3 Attach the appropriate 9 pin cable from the RS 232 C port to the terminal Terminals and controller should be configured as a DTE and therefore use straight through modem cable 4 Power on the ST112 SONET Transmission Test Set and verify that the following prompt appears on the terminal s display ST112 gt If the above prompt does not appear then one or more of the following problems may exist 1 The cable may be defective 2 The cable could be the wrong cable type Use a straight through modem cable if the terminal is configured as a DTE or a null modem cable if the terminal is DCE configured
286. random on off DS3 Random Error Rate Set Command Randomly generates the DS3 error rate Argument on Turns the DS3 error rate generator on and off randomly off Turns the DS3 error rate generator off Example ds3_bit_random on Response NONE Note The error rate is a negative exponent from 1 0E 9 to 1 5E 3 ds3_bit_random DS3 Random Error Rate Query Command Returns the state of the DS3 Bit error rate random generator Example ds3_bit_random Response DS3_BIT_RANDOM ON 7 56 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands ds3_bpv_rate n DS3 BPV Error Rate Set Command Sets the DS3 BPV Error Rate Example ds3_bpv_rate n Response NONE Note The error rate is a negative exponent from 1 0E 9 to 1 5E 3 ds3_bpv_rate DS3 BPV Error Rate Query Command Returns a character string indicating the current value of the DS3 BPV Error Rate Example ds3_bpv_rate Response DS3_BPV_RATE 3 2E 7 Note The error rate is displayed as a negative exponent from 1 0E 9 to 1 5E 3 ds3_bpv_random on off DS3 BPV Random Error Set Command Randomly generates the DS3 BPV error rate Argument on Turns the DS3 error rate generator on and off randomly off Turns the DS3 error rate generator off Example ds3_bpv_random on Response NONE Note The error rate is a negative exponent from 1 0E 9 to 1 5E 3 ds3_bpv_random DS3 BPV Rand
287. ransport of digital services The span line repeater continues as a major component of the T Carrier network For this reason the majority of tests that have evolved are designed to ensure the performance of them under live traffic conditions Since most network equipment contains regeneration and timing recovery functions similar to those of these repeaters the tests originally developed for them have proven suitable for testing all network equipment The following are Stress Test patterns that can be transmitted e The Daly patterns DALY 1 DALY 2 and DALY 3 is a version of the 55 octet pattern developed by Tom Daly that has been modified to meet pulse density standards when framed on octet boundaries The Daly pattern has been found useful for stressing the timing recovery circuits of line cards and the preamplifier equalizer circuits of repeaters utilizing discrete component ALBOs Automatic Line Build Outs A Daly pattern stresses a circuit by introducing rapid transitions from long sequences of low density octets to high density octets high density octets to low density octets and rapid 1 0 1 0 transitions e The 1 IN 8 pattern containing strings of seven sequential zeros is used on a circuit equipped with B8ZS to determine the ability of a circuit to handle payload signals having a minimum ones density Use of this pattern will often reveal the existence of timing recovery problem under conditions of low signal density e The 2
288. rate Response STX_BPV_RATE 1 0E 6 Note The rate is a negative exponent from 1 0E 9 to 1 5E 3 ST112 SONET Transmission Test Set 7 59 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands stx_bpv_rand on off STSX 1 BPV Random Set Command Turns the STSX 1 BPV error rate generator on or off Argument on generates BPV errors randomly across the STSX 1 frame at the rate set by the stx_bpv_rate command off disables the STSX 1 BPV error generator Example stx_bpv_rand on Response NONE Note See the stx_bpv_rate command stx_bpv_rand STSX 1 BPV Random Query Command Returns a character string indicating the state of the STSX 1 BPV Error Rate Generator Example stx_bpv_rand Response STX_BPV_RAND ON Note See the STSX 1 BPV Random Set Command spe_error SPE Error Set Command Generates a single bit error in the Synchronous Payload Envelope Example spe_error Response NONE Note Bit errors caused by this command result in STS n section line and path BIP 8 code violations because a single bit error is located at random anywhere in the SPE after the section line and path parity has been calculated tx_j1_fill h nn Transmit J1 Trace Set Command Sets the value of the J1 Trace message Fills all 64 bytes with the hexadecimal characters nn Example tx_j1_fill h45 Response NONE Note Any two hexadecimal characters from 00 to FF may be used tx
289. re 5 20 is used to enable the Trouble Scan Mode To run the Trouble Scan function it is necessary to start the test cycle after enabling the mode by typing Ctrl R at the terminal keyboard During the Trouble Scan test cycle payload results normally available from the Test Set displays are inactive Normal payload results will resume when the Trouble Scan Mode is turned off and the test cycle is restarted l Terminal ST112 TRM File Edit Settings Phone Transfers Help RX SETUP hn nnn nn nn nnn nnn nnn nnn n nner nnn nana Iq Input lI TROUBLE SCAN 3C Mapping l Iw Optics 11 CHANNEL STS3 STS1 Numbering l Ir Mapping 11 1 1 NONE 3 1 SCANNINGH l It UT1 5 Channel II 2 l ly UT1 5 DSX1 Cfg Il 3 3 I lu DS3 D X3 Cfg II 2 1 NONE 4 1 NONE l lo SPE Pointer lf 2 2 sae l Ip UT Pointer I 3 3 l Is TOH POH lI l Ig J1 Trace Messge II BUIEW Loe MEOR l Ih APS Bytes 11 CHANNEL DWELL TIME 10 l lj UT Channel Scan I TROUBLE SCAN MODE OFF ON l In Trouble Scan E a Figure 5 20 Receiver Trouble Scan Mode The Trouble Scan display illustrated in Figure 5 20 shows that only the first STS 1 channel in each of the four STS 3 channel groups is being scanned because 3c mapping is being used at the OC 12 rate It also shows that pressing the F4 key on the terminal keyboard will access the error log ST112 SONET Transmission Test Set 5 17 Artisan Technology Group Quality Instrumentation Guarantee
290. receiver should now be linked error free 5 On the transmitter side of the front panel press ERROR until the display shows the Tx OC12 Single Error menu 6 Using the LEFT RIGHT cursors and INC DEC keys select 1 and then press ENTER three times 7 Inthe receiver s STATUS section of the front panel observe that the red LEDs for B1 B2 and B3 flashed three times 8 On the receiver side of the front panel press ERROR until the lefthand side of the display shows SECT on the top line and B1 on the botttom line 9 On the display the value of TOT equals 3 and the value of SECT ES should be equal to or less than three 10 On the receiver side of the front panel under the DCC OW button press ERROR until the top line of the display shows B1 B2 B3 and FEBE ST112 SONET Transmission Test Set B 15 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Incoming Inspection Test 11 On the display the value of B1 equals three However because of the position of the error being injected B1 may equal up to six For the same reason the value of FEBE will be either zero or one and the values of B2 and B3 will be between zero and six 12 Press RUN STOP twice to clear all errors 13 On the transmitter side of the front panel press ALARM until the display shows the Errored Frame menu 14 Using the LEFT RIGHT cursors select CONT and then press ENTER 15 On the receiver
291. results are stored in memory Utilities ST112 SONET Transmission Test Set A 7 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Appendix A Specifications Data Communication Channel Add Drop Interface This connector provides the interface to an external protocol analyzer Add Drop D1 D3 D4 D12 Connector 15 Pin female DIN DTE and DCE V 11 compatible Orderwire Add Drop Interface This connector provides the interface to an external handset i e telephone Add Drop E1 E2 Connector 4 wire handset jack Computer Interface GPIB Standard IEEE 488 socket RS 232 C DB 25 pin female connector used for terminals or serial printer Parallel Printer Connector DB 25 pin female connector ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Appendix A Specifications Table A 2 lists specifications for additional features when the ST112 is equipped with option 03 Table A 2 ST112 Option 03 Optical Specifications OC 1 and OC 3 Characteristic Description Generator Output Optical Output Data Rates OC 1 51 84 Mb s OC 3 155 52 Mb s Signal Level amp Wavelength 1310 nm 9 dBm typical 2 3 dBm Pulse Shape Meets Bellcore GR 253 CORE Eye Pattern Masks Wavelength 1270 to 1330 nm Spectral Width RMS 10 nm Max
292. rint Capture The file capture function prompts for a path and file name before saving the file to disk Saved data files can be reviewed on screen or printed on paper at any time when the data is needed Using the RS 232 C for PC based Printing The VFP VT100 emulator must be off Enter CTRL Q to quit VFP mode if it is active Sequentially push the SETUP key on the Test Set until the REPORT TEST TIME menu is displayed Enter the menu and set up the report as if it was going to be printed on a dedicated printer Rather than select the default parallel printer port however select the RS 232 C port instead With the RS 232 port and your emulator set up as described earlier all reports that normally would go to the printer will be displayed on the screen The scrolling buffer and data capture capabilities provided by your communications software are available for viewing and reviewing the data An example of the on screen printer display is shown in Figure 6 1 below The first part is an ON ERROR report the second part is a SUMMARY report example 1994 04 02 09 56 28 B1 ERR 1994 04 02 09 56 38 B1 ERR 1994 04 02 09 56 39 B1 ERR 1994 04 02 09 56 47 B2 ERR 1994 04 02 09 56 48 B2 ERR 1994 04 02 09 56 49 B3 ERR 1994 04 02 09 56 50 B1 ERR B2 ERR B3 ERR 1994 04 02 09 56 51 B1 ERR B2 ERR B3 ERR START 1994 04 02 09 56 24 RATE STS1 DATA BIPOL CLOCK RECOVER STOP 1994 04 02 09 57 00 PAYLOAD VT1 5 01 B1 ERR B2 ERR B3 ERR B1 ERR COUN
293. s a negative exponent The result is not valid when receiving an OC n optical signal ds _bit_err DS1 DS3 Bit Error Count Query Command Returns the number of Bit Test Pattern errors counted in the selected DS1 or DS3 signal Example ds_bit_err Response DS_BIT_ERR 35 ds_bit_rate DS1 DS3 Bit Error Rate Query Command Returns the rate of Bit Test Pattern errors measured in the selected DS1 or DS3 signal Example ds_bit_rate Response DS_BIT_RATE 3 5E 09 Note The rate is returned as a negative exponent ds_fram_err DS1 DS3 Frame Bit Error Count Query Command Returns the number of Frame Bit errors counted in the selected DS1 or DS3 signal Example ds_fram_err Response DS_FRAM_ERR 12765 ds1_crc6_err DS1 CRC 6 Parity Error Query Command Returns the number of CRC 6 Parity Errors counted in the selected DS1 or DS3 signal Example ds1_crc6_err Response DS1_CRC6_ERR 432 ds1_crc6_rate DS1 CRC 6 Parity Error Rate Query Command Returns the rate of CRC 6 Parity Errors measured in the selected DS1 or DS3 signal Example ds1_crc6_rate Response DS1_CRC6_RATE 1 7E 08 Note The rate is returned as a negative exponent ds3_bit_es DS3 Bit Errored Seconds Query Command Returns the number of test pattern bit errored seconds counted in the selected DS3 signal Example ds3_bit_es Response DS3_BIT_ES 3394 ST112 SONET Transmission Test Set 7 45 Artisan Technology Group Quality Instrumentation Guaranteed 88
294. s been selected in this example Data or voice can be transmitted from a device connected to the rear panel DCC OW connector on the Section or Line DCC or Order Wire channels The DCC Data Communications Channel can be configured for OFF SECTION or LINE Generally e DCC is used to transfer data between NE network elements and ORDERWIRE is used for voice communications e Voice can be transmitter in either the LOCAL or EXPRESS ORDERWIRE channel LOCAL refers to the connection between two adjacent devices such as a regenerator and a NE or two adjacent regenerators and EXPRESS indicates the connection is between to NE with regenerator in between Communications between two Network Elements NE can use either a LOCAL or an EXPRESS connection Timing Transmitter ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel 2 Terminal ST112 TRM File Edit Settings Phone Transfers Help TX SETUP a SS SS SS es Iq Output Optics TX TIMING E I Iw Timing I ETX SONET TIHING l Ir Mapping STS 1 STS 3 BITS LOOP I lo SPE Pointer lI I Ip UT Pointer I TX UT1 5 BITS INPUT TERMINATION I Is Sonet Alarms ll MONITOR l Ig Sonet Error ie I 11 TOH POH i I Iz J1 Trace Messge I I I Figure 4 28 VFP Timing Transmitter Configuration The ST112 SONET Transmission Test Set provides for five TIMING sources det
295. s in Chapters 1 and 2 before applying power to the ST112 SONET Transmission Test Set Before using the ST112 Test Set verify that it is properly set up and powered on as follows 1 Remove the unit from its shipping carton and place it on a hard firm surface 2 Verify that the operating environment is within the limits detailed under the Environmental Requirement section in this manual 3 Allow approximately 2 inches 5 cm clearance for cooling on the top and rear of the unit The two rear panel fans draw air into the ST112 SONET Transmission Test Set which is exhausted through the top vents 4 Wire the unit for a chosen application Never exceed the maximum optical power limits 10 dBm listed on the front panel Always cover the unused OC connectors A CAUTION Signal levels greater than 10 dBm negative 10 dBm may damage the Optical Input devices Always pad the input level to less than 10 dBm 5 Plug the unit into the appropriate AC Power source as follows AC Power Requirements AC Voltage Voltage Range Frequency Range Maximum Power 110 VAC 90 VAC 135 VAC 47 63 Hz 250 Watts 220 VAC 180 VAC 270 VAC 47 63 Hz 250 Watts ST112 SONET Transmission Test Set 2 3 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview Display Display Controls and Indicators Figure 2 2 shows the ST112 SONET Transmission Test Set display and display controls
296. s section will detail the setup and verification of the Combined Dual Mode It includes the following Hardware Setup Combined Dual Mode Remote Commands and VT100 Access Combined Dual Mode Virtual Front Panel Combined Dual Mode Summary of Combined Dual Mode Verification Hardware Setup Combined Dual Mode Tektronix ST112 SONET Transmission Test Set OC 48 NE Figure 5 12 Active Analysis Combined Dual Mode A WARNING Always avoid exposure to the laser beam Before power is applied to the ST2400 2 4 Gb s SDH SONET Test Set be sure that all laser outputs are either covered with the screw cap provided or connected to the appropriate circuit Be sure to read understand and follow all of the Laser Safety instructions in the ST2400 Test Set documentation Figure 5 12 illustrates the front panel cabling connections not the positioning of the equipment Always allow for adequate air flow when installing positioning or mounting equipment ST112 SONET Transmission Test Set 5 11 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Applications and Use The OC 48 hardware setup shown in Figure 5 12 can be used to test and analyze all of the OC 48 sub rates tributaries and payloads In this illustration e The ST112 SONET Transmission Test Set Transmitter output is connected to the ST2400
297. s sse lt seosSesss Iq Output Optics l UT POINTER Iw Timing CURRENT UT POINTER 78 Ir Mapping ISNEW POINTER NDF lo SPE Pointer l Ip UT Pointer POINTER JUSTIFICATIONS Is Sonet Alarms DPL SINGLE PJ 11 TOH POH Iz J1 Trace Messge It UT1 5 Channel ly UT1 5 DSX1 Cfg Ik UT Err Alarms lu DS3 DSxX3 Cfg l l l l 1 1 Ig Sonet Error 1 1 1 1 1 1 l Figure 4 31 VFP VT Pointer Transmitter The VT POINTER p menu is only accessible in the VT mode All 28 VT pointers within the SPE Synchronous Payload Envelopment generated by the Test Set receive the same value 78 in this example The VT pointer value indicates the position of the V5 byte The VT pointer values can be set to any number from 0 to 103 The NDF New Data Flag indicates an arbitrary change in the pointer value due to a change in the payload position Use the arrow keys to move the reverse video cursor to the NEW POINTER NDF number Use the VT100 keyboard to type a different VT pointer number Press the F4 key during the test cycle to execute the change Use the arrow keys to move the cursor to either SINGLE PJ or SINGLE PJ and press the F4 key to change the respective pointer values Changing the pointer value will change the CURRENT VT POINTER number at the top of the display Figure 4 31 4 26 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www art
298. s that 4 or more consecutive frames of the signal have had frame alignment errors detected in the Al or A2 bytes May result from a high sustained error rate or error bursts in the monitored direction e The B1 error indicates that STS n section BIP 8 Bit Interleaved Parity 8 code violations were detected Section BIP 8 is carried in the B1 overhead byte Section code violations indicate an error condition in the monitored section between the monitor point and the next upstream Section Terminating Equipment STE Line Terminating Element LTE or a Regenerator ST112 SONET Transmission Test Set 2 9 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview Line Alarms The Line is a transmission medium between the line signal originating Network Element NE and the line signal terminating Network Element It includes one or more sections the associated regenerators and the required Line Terminating Equipment LTE The ST112 SONET Transmission Test Set has four Line LED indicators as follows The AIS Alarm Indication Signal indicates that bits 6 7 and 8 of the K2 byte have been a binary 111 respectively for five or more consecutive frames This condition indicates or emulates an upstream SONET facility failure The LOP Loss Of Pointer indicates that a New Data Flag NDF or invalid pointer has occurred in eight or more STS n frames The RDI Remote Defect Indic
299. se NONE Note The DS 1 Pattern will mapped into the VT1 5 Payload tx_vt_patt Transmitter VT Pattern Query Command Returns a character string indicating the selected transmitter VT Frame Format Example tx_vt_patt Response TX_VT_PATT PRBS_23 Note For Arguments see tx_vt_patt Tx VT Pattern Set Command ST112 SONET Transmission Test Set 7 35 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands vt_word b1 b2 b3 VT 24 Bit Word Set Command Sets the transmitter DS 1 Pattern Argument All three hexadecimal characters must be submitted at the same time Example vt_word haa h00 hff Response NONE Note The Example shows the 24 bit DS 1 hexadecimal word AAOOFF being inserted vt_word VT 24 Bit Word Query Command Returns a character string indicating the 24 bit Word that was previously set Argument All three hexadecimal characters must be submitted at the same time Example vt_word Response VT_WORD HAA H00 HFF Note The Example shows the 24 bit DS 1 hexadecimal word AAOOFF that had been set 7 36 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands Pointer Commands SPE burst_state Burst State Query Command Returns a character string indicating the STS n SPE pointer burst state Example burst_state Response BURST_STATE RUN
300. seceeceseceaecaecaeecaeeeseeeseensecnaeenaeenseenaes 54 b2_parity B2 Parity Error Set Command 0 c0eccscsevssssgssctsnecnssusnesescndenensesentghschesbietensevsnesdictcvens 54 b3_ parity B3 Parity Error Set Command sinisisi iinei eese Erei is in ia 54 bip2_error VT BIP 2 Parity Error Set Command esesseseseeiseesesrsrsrrrrererressrnstsrsrerernsrsrsersrsrerrens 54 bip2_rate n VT BIP 2 Parity Error Set Command 0 cc ccceccceeseeseceseceseceeecaeeeeeeeeeeneenecsseeeaeenaes 54 bip2_rate VT BIP 2 Error Rate Query Command 0 0 eeeeeeceseeeceeceeeeeceeeceeeenecaeeeecneeereaeeneeaeeas 54 bip2_random on off VT BIP 2 Random Error Rate Set Command 0 0 00 ceeceseeeeeeeeeeeeeeeeeeeees 55 bip2_ random VT BIP 2 Random Error Rate Query Command eeeeeeeseeeceeeeeeeeeereneeeeeeaeenees 55 bpv_error STSX 1 BPV Error Set Command cccccccceeseesseeseceeceseceseceecseecaeeeaeeeaeeeeeeeeeeereeeens 55 dsl bit rate n DS1 Bit Error Rate Set Command 00 eee eeeeeceseeeeeseeeesecaeeetceeeeceaeeeesaeeaeeaeeneees 55 dsl bit rate DS1 Bit Error Rate Query Command eececceccceseesseeseeeeeeeeeeeeeeeeceeeenseceseeneenaeenaes 55 dsl_bit random on off DS1 Random Error Rate Set Command sseeeeeseeeeeeeereeeereerersrrererees 55 dsl_bit_random DS1 Random Error Rate Query Command sssessssessseseresesersersresrsessresesseseesss 56 ST112 SONET Transmission Test Set 7 9 Artisan Technology Group Quality Instrumentation
301. sed through the RS 232 C Port connection gpib_bus GPIB Bus Query Command Returns the current status of the GPIB bus Example gpib_bus Response GPIB_BUS TALK_LISTEN Note The GPIB bus can be off off_bus or on talk_listen This command is only used through the RS 232 C Port connection gpib_bus talk_listen off_bus GPIB Bus Mode Command Sets the GPIB bus mode to on or off Arguments _ talk_listen enables the gpib bus off_bus disables the gpib bus In this mode the gpib bus will not respond to any commands except the GPIB Bus talk_listen from the RS 232 C port Example GPIB Bus off_bus Response None see gpib_bus command Note This command is only used through the RS 232 C Port connection options Options Query Command Returns one or more character strings indicating which options are installed Example options Response OPTIONS OC12 3C 12C Note The response indicates supported testing OC 12 OC 3c and OC 12c print_port Print Port Query Command Returns the current printer port setting Example print_port Response PRINT_PORT PARALLEL Note The default printer port can be set to parallel or serial print_port parallel serial Print Port Select Command Sets the default printer port to parallel or serial Example print_port parallel Response NONE Note directs all printing to the parallel centronics port ST112 SONET Transmission Test Set 7 17 Artisan Technology Group Quality Instrumentation
302. see rx_vt_fram Rx VT Frame Set Command rx_vt_patt prbs_23 prbs_15 qrw word Rx VT Pattern Set Command Sets the receiver DS 1 Pattern Argument prbs_23 228 1 Pseudo Random Bit Stream prbs_15 215 1 Pseudo Random Bit Stream qrw Quasi Random Word word 24 Bit Word Pattern auto configuration Example rx_vt_patt prbs_23 Response NONE Note This Pattern will be use to analyze the VT1 5 Payload DS 1 rx_vt_patt Receiver VT Pattern Query Command Returns a character string indicating the selected receiver VT Frame Format Example rx_vt_patt Response RX_VT_PATT PRBS_23 Note For Arguments see rx_vt_patt Rx VT Pattern Set Command s12c_patt_inv norm invert 12c or 3c Pattern Set Command Sets the polarity of the test pattern in the selected STS 3c or STS 12c Argument norn normal CCITT Standard Pattern invert inverted CCITT Standard Pattern Example 12c_patt_inv invert Response NONE Note These patterns will be use to analyze the STS 3c or STS 12c Payloads 7 32 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands s12c_patt_inv Receiver 12c or 3c Pattern Query Command Returns a character string indicating the selected STS 3c or STS 12c test pattern Example 12c_patt_inv Response 12C_PATT_INV NORM Note For Arguments see the s12c_patt_inv 12c or 3c Pattern Set Command tx_ds3_frm m13 cbit un
303. should not be used until all other tests have been successfully completed Transmission of an all ZEROS pattern through some DS3 equipment may cause DS1 failure if the DS3 equipment is not properly optioned for B8ZS clear channel operation ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel VT Errors Alarms l Terminal ST112 TRM File Edit Settings Phone Transfers Help TX SETUP Iq Output Optics l UT1 5 DSX1 ERROR ALARM Iw Timing 1ZDS1 ALARMS Ir Mapping l AIS RAI lo SPE Pointer Ip UT Pointer Is Sonet Alarms l l l l SINGLE ERROR INJECT l Ig Sonet Error l l l l l l l DS1 11 TOH POH Iz J1 Trace Messge It UT1 5 Channel ly UT1 5 DSX1 Cfg Ik UT Err Alarms lu DS3 DSX3 Cfg I i I DS1 UT BIT ERROR RATE 0E 3 ENABLE ON I I Figure 4 41 VT1 5 DSX 1 Error Alarm The VT1 5 DSX 1 ERROR ALARM menu A is used to inject payload Errors and Alarms before the DS1 is mapped to the VT1 5 STS 1 frame The VT1 5 Channel menu f was used to configure the effected channels The menu has three sections The first is used to enable or disable AIS and RAI alarms AIS is a DS1 or DS3 payload Alarm Indication Signal and RAI is a Remote Alarm Indication signal that shows the detection of a SF SLC 96 or ESF Yellow in a DS1 paylo
304. sing the tx_sts_chan command ST112 SONET Transmission Test Set 7 37 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands rx_spe_ndf Receiver SPE NDF Count Query Command Returns a character string indicating the number of New Data Flag adjustments counted in the received SONET signal Example rx_spe_ndf Response RX_SPE_NDF 1234 Note There is one NDF for each STS 1 Channel received in the SONET signal rx_spe_pntr Receiver SPE Pointer Value Query Command Returns a character string indicating the value of the STS SPE Pointer in the received SONET signal Example rx_spe_pntr Response RX_SPE_PNTR 522 tx_ptr_ndf n Transmitter STS NDF Setup Command Sets the value of the New Data Flag that will become the active transmit STS n SPE pointer value when the next tx_spe_ndf command is executed Example tx_ptr_ndf n n a decimal number from 0 to 782 Response NONE Note See the tx_spe_ndf command tx_ptr_ndf Transmitter STS NDF Setup Query Command Returns a character string indicating the New Data Flag value associated with the tx_ptr_ndf Set Command that will become the STS NDF value when the tx_spe_ndf command is executed Example tx_ptr_ndf Response TX_PTR_NDF 500 Note There is one NDF for each STS 1 Channel received in the SONET signal tx_spe_ndf Transmitter SPE NDF Set Pointer Execute Command Sets the New Data Flag Pointer Value to the value th
305. sion Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Calibration Verification Test 4 On the front panel press SETUP until the display shows the SONET Quickset menu 5 Using the INC DEC keys select OC1 and then press ENTER 6 Compare the signal on the scope screen to the standard OC1 mask Only the scope s vertical adjustment may be moved in order to make the signal fit within the mask Note The CSAS803A oscilloscope contains the standard template in memory 7 Set the vertical adjustment back to the normal position OC3 Signal Mask Verification This section of the procedure verifies that the output signal matches the standard OC3 mask The CSA803A scope a single mode optical cable an in line 5db optical attenuator an Optical Electrical converter and a 50 ohms bnc cable are needed Leave everything set up as it was in the last section There are five steps in this section of the procedure 1 On the front panel press SETUP until the display shows the SONET Quickset menu Using the INC DEC keys select OC3 Using the LEFT RIGHT cursors select DS3 and then press ENTER Be ob Compare the signal on the scope screen to the standard OC3 mask Only the scope s vertical adjustment may be moved in order to make the signal fit within the mask Note The CSA803A oscilloscope contains the standard template in memory 5 Set the vertical adjustment back to the normal
306. sion Test Set 6 11 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers and Printers Table 6 7 SESR Bit Definitions 7 MSB 0 LSB URQ User Request Not used CME Command Error Set to one when a command header mnemonic has been received that is not recognized or is invalid EXE Execution Error Set to one when an error has occurred while the instrument was responding to a set command or query May indicate a parameter is out of range b command uses too many or too few parameters or c command cannot be properly executed due to the instrument s current state DDE Device Dependent Error Set to one if input data has been lost at the interface corrupted characters or the input buffer has overflowed because a command exceeded the 80 character limit without a terminator QYE Query Error Set to one if a an attempt has been made to query the output queue when there are no messages available or pending b a command is received but the output queue is not empty or c an attempt has been made to query the output queue when an unterminated command is in the input queue RQC Request Control Not used OPC Operation Complete Set to one after a OPC command is received Event Status Enable Register The Event Status Enable Register ESER is the enable register associated with the SESR status register Each enable bit in the ESER occ
307. smission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays e The ST2400 COM LINK is the last of the nine setup menus Pressing the setup key will loop back to the QUICK SETUP starting menu Moving the cursor to OPEN and pressing the enter key will enable the communication link between the ST112 Test Set and the ST2400 2 4Gb s SDH SONET Test Set expanded its capabilities to OC 48 testing This Combined Dual Mode function is detailed in the Applications Chapter of this manual Report Test Time Menu System The REPORT TEST TIME main menu is used to access seven submenus that are used to configure the measurement control test time and report setup Pressing the enter key will access the MEASURE CONTROL menu e The MEASURE CONTROL menu sets the test cycle to be used when the run key is pressed UNTIMED will run until the stop key is pressed TIMED will run the test for the duration of time set in the TEST TIME menu REPEAT will run the test for the duration of time set in the TEST TIME menu then start the test again The stop key can stop any test that is running e Next is the TEST TIME menu used to set the test run duration in terms of days D hours HH minutes MM and seconds SS The maximum time supported is 9 days 23 hours 59 minutes and 59 seconds Press the enter key to store any changes and the setup key to move to the next menu e Ne
308. st l ais configures alarm burst generator for AIS alm count 100 sets alarm burst length to 100 STS n frames alm_enab_burst generates one AIS alarm burst ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands Table Of Commands GENERAL COMMANDS 22 ccccceeeeseeeeesneeeeeeeeeeeeeeeeeeeaeeseneeeeeeeeeeeneeseneeeeeeees 12 header on off Header Mode Set Command ccececcecsccesecesecssecseeeseeeneeeeeeeeeeeenaeenseenecneenaeenaes 12 header Header Mode Query Command cccccesecssesssesseeeseeeeceeeceseceaeceaecaecaaecaeecseseseseeeseeenereenaees 12 logo Logo Query Command sssrin n Er E E EEEE E a ES 12 idn Identify epn tE EEEE E EEEE EEEE EEN EEEE EEE EEES EAE EEEE EEY 12 lrn Leari Query Command 0 33 eens iin E E E R RE E E R E R RRG 12 wal Wait Command seresa E E EA 13 STANDARD REGISTER COMMANDS ccccccceeeeeeeeeeeeeeeeeeeeeeeeeeeeneeeeeeeeeeeees 13 cls Clear Status Register Command oiiec s cccccseccececeesseicasdstivesscsceeen tee ceace aE tucks T in i 13 ese n Event Status Enable Register Set Command ccccesccssecseeeseceseceeeeeeeeeeeeeceeeseeeeseeeeenaees 13 ese Event Status Enable Register Query Command 0 ccccececsseesseesceeeceeeceeeensecnseceaeenaecneeeaeenaes 13 esr Event Status Register Query Command ccceeccesecesecseeceeeseeeseeseeneceseseeeeeeeseeeae
309. st section There are thirty steps in this section of the procedure 1 On the front panel press SETUP until the display shows the Quick DSX Setup menu 2 Using the LEFT RIGHT cursors select DSX3 and then press ENTER 3 Press RUN STOP twice to clear all errors 4 The transmitter and receiver sides should now be linked error free 5 On the transmitter side of the front panel under the DS3 VT1 5 STS3C 12C heading press ERR ALM until the display shows the Single Error menu 6 Using the LEFT RIGHT cursors select DS3 and press ENTER three times 7 Inthe receiver s STATUS section of the front panel under the PAYLOAD DS1 DS3 heading observe that the red LEDs for PAR and BIT flashed three times Also in the receiver section of the display observe that DS3 equals three 8 On the receiver side of the front panel under the DS3 VT1 5 STS3C 12C heading press ERROR until the lefthand side of the display shows DS3 on the top line and PAR on the bottom line 9 On the display the value of TOT should equal three and the value of DS3 ES should be equal to or less than three 10 On the receiver side of the front panel under the DS3 VT1 5 STS3C 12C heading press ERROR until the lefthand side of the display shows DS3 on the top line and BIT on the bottom line 11 On the display the value of TOT should equal three and the value of DS3 ES should be equal to or less than three 12 On the receiver side of the front panel under the
310. stecuaneeesehcosceeenusesaete cajueveteesseatuatenseveee 3 12 DCC Orderwire Menus ccccccessecessscesececsseceeececsaeceeeeecsaeceeeecsseceeeeeceaeceeeessaeeeeeeess 3 12 Error Measurement DisplayS cccccesccesecsseeseeeseeeeceeeceecnsecesecaecsecaeecaeecaeeeseeneeeneeeas 3 13 Optical Input Select Menu ceccesecssesseesseeseceerceeceseceaeeaecsaecseecseeeseeeeeserseseeeseseneeas 3 14 DS VT STS 3c and 12c Menus RX csccsscsssssssssssssssesscssscssecssccescssecsssseseseaseessenses 3 16 Pattern Menus and Displays ceceeecsssessseseceeeeeceeeeceaeceeesecaeeseceeveneeaeeeeaecateaeeaeeates 3 16 Fraing yess cccesies eccscireccst e R ERE E R ENEE R RR RRE 3 17 Paylodd Error Display cc c csesussatcotetecpsssccsnpsansoteecestosnsentacsssencasasedotetuensiassesosesdiacaseas 3 17 Transmitter Menus amp Displays scsscsscsssssscsssseesssesseesssessessssssssesssessseesseessessoees 3 19 Output Menu amp Display eeeeescseeecsseeeeeseceeeeeceeeecsaeceessecaeeeecneveeeaeeeeeaesaeeeeeneeares 3 19 Optical Output Menu Displays eccecccsseesceesceseceeeceeeceseceeeceecseecaeeeeeeeeecaeeeseeeeeeereeas 3 19 Overhead Menus c ccccsccesssccssscesseecessseeseecseceeesecseceeeecsaeceeeeecsaeeeeeeecsaeceeeessaeeeeeeess 3 20 Mapping Menus cccccsseesseesceesceesceecesecaecsaecseecaeecseesseeeeeeeceaecnaecaaecaeecaeeeseeneeeseees 3 21 TIMIN G eere eee Eea SEE EEE EEEE EAR EEA EEEE EEEE EEEN NEEE EEE
311. storical data is available CUR Current Indicates that the LED is on sect_b1 Section B1 Query Command Returns the current state of the Section B1 Indicator Clear History or Current Example sect_b1 Response SECT_B1 CUR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on sect_lof Section LOF Query Command Returns the current state of the Section LOF Indicator Clear History or Current Example sect_lof Response SECT_LOF CLEAR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on sect_los Section LOS Query Command Returns the current state of the Section LOS Indicator Clear History or Current Example sect_los Response SECT_LOS HIST Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on 7 52 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands sts_oof STS 1 OOF Query Command Returns the current state of the STS 1 OOF Indicator Clear History or Current Example sts_oof Response
312. t operate with suspected failures If you suspect there is damage to this product have it inspected by qualified service personnel ST112 SONET Test Set User Manual ix Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Safety Summary Safety Terms and Symbols Terms in this manual These terms may appear in this manual Icon Label Meaning WARNING Warning statements identify conditions or practices that could AN result in injury or loss of life CAUTION Caution statements identify conditions or practices that could result AN in damage to this produce or other property DANGER indicates an injury hazard immediately accessible as you read the marking WARNING indicates an injury hazard not immediately accessible as you read the marking CAUTION indicates a hazard to property including the product Symbols on the Product The following symbols may appear on the product 7 A oO DANGER Protective Ground ATTENTION Double Insulated High Voltage Earth Terminal Refer to Manual Certifications and Compliances CSA Certified Power Cords CSA Certification includes the products and power cords appropriate for use in the North American power network All other power cords supplied are approved for the country of use X ST112 SONET Test Set User Manual Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Preface Prefac
313. t_state Test State Query Command Returns the current status of the test cycle Example test_state Response TEST_STATE ON Note The test cycle can be either on running or off When the test state stop the pause run resume sequence can be used to save the current data and history test_time d hh mmi ss Test Time Set Command Sets the duration of the test cycle in days d hours hh minutes mm and seconds ss Example test_time 0 02 00 00 Response NONE Note The Argument must be enclosed in quotation marks One hyphen and two colons must be used as shown in the example Maximum Test Time 9 days 23 hours 59 minutes 59 seconds test_time Test State Query Command Returns a character string indicating the current test time settings Example test_time Response TEST_TIME 0 02 00 00 pause_state pause resume Pause State Set Command Sets the test state to either pause or resume Arguments pause interrupts the test cycle resume restarts the test cycle Example pause_state pause Response NONE Note See test_state command pause_state Pause State Query Command Returns the current status of the test cycle Example pause_state Response PAUSE_STATE PAUSE Note The PAUSE cycle can be either on running or off When the test state stop the pause run resume sequence can be used to save the current data and history print_string s Print String Command Prints the string s out the
314. ta or history is saved A stopped test can be restarted using the pause run resume sequence saving stored history data In other words when the test cycle has been stopped pressing the PAUSE RESUME key will change the test mode from stopped to pause Then the RUN STOP key is pressed to restart the test in the paused state Next the PAUSE RESUME key is pressed restarting the test cycle without loss of the previous test data RUN STOP PAUSE lo RESUME Figure 2 9 Measurement Controls and Indicators Remote Indicators Figure 2 10 shows the two GPIB front panel LED status indicators The Remote Operation REM LED indicates that the Test Set is being controlled through its GPIB connection The REM LED is off when the unit is in the local mode In the Local Lockout LLO mode the ST112 SONET Transmission Test Set front panel is disabled by a remote controller that is using GPIB access commands Front panel control can only be restored by the appropriate GPIB command or by a power initialization cycle Power initialization should only be used when the Test Set is not being remotely operated GPIB LLO REM Figure 2 10 Communication Indicators ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Functional Overview Rear Panel Description Rear Panel Connectors Figure 2 11 shows the ST112 SONET Transmission Test Set rear panel connectors
315. tal error count and bit error rate can be obtained by pressing the receiver payload ERROR key ERR ALM Key v Figure 3 32 DSX 3 Error Alarm Menu Transmitter Figure 3 32 shows the Error Alarm LCD menus that will be displayed when the test set is configured for DSX 3 cross connect each functions as follows e This SINGLE ERR menu is used to inject one single bit error into the DS3 payload by positioning the cursor around the DS3 on the second line of the display and pressing the enter key The left side of the top line provides the display name but the right side indicates the number of DS3 bit errors received during the test cycle 42 in this example This same menu is used to inject a single bit error into the DS1 when a DSX 1 cross connect signal is configured The DSX 3 or DSX 1 electrical signals will be transmitted from the designated front panel connectors e DS1 VT BIT ERROR RATE menu is used to set the rate that will be used during the test cycle Use the left and right arrow keys and the enter key to set the error rate from 1 0E 9 to 1 5E 3 An ERROR RATE OUT OF RANGE message will be displayed when the enter key is pressed for any out of range setting and the nearest valid setting will be forced 3 28 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com LCD Menus and Displays e DS3 BIT ERROR RATE menu is used to set the rate that
316. ter designated by Tektronix with shipping charges prepaid Tektronix shall pay for the return of the product to Customer if the shipment is to a location within the country in which Tektronix service center is located Customer shall be responsible for paying all shipping charges duties taxes and any other charges for products returned to any other locations This warranty shall not apply to any defect failure or damage caused by improper use or improper or inadequate maintenance and care Tektronix shall not be obligated to furnish service under warranty a to repair damage resulting from attempts by personnel other than Tektronix representatives to install repair or service the product b to repair damage resulting from improper user or connection to incompatible equipment or c to service a product that has been modified or integrated with other products when the effect of such modification or integration increases the time or difficulty of servicing the product THIS WARRANTY IS GIVEN BY TEKTRONIX WITH RESPECT TO THIS PRODUCT IN LIEU OF ANY OTHER WARRANTIES EXPRESSED OR IMPLIED TEKTRONIX AND ITS VENDORS DISCLAIM ANY IMPLIED WARRANTIES OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE TEKTRONIX RESPONSIBILITY TO REPAIR OR REPLACE DEFECTIVE PRODUCTS IS THE SOLE AND EXCLUSIVE REMEDY PROVIDED TO THE CUSTOMER FOR BREACH OF THIS WARRANTY TEKTRONIX AND ITS VENDORS WILL NOT BE LIABLE FOR ANY INDIRECT SPECIAL INCIDENTAL OR CONSEQUENTIAL
317. tes that the LED is off and historical data is available CUR Current Indicates that the LED is on ds_lof DS1 LOF Query Command Returns the current state of the PAYLOAD DS1 DS3 LOF indicator Clear History or Current Example ds_lof Response DS_LOF CUR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on 7 48 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands ds_sync DS1 SYNC Query Command Returns the current state of the PAYLOAD DS1 DS3 SYNC indicator Clear History or Current Example ds_sync Response DS_SYNC CLEAR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on ds1_ yellow DS1 YEL DS3 Query Command Returns the current state of the PAYLOAD DS1 DS3 RAI indicator Clear History or Current Example ds1_yellow Response DS1_YELLOW HIST Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on ds3_bit_sta DS3 BIT Indicator Query Command Returns the current state of the PAYLOAD DS1 DS3 B
318. th AIS Query Command seriinin iE nET ENEEK 51 path b3 Path B3 Query Command nemenenerennei i R R RS 51 path _febe Path FEBE Query Command ispsisssissiiririserrsissishicsepreaniisssitasearriersndakeienseaiaiani chaines ts 51 path_yel Path Yellow Query Command cccecccesccessceseceseceecseecaeeeseceeeeeeseeensecnseenaeenseeneeeaeenaes 52 pyld_los Payload LOS Query Command 0 0 0 ceececeeeseeeceseeeeesecseesecevereeaeseeeaecaeseeenaeereaeeneeaeeas 52 sect_bl Section B1 Query Command v ir i REEE eE Esi 52 sect_lof Section LOF Query Command ssssssssesseneeeseeesssteessrstrserrtstrstnrtssteessrernsstntesreserstesreneno 52 sect_los Section LOS Query Command sss sessessesseeseeessseeeessesesrestesesstertssesessrenesstsesreseeseeseeseso 52 sts_oof STS 1 OOF Query Command ce esesesesesesesceeeceseceneeeseesnesaseceseecaseneceeesnsneseneasenseaesas 53 vt_ais VT Path AIS Query Command peresis eiiiai E cae A dates 53 vt_bip2_ stat VT Path BIT 2 Query Command 00 cc eeceeeeeceseeeeseeeeeeceeeceaeceeesecaeeeesnereesaeeneeaeeates 53 vt_febe VT Path FEBE Query Command ccccccecsseessessceescesecesecnecseecaeeeaeeseeseeeeeeenseeeeeneenaeenaes 53 vt_ yellow VT Path Yellow RDI Query Command 0 eceeeeceeesceeeeeeeceeeeeceeerceaeeneeaeeateaeeaeeas 53 TRANSMITTER ERROR COMMANDS ccccceseeeeeeeeeeeeeeeeeeeeeeenneeeeeeeeeeeeeeeeaes 54 bl_ parity B1 Parity Error Set Command ccccecccesecssesesceeece
319. the Path B3 indicator Clear History or Current Example path_b3 Response PATH_B3 HIST Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on path_febe Path FEBE Query Command Returns the current state of the Path FEBE indicator Clear History or Current Example path_febe Response PATH_FEBE CUR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on ST112 SONET Transmission Test Set 7 51 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands path_yel Path Yellow Query Command Returns the current state of the Path Yellow indicator Clear History or Current Example path_yel Response PATH_YEL CLEAR Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and historical data is available CUR Current Indicates that the LED is on pyld_los Payload LOS Query Command Returns the current state of the Payload LOS Indicator Clear History or Current Example pyld_los Response PYLD_LOS HIST Note CLEAR Indicates that the LED is off and no history is available HIST History Indicates that the LED is off and hi
320. the coax cables to channel 1 of the scope Tip Connect the other coax cable to channel 2 of the scope Ring On the front panel press SETUP until the display shows the DSX1 Line Code menu Using the LEFT RIGHT cursors select AMI and then press ENTER On the transmitter side of the front panel under the DS3 VT1 5 STS3c 12c heading press PATTERN until the display shows the TX Stress Pattern DSX1 menu On the front panel press ENTER 8 On the transmitter side of the front panel under the DS3 VT1 5 STS3c 12c heading press PATTERN until the bottom line of the display shows 1 8 9 On the front panel press ENTER ak a p Sad 10 Invert one of the scope channels and then add them This gives the balanced signal needed 11 Setting the signal around the center of the scope measure the amplitude of the signal Note The amplitude of the signal is the peak to peak value The amplitude of the DS1 signal should be 6 Vpp 400mV 12 Compare the signal on the screen to the standard DS1 mask Only the scope s vertical adjustment may be moved in order to make the signal fit within the mask Note The CSAS803A oscilloscope contains the standard template in memory 13 Set the vertical adjustment back to its normal position 14 Remove the special cable from the transmitter and the scope DS3 Frequency and Signal Mask Verifications This section of the procedure verifies that the frequency is within the proper tolerance a
321. the instrument should be terminated by a simple carriage return CR Responses generated by the instrument will be terminated as specified in the RS 232 End of Line setup menu for carriage return and line feed functions CR LF CR LF or LF CR e GPIB Interface Command lines issued to the instrument can be terminated by either EOI End Or Identify or EOI LF Responses generated by the instrument will be terminated as specified in the GPIB setup menu for End Or Identify and Line Feed functions EOI or EOJ LF ST112 SONET Transmission Test Set 733 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands 7 4 Command Examples The following is a brief example of an interactive remote session that does the following 1 2 3 4 Generates a random bit error rate of 1 x 10 6 Enables the Loss Of Signal LOS to occur for 135 micro seconds Sets the Line AIS Indication Signal to Burst and enables that Alarm output Sets the SPE Pointer set during the LOP test to burst with the Pointer value set to 522 Example interactive session parity_rate 6 sets error generator rate 1 x10 6 parity_rate queries error generator rate setup PARITY RATE 6 response error_rate on turns error generator on error_rate queries state of error generator ERROR RATE ON response los time 135e 06 sets LOS generator time to 135 Us los_enab causes one LOS event alm bur
322. tion of the Test Set commands Most remote commands are the same for both the GPIB and RS 232 C ports ANSI IEEE 488 2 Programming Manual Requirements This section explains how the ST112 SONET Transmission Test Set implements certain standard GPIB functions as required by ANSI IEEE Std 488 2 1987 Power On Settings When powered on the ST112 SONET Transmission Test Set will automatically restore all device settings to their last powered settings No remote commands will affect this power on tule However if the instrument detects a problem in non volatile battery backed RAM at power up then factory default settings will be restored rather than the last powered settings A RAM problem at power up will be indicated in the LCD display by the message RAM Corruption 6 8 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com External Controllers and Printers Message Exchange The GPIB message exchange characteristics are as follows The input buffer is command line oriented A new buffer is provided for each new command line Each command line may contain a maximum of 80 characters The only ST112 SONET Transmission Test Set commands that can return more than one message unit are lrn oh_all oh_err_all Command responses are generated immediately The Test Set will not wait for a read command before generating a response to a query command
323. tisantg com Applications and Use Trouble Scan Basics The ST112 SONET Transmission Test Set Receiver can be used to scan and analyze SONET STS signals in a hierarchical manner with a variety of rates and payload mappings The Trouble Scan n mode will provide a report of section line and path errors and alarms that occur during the user selected dwell time Trouble Scan can only examine relevant STS information The ST112 SONET Transmission Test Set Trouble Scan Mode supports the STS 1 OC 1 OC 3 and OC 12 rates with DS3 VT1 5 OC 3c and OC 12c payload mapping The Test Set can be used with the ST2400 2 4Gb s SDH SONET Test Set to run Trouble Scan at the OC 48 rate with DS3 VT1 5 OC 3c and OC 12c payload mapping detailed later in this chapter The Trouble Scan Mode has two types of logs The Dwell Period Event Log records section line path and a summary of the events that were detected The Detailed Event Log records errors and alarms with date stamped Both event logs can be printed out or displayed on a terminal All of the errors and alarms are detailed in the Receiver Status Indicators section of Chapter 2 When the Trouble Scan Mode is set to ON it takes over complete command of the Test Set all other Test Set receiver features are not available After starting Trouble Scan the test will run continuously or stop automatically at the end of the time that was set in the Timed Test menu The Virtual Front Panel VFP menu n Figu
324. trated in Figure 4 2 and throughout the next section If your display looks different type CTRL Q to quit and try the other command ST112 SONET Transmission Test Set 4 3 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel Screen Displays All of the screens illustrated in this chapter are shown as either full 24 lines by 80 column screens or partial screen that focus on the individual example All are intended to illustrate current samples and provide simplified explanations Some minor differences in location size and shape may occur Setup and Current Configuration Screen l Terminal ST112 TRM lel Es File Edit Settings Phone Transfers Help SETUP ie i a a E SECTION LINE E Iq Quick Setup I CURRENT CONFIGURATION T112 l lw Time 1 TRANSMITTER RECEIVER l LOS AIS l Ir DSX Line Code IOUTPUT STSX1 INPUT OPTIC LOF LOP It Store Recall IOPTICS oci2 I OOF RDI ly Timed Test l STS CHANNEL 1 B1 B2 lu Report Printing IMAP INT STS12C MAP STS12C l l l l l l Im Current Cfg 112C PAT 2E23 12C PAT 2E23 l l l l l l l I l l l l I PATH UT PATH l l I l l le I I I I I I I I I I II AIS AIS I I IDSX1 PAT DALY 1 I1 RDI RDI I IDSX1 FRM UNFRM 11 FEBE FEBE I ISONET ALM OFF 11 B3 BIP 2 I I I LOP 1 I t I PAYLOAD
325. upies the same bit position as the corresponding status bit in the SESR Status Byte Register The Status Byte Register SBR indicates the overall status of the instrument and is used to control the SRQ line on the GPIB bus The name of each defined bit in the SBR is shown in Table 6 8 The function of each defined bit in the SBR is described in Table 6 9 Table 6 8 Status Byte Register SBR Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com 7 6 5 4 3 2 1 MSS ESB MAV p ST112 SONET Transmission Test Set External Controllers and Printers Table 6 9 Status Syte Register Bit Definitions 7 MSB T defined MSS Master Status Summary This bit summarizes the state of the three other bits in the SBR Itis set to 0 if all other bits are 0 It will be set to 1 when any other bit in the SBR equals 1 and its corresponding bit in the SRER is set to one The status of the MSS bit is reevaluated each time a bit in the SBR or the Service Request Enable Register SRER changes ESB Event Status Bit This bit summarizes the Standard Event Status Register SESR It is set to 0 if all bits in the SESR are 0 It is set to 1 if any enabled bit in the SESR equals 1 If the ESB is enabled and set to 1 then the RQS and MSS bits will be set to 1 The status of the ESB bit is reevaluated each time one of the bits in the SESR or the Event Status Enable Register ESER changes Po
326. uration Example dsx1_code Response DSX1_CODE AMI Note The DSX 1 Code can be either AMI or b8zs see DSX 1 Code Configuration edit_setup n s Edit Setup Label Set Command Assigns a label s to the saved setup n Augment n is the setup number from 0 to 9 in decimal s is the string of Example edit_setup 7 OC 12 Test Response NONE Note Up to 10 ASCII characters can be saved with each of the 10 setups The string must be enclosed in quotation marks Only upper case ASCII characters A to Z and numbers 0 to 9 can be used along with the following ASCII symbols amp edit_setup n Edit Setup Label Query Command Returns the current label assigned to the n setup saved in memory Example edit_setup n n a decimal integer between 0 and 9 Response EDIT_SETUP OC 12 TEST Note Up to 10 ASCII characters can be saved with each of the 10 setups gpib_address GPIB Address Query Command Returns the current address value Example gpib_address Response GPIB_ADDRESS 15 Note This command is only used through the RS 232 C Port connection 7 16 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands gpib_address n GPIB Address Set Command Sets the value of the GPIB Port address Example gpib_address n n a decimal integer from 0 to 15 Response NONE Note This command is only u
327. ve status on off or history 4 4 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Virtual Front Panel Receiver Error Summary data is shown in the center of the display Figure 4 2 below the Current Configuration Listed are the error totals for B1 B2 B3 and the Payload Bit Error Count and Rate BER NOTE Bit Error Rates are displayed as a negative exponent An error rate of 1 0E 6 would equate to the decimal number derived from receiving one errored bit in a million bits In other words one divided by one million would equal 0 000001 or 1 0E 6 decimal Along the bottom are the function and control keys and a message and status display area Function and Control Keys VFP Along the bottom of the display shown in Figure 4 2 are the function and control keys Three function keys and one control key are used to access four VFP screens TX SETUP F1 RX SETUP F2 RESULTS F3 SETUP CTRL T These four menus will be detailed under their appropriate headings in this chapter Two additional control keys are used as switches The CTRL R will run and stop receiver test cycles and CTRL P will pause and resume them Starting a test cycle will erase all previously collected data Stopping or pausing a test cycle will not affect the stored data When CTRL R is used to start the test the following message may be displayed across the bottom of th
328. vel 3 12c concatenated STS 12 Synchronous Transport Signal Level 12 Example rx_map 12c Response NONE rx_map Receive Mapping Mode Query Command Returns a character string indicating the current Receiver Payload Mapping Example rx_map Response RX_MAP 12C Note Receiver Mapping can be DS3 BIT_FL BYTE_FL 3c or 12c see Rx Mapping Mode Set Command rx_ocn oc1 oc3 0c12 Receiver Optical Rate Set Command Sets the Receiver Optical Rate Argument oc1 optical carrier level 1 51 84 Mb s oc3 optical carrier level 3 155 52 Mb s 0c12 optical carrier level 12 622 08 Mb s Example rx_ocn 0c12 Response NONE Note see Optical Output opt_output and Tx OC n rate tx_ocn commands rx_ocn Receiver Optical Rate Query Command Returns a character string indicating the current Receiver Optical Rate Example rx_ocn Response RX_MAP 0C12 Note Receiver optical rate can be OC 1 OC 3 or OC 12 see Receiver Optical Rate Set Command rx_owire local express Receive Order Wire Set Command Selects the Order Wire to be dropped from the received STS n signal to the rear panel Port Argument local drops the Section Order wire Channel byte E1 express drops the Line Order wire Channel byte E2 Example rx_owire local Response NONE Note The rear panel port is labeled ORDER WIRE ST112 SONET Transmission Test Set 7 21 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www art
329. verload To avoid electric shock or fire hazard do not apply a voltage to a terminal that is outside the range specified for that terminal Ground the product This product is grounded through the grounding conductor of the power cord To avoid electric shock the grounding conductor must be connected to earth ground Before making connections to the input or output terminals of the product ensure that the product is properly grounded Do not operate without covers To avoid electric shock or fire hazard do not operate this product with covers or panels removed Use Proper Fuse To avoid fire hazard use only the fuse type and rating specified for this product Do not operate in Wet Damp Conditions To avoid electric shock do not operate this product in wet or damp conditions ST112 SONET Test Set User Manual viii Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Safety Summary Do not operate in Explosive Atmosphere To avoid injury or fire hazard do not operate this product in an explosive atmosphere Wear Eye Protection To avoid eye injury wear eye protections if there is a possibility of exposure to high intensity rays Product Damage Precautions Use Proper Power Source Do not operate this product from a power source that applies more than the voltage specified Provide Proper Ventilation To prevent product overheating provide proper ventilation Do no
330. vt_pntr Transmitter VT NDF Pointer Query Command cceeeseeceseeeeceecneeeeceaeeneeaeeateaeeneees 40 tx_vt_sing pos neg VT Single Step Pointer Set Command ccecceecceseeeceeeceeeeeeenseeneeeeeenes 40 vt_pos_pj Receiver VT PJ Query Command 0 ccccceeseeecceseeesecssecseecaeeeseeeeeeeeesereeeeeseeeaeenneeeaes 40 vt_neg pj Receiver VT PJ Query Command cccecccescceseceecseeceeeeseeeseeeeeseeeeseenseenaeenseenaeenaeenes 40 RECEIVER OVERHEAD QUERY COMMANDS cc eseseeceeeeeeeeeeeeeeeeeeeeeeees 41 rx_aps_byte Receiver APS Bytes Query Command cccccecsesscesseeseceeceseceseceecaeeeneeeeeenseeereees 41 rx_jl_trace Receive J1 Trace Query Command ccecccecccesecsceeseeeseeeeeeeeeeeeesecnseensecnseeneeeneeenes 41 rx_oh all Receive Overhead All Query Commmand ceececeeccsseseceteceeeeecneeeeceereeeeaeeeeeaecaeeeeeneeaees 41 rx_oh byte s Receive Overhead Byte Query Command sssseseseessssesssrsersresersrssrrsessreeessesees 42 rx_oh offset n Receive Overhead Offset Query Command ssssssnessssessrsreeessrsersrrsresresenrsssreerses 42 RECEIVER MEASUREMENT COMMAND cccccccceeeeeeeeeeeeeeeeeeeeeeeeeeneeeeees 43 bl_ber B1 Error Rate Query Command ceeeseesecseseeeneeeeceseeeessecseesecaeesaeceeesecaeeaecevereaeeeeeaeentes 43 bl _err B1 Error Count Query Command cccceseeseeeseeeeceseeeeeseeeeesecaeeaeceessesaeeseceeveneaeeeeeaeeaees 43 bl
331. will be used during the test cycle Use the left and right arrow keys and the enter key to set the error rate from 1 0E 9 to 1 5E 3 An ERROR RATE OUT OF RANGE message will be displayed when the enter key is pressed for any out of range setting and the nearest valid setting will be forced e DSX 3 BPV ERROR RATE menu is used to set the rate that will be used during the test cycle Use the left and right arrow keys and the enter key to set the error rate from 1 0E 9 to 1 5E 3 An ERROR RATE OUT OF RANGE message will be displayed when the enter key is pressed for any out of range setting and the nearest valid setting will be forced e DSX 3 SINGLE menu is used to inject one single Bipolar Violation each time the enter key is pressed during the test cycle The left side of the top line provides the display name but the right side indicates the number of BPV errors received during the test cycle The 07 asterisk zero seven in this example shows that the number 7 is invalid because the three digit counter has rolled over at least one time Restarting the test cycle will clear the counter e DS3 ALARMS menu is used to inject one of three payload alarms YELLOW AIS or IDLE e YELLOW is generated by setting the x bits to zero e AIS the Alarm Indication Signal generates a framed 1010 sequence in the DS3 payload e IDLE generates a framed 1100 sequence in the DS3 payload e DS3 PATH ALARMS PARITY is used to inject a burst of parity errors Th
332. x_ signal stsx1 dsx3 dsx1 optic Rx Signal Set Command eee eeceeecceeeeceeeeeeeeeeeeeneees 22 rx_ signal Receiver Signal Query Command ceeeessesssceeeeeceseeeceseceeesecseesecaveeseaeeeseessaeeneeaeeates 22 rx_sts chan n Receiver STS 1 Channel Set Command 0 0 ceceessseseeeseceeeeeceeeeeceaeeeeesecaeeaeeaeens 22 rx_sts_chan Receive STS 1 Channel Query Command ccesecseeeseeeeeceeeeecnseeeverenaeeeeeaeeneeaeeas 22 rx_vt_chan n Receiver VT Channel Set Command eseseseseeeieesssssrstererssstsrsterrststssesrsreeeesesss 22 rx_vt_chan Receive VT Channel Query Command ceceeceseeceeseeseeeeceeeeeceaeeeceaecaeeseeaeeaeeneeas 23 rx_vt_map map1x28 map4x7 Receiver VT Mapping Set Command s seeseeeeeeeeeersereerererree 23 rx_vt_map Receive VT Mapping Query Command ccecsecceseecsseseceeceeeeeeneeeecaeeneeaeeateaeeneees 23 TRANSMITTER SETUP AND MODE COMMANDS cceeeeeeeeeeeeeeeeeeeeeeeeees 24 opt_output on off Optical Output Set Command 00 eee ceceeceseeeeeeeeeseceeeeeceeerceaeeeesseeaeeeeeneees 24 opt_output Optical Output Query Command cecescesessseeseeeseeeseeeeceeeeeeeeeseceseceaeenaeesaecaeeaeeeaes 24 sts_sync sts1 sts3 async bits loop Transmit Timing Set Command ce eeeeeeeeeeneeeeceeeeeeeeeens 24 sts_sync Transmit Timing Query Command cceeessssceeeecsseeeeeececeeeeeaeceeesecaeeseceseneaeeneeaeeates 24 tx_dcc off section line Tx Data Comm
333. x_stress Receiver Stress Test Query Command Returns a character string indicating the selected receiver Stress Test Pattern Example rx_stress Response RX_STRESS WORD_324 Note The Stress Test only functions in the DSX 1 mode See rx_stress Receiver Stress Test Set Command rx_vt_chan n Receiver VT Channel Select Command Selects the VT1 5 Channel Number to be monitored Example rx_vt_chan n n a decimal number from 1 to 28 Response NONE Note The VT1 5 channel is selected from the currently selected STS 1 channel See rx_sts_chan Receive STS Channel Select Command rx_vt_chan Receiver VT Channel Query Command Returns a character string indicating the current receiver VT1 5 Channel selected Example rx_vt_chan Response RX_VT_CHAN N N a decimal number from 1 to 28 Note See rx_vt_chan Receive VT Channel Select Command ST112 SONET Transmission Test Set 7 31 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands rx_vt_fram unframed sf esf sic Rx VT Frame Set Command Sets the receiver DS 1 Frame Format Argument unframed sf super frame esf extended super frame slc SLC 96 Subscriber Loop Carrier 96 Example rx_vt_fram esf Response NONE rx_vt_fram Receiver VT Frame Query Command Returns a character string indicating the selected receiver VT Frame Format Example rx_vt_fram Response RX_VT_FRAM ESF Note For Arguments
334. x_sts_ chan Receive STS 1 Channel Query Command Returns a character string indicating the current VT1 5 Channel selected Example rx_sts_chan Response RX_STS_CHAN 3 Note See the Receiver STS 1 Channel Set Command rx_vt_chan n Receiver VT Channel Set Command Sets the Receiver VT1 5 Channel number within the STS 1 channel Argument n a decimal number from 1 to 28 Example rx_vt_chan 14 Response NONE 7 22 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands rx_vt_chan Receive VT Channel Query Command Returns a character string indicating the current VT1 5 Channel selected Example rx_vt_chan Response RX_VT_CHAN 14 Note See the Receiver VT Channel Set Command rx_vt_map map1x28 map4x7 Receiver VT Mapping Set Command Sets the Receiver VT1 5 Payload Mapping Argument map1x28 Selects sequential VT channel numbering 1 to 28 map4x7 Select 4 x 7 VT channel numbering Example rx_vt_map map4x7 Response NONE rx_vt_map Receive VT Mapping Query Command Returns a character string indicating the current VT1 5 Payload Mapping selected Example rx_vt_map Response RX_VT_MAP MAP4x7 Note VT1 5 channel numbering mapping can be either sequential MAP1x28 or 4x7 interleaved MAP4x ST112 SONET Transmission Test Set 7 23 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www
335. xample tx_owire Response TX_OWIRE LOCAL tx_signal stsx1 dsx3 Tx Signal Set Command Selects the cross connect signal to be transmitted from the six 75 ohm front panel connectors Argument stsx1 enables the stsx1 electrical outputs dsx3 enables the dsx3 electrical outputs Example tx_signal stsx1 Response NONE Note The STSX 1 is automatically selected when the Transmitter Optical Output is enabled see the opt_output on command The DSX 1 output is always active tx_signal Transmitter Signal Query Command Returns a character string indicating the current cross connect signal type being transmitted Example tx_signal Response TX_SIGNAL STSX1 Note Either STSX or DSX 1 cross connect signal will be transmitted from the six 75 ohm front panel ports The STSX 1 is automatically selected when the Transmitter Optical Output is enabled see the opt_output on command tx_vt_map map1x28 map4x7 Transmitter VT Mapping Set Command Sets the Transmitter VT1 5 Payload Mapping Argument map1x28 Selects sequential VT channel numbering 1 to 28 map4x7 Select 4 x 7 VT channel numbering Example tx_vt_map map4x7 Response NONE 7 26 ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands tx_vt_map Transmitter VT Mapping Query Command Returns a character string indicating the current VT1 5 Payload Mapping selected Exam
336. xclusive OR argument a b c that means include one and only one of the following parameters a b or c ST112 SONET Transmission Test Set Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Remote Commands Multiple Commands A given command line may contain one or more commands up to 80 ASCII characters both upper and lower case Multiple commands use a semicolon as a delimiter as follows Prompt gt rx_sts_chan 3 sts_oof sect_los sect_lof bl ber Arguments Commands may include one or more arguments parameters following the header The first argument following the header must be separated from the header by one or more blank characters spaces Subsequent arguments must be separated from previous parameters using commas Blank Characters Spaces One or more spaces are required between the command header and first parameter if any Otherwise spaces are ignored and may be used on a command line between headers parameters or required separators for readability Arguments Outside of Legal Ranges If the instrument receives a set command with an argument that is outside the legal range for that argument then the instrument will set the indicated parameter to its maximum or minimum legal value depending on which is closer to the received value Command Line Terminator Command lines must be terminated as follows e RS 232 Interface Command lines issued to
337. xt is the REPORT SETUP PRINT menu used to control the printing Setting it to OFF means no printout ERR will print a report each time an error is detected during a test cycle EOT will print a report summary at the end of the test cycle BOTH will print on error and at the end of test cycle The printer can be connected to either the parallel or serial RS 232 C port Parallel is the factory default setting e The REPORT SETUP SQUELCH menu is used to limit the total number of errors logged saving memory space When squelch is set to ON error recording will stop after 10 consecutive seconds with errors Then error recording will be resumed after 10 consecutive seconds without any errors e The PRINTER SELECTION menu offers either PARALLEL or RS 232 C RS232 serial printer selection The printer should be connected to the appropriate port on the ST112 SONET Transmission Test Set rear panel e Inthe REPORT SETUP menu CLEAR ERR error is used to clear the error log by moving the cursor to YES and pressing the enter key It immediately clears the error log and returns to NO after execution The error log should be cleared before running a long test preventing buffer overflow An error log warning message will be displayed when the run key is pressed if the log is 95 full e The REPORT REPRINT menu is used to print the previous error log ERR the previous end of test summary PREV EOT or the current error log CURR if it exist ST112 SON

Combined (Dual) Mode Commands

Contents

Download Pdf Manuals

Related Search

Related Contents