ABI PRISM® dRhodamine Terminator Cycle Sequencing Ready
Contents
1. Step Action 1 In the Data Utility application choose Make Matrix from the Utilities menu The Make Matrix dialog box appears 2 In the Make Matrix dialog box click the T7 Terminator Matrix button at the lower left 3 Click on the box for each nucleotide base and enter the data file that corresponds to the correct matrix standard as shown in Table 6 on page 30 note the order of the matrix standard files 4 Enter the same numbers for each matrix standard sample in the Start at and Points boxes as were used for the Dye Primer Matrix and Taq Terminator Matrix 5 Click Update File A dialog window appears 6 Choose dRhod from the ABI folder within the System folder and click Save The Make Matrix dialog box should look like that shown below Make Matrix 23edROH matrix std Start at 17 dR66 matrix std Start at 6 21 dR110 matrix sta Start at 19 dTRMRR matrix std Start at Points 1500 10 cer Instrument Comment Dye Primer Matrix Taq Terminator Matrix QT Terminator Matrix 7 a Click OK The computer makes the matrix When finished a dialog window appears with the message Make matrix successfully completed b Click OK 35 To check the instrument file Step Action 1 From the Utilities menu choose Copy Matrix 2 Under Source select Instrument file and choose dRhod from the ABI folde2. Materials Ready Reaction The ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Kit Reagents Reaction Kits contain sufficient reagents to sequence 100 or 1000 templates P N 403044 and 403045 respectively Enough standard primer and double stranded template for 12 control reactions are included in the 100 reaction kits The 1000 reaction kits contain enough standard primer and template for at least 50 reactions The kit reagents are listed below Storage and Use of the Kit Terminator Ready Reaction Mix A Dye Terminator labeled with dichloro R6G C Dye Terminator labeled with dichloro TAMRA G Dye Terminator labeled with dichloro R110 T Dye Terminator labeled with dichloro ROX deoxynucleoside triphosphates dATP dCTP dITP dTTP AmpliTag DNA Polymerase FS with thermally stable pyrophosphatase MgCl Tris HCl buffer pH 9 0 pGEM 3Zf double stranded DNA Control Template 0 2 ug uL 21 M13 Control Primer forward 0 8 pmol uL The ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Reaction Kit should be stored at 15 to 25 C Prior to each use of the kit allow the frozen stocks to thaw at room temperature do not heat Mix each stock thoroughly and then centrifuge briefly to collect all the liquid at the bottom of each tube Whenever possible thawed materials should be kept on ice during use Reagents and Equipment Not Included In addition to the reagents supplied in this kit other item
3. automated sequencing machine or other authorized DNA sequencing machines that have been authorized for such use by Applied Biosystems or for manual DNA sequencing No license is hereby granted for use of this kit or the reagents therein in any other automated sequencing machine Such sublicense is granted solely for research or other uses that are not unlawful No other license is granted expressly impliedly or by estoppel For information concerning the availability of additional license to practice the patented methodologies contact Amersham Life Science Inc Vice President Regulatory Affairs P O Box 22400 Cleveland Ohio 44122 Patents are pending in countries outside the United States Notice to Purchaser Limited License The purchase price of this product includes a limited nontransferable license under U S patents or its foreign counterparts to use only this amount of the product for DNA Sequencing and related processes described in said patent solely for the research and development activities of the purchaser No license under these patents to use the PCR process is conveyed expressly or by implication to the purchaser by the purchase of this product A license to use the PCR process for certain research and develop ment activities accompanies the purchase of certain reagents from licensed suppliers such as Applied Biosystems when used in conjunction with an Authorized Thermal Cycler or is available from Applied Biosystems Further
4. its maximum fluorescence at a different wavelength During data collection on the ABI PRISM 310 and ABI PRISM 377 instruments the ABI PRISM Collection software collects light intensities from four specific areas on the CCD camera each area corresponding to the emission wavelength of a particular fluorescent dye Each of these areas on the CCD camera is referred to as a virtual filter since no physical filtering hardware like band pass glass filters is used The information that specifies the appropriate virtual filter settings for a particular set of fluorescent dyes is contained in each appropriate ABI PRISM Collection module file In the dRhodamine dyes dR110 emits at the shortest wavelength and is detected as blue followed by dR6G green dTAMRA yellow and ROX red Although each of these dyes emits its maximum fluorescence at a different wavelength there is some overlap in the emission spectra between the four dyes Figure 5 on page 4 The goal of multicomponent analysis is to isolate the signal from each dye so that there is as little noise in the data as possible The precise spectral overlap between the four dyes is measured by running DNA fragments labeled with each of the dyes in separate lanes of a gel or in separate injections on a capillary These dye labeled DNA fragments are called matrix standard samples The Data Utility software see page 30 then analyzes the data from each of these four samples and creates an
5. samples on the ABI PRISM 377 with XL Upgrade Step Action 1 Prepare a loading buffer by combining the following in a 5 1 ratio deionized formamide 25mM EDTA pH 8 0 with blue dextran 50 mg mL WARNING CHEMICAL HAZARD Formamide is a teratogen and is harmful by inhalation skin contact and ingestion Use in a well ventilated area Use chemical resistant gloves and safety glasses when handling If ethanol precipitation was used for purification Resuspend each sample pellet in loading buffer as follows 4uL for a 36 well gel 2yL for a 48 well or 64 well gel If spin columns were used for purification Resuspend each sample pellet in 4 uL of loading buffer Vortex and spin the samples Heat the samples at 95 C for 2 minutes to denature Place on ice until ready to load Load each sample into a separate lane of the gel as shown below Comb Size Purification Method Loading Volume pL 36 well ethanol precipitation 2 spin column 1 48 well ethanol precipitation 1 64 well spin column 1 Appendix A Making Instrument Matrix Files Multicomponent Multicomponent analysis is the process that separates the four different Analysis fluorescent dye colors into distinct spectral components The four dyes used in the ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Reaction Kit are dR110 dR6G dTAMRA and dROX Each of these fluorescent dyes emits
6. the tubes the more unincorporated dye terminators will remain in the samples Visually inspect the sample tubes for residual supernatants If there are any residual supernatants a Place the tubes in the microcentrifuge in the same orientation as in step 5 and spin for 5 10 seconds b Aspirate the supernatants carefully as in step 6 Dry the samples in a vacuum centrifuge for 10 15 minutes or to dryness Alternatively place the tubes with the lids open in a heat block or thermal cycler at 90 C for 1 minute Precipitation in MicroAmp Trays Step Action 1 Remove the MicroAmp Tray from the thermal cycler Remove the caps from each tube 2 Add 74 uL of 70 EtOH 0 5 mM MgCl to each tube Alternatively add 20 uL of 2 mM MgCl and then 55 uL of 95 ethanol 3 Seal the tubes by applying a piece of 3M Scotch Tape 425 3 adhesive backed aluminum foil tape Press the foil onto the tubes to prevent any leakage 4 Invert the tray a few times to mix Precipitation in MicroAmp Trays continued Step Action 5 Leave the tray at room temperature for 10 15 minutes to precipitate the extension products Note Precipitation times less than 5 minutes will result in the loss of very short extension products Precipitation times greater than 24 hours will increase the precipitation of unincorporated dye terminators Place the tray in a table top centrifuge with tube tray
7. using the DNA Thermal Cycler TC1 or DNA Thermal Cycler 480 Overlay the reaction mixture with 40 uL of light mineral oil Cycle Sequencing To sequence DNA on the GeneAmp PCR System 9600 or 2400 on the GeneAmp 9600 or 2400 Cycle Sequencing on the DNA Thermal Cycler TC1 or DNA Thermal Cycler 480 Step Action 1 Place the tubes in a thermal cycler and set the volume to 20 pL 2 Repeat the following for 25 cycles Rapid thermal ramp to 96 C 96 C for 10 sec Rapid thermal ramp to 50 C 50 C for 5 sec Rapid thermal ramp to 60 C 60 C for 4 min gt 9 9 9 9 Rapid thermal ramp to 4 C and hold until ready to purify Spin down the contents of the tubes in a microcentrifuge Proceed to Purifying Extension Products on page 18 To sequence DNA on the TC1 or DNA Thermal Cycler 480 Step Action 1 Place the tubes in a thermal cycler and set the volume to 20 pL 2 Repeat the following for 25 cycles Rapid thermal ramp to 96 C 96 C for 30 sec Rapid thermal ramp to 50 C 50 C for 15 sec Rapid thermal ramp to 60 C 60 C for 4 min 9 9 9 9 9 Rapid thermal ramp to 4 C and hold until ready to purify Spin down the contents of the tubes in a microcentrifuge Proceed to Purifying Extension Products on page 18 15 Cycle Sequencing on the CATALYST 800 Templates that have been prepared a
8. will be at an angle in the column after the first spin 12 Discard the column The sample is in the sample collection tube 13 Dry the sample in a vacuum centrifuge for 10 15 minutes or until dry Do not over dry Sample Electrophoresis Overview Follow the procedure below for the sequencer you use For more information about using a specific instrument refer to the user s manual for that instrument Cycle sequencing with the dRhodamine dye terminators requires new run modules and dye set primer mobility files that are found on the diskette supplied with the dRhodamine Matrix Standards Kit P N 403047 They can also be obtained from the Applied Biosystems site on the World Wide Web www appliedbiosystems com techsupport from Applied Biosystems Technical Support or from your local field applications specialist call your local sales office for more information IMPORTANT You cannot use dRhodamine dye terminators and rhodamine dye terminators on the same gel The two types of terminators use different run modules dye set primer mobility files and instrument matrix files Run Modules Use the appropriate run module as shown in Table 4 Table 4 Run Modules Instrument Configuration Run Module ABI PRISM 310 DNA Sequencing Polymer 250 pL syringe DNA Seq Run 250 uL E Sequencing Capillary POP 6 polymer 1 mL syringe 61 cm 50 um i d Seq POP6 1 mL E capillary POP 6 polymer Rap
9. 00 columns Table top centrifuge with 96 tube tray adaptor Thermal cycler Applied Biosystems Applied Biosystems P N 402840 Applied Biosystems P N 402839 Applied Biosystems P N 401821 Applied Biosystems P N 402790 P N 402791 3M Scotch Tape P N 425 3 Applied Biosystems P N N930 2119 MLS Princeton Separations P N CS 901 Applied Biosystems P N 401763 P N 401762 MLS Applied Biosystems Table 2 Equipment Supplied by the User continued Item Source Vacuum centrifuge Savant Speedvac P N DNA100 or equivalent Vortexer MLS Technical Support For the latest services and support information for all locations go to hitp www appliedbiosystems com then click the link for Services and Support At the Services and Support page you can Search through frequently asked questions FAQs Submit a question directly to Technical Support Order Applied Biosystems user documents MSDSs certificates of analysis and other related documents Download PDF documents Obtain information about customer training Download software updates and patches In addition the Services and Support page provides access to worldwide telephone and fax numbers to contact Applied Biosystems Technical Support and Sales facilities Preparation of Templates Control DNA Templates Single stranded DNA Templates Double stranded DNA Templates Transposons Always use a control templat
10. ABI PnisM dRhodamine Terminator Cycle Sequencing Ready Reaction Kit With AmpliTaq DNA Polymerase FS Protocol Applied E Bibbystems Copyright 2003 2010 Applied Biosystems For Research Use Only Not for use in diagnostic procedures Notice to Purchaser Limited License A license under the process claims of U S patents or their foreign counterpart claims has an up front fee component and a running royalty component The purchase price of the ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Reaction Kit includes limited non transferable rights under the running royalty component to use only this amount of the product to practice the DNA sequence and fragment analysis processes described in said patents when this product is used in conjunction with an Authorized DNA sequence analysis instrument whose use is covered under the up front fee component of these patents No other rights are granted expressly by implication or by estoppel or under any other patent rights owned or licensable by Applied Biosystems Further information relating to the purchase of licenses for DNA sequence and fragment analysis and other applications may be obtained by contacting the Director of Licensing at Applied Biosystems 850 Lincoln Centre Drive Foster City CA 94404 U S A Notice to Purchaser Limited License The purchase of the ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Reaction Kit includes a limited nontrans ferable n
11. ATTGTAAT ACGACTCACT ATAGGGCGAA TTCGAGCTCG 40 GTACCCGGGG ATCCTCTAGA GTCGACCTGC AGGCATGCAA 80 GCTTGAGTAT TCTATAGTGT CACCTAAATA GCTTGGCGTA 120 ATCATGGTCA TAGCTGTTTC CTGTGTGAAA TTGTTATCCG 160 CTCACAATTC CACACAACAT ACGAGCCGGA AGCATAAAGT 200 GTAAAGCCTG GGGTGCCTAA TGAGTGAGCT AACTCACATT 240 AATTGCGTTG CGCTCACTGC CCGCTTTCCA GTCGGGAAAC 280 CTGTCGTGCC AGCTGCATTA ATGAATCGGC CAACGCGCGG 320 GGAGAGGCGG TTTGCGTATT GGGCGCTCTT CCGCTTCCTC 360 GCTCACTGAC TCGCTGCGCT CGGTCGTTCG GCTGCGGCGA 400 GCGGTATCAG CTCACTCAAA GGCGGTAATA CGGTTATCCA 440 CAGAATCAGG GGATAACGCA GGAAAGAACA TGTGAGCAAA 480 AGGCCAGCAA AAGGCCAGGA ACCGTAAAAA GGCCGCGTTG 520 CTGGCGTTTT TCCATAGGCT CCGCCCCCCT GACGAGCATC 560 ACAAAAATCG ACGCTCAAGT CAGAGGTGGC GAAACCCGAC 600 AGGACTATAA AGATACCAGG CGTTTCCCCC TGGAAGCTCC 640 CTCGTGCGCT CTCCTGTTCC GACCCTGCCG CTTACCGGAT 680 ACCTGTCCGC CTTTCTCCCT TCGGGAAGCG TGGCGCTTTC 720 TCATAGCTCA CGCTGTAGGT ATCTCAGTTC GGTGTAGGTC 760 GTTCGCTCCA AGCTGGGCTG TGTGCACGAA CCCCCCGTTC 800 AGCCCGACCG CTGCGCCTTA TCCGGTAACT ATCGTCTTGA 840 GTCCAACCCG GTAAGACACG ACTTATCGCC ACTGGCAGCA 880 GCCACTGGTA ACAGGATTAG CAGAGCGAGG TATGTAGGCG 920 GTGCTACAGA GTTCTTGAAG TGGTGGCCTA ACTACGGCTA 960 CACTAGAAGG ACAGTATTTG GTATCTGCGC TCTGCTGAAG 1000 Worldwide Sales Offices Applied Biosystems vast distribution and Service network composed of highly trained support and applications personnel reaches 150 countries on six continents For international office locations please call our local office or refer to
12. adaptor for 20 30 minutes at the maximum speed This should be at least 1400 x g but less than 3000 x g Note A MicroAmp tube in a MicroAmp Tray can withstand 3000 x g for 30 minutes IMPORTANT Proceed to the next step immediately Without disturbing the precipitates remove the adhesive tape and discard the supernatant by inverting the tray onto a paper towel folded to the size of the tray Place the inverted tray with the towel into the table top centrifuge and spin at 500 1000 x g for 1 minute Remove the tray and discard the paper towel Note Pellets may or may not be visible Vacuum drying of the samples is not necessary 21 22 Shrimp Alkaline Phosphatase Digestion Optional The following shrimp alkaline phosphatase SAP digestion procedure is optional It can be used for more efficient removal of unincorporated dye terminators To perform shrimp alkaline phosphatase SAP digestion Step Action 1 At the end of thermal cycling add 2 uL of SAP 1 U uL and 18 uL of 1X SAP buffer to each tube Seal each tube and incubate at 37 C for 30 minutes 2 For precipitation in microcentrifuge tubes a Transfer the contents of each tube to a 1 5 mL microcentrifuge tube b Add 150 uL of 70 EtOH 0 5 mM MgCl to each tube Alternatively add 40 uL of 2 mM MgCl and then 110 uL of 95 ethanol c Proceed to step 3 of Precipitation in microcentrifuge tubes on page 19 F
13. be used for the run When the run is completed you must make a matrix file with the new matrix standards as detailed i n Appendix A on page 29 To run the samples on the ABI PRISM 310 Step Action 1 Resuspend each sample pellet in 12 uL of Template Suppression reagent TSR supplied with the polymer Vortex and spin the samples Heat the samples at 95 C for 2 minutes to denature then chill on ice Vortex and spin the samples again Place on ice until ready to use Note Occasionally you may want to prepare only a portion of a sequencing reaction for analysis on the ABI PRISM 310 and reserve the rest for analysis later or elsewhere refer to the ABI PRISM 310 Genetic Analyzer User s Manual for more information Refer to the ABI PRISM 310 Genetic Analyzer User s Manual for guidelines on loading the samples Electrophoresis on Electrophoresis on the ABI PRISM 377 DNA Sequencer requires the the ABI PRISM 377 appropriate run module see Table 4 on page 25 dye set primer mobility file see Table 5 on page 26 and an instrument matrix file prepared as in Appendix A on page 29 You can use any plate check and prerun modules Note The first time you run sequencing reactions with the new dRhodamine dye terminators any matrix file or none can be used for the run When the run is completed you must make an instrument matrix file with the new matrix standards as detailed in Ap
14. dye terminators Step Action 1 For each sequencing reaction prepare a 1 5 mL microcentrifuge tube containing the following 2 0 uL of 3 M sodium acetate NaOAc pH 4 6 50 uL of 95 ethanol EtOH 2 Pipet the entire contents of each extension reaction into a tube of sodium acetate ethanol mixture Mix thoroughly To remove reactions run on the TC1 or DNA Thermal Cycler 480 Place the pipette tip into the bottom of the reaction and carefully remove the reaction from the oil Oil Reaction IMPORTANT Transfer as little oil as possible 3 Vortex the tubes and place on ice for 10 minutes to precipitate the extension products To remove excess dye terminators continued Step Action 4 Spin the tubes in a microcentrifuge for 15 30 minutes at maximum speed Carefully aspirate the supernatant with a pipette and discard Rinse the pellet with 250 uL of 70 ethanol Spin for five minutes in a microcentrifuge at maximum speed Again carefully aspirate or decant the supernatant and discard Dry the pellet in a vacuum centrifuge for 10 15 minutes or until dry Do not over dry Simplified Ethanol These procedures require 7096 ethanol EtOH containing 0 5 mM Precipitation MgCl This reagent can be prepared in situ or as a stock solution Procedures To prepare the 70 EtOH 0 5 mM MgCl stock solution Step Action 1 Combine the following i
15. e We recommend M13mp18 as a single stranded control pGEM 3Zf as a double stranded control A protocol for preparing M13 templates is provided in the AB PRISM DNA Sequencing Guide P N 903563 Prepare adequate template to check purity and to quantitate the DNA accurately The recommended concentrations and quantities are shown in Table 3 on page 13 The quality of your sequencing results will be directly proportional to the quality of your starting DNA template The optimal procedure for preparing a particular plasmid depends on the particular bacterial strain and the yield of each construct Good sequencing data has been obtained from plasmids isolated by cesium banding methods and alkaline lysis miniprep methods such as the ABI PRism Plasmid Miniprep Kit P N 402790 or 402791 The recommended concentrations and quantities are shown in Table 3 on page 13 Transposons TNs are mobile genetic elements regions of DNA capable of inserting themselves or copies of themselves into the genome Transposons encode the proteins that facilitate their insertion into the target DNA This property of transposons can be exploited to place unique primer binding sites randomly throughout any large segment of DNA These primer sites may be used subsequently as templates for PCR and or sequencing reactions Transposon insertion is an alternative to subcloning or primer walking when sequencing a large cloned DNA region The Primer Island Transp
16. e Sequencing Analysis software If many peaks are off scale dilute the matrix standards and rerun them 33 To make the Taq Terminator Matrix Step Action 1 In the Data Utility application choose Make Matrix from the Utilities menu The Make Matrix dialog box appears 2 In the Make Matrix dialog box click the Taq Terminator Matrix button at the lower left 3 Click on the box for each nucleotide base and enter the data file that corresponds to the correct matrix standard as shown in Table 6 on page 30 IMPORTANT The order of matrix standard data files is different from that in the Dye Primer Matrix see Table 6 on page 30 4 Enter the same numbers for each matrix standard sample in the Start at and Points boxes as for the Dye Primer Matrix 5 Click Update File A dialog window appears 6 Choose dRhod from the ABI folder within the System folder and click Save The Make Matrix dialog box should look like that shown below Make Matrix C 23 dROH matris std Start at 17 dR66 matrix std Start at G 21 dR110 matrix sta Start at 19 dTRMRR matrix std Start at Points 1500 10 eee Instrument Comment Dye Primer Matrix Taq Terminator Matrix QT Terminator Matrix 7 a Click OK The computer makes the matrix When finished a dialog window appears with the message Make matrix successfully completed b Click OK To make the T7 Terminator Matrix
17. enaturation step required for double stranded DNA same protocol for both single and double stranded templates less starting template needed 9 9 more reproducible results Applied Biosystems has designed new dichlororhodamine dRhodamine dye terminators to give more even peak heights than the original rhodamine dye terminators The new dyes have narrower emission spectra giving less spectral overlap and therefore less noise The new dRhodamine dye terminators have the following dye labels Color of Raw Data Color of Raw Data on ABI PRISM 310 on ABI PRISM 377 Terminator Dye Label Electropherogram Gel Image A dichloro R6G green green C dichloro TAMRA black yellow G dichloro R1 10 blue blue T dichloro ROX red red Data collected in Applied Biosystems laboratories shows more uniform signal intensities with the new dyes and a reduction of the weak G after A pattern that is characteristic of the original rhodamine dye terminators With less noise better signal uniformity and a reduced weak G after A pattern the new dRhodamine dye terminators can give better sequencing results than the rhodamine dye terminators Figure 1 and Figure 2 TGRRTCGGCCRRCGCGCGG6GG RG6RGG6CGGTTTGCGTRTTGG G CG CTCT 300 310 2 3 4 Figure 1 Region of pGEM 3Zf sequenced with rhodamine dye terminators GA ATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTC 300 310 320 330 34 Figure 2 Region of pGEM 3Zf sequ
18. enced with dRhodamine dye terminators Note in particular that the G nucleotides after A nucleotides near base 320 are much stronger with the dRhodamine dye terminators than with the rhodamine dye terminators dRhodamine Dye The structures of the dRhodamine dye terminators are shown in Terminator Figure 3 Structures Note Uracil is used in place of thymine in the T Dye Terminator LA o 4 ddU EO dROX KC ddG EO dR110 ddG HaC A CHs ddC EO dTAMRA ddA ddA dR6G Figure 3 dRhodamine dye terminators Dye Spectra The normalized absorption and emission spectra of the dRhodamine dyes are shown in Figure 4 and Figure 5 respectively dR110 dR6G dTAMRA dROX Absorbance 0 450 500 550 600 650 Wavelength nim Figure 4 Absorption spectra of dRhodamine dyes dR110 dR6G dTAMRA dROX Fluorescence 500 550 600 650 700 Wavelength nm Figure 5 Emission spectra of dRhodamine dyes dRhodamine Terminator Ready Reaction Kit Instrument Platforms Filter Set E The ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Reaction Kit combines the unique properties of AmpliTaq DNA Polymerase FS and the new dRhodamine dye terminators with the convenience of the Ready Reaction format In this format the dye terminators deoxynucleoside triphosphates enzymes magnesium chloride and buffer are premixed into a single tube of Ready Reaction Mix and are ready to use These reagents are suitab
19. ent Comment Dye Primer Matrix Taq Terminator Matrix QT Terminator Matrix 5 Click on the box for each nucleotide base and enter the data file that corresponds to the correct matrix standard as shown in Table 6 on page 30 6 Enter the analysis start point for each matrix standard sample as determined in step 1 on page 31 7 Click New File A dialog window appears as shown below Name the file dRhod and save it in the ABI folder within the System folder J ABI Folder Y c Shadow amp 3 Generic Matrix 2 i Eject A Koshka s Matrix Seq finalysis Command File Seq Analysis Error File Desktop f Shadow s Matrix Name for new matrix file Cancel dRhod To make the Dye Primer Matrix continued Step Action 8 The Make Matrix dialog box should look like that shown below Note The numbers in the Start at and Points boxes below are typical values Your numbers may vary Make Matrix 21 dR110 matrix std Start at 17 dR66 matrix std Start at G 19 dTRMRR matrix std Start at 23edROH matrix std Start at Points 1500 anne EE Instrument Comment E Dye Primer Matrix Taq Terminator Matrix QT Terminator Matrix 9 a Click OK The computer makes the matrix When finished a dialog window appears with the message Make matrix successfully completed b Click OK 10 If the computer is unable to make a matrix examine the raw data again in th
20. esis on the ABI PRISM 377 02 cece ee eens 27 Electrophoresis on the ABI PRISM 377 with XL Upgrade 28 Appendix A Making Instrument Matrix Files 00 29 Multicomponent Analysis 00 0 0 c eee eee eee 29 Data Utility Software 30 Make the Instrument File 2 0 0 0 0 eee eee eee 31 Appendix B Selecting Sequencing Primers 0 0 37 OVEIVIEW i e oper P aula UE RR RU RETE RR INE wise 37 Recommendations 2 0 0 cece eee ree 37 Appendix C Control Sequence 0 0 eee eee eee 38 Introduction Cycle Sequencing with AmpliTaq DNA Polymerase FS New Dye Terminators This kit formulation contains the sequencing enzyme AmpliTaq9 DNA Polymerase FS This enzyme is a variant of Thermus aquaticus DNA polymerase that contains a point mutation in the active site This results in less discrimination against dideoxynucleotides which leads to a much more even peak intensity pattern This enzyme also has a second mutation in the amino terminal domain that virtually eliminates the 53 nuclease activity of AmpliTaq DNA Polymerase The enzyme has been formulated with a thermally stable inorganic pyrophosphatase to eliminate problems associated with pyrophosphorolysis Cycle sequencing protocols that rely on the use of AmpliTaq DNA Polymerase FS offer the following advantages over traditional sequencing methods less hands on operation no alkaline d
21. id Sequencing 1 mL syringe Seq POP6 1 mL Rapid E 47 cm 50 um i d capillary ABI PRISM 377 36 cm wtr 2X 1200 scans hr any comb Seq Run 36E 1200 36 cm wtr 4X 2400 scans hr any comb 48 cm wtr 2X 1200 scans hr any comb Seq Run 36E 2400 Seq Run 48E 1200 ABI PRISM 377 with XL Upgrade 36 cm wtr 1200 scans hr any comb 36 cm wtr 2400 scans hr any comb 48 cm wtr 1200 scans hr any comb Seq Run 36E 1200 Seq Run 36E 2400 Seq Run 48E 1200 25 Dye Set Primer Use the correct dye set primer mobility file for your instrument as Files shown in Table 5 Table 5 Dye Set Primer Mobility Files Electrophoresis on the ABI PRISM 310 Instrument Dye Set Primer File ABI PRISM 310 DT DSP dR Set AnyPrimer ABI PRISM 310 POP 6 polymer DT POP6 dR Set Any Primer ABI PRISM 310 POP 6 polymer DT POP6 dR Set Any Primer Rapid Sequencing ABI PRISM 3778 DT dR Set Any Primer ABI PRISM 377 with XL Upgrade DT dR Set Any Primer a The dye set primer file can be used with 5 and 5 5 Long Ranger gels and 4 and 4 25 polyacrylamide gels 19 1 acrylamide bis Electrophoresis on the ABI PRISM 310 Genetic Analyzer requires the appropriate run module see Table 4 on page 25 dye set primer mobility file see Table 5 and a matrix file prepared as in Appendix A on page Note dye term 29 The first time you run sequencing reactions with the new dRhodamine inators any matrix file or none can
22. information on purchasing licenses to practice the PCR process may be obtained by contacting the Director of Licensing Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 TRADEMARKS ABI PRISM and its design GeneScan and MicroAmp are registered trademarks of Applied Biosystems or its subsidiaries in the U S and certain other countries AB Design Applera and Catalyst are trademarks of Applied Biosystems or its subsidiaries in the U S and certain other countries AmpliTaq and GeneAmp are registered trademarks of Roche Molecular Systems Inc All other trademarks are the sole property of their respective owners Printed in the USA 06 2010 Part Number 403041 Rev F Contents Introduction oce pheUEDESRRDESPELESDDETUMPET UMEN ERE ES 1 Cycle Sequencing with AmpliTaq DNA Polymerase FS 1 New Dye Terminators 0 00 c eee eee ee eee 1 dRhodamine Dye Terminator Structures 00 3 Dye Spectra toph pe TRE eg sks a Roten as 4 dRhodamine Terminator Ready Reaction Kit 5 Instrument Platforms 5 Filter Set Ed oC RC RS Re oe edes 5 Material se i beu ep ob P e PEU EP 6 Ready Reaction Kit Reagents 00 0002 ee eee ee eee 6 Storage and Use of the Kit llle 6 Reagents and Equipment Not Included 2 00 7 Technical Support asee sua es pre eee eee ee I neers 10 Preparation of Templates 1 0 0 0 cece eee eee ne 11 Co
23. instrument matrix file The instrument file contains tables of numbers with four columns and four rows These numbers are normalized fluorescence intensities and represent a mathematical description of the spectral overlap that is observed between the four dyes Multicomponent analysis of sequencing data is performed automatically by the Sequencing Analysis software which applies a mathematical matrix calculation using the values in the instrument file to all sample data 29 Data Utility Software Using the new dRhodamine based sequencing chemistries requires making instrument files from the new matrix standards found in the dRhodamine Matrix Standards Kit P N 403047 The instrument file is prepared to be consistent with current base calling conventions i e C is blue A is green G is black and T is red in the output files The Data Utility software is used to make instrument files You must put the correct data file for each matrix standard into the correct box in the Data Utility application Table 6 Table 6 Placement of Standards in the Data Utility Application Dye Primer Taq Terminator T7 Terminator Box Matrix Matrix Matrix C dR110 dROX dR6G A dR6G dR6G dTAMRA G dTAMRA dR110 dROX T dROX dTAMRA dR110 You need to make all three matrix files if you wish to use the other dRhodamine sequencing chemistries For example the Collection software will not run with only a terminator matrix in the file A
24. le for performing fluorescence based cycle sequencing reactions on single stranded or double stranded DNA templates or on polymerase chain reaction PCR fragments The protocols provided in this document were optimized using GeneAmp PCR Instrument Systems thermal cyclers Reactions can also be carried out on the CATALYST 800 Molecular Biology LabStation or the ABI PRISM 877 Integrated Thermal Cycler General instructions are given for using the kit reagents to generate samples for the ABI PRISM 310 Genetic Analyzer the ABI PRISM 377 DNA Sequencer and the ABI PRISM 377 DNA Sequencer with XL Upgrade ABI PRISM 377XL For more detailed instructions refer to the appropriate instrument user s manual IMPORTANT You must install new dye set primer mobility files and run modules see Sample Electrophoresis on page 25 and make new instrument matrix files to use the dRhodamine dye terminators see Appendix A on page 29 The ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Reaction Kit is for use with the ABI PRISM 310 Genetic Analyzer the ABI PRISM 377 DNA Sequencer and the ABI PRISM 377 DNA Sequencer with XL Upgrade IMPORTANT This kit is not designed for use with the ABI 373 DNA Sequencer or the ABI 373 DNA Sequencer with XL Upgrade You must use run modules and dye set primer mobility files for virtual Filter Set E when sequencing with the ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Reaction Kit
25. mal Cycler TC1 and the DNA Thermal Cycler 480 Applied Biosystems P N 403047 Applied Biosystems P N 4303120 available September 1997 Applied Biosystems P N 402091 Applied Biosystems P N 401884 Applied Biosystems P N 402844 Applied Biosystems P N 402824 Major laboratory suppliers MLS MLS Applied Biosystems P N 402055 MLS MLS Applied Biosystems P N 0186 2302 Table 1 Reagent Reagents Supplied by the User continued Source Shrimp alkaline phosphatase SAP 1 U uL and 10X SAP buffer 200 mM Tris HCl 100 mM MgCl pH 8 0 Sodium acetate NaOAc 3 M pH 4 6 Amersham Life Science P N E 70092 Z Applied Biosystems P N 400320 Table 2 Equipment Supplied by the User Item Source ABI PRISM 310 Genetic Analyzer ABI PRISM 377 DNA Sequencer or ABI PRISM 377 DNA Sequencer with XL Upgrade ABI PRISM 310 Capillaries 61 cm x 50 um i d for long read sequencing with POP 6 ABI PRISM 310 Capillaries 47 cm x 50 um i d for rapid sequencing with POP 6 DNA Sequencing Capillaries internally coated for use with the DNA Sequencing Polymer ABI PRISM Plasmid Miniprep Kit 100 purifications 500 purifications Adhesive backed aluminum foil tape Centricon 100 Micro Concentrator columns Microcentrifuge variable speed capable of reaching 14 000 x g Spin column Centri Sep 1 mL in North America outside North America 32 columns 1
26. n a 1 5 mL microcentrifuge tube 1mL 7096 EtOH 10L0 5 M MgCl Vortex briefly to mix Precipitation in microcentrifuge tubes Step Action 1 Pipet the entire contents of each extension reaction into a 1 5 mL microcentrifuge tube Note If the TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove the reactions from the tubes as shown in step 2 of the EtOH NaOAc procedure on page 18 Add 74 uL of 70 EtOH 0 5 mM MgCl to each tube Alternatively add 20 uL of 2 mM MgCl and then 55 uL of 95 ethanol Close the tubes and vortex briefly 19 Precipitation in microcentrifuge tubes continued Step Action 4 Leave the tubes at room temperature for 10 15 minutes to precipitate the extension products Note Precipitation times less than 5 minutes will result in the loss of very short extension products Precipitation times greater than 24 hours will increase the precipitation of unincorporated dye terminators Place the tubes in a microcentrifuge and mark their orientations Spin the tubes for 10 20 minutes at maximum speed IMPORTANT Proceed to the next step immediately Carefully aspirate the supernatants with a separate pipette for each sample and discard Pellets may or may not be visible IMPORTANT The supernatants must be removed completely as unincorporated dye terminators are dissolved in them The more residual supernatant left in
27. n error message will appear saying Tag not found Cannot start the run Make the Instrument File To make the Dye Primer Matrix Step Action 1 Set the analysis start point and the number of data points to analyze a Inthe Sequencing Analysis software examine the raw data for one of the matrix standard samples as shown below b Select a starting point where there are no peaks and the baseline is flat C Select a number of data points to analyze such that no peaks in the range are off scale i e above 4000 relative fluorescence units RFU and where the baseline at the end of the range is flat A typical number of data points is 1500 23edROK matrix std Repeat step 1 for each matrix standard sample Record the results for later use IMPORTANT The number of data points analyzed is the same for each matrix standard Choose starting points for each sample such that all peaks are less than 4000 RFU and where both the starting and ending points have flat baselines and no peaks Launch the Data Utility software 31 32 To make the Dye Primer Matrix continued Step Action 4 From the Utilities menu choose Make Matrix The Make Matrix dialog box appears as shown below Verify that the Dye Primer Matrix button at the lower left is selected Make Matrix cm Start at a Start at E Start at am Start at Points Instrum
28. ntrol DNA Templates 11 Single stranded DNA Templates 0 esses 11 Double stranded DNA Templates selle lesen 11 Transposon Lo ie See ee ee AE S ee e DR ee 11 Symmetric PCR Templates 0 0 0 eee ee eee 12 Purifying PCR Fragments 00 0 0 cee eee eee 12 DNA Quantity ice neii uau RERO ES UI 13 Cycl Sequencing occus e ERE wy td PONE NESSUN 14 OVerVIe Ws vote ecole e epe qr e Oh ahh um dese n aay cling 14 Mixing the Reagents 0 cece eee eee eee 14 Cycle Sequencing on the GeneAmp 9600 or 2400 15 Cycle Sequencing on the DNA Thermal Cycler TC1 or DNA Thermal Cycler ASO Files esetES Reg a As apes sre His ERG Eee 15 Cycle Sequencing on the Catalyst 800 04 16 Cycle Sequencing on the ABI PRISM 877 ITC sues 17 Purifying Extension Products llle eese 18 OVerVIeW s eeeavpP ISAAC EE PE 18 Ethanol Sodium Acetate Precipitation Procedure 18 Simplified Ethanol Precipitation Procedures 19 Shrimp Alkaline Phosphatase Digestion Optional 22 Spin Column Purification 0 0 0 0 eee eee eee ee eee 23 Sample Electrophoresis 0 0 0 cece cee 25 OVEIVIEW iach et he MA EN Eng ee i ey 25 Run Modules 1 5 tese spe PPRve SADDER aeree ES ep RS 25 Dye SeUPrimer Files erre De Rr Er EY 26 Electrophoresis on the ABI PRISM310 0 0 0 e eee eee 26 Electrophor
29. on 1 Assemble the Centricon 100 column according to the manufacturer s recommendations 2 Load 2 mL deionized water onto the column 3 Add the entire sample to the column 4 Spin the column at 3000 x g in a fixed angle centrifuge for 10 minutes Note The manufacturer recommends a maximum speed of 1000 x g but 3000 x g has worked well in Applied Biosystems laboratories If you are following the manufacturer s guidelines increase the time to compensate 5 Remove the waste receptacle and attach the collection vial 6 Invert the column and spin it at 270 x g for 2 minutes to collect the sample This should yield approximately 40 60 uL of sample 7 Add deionized water to bring the purified PCR fragments to the original volume DNA Quantity If possible quantitate the amount of purified DNA by measuring the absorbance at 260 nm or by some other method The recommended concentrations and amounts are shown in Table 3 Table 3 Recommended DNA Concentrations and Quantities DNA Concentration Quantity single stranded DNA 50 100 ng uL 50 100 ng double stranded DNA 100 200 ng uL 200 500 ng PCR product DNA 5 15 ng uL 30 90 ng The ranges given in the table above should work for all primers You may be able to use even less DNA especially when sequencing with the 21 M13 primer The amount of PCR product to use in sequencing will also depend on the length and purity of the PCR product N
30. on exclusive license without the right to resell repackage or sublicense under the process claims of U S patents and corresponding foreign patent claims and patent applications to use this product solely with an Applied Biosystems commercial automated DNA sequencing machine or other authorized automated DNA sequencing machines that have been authorized under these patents by Applied Biosystems No license is hereby granted for the use of this kit or the reagents therein in any other automated sequencing machine Such license is granted solely for research and other uses that are not unlawful No other license is granted expressly impliedly or by estoppel For information concerning the availability of additional licenses to practice the patented methodologies contact Director of Licensing Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 U S A Patents are pending in countries outside the United States Notice to Purchaser About Limited License This kit reagent is sold pursuant to a limited sublicense from Amersham International plc under one or more U S Patent Nos 5 498 523 5 614 365 and corresponding foreign patents and patent applications The purchase of this kit reagent includes a limited non exclusive sublicense without the right to resell repackage or further sublicense under such patent rights to use this reagent for DNA sequencing or fragment length analysis solely with an Applied Biosystems commercial
31. or precipitation in MicroAmp Trays a Add 150 uL of 70 EtOH 0 5 mM MgCl to each tube Alternatively add 40 uL of 2 mM MgCl and then 110 uL of 95 ethanol b Proceed to step 3 of Precipitation in MicroAmp Trays on page 20 Spin Column We recommend Centri Sep spin columns from Princeton Separations Purification P N CS 901 Refer to the manufacturers instructions and User Bulletin Number 20 for more details Tips for optimizing spin column purification Use one column for each sample Do not process more columns than you can handle conveniently at one time Load the sample in the center of the column bed Make sure that the sample does not touch the sides of the column Spin the column at 325 1300 x g for best results Use the following formula to calculate the best speed for your centrifuge g 11 18 x rx rpm 1000 where g relative centrifugal force rpm revolutions per minute r radius of the rotor in cm The entire spin column procedure should be performed without interruption to ensure optimal results Do not allow the column to dry out To perform spin column purification Step Action 1 Gently tap the column to cause the gel material to settle to the bottom of the column Remove the upper end cap and add 0 8 mL of deionized water Replace the upper end cap and invert the column a few times to mix the water and gel material 4 Allow the gel to hydrate a
32. osition Kit P N 402984 provides reagents for generating artificial transposon insertions into target DNA in vitro The artificial transposon contains the Pl and Pl priming sites The Primer Island reagents are combined with a target DNA of choice and used to transform Escherichia coli To identify the E coli carrying the transposon the transformed bacteria are plated on Luria Bertani LB agar plates containing carbenicillin and trimethoprim antibiotics Each carbenicillin and trimethoprim resistant colony has integrated a copy of the transposon into the target DNA 11 Symmetric PCR Templates Purifying PCR Fragments The target DNA can be isolated for sequencing or PCR analysis Refer to the Primer Island Transposition Kit Protocol P N 402920 for more information Cycle sequencing has been found to provide the most reproducible results when sequencing symmetric templates Although symmetric PCR fragments can be difficult to denature with traditional sequencing methods cycle sequencing provides several chances to denature and extend the template which ensures adequate signal in the sequencing reaction For optimum results purify the PCR product before sequencing In general any method that removes dNTPs and primers should work We recommend Centricon 100 columns P N N930 21 19 The protocol for using these columns is provided in Purifying PCR Fragments below To purify PCR fragments Step Acti
33. ote In general higher DNA quantities give higher signal intensities 13 Cycle Sequencing Overview This protocol has been optimized for all Applied Biosystems thermal cyclers including the DNA Thermal Cycler TC1 the DNA Thermal Cycler 480 the CATALYST 800 Molecular Biology LabStation the ABI PRISM 877 Integrated Thermal Cycler and the GeneAmp PCR Systems 9600 and 2400 The protocols contained in this document should work for all six instruments If you use a thermal cycler not manufactured by Applied Biosystems you may need to optimize thermal cycling conditions Ramping time is very important If the thermal ramping time is too fast gt 1 sec poor noisy data may result Mixing the Note The type of tube required depends on the type of thermal cycler used Reagents Forthe DNA Thermal Cycler TC1 and DNA Thermal Cycler 480 use 0 5 mL GeneAmp Thin Walled PCR tubes For the GeneAmp PCR Systems 9600 and 2400 use 0 2 mL MicroAmp PCR tubes If using the CATALYST 800 or ABI PRISM 877 refer to your instrument user s manual for reaction setup To prepare the reaction mixtures Step Action 1 For each reaction add the following reagents to a separate tube Reagent Quantity Terminator Ready Reaction Mix 8 0 uL Template single stranded DNA 50 100 ng double stranded DNA 200 500 ng PCR product 30 90 ng Primer 3 2 pmol Deionized water q s Total Volume 20 uL 2 Mix well and spin briefly 3 If
34. our Web site at www appliedbiosystems com Headquarters 850 Lincoln Centre Drive Foster City CA 94404 USA Phone 1 650 638 5800 Toll Free 1 800 345 5224 Fax 1 650 638 5884 Technical Support For technical support Toll Free 1 800 831 6844 ext 23 Fax 1 650 638 5891 www appliedbiosystems com Applied KS Biosystems Applied Biosystems is committed to providing the world s leading technology and information for life scientists Printed in the USA 06 2010 Part Number 403041 Rev F
35. ous options are available for purge of the thermal cycler plate Quick purge rinses the plate twice with water Standard purge and Terminator purge rinse the plate with water Tris Tween 20 solution then water again and heat the plate during the first two rinses Bleach purge rinses the plate with sodium hypochlorite solution water Tris Tween 20 solution and water again Bleach purge is the most extensive and most time consuming purge but is recommended for regular e g weekly complete cleaning of plates especially when PCR products are used as templates 17 Purifying Extension Products 18 Overview Ethanol Sodium Acetate Precipitation Procedure The ABI PRISM Dye Terminator Cycle Sequencing Kits with AmpliTaq DNA Polymerase FS require much lower amounts of dye terminators than earlier kits with AmpliTaq DNA Polymerase As a result excess dye terminators can be removed either by ethanol precipitation or by using a spin column With ethanol precipitation traces of unincorporated terminators may be seen at the beginning of the sequence data up to base 40 but this is usually minimal Some loss in the recovery of the smallest fragments may also be observed Note These protocols are for use only with AmpliTag DNA Polymerase FS dRhodamine dye terminator chemistry For purifying extension products of other chemistries refer to the appropriate protocol or chemistry guide To remove excess
36. pendix A on page 29 To run samples on the ABI PRISM 377 Step Action 1 Prepare a loading buffer by combining the following in a 5 1 ratio deionized formamide 25mM EDTA pH 8 0 with blue dextran 50 mg mL WARNING CHEMICAL HAZARD Formamide is a teratogen and is harmful by inhalation skin contact and ingestion Use in a well ventilated area Use chemical resistant gloves and safety glasses when handling Resuspend each sample pellet in 4 uL of loading buffer Vortex and spin the samples Heat the samples at 95 C for two minutes to denature Place on ice until ready to load Load each sample into a separate lane of the gel as shown below Purification Method Loading Volume pL ethanol precipitation 2 spin column 1 27 Electrophoresis on the ABI PRISM 377 with XL Upgrade Electrophoresis on the ABI PRISM 377 DNA Sequencer with XL Upgrade requires the appropriate run module see Table 4 on page 25 dye set primer mobility file see Table 5 on page 26 and an instrument matrix file prepared as in Appendix A on page 29 You can use any plate check and prerun modules Note The first time you run sequencing reactions with the new dRhodamine dye terminators any matrix file or none can be used for the run When the run is completed you must make an instrument matrix file with the new matrix standards as detailed in Appendix A on page 29 To run
37. r Terminator and Terminator Automix Sequencing options Predefined temperature profiles are provided for Terminator Sequencing The profile is chosen on the Chemistry page of the Sequencing Notebook and can be edited to make custom profiles Refer to Chapter 4 Using the ABI PRISM 877 Software in the ABI PRISM 877 Integrated Thermal Cycler User s Manual for instructions on editing temperature profiles Terminator Sequencing uses a reaction premix containing the sequencing primer or else requires premixing template with primer in the sample tube Terminator Automix Sequencing combines reaction cocktail lacking primers water primer from one tube and template from another tube This eliminates the requirement for premixing of samples and primers Refer to Chapters 2 and 4 Getting Started and Using the ABI PRISM 877 Software respectively in the ABI PRISM 877 Integrated Thermal Cycler User s Manual Ethanol precipitation can be chosen for dye terminator sequencing The proportions of ethanol and precipitation additive are set for default reaction volumes These volumes can be changed especially if the reaction volume is modified After the program is completed proceed to Purifying Extension Products on page 18 Note On extended runs e g overnight we recommend withholding addition of ethanol until plate processing can be completed This delay can be programmed on the Chemistry page of the Sequencing Notebook Vari
38. r within the System folder The three matrix files within the dRhod instrument file appear as shown below Copy Matrix Instrument Comment Destination No Destination File Instrument Comment 3 Copy Primer Matrix 3 Copy Taq Term Matrix 1 000 0 12 0 011 0 000 1 000 0 127 0 011 0 000 0 455 1 000 0 183 0 000 0 455 1 000 0 183 0 000 0 248 0 483 1 000 0 151 0 248 0 485 1 000 0 151 0 115 0 282 0 529 1 000 0 115 0 282 0 529 1 000 3 Copy T Term Matrix 1 000 0 12 0 011 0 000 0 455 1 000 0 183 0 000 0 248 0 483 1 000 0 151 0 115 0 282 0 529 1 000 3 Make sure that all three matrix files have numbers that range from 0 1 The numbers on the diagonals from top left to bottom right should be 1 If not then repeat the matrix making procedure starting with To make the Dye Primer Matrix on page 31 Note The corresponding numbers for all three matrix files will be the same Click Cancel 5 Restart the Sequencing Analysis software and use dRhod as the instrument file to analyze your sequencing data Appendix B Selecting Sequencing Primers Overview Recommendations The choice of sequencing primer sequence method of primer synthesis and approach to primer purification can have a significant effect on the quality of the sequencing data obtained in dye terminator cycle sequencing reactions with this kit These decisions are particularly important when sequencing is done on real time detection systems where signal st
39. rength is critical Some of the recommendations given here are based on information that is general knowledge while others are based on practical experience gained by Applied Biosystems scientists The following recommendations are provided to help optimize primer selection Primers should be at least 18 bases long to ensure good hybridization Avoid runs of an identical nucleotide This is especially true for guanine where runs of four or more Gs should be avoided Keep the G C content in the range 30 80 For cycle sequencing primers with melting temperatures Tm above 45 C produce better results than primers with lower T For primers with a G C content less than 50 it may be necessary to extend the primer sequence beyond 18 bases to keep the Tm gt 45 C Use of primers longer than 18 bases also minimizes the chance of having a secondary hybridization site on the target DNA Avoid primers that have secondary structure or that can hybridize to form dimers Several computer programs for primer selection are available They can be useful in identifying potential secondary structure problems and determining if a secondary hybridization site exists on the target DNA 37 Appendix C Control Sequence Partial Sequence of pGEM 3Zf 4 from the 221 M13 Forward Primer The sequence of the 21 M13 forward primer followed by the ensuing 1000 bases is shown here TGTAAAACGACGGCCAGT 21 M13 primer GA
40. s described on page 11 should be suitable for use on the CATALYST 800 Molecular Biology LabStation using LabStation 3 0 protocols Follow the protocols in the Turbo Appendix of the CATALYST 800 Molecular Biology LabStation User s Manual to set up your reactions CATALYST Turbo offers Primer and Terminator Sequencing options Predefined temperature profiles are provided for Double Stranded Forward Universal Primer Double Stranded Reverse Universal Primer Single Stranded Forward Primer Quick Cycle for primer sequencing and Terminator These are chosen during the pre run dialogue and can be edited to make custom profiles Terminator Sequencing has two options using a reaction premix containing the sequencing primer or premixing template with primer in the sample tube combining reaction cocktail lacking primers water and primer from one tube and template from another tube This eliminates the requirement for premixing samples and primers Ethanol precipitation is not available for Terminator Sequencing protocols on the CATALYST 800 Molecular Biology LabStation Ethanol precipitation or spin column purification must be performed manually See Purifying Extension Products on page 18 Note Ethanol precipitation is available for Terminator Sequencing protocols on the ABI PRISM 877 Integrated Thermal Cycler see page 17 Cycle Sequencing on the ABI PRISM 877 ITC The ABI PRISM 877 Integrated Thermal Cycler offers Prime
41. s may be required depending on which instrument is used Refer to the individual instrument protocols for the specific items needed Many of the items listed are available from major laboratory suppliers MLS unless otherwise noted Equivalent sources may be acceptable where noted WARNING CHEMICAL HAZARD Before handling the chemical reagents needed for dRhodamine terminator cycle sequencing read the safety warnings on the reagent bottles and in the manufacturers Material Safety Data Sheets MSDS Always wear protective equipment lab coat safety glasses and chemical resistant gloves when handling chemicals Dispose of waste in accordance with all local state and federal health and environmental regulations and laws Reagents and Equipment Table 1 Reagent Reagents Supplied by the User Source ABI PRISM dRhodamine Matrix Standards Kit dRhodamine Terminator Cycle Sequencing Standard with AmpliTaq DNA Polymerase FS DNA Sequencing Polymer with Template Suppression Reagent TSR ABI PRISM 310 Genetic Analyzer Buffer for use with DNA Sequencing Polymer Performance Optimized Polymer 6 POP 6 with TSR ABI PRISM 310 Genetic Analyzer Buffer with EDTA for use with POP 6 Deionized formamide Deionized water 25 mM EDTA ethylenediaminetetraacetate with 50 mg mL blue dextran pH 8 0 Ethanol EtOH non denatured 95 or 70 Magnesium chloride MgCl 0 5 M or 2 mM Mineral oil for the DNA Ther
42. t room temperature for at least 30 minutes Note Rehydrated columns can be stored for a few days at 2 6 C Longer storage in water is not recommended Allow columns that have been stored at 2 6 C to warm to room temperature before use 5 Remove any air bubbles by inverting or tapping the column and allowing the gel to settle 23 To perform spin column purification continued Step Action 6 Remove the upper end cap first then remove the bottom cap Allow the column to drain completely by gravity Note If flow does not begin immediately apply gentle pressure to the column with a pipette bulb Insert the column into the wash tube provided Spin the column in a microcentrifuge at 1300 x g for 2 4 minutes to remove the interstitial fluid Remove the column from the wash tube and insert it into a sample collection tube e g a 1 5 mL microcentrifuge tube 10 Remove the extension reaction mixture from its tube and load it carefully on top of the gel material Note If the TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove the reactions from the tubes as shown in step 2 of the EtOH NaOAc procedure on page 18 11 Spin the column in a microcentrifuge at 1300 x g for 2 4 minutes Note If using a centrifuge with a fixed angle rotor place the column in the same orientation as it was in for the first spin This is important because the surface of the gel
Download Pdf Manuals
Related Search