Taq Full DNA Polymerase User Manual
Contents
1. 5 primer 5 CTTGTCCTAATCTTCCTCCTCACGGCA 3 3 primer 5 TGGCACGGCCATAAGAGGTAGATGTCA 3 4x1 25 ml PCR Grade Water Tag Full Hot Start DNA Polymerase PCR Kit Cat No 639231 20 ul Tag Full Hot Start DNA Polymerase Mix 5 units pl 1 25 100 500 lt 10 20 m 1 Hu 1 Hu Includes Tag Full DNA Polymerase 5 units ul and TaqStart Antibody 1 1 ug ul in storage buffer 15 mM Tris HCl pH 8 0 75 mM KCl 0 05 mM EDTA 0 5 mg ml BSA and 50 Glycerol 10X Taq Full PCR Buffer 200 mM Tris HCl pH 8 5 500 mM KCI 20 mM MgCl and 0 1 96 Tween 20 dNTP Mix 10 mM each of dATP dCTP dGTP and dTTP MgCl 50 mM Control Genomic DNA Template Calf Thymus DNA 100 ng ul Control Primer Mix 407 bp bovine pancreatic trypsin inhibitor BPTI gene forward and reverse primers 10 uM each 5 primer 5 CTTGTCCTAATCTTCCTCCTCACGGCA 3 3 primer 5 TGGCACGGCCATAAGAGGTAGATGTCA 3 4x1 25 ml PCR Grade Water Protocol No PT3820 1 www clontech com Version No PR4Z027 Clontech Laboratories Inc 9 Tag Full DNA Polymerase User Manual lll Additional Materials Reguired The following reagents and equipment are required but not supplied Thermal cycler heated lid or non heated lid Pipettors dedicated for pre PCR no template work Aerosol free PCR pipette tips suitable for use with the above pipettors and preferably eguipped with hydrophobic filters Gel electrophoresis eguipment DNA2. b Mix well and spin briefly c Add DNA template Note When using a heated lid thermal cycler do not overlay samples with mineral oil as this may decrease overall product yield Clontech Laboratories Inc www clontech com Protocol No PT3820 1 16 Version No PR4Z027 Tag Full DNA Polymerase User Manual V Tag Full PCR Procedure continued 2 General cycling parameter guidelines Use the guidelines in Step A 3 and Table when setting up your initial experiments with the Tag Full system These are general guidelines the optimal parameters may vary with different thermal cyclers and will depend on your particular primers template and other experimental variables See the Troubleshooting section to address particular issues associated with determining PCR cycling parameters C Recommendations for electrophoresis We recommend that you transfer a 5 ul sample of your PCR reaction to a fresh tube and add 1 ul of 5X Stop Loading buffer Place the remaining 45 ul of the reaction mixture on ice it can be subjected to further cycling if you do not see a product Analyze your sample s along with suitable DNA size markers by electrophoresis on an appropriate agarose gel containing 0 1 ug ml EtBr The percentage of agarose and the DNA size markers you choose will depend on your expected range of product sizes You may find the following general guidelines helpful in choosing your gel Recommendations for agarose gels Expecte
3. Clontech Laboratories Inc www clontech com Protocol No PT3820 1 6 Version No PR4Z027 Tag Full DNA Polymerase User Manual Introduction continued Recommended uses for Tag Full Products Tag Full DNA polymerase mix is not intended for certain applications reguiring very high fidelity PCR In such cases we recommend Advantage HF 2 PCR Kits Cat Nos 639123 amp 639124 specifically designed for long and accurate PCR If you plan to amplify long gt 5 kb and or highly complex templates for prepara tive purposes we recommend our Advantage 2 Mix and related kits many Additionally the QTaq DNA Polymerase Mix Cat Nos 639651 639652 amp 639655 is ideal for real time qPCR applications and has been optimized for use with our wide selection of specialized Qzyme Assays many See the Related Products Section for ordering information Protocol No PT3820 1 www clontech com Clontech Laboratories Inc Version No PR4Z027 7 Tag Full DNA Polymerase User Manual ll List of Components Store all components at 209C Enough reagents are supplied for 100 500 or 5 000 PCR reactions of 1 unit enzyme per 50 ul reaction volume Tag Full DNA Polymerase Enzyme Mix Cat No Cat No Cat No 639232 639233 639234 100 U 500 5 000 20 ul 1001 1ml Taq Full DNA Polymerase Mix Includes Taq Full DNA Polymerase 5 units ul in storage buffer 20 mM Tris HCl pH 8 0 100 mM KCI 0 1 mM EDTA 1 0 mg ml BSA
4. Redesign your primer s after confirming the accuracy of the seguence information If the original primer s was less than 22 nt long try using a longer primer If the original primer s had a G C content of less than 45 try to design a primer with a G C content of 45 60 Repeat PCR using a higher concentration of DNA after amplification using more cycles Check template integrity by electrophoresis on a standard TBE agarose gel If necessary repurify your template using methods that minimize shearing and nicking and never vortex your template or freeze thaw multiple times Especially when working with longer templates increase extension time in 1 min increments We recommend 1 min extension per kb of template Protocol No PT3820 1 Version No PR4Z027 www clontech com Tag Full DNA Polymerase User Manual VI Troubleshooting Guide continued Enzyme concen tration not optimal Mg not optimal dNTPs not optimal Target difficult to amplify Protocol No PT3820 1 Version No PR4Z027 The Taq Full DNA Polymerase Enzyme Mix can be used at 1 unit per 50 ul reaction for most routine applications but can be increased up to 2 5 units per 50 ul reaction The Taq Full DNA Polymerase Enzyme Mix performs well for most applications using a 2 mM Mg concentration broad range of amplicon sizes and template types Therefore as long as you use the buffer included with the polymerase mix and a final concentra
5. A neutralizing monoclonal antibody that facilitates Hot Start PCR April 1994 Clon techniques IX 2 1 5 Clontech Laboratories Inc www clontech com Protocol No PT3820 1 Version No PR4Z027 Tag Full DNA Polymerase User Manual VIII Related Products For a complete listing of all Clontech products please visit www clontech com Products Cat No e TagStart Antibody 639250 639251 e Advantage HF 2 PCR Kit 639124 639123 e QUICK Clone cDNAs many e Marathon cDNA Amplification Kit 634913 e Marathon Ready cDNAs many e Sprint TITANIUM Tag 384 Plate 639552 e Sprint Advantage 96 Plate 639550 e Sprint Advantage Single Shots 639556 639553 639554 e TITANIUM Tag DNA Polymerase 639208 639209 e TITANIUM Tag PCR Kit 639211 639210 e TITANIUM One Step RT PCR Kits 639503 639504 e SMART cDNA Library Construction Kit 634901 Advantage 2 Polymerase Kit 639201 639202 e Advantage amp 2 PCR Kit 639206 639207 e 10X Advantage 2 PCR Buffer 639137 639138 e 10X Advantage 2 SA PCR Buffer 639147 639148 e Advantage Genomic Polymerase Mix 639110 e Advantage Genomic PCR Kit 639104 639103 e Advantage GC Genomic Polymerase Mix 639113 e Advantage GC Genomic PCR Kit 639118 639117 Protocol No PT3820 1 www clontech com Clontech Laboratories Inc Version No PR4Z027 23 Tag Full DNA Polymerase User Manual VIII Related Products continued Products Advantage GC 2 Polymerase Mix Advantage
6. Master Mix for multiple reactions of the same type The Master Mix contains all components reguired as listed below except the DNA template which is added last in Step 1 c To ensure that you have sufficient Master Mix prepare enough for all reactions plus one additional reaction a Combine the following reagents in an appropriately sized PCR tube Table III Note If using Taq Full DNA polymerase without Hot Start optimal results are obtained when all components and reactions including the Master Mix are assembled and maintained on ice Preparation at room temperature may result in higher background and lower yield of specific products These set up conditions are not as crucial for reactions containing TaqStart antibody TABLE Ill MASTER MIX PREPARATION Reagent Amount per reaction Final 10X Taq Full PCR Buffer 5 ul 1X containing 20 mM MgCl 2 mM dNTP Mix 10 mM each 1 ul 200 uM each Primer mix 10 HM each 2 ul 0 4 uM Taq Full DNA Polymerase Mix 0 2 0 5 ul 1 2 5 units Template DNA 1 5 variable PCR Grade Water up to 50 ul a Additional 50 mM MgCl is provided in the PCR Kits to allow you to establish your reactions with a final MgCl concentration higher than 2 mM if necessary gt A range of 1 2 5 unit per reaction is appropriate for most applications Longer amplicons and more complex templates may reguire more units per reaction but final titrations should be empirically determined for each ap plication
7. a negative control reaction that lacks template 2 Practice careful pipetting Because of the small volumes used in PCR experiments careful pi petting technique is extremely important Always verify that no extra solution is carried over on the outside of the pipette tip before transfer When adding liquid to a tube immerse the tip into the reaction mixture deliver the contents from the pipette tip into the mixture and then rinse the tip by pipetting up and down several times 3 Use a Master Mix Assembling a Master Mix which contains the appropriate volumes of all reagents required for multiple reactions eliminates repeated pipetting of individual reaction components into each reaction tube In addition it greatly reduces sample to sample variation Clontech Laboratories Inc www clontech com Protocol No PT3820 1 12 Version No PR4Z027 Tag Full DNA Polymerase User Manual IV General Considerations continued 4 Always include positive and negative controls i e PCR grade HO instead of DNA template Touchdown PCR Touchdown PCR can significantly improve the specificity of many amplfica tion reactions in a wide variety of applications by increasing the abundance of the initial primer template duplex Don et al 1991 Roux 1995 Briefly touchdown PCR involves using an annealing extension temperature that is several degrees higher typically 3 10 C than the T of the primers during the initial phase typica
8. and 50 Glycerol 1 25ml 3ax1 25ml 30 ml 10X Tag Full PCR Buffer Includes 200 mM Tris HCl pH 8 5 500 mM KCI 20 mM MgCl and 0 1 Tween 20 Tag Full Hot Start DNA Polymerase Enzyme Mix Cat No Cat No Cat No 639228 639229 639230 100U 500 5 000 20 ul 100 ul 1 ml Taq Full Hot Start DNA Polymerase Mix Includes Taq Full DNA Polymerase 5 units ul and TaqStart Antibody 1 1 ug ul in storage buffer 15 mM Tris HCl pH 8 0 75 mM KCI 0 05 mM EDTA 0 5 mg ml BSA and 50 Glycerol 1 25mi 3ax1 25ml 30 ml 10X Taq Full PCR Buffer Includes 200 mM Tris HCl pH 8 5 500 mM KCI 20 mM MgCl and 0 1 Tween 20 Clontech Laboratories Inc www clontech com Protocol No PT3820 1 8 Version No PR4Z027 Tag Full DNA Polymerase User Manual ll List of Components continued Tag Full DNA Polymerase PCR Kit Cat No 639235 20 Mul Tag Full DNA Polymerase Mix 5 units ul 125 100 500 lt 10 20 m 1 H 1 H Includes Tag Full DNA Polymerase 5 units ul in storage buffer 20 mM Tris HCl pH 8 0 100 mM KCI 0 1 mM EDTA 1 0 mg ml BSA and 50 Glycerol 10X Taq Full PCR Buffer 200 mM Tris HCl pH 8 5 500 mM KCI 20 mM MgCl and 0 1 96 Tween 20 dNTP Mix 10 mM each of dATP dCTP dGTP and dTTP MgCl 50 mM Control Genomic DNA Template Calf Thymus DNA 100 ng pl Control Primer Mix 407 bp bovine pancreatic trypsin inhibitor BPTI gene forward and reverse primers 10 uM each
9. size markers 5X Stop Loading buffer Sambrook et al 2001 provides several recipes 0 5 ml PCR reaction tubes or multi well plates We recommend Applied Biosystems GeneAmp PCR Reaction Tubes 0 5 ml Cat No N801 0737 GeneAmp PCR Reaction Tubes with Flat Cap 0 5 ml Cat No N801 0180 or MicroAmp Optical 96 well Reaction Plates Cat No N801 0560 Optional Mineral oil for overlaying samples run on a non heated lid thermal cycler We recommend Sigma Cat No M3516 The following reagents are supplied with the Tag Full DNA Polymerase PCR Kits Cat Nos 639235 amp 639231 but not with the Tag Full DNA Polymerase Enzyme Mixes Cat Nos 639228 639229 63930 639232 639233 amp 639234 Advantage Ultrapure PCR Deoxynucleotide Mix Cat No 639125 Positive Control Genomic DNA Template and Control Primer Mix Forward and reverse primers 10 uM each 50 mM MgCl Allows you to customize your reactions if a final MgCl concentration greater than 2 mM is reguired PCR Grade Water Avoid using autoclaved HO because the recycled steam in some autoclaves can introduce contaminants that may interfere with PCR Clontech Laboratories Inc www clontech com Protocol No PT3820 1 10 Version No PR4Z027 Tag Full DNA Polymerase User Manual IV General Considerations A Primer Design Primer design is the single largest variable in PCR applications and the single most important factor in determining the success or fa
10. E 5 Si Bm o UU Tag Full DNA Polymerase User Manual Clontech United States Canada 800 662 2566 Asia Pacific 1 650 919 7300 Europe 33 0 1 3904 6880 Japan 81 0 77 543 6116 Clontech Laboratories Inc ATakara Bio Company 1290Terra Bella Ave PT3820 1 PR4Z027 Technical Suppor US Published 12 May 2005 E mail tech clontech com www clontech com Tag Full DNA Polymerase User Manual Table of Contents VI VII VIII Introduction List of Components Additional Materials Reguired General Considerations Primer Design Template Purity and Guantity Amplicon Size Background Amplification Good PCR Practices Touchdown PCR Use of Additives Taq Full PCR Procedure A Control PCR Reactions B Guidelines for Taq Full Test PCR Reactions C Recommendations for Electrophoresis Troubleshooting Guide omnmoomwpe References Related Products List of Figures Figure 1 Amplification of a single copy gene from calf thymus genomic DNA using Tag Full and Tag Full Hot Start DNA polymerase mixes Figure 2 Less enzyme and template reguired per reaction with Tag Full and Tag Full Hot Start DNA polymerase mixes Figure 3 Tag Full Hot Start DNA polymerase mix provides higher yield and more consistent results than other hot start enzymes List of Tables Table Control Reaction Mixes Table Il Examples of Typical Cycling Parameters Table lll Master Mix Preparation Clonte
11. GC 2 PCR Kit Advantage UltraPure PCR Deoxynucleotide Mix Advantage UltraPure dNTP Combination Kit 639132 Advantage RT for PCR Kits Super SMART PCR cDNA Synthesis Kit SMART RACE cDNA Amplification Kit Human GenomeWalker Kit Mouse GenomeWalker Kit Rat GenomeWalker Kit GenomeWalker Universal Kit PCR Select cDNA Subtraction Kit PCR Select Bacterial Genome Subtraction Kit LD Insert Screening Amplimer Sets RT PCR Control Amplimer Sets MTC Multiple Tissue cDNA Panels NucleoSpin Kits NucleoSpin Extract Kits NucleoBond Kits NucleoFast Kits NucleoTrap PCR Purification Kits Clontech Laboratories Inc www clontech com 24 Cat No 639114 639120 639119 639125 639505 639506 635000 634914 638901 638902 638903 638904 637401 637404 many many many many many many many 636054 636020 Protocol No PT3820 1 Version No PR4Z027 Tag Full DNA Polymerase User Manual Notes Protocol No PT3820 1 www clontech com Clontech Laboratories Inc Version No PR4Z027 25 Tag Full DNA Polymerase User Manual Notes Clontech Laboratories Inc www clontech com Protocol No PT3820 1 Version No PR4Z027 Tag Full DNA Polymerase User Manual Notes Notice to Purchaser This product is intended to be used for research purposes only Itis not to be used for drug or diagnostic purposes noris itintended for human use Clontech products may not be resold modified for resale or u
12. amplicon Lane 5 3 500 bp amplicon M Mixture 1 1 of A DNA Hind Ill and X174 Hae lll digests NEB Cat Nos N3012S amp N3026S respectively The Tag Full Hot Start Buffer B samples contain ammonium sulfate and 3 mM MgCl Automatic Hot Start with TaqStart Antibody The Taq Full Hot Start DNA Polymerase Mix Cat Nos 639228 639229 amp 639230 and the Taq Full Hot Start PCR Kit Cat No 639231 both contain built in hot start PCR This is due to the presence of TaqStart Antibody which is conveniently included in the enzyme mix TagStart antibody is a highly efficient high affinity neutralizing monoclonal antibody that recognizes both full length and N terminal deletion versions of Tag Antibody mediated hot start with TaqStart Antibody has been shown to significantly improve the efficiency and specificity of PCR amplifications by reducing background DNA synthesis and increasing amplification of desired products April 1994 Clontechniques Kellogg etal 1994 Certain PCR enzymes exhibit significant polymerase activity at temperatures encountered during reaction setup or while ramping Inhibition of enzymatic activity at ambient temperatures ensures that our polymerase mix will result in greatly reduced background for most PCR applications by eliminating nonspecific primer annealing and extension products and primer dimer artifacts created prior to the onset of thermal cycling both of which could contribute to amplification of und
13. ate dedicated laboratory areas with separate sets of pipettors for your pre PCR reaction set ups and post PCR analyses Laboratory benches and pipettor shafts can be decontaminated by depuri nation Wipe surfaces with 1N HCI followed by 1N NaOH Then neutralize with a neutral buffer e g Tris or PBS and rinse with ddH O We highly recommend using commercially available aerosol free pipette tips for all liquid manipulations An enzymatic method has been published for destroying PCR product car ryover Longo et al 1990 It involves incorporation of dUTP into the PCR products and subsequent hydrolysis with uracil N glycosylase UNG When performing PCR directly on phage plaques or bacterial colonies failure to isolate single plaques or colonies will also produce multiple bands Protocol No PT3820 1 www clontech com Clontech Laboratories Inc Version No PR4Z027 21 Tag Full DNA Polymerase User Manual VII References Don R H Cox P T Wainwright B J Baker K amp Mattick J S 1991 Touchdown PCR to circumvent spurious priming during gene amplification Nucleic Acids Res 19 4008 Engelke D R Krikos A Bruck M E amp Ginsburg 1990 Purification of Thermus aquaticus DNA polymerase expressed in Escherichia coli Analytical Biochemistry 191 396 400 Kellogg D E Rybalkin I Chen S Mukhamedova N Vlasik Siebert P amp Chenchik A 1994 TaqStart Antibody Hot Start PCR facilit
14. ated by a neutralizing monoclonal antibody directed against Tag DNA polymerase BioTechnigues 16 1134 1137 Kim Y Eom S H Wang J Lee D S Suh S W amp Steitz T A 1995 Crystal structure ofThermus aquaticus DNA polymerase Nature 376 612 616 Lawyer F C Stoffel S Saiki R K Myambo K Drummond R amp Gelfand D H 1989 Isolation characterization and expression in Escherichia coli of the polymerase gene from Thermus aquaticus J Biol Chem 264 6427 6437 Lawyer F C Stoffel S Saiki R K Chang S Y Landre P A Abramson R D amp Gelfand D H 1993 High level expression purification and enzymatic characterization of full lengthThermus aquaticus DNA Polymerase and a truncated form deficient in 5 to 3 exonucle ase activity PCR Methods and Applications Cold Spring Harbor Laboratory Press Cold Spring Harbor NY Longo M C Berninger M S amp Hartley J L 1990 Use of uracil DNA glycosylase to control carry over contamination in polymerase chain reactions Gene 93 3749 McPherson M J amp Maller S G 2000 PCR The Basics from background to bench Springer Verlag Telos New York NY Roux K H 1995 Optimization and troubleshooting in PCR PCR Methods Appl 4 5185 5194 Sambrook J Russell D W amp Sambrook J 2001 Molecular Cloning A Laboratory Manual Third Edition Cold Spring Harbor Laboratory Cold Spring Harbor NY TaqStart
15. c www clontech com Protocol No PT3820 1 Version No PR4Z027 Tag Full DNA Polymerase User Manual V Tag Full PCR Procedure continued 3 Start thermal cycling using the following parameters e Initial denaturation 94 C for 3 min e PCR cycles 30 cycles Denaturation 94 C for 30 sec Annealing Extension 68 C for 1 min e Additional Extension 68 C for 5 min a Use the minimal possible time In some cases better results may be obtained by modifying the denaturation step e g 949C for 15 sec Exposure of DNA to high temperatures causes some depurination of single stranded DNA during denaturation which eventually leads to strand scission High temperature also leads to gradual loss of enzyme activity Important If you are using Taq Full DNA polymerase without hot start antibody the initial denaturation cycle applies only to DNAtemplate denaturation thus the duration of the initial denaturation can be reduced to 1 min b 30 35 cycles for single or low copy number genes or rare cDNAs For most applica tions we prefer two step cycles denaturation at T followed by annealing and exten sion at instead of three step cycles denaturation at T4 followed by annealing at T followed by extension at 15 Three step cycles will be necessary when the Tm of the primers is less than 60 65 C and in certain special protocols Note The supplied Control Template and Control Primer Mix have been optimized with two step cycling para
16. ch Laboratories Inc www clontech com 2 10 11 11 11 12 12 12 13 13 14 14 16 17 18 22 23 14 15 16 Protocol No PT3820 1 Version No PR4Z027 Tag Full DNA Polymerase User Manual l Introduction Tag Full DNA Polymerase is a high quality full length recombinant version of the Thermus aguaticus strain YT1 DNA Polymerase Engelke et al 1990 It is suitable for most general PCR amplification procedures Tag Full DNA polymerase provides the best yield and greatest sensitivity of any Tag derived polymerase It can generate the highest yields from most DNA templates including rare ones ranging from bacterial and plasmid DNA to cDNA and complex genomic DNA The high efficiency sensitivity and robust nature of Taq Full enzyme translates into three primary advantages over other DNA polymerases Less template is needed Targets can be amplified using less template per reaction specific amplification of a single copy gene can be performed with as little as 1 ng of genomic DNA template Figure 1 In situations where the amplification target is present at extremely low levels e g amplifying a rare cDNA in an RT PCR experiment or detecting viral nucleic acid the heightened sensitivity of Taq Full DNA polymerase allows successful target gene amplification where other polymerases would fail Less enzyme is needed The high processivity and extension rate of Taq Full DNA polymerase enables you to use less en
17. d Recommended Recommended insert size range agarose DNA size markers 0 3 1 5 kb 1 5 oX174 Hae lll 0 5 10 kb 1 2 1 kb DNA ladder gt 5 kb 0 8 Hind III Version No PR4Z027 Tag Full DNA Polymerase User Manual VI Troubleshooting Guide The following general guidelines apply to most PCR reactions However this User Manual does not comprehensively address troubleshooting guidelines for all of the applications for which Tag Full products can be used When using Tag Full DNA polymerase with a companion or accessory Clontech product please refer to the appropriate application specific User Manual A No product observed or low yield PCR component missing degraded Cycle number inadeguate Annealing temp too high Primer concen tration not optimal Primer design not optimal Template amount insufficient Template guality poor Extension time inappropriate Clontech Laboratories Inc 18 Use a checklist when assembling reactions Always perform a positive control to ensure that each component is functional If the positive control does not work repeat the positive control only If the posi tive control still does not work repeat again replacing individual components to identify the faulty reagent Increase the number of cycles by 5 additional cycles at a time up to 40 cycles Decrease the annealing temperature in increments of 2 49C Perform titration of primer concentration in multiple reactions
18. esirable products Such mispriming reduces overall yield impairs gel analysis and product quantitation and may necessitate sequencing specific products to obtain useful information With TagStart antibody more definitive results can be obtained when your target is either present in very low copy number or within a Protocol No PT3820 1 www clontech com Clontech Laboratories Inc Version No PR4Z027 5 Tag Full DNA Polymerase User Manual l Introduction continued complex background of genomic DNA or cDNA Full polymerase activity is then restored at the onset of thermal cycling because the antibody is denatured at high temperature during the first denaturation step Besides increased specificity and sensitivity the built in hot start using TagsStart antibody offers convenience Other methods of hot start require extra steps such as the addition and premelting of wax beads or the addition of a criti cal component after the initial denaturation These extra steps are inconvenient cumbersome and introduce a potential source of cross contamination In contrast because there is no need to add the antibody as a separate reagent during PCR setup Taq Full Hot Start polymerase mix provides all the advantages of hot start PCR with none of the disadvantages of other current hot start methods Flexible and Convenient Formats The Taq Full DNA Polymerase Enzyme is available in several formats to suit your application needs It is available witho
19. id using a T residue as this increases the chance of a mis match Template Purity and Quantity Both the purity and quantity of the starting DNA template significantly affect PCR sensitivity and efficiency Because PCR amplification pro ceeds exponentially many conventional PCR applications work well with templates of average or even low quality In many applications Taq Full DNA polymerase will tolerate a wide range of template quality Template quality becomes much more important when amplifying from longer more complex targets or when desiring the highest possible sensitivity Many methods are available to optimally purify your template DNA NucleoSpin columns many yield rapid minipreparations of plasmid or genomic DNA using centrifigation and or vacuum manifolds For large scale preparations that require no centrifugation NucleoBond columns many may be used The optimal nucleic acid purification product depends on your starting ma terial DNA amount being purified and end application s These products Protocol No PT3820 1 www clontech com Clontech Laboratories Inc Version No PR4Z027 Tag Full DNA Polymerase User Manual IV General Considerations continued are available in a wide array of formats and sizes for DNA purification of various DNA types plasmid genomic BAC Lambda plant and viral and sources cell cultures tissues and blood Our NucleoSpin Extract Kits many allow extraction of DNA fragments fro
20. ilure of PCR reactions Always check and recheck your primer design before con structing or ordering primers For helpful guidelines on primer design please visit the following web site http www basic nwu edu biotools oligocalc html The Tag Full system can be used in a wide variety of PCR applications and the constraints on primer design will vary from one application to the next The following general rules are provided as guidelines Tm Design primer pairs with similar T values For most applications we prefer two step cycles denaturation at T followed by annealing and extension at T5 instead of three step cycles denaturation at followed by annealing at T followed by extension at T3 Three step cycles will be necessary when the T of the primers is less than 60 65 C and in certain special protocols See Table for cycling parameters Annealing temperature Optimal annealing temperatures may be above or below the estimated T As a starting point use an annealing temperature of T 59C Length Primers should be at least 22 nucleotides nt long 25 30 mers are preferred G C content 45 60 Avoid runs of 3 or more Gs or Cs at 3 ends Complementary sequences Avoid complementary sequences within the entire primer sequence as well as between primer pairs This is especially crucial for the terminal 2 3 bases at the 3 ends of primer pairs in order to avoid primer dimer formation 3 end Avo
21. l A or Taq Full Hot Start Panel B DNA polymerase mix Reactions were run under the following two step cycling conditions 94 C for 3 min 30 cycles of 94 C for 30 sec 68 C for 1 min 68 C for 5 min Lane 1 5 units reaction Lane 2 2 5 units reaction Lane 3 1 0 units reaction Lane 4 0 5 units reaction Lane 5 0 2 units reaction Lane 6 0 units reaction M Mixture 1 1 of DNA Hind lll and X174 Hae Ill digests NEB Cat Nos N3012S amp N3026S respectively Clontech Laboratories Inc www clontech com Protocol No PT3820 1 4 Version No PR4Z027 Tag Full DNA Polymerase User Manual l Introduction continued Tag Full Tag Full Hot Start Hot Start Supplier A Supplier B Supplier C Buffer B mit 234 5l1 23 4511 23 45lml1 234 5ll123 45 Figure 3 Tag Full Hot Start DNA polymerase mix provides higher yield and more consistent results than other hot start enzymes Various sized amplicons were produced from 100 ng of calf thymus genomic DNA template following manufacturer recommendations Each reaction 50 yl contained 2 units of enzyme 1X PCR buffer with the appropriate amount of MgCl for each enzyme and 400 nM of each primer Reactions were assembled at room temperature and performed using the following two step cycling conditions 94 C for 3 min 30 cycles of 94 C for 30 sec 68 C for 3 min 30 sec 68 C for 5 min Lane 1 500 bp amplicon Lane 2 900 bp amplicon Lane 3 2 000 bp amplicon Lane 4 2 500 bp
22. ling conditions Protocol No PT3820 1 www clontech com Clontech Laboratories Inc Version No PR4Z027 3 Tag Full DNA Polymerase User Manual l Introduction continued Tag Full Tag Full Hot Start Mli 2 a34567M 1234567 407 bp gt Figure 1 Amplification of a single copy gene from calf thymus genomic DNA using Tag Full and Tag Full Hot Start DNA polymerase mixes Specific amplification of the single copy gene encoding bovine pancreatic trypsin inhibitor BPTI from various amounts of calf thymus ge nomic DNA template using 1 unit reaction of Tag Full or Tag Full Hot Start DNA polymerase mixes Reactions 50 ul were performed using the following two step cycling conditions 94 C for 3 min 30 cycles of 94 C for 30 sec 68 C for 1 min 68 C for 5 min Lane 1 0 ng template Lane 2 1 ng template Lane 3 5 ng template Lane 4 10 ng template Lane 5 20 ng template Lane 6 100 ng template Lane 7 200 template M Mixture 1 1 of DNA Hind III and X174 Hae lll digests NEB Cat Nos N3012S amp N3026S respectively Tag Full Tag Full Hot Start MII 2 3 4 5 6 Mii 2 3 4 5 6 500 500 bp gt Figure 2 Less enzyme and template required per reaction with Taq Full and Taq Full Hot Start DNA polymerase mixes Using a reduced amount of calf thymus genomic DNA template per reaction 10 ng a 500 bp amplicon was amplified using decreasing numbers of units per reaction of Taq Full Pane
23. lly 5 10 cycles In subsequent cycles the annealing temperature is decreased in 1 2 C increments per cycle until a temperature is reached that is equal to or 2 59C below the Tm of the primers This change can be performed either in a single step or in incre ments over several cycles G Use of additives TaqStart Antibody binds Tag Full DNA polymerase with high affinity un der the conditions described in this User Manual The addition of 2 5 DMSO will not interfere with antibody function and may improve results in some instances However the addition of formamide or other cosol vents may disrupt antibody function Furthermore excessive amounts of glycerol solutes e g salts pH extremes and or other deviations from the recommended reaction conditions may reduce the effectiveness of both TaqStart antibody and Tag Full DNA polymerase Protocol No PT3820 1 www clontech com Clontech Laboratories Inc Version No PR4Z027 13 Tag Full DNA Polymerase User Manual V Tag Full PCR Procedure PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING IMPORTANT CONSIDERATIONS For best results all components should be fully thawed vortexed briefly and then stored on ice until needed If using Tag Full DNA Polymerase without Hot Start optimal results are obtained when all components and reactions including Master Mix are assembled and maintained on ice Preparation at room temperature may result in higher background and lower yield
24. m PCR reactions while the NucleoFast many and NucleoTrap PCR Purification Kits Cat Nos 636054 amp 636020 purify away unwanted PCR components primer dimers high salts dNTPs and PCR primers Please visit our web site at www clontech com for detailed information regarding which nucleic acid or PCR purification products best suit your needs C Amplicon Size Tag Full enzyme has successfully amplified targets of up to 3 5 kb in size from genomic DNA Figure 3 Background Amplification Due to the sensitivity and robustness of the Tag Full enzyme nonspecific background amplification may sometimes result Try using our Tag Full Hot Siart polymerase mix if you are not already doing so Additionally you may need to adjust the cycle number or annealing tem perature See Section VI B for more troubleshooting suggestions E Good PCR Practices 1 Use a dedicated space and dedicated eguipment Prepare reactions in a PCR workstation using dedicated pipettors in a dedicated work space that is free of contaminating DNA Due to the tremendous amplification power of PCR minute amounts of contaminating DNA can produce nonspecific amplification We recommend that you use small aliquots of starting material to avoid con taminating your stocks As with all PCR experiments always wear gloves use PCR pipette tips with hydrophobic filters and dedicated solutions and perform post PCR analysis in a separate area We also recommend setting up
25. meters but are also suitable for use with a three step program See Table below for examples of suitable cycling parameters 4 Store reactions at 4 C or 20 C until needed 5 Analyze 5 ul of your PCR reaction by electrophoresis on a 0 8 1 596 agarose EtBr gel See Section V C for gel electrophoresis details Expected results Using the positive Control Template and Control Primer Mix supplied in the kit the reaction should produce a single major band of 407 bp from the bovine pancreatic trypsin inhibitor gene See Figure 1 No bands should be generated in the negative control no DNA template TABLE Il EXAMPLES OF TYPICAL CYCLING PARAMETERS Two step program Three step program 94 C for 3 min 94 C for 3 min 30 cycles 30 cycles 94 C for 30 sec 94 C for 30 sec 68 C for 1 min 68 C for 30 sec 72 C for 1 min 68 C for 5 min 729C for 5 min Protocol No PT3820 1 www clontech com Clontech Laboratories Inc Version No PR4Z027 15 Tag Full DNA Polymerase User Manual V Tag Full PCR Procedure continued Recommended Guidelines for Tag Full Test PCR Reactions Use the following guidelines when setting up your initial experiments with Tag Full DNA polymerase mix These are general guidelines optimal pa rameters may vary with different thermal cyclers and will depend on your particular primers and template as well as other experimental variables 1 Preparation of Master Mix Whenever possible use a
26. of specific products These set up conditions are not as crucial for reactions containing TaqStart Antibody i e Taq Full Hot Start products A Control PCR Reactions Positive and negative control PCR reactions should be performed in parallel with your experiments to ensure that the Taq Full DNA Polymerase Mix is working properly In addition to enzyme and 10X Buffer our Taq Full Cat No 639235 and Taq Full Hot Start Cat No 639231 PCR Kits include Positive Control Genomic DNA template and Control Primer Mix as well as dNTP Mix and PCR Grade Water For all other Taq Full Enzyme Mix products Cat Nos 639228 639229 639230 639232 639233 amp 639234 you must supply these components separately and therefore you may need to adjust the actual component volumes from the values found in Table I 1 Set up the Control Reactions Table TABLE I CONTROL REACTION MIXES 50 pl Reagent Positive Negative Final Concentration 10X Taq Full PCR Buffer 5 ul 5 ul 1X containing 20 mM MgCl 2 mM final dNTP Mix 10 mM each 1 ul 1 ul 200 uM each Control Primer Mix 10 uM each 2 ul 2 ul 0 4 uM Tag Full DNA Polymerase Mix 0 2 ul 0 2 ul 1 unit Control Genomic DNA Template 1 ul 100 100 ng pl PCR Grade Water up to 50 jl up to 50 yl 2 Mix well and spin tube briefly Note When using a heated lid thermal cycler do not overlay samples with mineral oil as this may decrease overall product yield Clontech Laboratories In
27. s to be included on nucleic acid arrays blots or in libraries or other cDNA collections which are then sold to third parties or 3 constructing databases which are then sold to third parties Reproduction amplification modification reformulation or resale of the reagents provided in PCR Select products is not permitted For information on licensing PCR Select for commercial purposes please contact a licensing representative by phone at 650 919 7320 or by e mail at licensing clontech com MicroAmp is a registered trademark of Applera Corporation or its subsidiaries in the US and certain other countries NucleoSpin and NucleoBond are registered trademarks of MACHEREY NAGEL GmbH and Co KG Tween206 is a registered trademark of of ICI Americas Inc Clontech Clontech logo and all other trademarks are the property of Clontech Laboratories Inc Clontech is a Takara Bio Company 2005 Protocol No PT3820 1 www clontech com Clontech Laboratories Inc Version No PR4Z027 27
28. sed to manufacture commercial products without written approval of Clontech Laboratories Inc Advantage 2 products are covered by U S Patent No 5 436 149 SMART Technology is covered by U S Patents Nos 5 962 271 amp 5 962 272 For Profit and Not For Profit purchasers of SMART Products are entitled to use the reagents for internal research However the following uses are expressly prohibited 1 performing services for third parties 2 identifying nucleic acid sequences to be included on nucleic acid arrays blots or in libraries or other cDNA collections which are then sold to third parties Reproduction modification reformulation or resale of the reagents provided in SMART Products is not permitted For information on licensing SMART Technology for commercial purposes please contact a licensing representative by phone at 650 919 7320 or by e mail at licensing clontech com TaqStart Antibody is licensed under U S Patent No 5 338 671 Clontech PCR Select cDNA Subtraction products are covered by U S Patent Nos 5 565 340 and 5 759 822 as well as pending foreign patent applications For Profit and Not For Profit purchasers of PCR Select products are entitled to use the reagents for internal research including identification of molecular markers or differentially expressed genes however the following uses are expressly prohibited 1 performing services for third parties 2 identifying nucleic acid sequence
29. shooting Guide continued B Multiple products Hot start reguired Cycle number inappropriate Annealing temp erature too low Primer design not optimal Touchdown PCR reguired Contamination Less enzyme reguired Less template reguired Low yield Template guality poor If you choose to use Tag Full DNA Polymerase without Hot Siart you willneedto assemble yourreac tions on ice You may also want to use a conventional hot start method such as adding enzyme only after the reaction has been heated Reducing the cycle number may eliminate nonspecific bands Try Touchdown PCR see Section IV F Increase the annealing extension temperature in increments of 2 3 C See Section A Touchdown PCR significantly improves the specificity of many PCR reactions in various applications Don et al 1991 Roux 1995 Touchdown PCR uses an annealing extension temperature that is several degrees higher than the Tm Of the primers during the initial PCR cycles The annealing extension temperature is then reduced to the primer T for the remaining PCR cycles The change can be performed either in a single step or in increments over several cycles See Section E If smearing is observed first try optimizing the cycle parameters as described above then try reducing the enzyme concentration Try a lower concentration of DNA template in the PCR reaction Check template integrity by electrophoresis on a
30. standard TBE agarose gel If necessary repurify your template using methods that minimize shearing and nicking Products are smeared on gel Cycle number inappropriate Clontech Laboratories Inc 20 Reduce the cycle number by 3 5 cycles to see if nonspecific bands are eliminated Protocol No PT3820 1 Version No PR4Z027 www clontech com Tag Full DNA Polymerase User Manual VI Troubleshooting Guide continued Denaturation temp Try increasing the denaturation temperature in erature too low increments of 1 C Extension time Decrease the extension time in 1 2 min increments inappropriate Primer concen Perform titration of primer concentration in reactions tration not optimal Poor template See Section A guality Touchdown PCR See Section IV F required Hot start If you choose to use Taq Full DNA Polymerase required without TagStart Antibody you will need to assemble your reactions on ice You may want to use aconventionalmethod ofhotstartsuch as adding enzyme only after the reaction has been heated E Dealing with contamination Contamination most often results in extra bands or smearing It is important to include a no template negative control a control that replaces the DNA template with PCR grade H5O but still includes the primers in every PCR experiment to determine if the PCR reagents pipettors or PCR reaction tubes are contaminated with previously amplified targets If possible set up separ
31. tion of 0 2 mM of each dNTP it is unlikely that a lack of product is due to problems with the Mai concentration However high concentrations of EDTA or other metal chelators in the template stock solution can reduce the effective concentration of Mg to a suboptimal level In those cases perform PCR reactions using increasing amounts of Mg from 2 0 3 5 mM final concentration in a 50 ul reaction When used as recommended the dNTP Mix provided with the kit gives a final concentration of 0 2 mM of each dNTP In our experience this con cen tration of dNTPs is suitable for a wide range of applications If you are preparing your own dNTPs be sure that your final concentration of each dNTP in the reaction is 0 2 mM We recommend using either our Advantage Ultrapure PCR Deoxynucleotide Mix Cat No 639125 or dNTP Combination Kit Cat No 639132 Note that if you increase the concentration of dNTPs you will also need to increase the Mg proportionately Some targets are inherently difficult to amplify If you are amplifying a complex template a template with unusually high G C content or a low abundance gene you may need to increase the amount of start ing template Advantage GC 2 Polymerase Mix and PCR Kits Cat Nos 639114 639120 amp 639119 are recommendedin cases of unusually high G C content and or secondary structure www clontech com Clontech Laboratories Inc 19 Tag Full DNA Polymerase User Manual VI Trouble
32. ut TaqStart Antibody in the Tag Full DNA Polymerase Enzyme Mix products Cat Nos 639232 639233 639234 amp 639235 and with TaqStart Antibody in the Tag Full Hot Start DNA Polymerase Enzyme Mix products Cat Nos 639228 639229 639230 amp 639231 Addition of the TaqStart Antibody provides automatic hot start PCR Kellogg et al 1994 Both enzymes are also available as enzyme mixes with PCR buffer Cat Nos 639228 639229 639230 639232 639233 amp 639234 or as convenient PCR Kits containing dNTP mixes MgCl and control primers and template in addition to the enzyme mix and buffer Cat Nos 639231 amp 639235 No Buffer Optimization Needed Taq Full DNA Polymerase allows you to easily perform PCR without tedious buffer optimization Both the enzyme formulation and PCR kits are conve niently supplied with an optimized 10X Tag Full PCR Buffer containing salts and a set concentration of 20 mM MgCl suitable for most PCR applications Addi tionally both PCR kits come with a supplemental tube of 50 mM MgCl to allow you to customize and titrate your reactions if required In any given reaction the Tag Full enzyme tolerates a wide range of Mo concentrations This formula tion eliminates the need to add Mg as a separate component during reaction setup Our enzyme is also versatile it performs just as well when used with an alternative PCR buffer containing ammonium sulfate and a higher MgCl con centration Figure 3
33. zyme in each PCR reaction Favorable results can be generated using as little as 0 2 units in a single reaction Figure 2 Higher yields Taq Full Hot Start polymerase mix produces higher yields of each of the fragments in the 0 5 3 5 kb range than other hot start DNA polymerases Figure 3 In addition the Tag Full Hot Start enzyme consistently performs across this range of amplicon sizes The efficiency of Taq Full Hot Start DNA polymerase and its ability to withstand a high number of PCR cycles allows you to obtain higher yields These advantages translate into significant benefits whether your key objective is conserving limited and precious samples or generating more data per unit of Taq Full DNA polymerase or both Unlike other DNA polymerases currently offered by Clontech Taq Full DNA polymerase is a recombinant version of the full length Thermus aquaticus enzyme 94 kD Our Advantage Advantage 2 and TITANIUM PCR enzymes are truncated N terminal deletion mutants of wild type Tag polymerase The Tag Full DNA polymerase has two catalytic activities 1 It catalyzes the 5 to 3 polymerization of nucleotides into duplex DNA with a processivity of 50 60 nucleotides and an extension rate of about 75 nucleotides per second and 2 It contains a double strand specific 5 to 3 exonuclease activity reviewed in McPherson et al 2000 Its half life of 40 minutes at 95 C makes it highly suitable for lengthy PCR cyc
Download Pdf Manuals
Related Search