Instructions for Use
Contents
1. Code J Handpiece communication halted Please restart the System If the problem persists please see the User s Manual for further information or contact Ulthera Support Code K Software halted Please restart the System If the problem persists please see the User s Manual for further Information orcontact Ulthera Support CodeL Transducer out of lines Please replace transducerand continue See User s Manual for further information Code M Handpiece motion halted If the problem persists please see the User s Manual for further Information orcontact Ulthera Support Ulthera Inc Transducer motion wasnot detected Ensure that the transducer Is properly mounted in the handpiece Please be sure to always hit Scan N before removing transducer Remove and reinsert the transducer Communication halted due to an event detected in the control unit Communication halted due to an event detected in the control unit Software washalted due to an event detected in the control unit The transducers remaining line count is zero Remove and replace the transducer Inspect handpiece Ensure that the transduceris properly mounted and latched in the handpiece Page 57 Page 58 Code N USB flash memory connectivity Please check flash drive and continue See User sManualforfurther information Code O The System scanning is disabled because of multiple Code Ms Please contact2. IMAGING CONTROLS Displa ysthe Tools menu see Figure 7 3 Patient Name and ID Displays the name and ID information Total Line Count Number of lines that have been delivered during this treatment session The number of linesdelivered Thisline count value may be reset by tapping Curent Line Count l the Reset button immediately below the line count value HOME BAR Page 38 Ulthera Inc mee ane The number of lines recommended forthe region selected e Transducertype TransducerInformation e Numberof treatment lines remaining total treatment line capacity of transducer The energy per TC P being delivered May be adjusted with the buttons below Lenoth The length of the treatment line being delivered May be adjusted with the g buttons below For planning purposes toggling these buttons displays the associated Transducer Types treatment region infomation on the facial graphic or user regions window being displayed The curent transducer inserted isthe default button selected An available region is displayed semi highlighted and contains the recommended line count for that region The number in the center represents the recommended line count for that region Facial Graphic A selected region is displayed in white and is outlined with the color of the transducer being used The line count in the center represents the running line The facial graphic count for that region indicates the status of treatment regions A tre
3. The Ulthera System hasnot been evaluated for use in patientson an anticoagulant treatment plan It is recommended that the following areas should be avoided during treatment e Thyroid gland thyroid cartilage and trachea e Majorvessels e Breast tissue or breast implant The Ulthera System has not been evaluated for use in the following patient populations e Pregnant orbreast feeding women e Children e Those with the following disease states A hemomhagic disorder orhemostatic dysfunction An active systemic orlocal skin disease that may alter wound healing O o Herpessimplex o Autoimmune disease o Diabetes o Epilepsy o Bell s palsy 2 5 Patient Safety Waming Ulthera should not be used on a patient seyesorin a location or technique where ultrasound energy can reach the eye A Waming Use this system only if you are trained and qualified to do so Waming If any problemsoccur during system operation take immediate action s lift the transducer off the patient s skin press the See pushbutton Page 10 Ulthera Inc 2 6 2 1 on the handle to discontinue the treatment in progress and or pressthe red emergency Stop button to completely halt system operation Potential Side Effects Side effects reported in the clinical evaluation of the Ulthera System were mild and transient in nature These were limited to e Erythema redness The treated area may exhibit erythema immediately following treatmen
4. T ae Figure 3 2 Control Unit Front View left and Rear View right See Table 3 1fora description of the controls and connector ports of the control unit Table 3 1 Control Unit Connector Ports and Controls See Figure 3 2 ITEM DESCRIPTION Handpiece Connector TN 1 Socket for plugging in handpiece cable USB Ports two For optional USB removable storage device Emergency Stop Halts system operation if pressed e Momentarily press to tum system ON On Off Button e Momentarily pressto tum system OFF e Press and hold to force system shutdown Rear Panel USB port For Ulthera System Access Key Main Power Switch Supplies powerto system Leave ON symbol pressed in 7 Power Cord Receptacle Socket for attachment of power cord Ulthera Inc Page 13 Page 14 Below the monitor on the front panel of the control unit isa handpiece connector receptacle that interfaces with the handpiece cable On the front right of the panel isan On Off button and an emergency Stop button When tumed OFF via the On Off button the system goesinto a very low power standby mode unlessthe Main Power Switch is also tumed to the OFF position by pressing the O symbol The front of the control unit also hastwo Universal Serial Bus USB ports both ports may be used forthe Ulthera System Access Key orforan optional removable storage device thumb drive Waming When not in use by trained personnel the Ulthera System Access Key should be r
5. in ready to use non sterile pouches Physical Environment System Base The System may be placed on a cartorcounter with the depth to accommodate the control unit handpiece and powercord provided A Cart is recommended to offer maximum mobility forthe user when treating the patient and provide a more secure housing forthe handpiece System weight and dimensions are listed in the Technical Information Manual Ulthera System Specifications Space should be provided around the back sides bottom and top of the System forcooling During continuous use forextended periods of time it is normal forthe System to be warm Electromagnetic Environment See the detailed EMC Guidance in Section 3 of the Technical Information Manual The System is not likely to cause interference in nearby electronic equipment however other electronic equipment should not be stacked or placed immediately adjacentto the System Flooring should be wood concrete orceramic tile If covered with synthetic material the relative humidity should be at least 30 Waming The Ulthera System should not be situated adjacentto or stacked with other electronic equipment If the System must be installed in close proximity to other equipment both the Ulthera System and the nearby equipment should be observed to verify normal operation in that configuration A Caution EMI Electro Magnetic Interference from other electronic systems may cause degradation of the ultraso
6. If the problem persists please see the User s Manual for further information or contact Ulthera Support Code W Unauthonzed transducer Please replace the transducer and continue Please contact your local representative for further assistance Code X Transducercannot be read Please remove and reinsert the transducer If the problem persists please see the User s Manual for further information or contact Ulthera Support Ulthera Inc Excessive reflected powerhasbeen detected If the problem persists please try anothertransducerand contact Ulthera Support Use a transduceronly asinstructed Tap Scan Y to resume scanning The transducer connected isnotan authorized transducer Contact your local representative forfurther assistance The transducercannot be read Remove and reinsert the transducer Checkthatthe transducercontact area is clean Page 59 e9 Cleaning and Care 9 1 9 2 Page 60 Cleaning the Transducerand Handpiece 9 Note Transducersare packaged and shipped non stenle and ready to use Because the transducer will come in contact with the skin of a patient the standard practice for cleaning and low level disinfection of transducers between patients isto gently but thoroughly wipe the transducers with a standard 7096isopropyl alcohol prep pad A CaviCide wipe followed by wiping with 70 isopropyl alcohol may be used for additional disinfection if desired One may also use
7. The marks ULTHERA ULTHERAPY and DEEPSEE are registered in the U S and orcertain foreign countnes to Ulthera Inc henceforth Ulthera The marks SEE THE POWER OF SOUND SEE THE BEAUTY OF SOUND ULTHERA AM PLIFY ULTHERAPY AMPLIFY and AMPLIFY are trademarks of Ulthera This manual may not be copied translated or reproduced in whole or in part without the express written consent of Ulthera Various features of the Ulthera System are covered by U S Patents 6 049 159 7 758 524 8 366 622 8 444 562 8 506 486 8 535 228 8 641 622 8 690 778 8 690 779 8 690 780 and 8 915 853 and contemplated features may be covered by one or more of the following U S Patents 5 820 564 6 036 646 6 050 943 6 120 452 6 213 948 6 440 071 6 500 121 6 540 679 7 142 905 7 229 411 7 393 325 7 491 171 7 530 958 7 571 336 7 615 016 7 824 348 7 914 453 8 057 389 8 066 641 8 166 332 8 128 618 8 133 180 8 235 909 8 282 554 8 333 700 8 409 097 8 460 193 8 480 585 8 523 775 8 636 665 8 663 112 8 672 848 8 708 935 8 715 186 8 857 438 8 915 870 8 915 854 and 8 920 324 More than 100 other U S and Intemational patents to which Ulthera has rights are issued published or pending Page 4 Ulthera Inc THIS PAGE INTENTIONALLY LEFT BLANK Ulthera Inc Page 5 e lable of Contents 1 MOa donto Manua eiee EE EAA 8 i PUDO eee ee a ener ee ee ee ees 8 L2 C ONVENUONS enr Aaa a a eee er 8 2 Medical Se TOBY RTT 9 Zn TEE e E E E O
8. Ulthera Support Code P Hardware halted Please restart the System If the problem perssts please see the User s Manual for further information or contact Ulthera Support Code S The red SIOP button hasbeen pressed Please restart the System If the problem persists please see the User sManual forfurther information or contact Ulthera Support CodeT Intemal transducertemperature is too high If the problem persists please see the User s Manual for further Information orcontact Ulthera Support Code U Control unit temperature too high If the problem persists please see the Users Manual for further information or contact Ulthera Support A problem wasdetected with the attached Access Key or USB removable storage device thumb drive Do not remove the Access Key while the System is communicating with it The System has experienced multiple Code Msand hasbeen locked from further use This isto allow for further assessment by Ulthera in orderto minimize risk Hardware washalted due to an event detected in the control unit The red Stop button was pressed The intemal transducer temperature is above its limit Allow the transducerto cool down oruse anothertransducer The intemal control unit temperature is above its limit Allow the control unit to cool down Provide proper ventilation Ulthera Inc Code V Transducer energy delivery halted Tap Scan Y to resume scanning
9. a standard 70 isopropyl alcohol prep pad to gently wipe the handpiece and cable Neitherthe transducers northe handpiece should be submerged in liquid Place the transducer back into its original packaging between uses Wa ming Use only this procedure for cleaning Do not use acetone or other solvents asthis can damage the transducer General Care of the System To ensure the best possible performance treat the equipment carefully by adhering to the following guidelines l Inspectthe handpiece and connectors regulary for any problems 2 Ium scanning off before changing transducers to ensure proper identification of transducers and to prolong the life of the System 3 Do not drop the handpiece ortransducerson the floor or other hard surfaces Thiscan cause permanent damage 4 Do not twist or pull the handpiece cables This could cause damage to intemal wires and connections 5 Use aqueous ultrasound gel only Other lubncants or lotions particula dy mineral oil could eventually damage transducers orcables 6 Do not use acoustic standoff padsorany objects between the transducer and patient 7 Apply ultrasound gel only to the area to be treated and wipe it from the transducerafter completing a treatment Avoid getting the gel on the handpiece orcontrol unit Ulthera Inc 8 Transducers should be cleaned between procedures See cleaning procedure information immediately preceding this subsection 9 Keep new transducer
10. handpiece ortransduceris dropped or broken orany part of the System isdamaged disconnect the System from the power source outlet before touching any other part of the equipment Thoroughly inspect the equipment for extemal damage before reconnecting Do not use a damaged handpiece ortransducer Scan the Region to be Treated l Tap the region to be treated from the available regions and it will highlight white showing you the number of lines that have been delivered in the center of the region The energy and treatment line length will be set to appropnate levels for the entire treatment session unless manually adjusted by the user Ulthera Clinic Treating Clinician Jane Adams Patient Total 1 3 1235 Energy Length JA080812 88 Lines of 40 DS7 30 2400 OOM Piu Reset End Treatment Ulthera Inc 7 3 5 Figure 7 8 DeepSEE Screen 2 Ensure that the region to be treated hasbeen cleansed thoroughly 3 Apply a thin layerof aqueousultrasound gelto the area to be treated Waming Too much ortoo little gel will obstruct skin contact Do not use other lubricants or lotions because they may damage the transducer 4 Place the transducer treatment window flush with the patient s skin and pressthe See button on the handpiece to begin imaging An image of the patient stissue appears The green treat line on the image showsthe depth at which treatment will be delivered Green tick marks on the ruler show the lateral positions where
11. is entered here Field for entering or editing the name of the region Field for selecting the transducer for the region that is Transducer NU highlighted Field for entering or editing the number of lines that is NumberofLines going to be recommended forthe region that is Edit Region Fields highlighted Field for selecting the default energy that will be used forthe region that is highlighted PEE EAE When a transducers energy level is changed in an existing User Region Guideline all energy levels will be updated in that guideline forthat transducertype Ulthera Inc Field Controls List of Entered Regions Lists the regions that have been entered into the user region treatment guideline The highlighted region is populated into the Edit Region Fields to allow for editing If using the Edit Guideline user region action button changes will not be visible in the therapy screen until a system reboot is performed Controls keyboard or menu of options used for entering information into fields This section changes based on the field that is being edited Saves the current User Region Guideline and retumsto the startup screen Add Region Button Addsa new unnamed region to the treatment guideline Delete Region Button Deletesthe highlighted region NOTE Thisaction cannot be undone In the event that a region is inadvertantly deleted the region will need to be re entered Closesthe User Region Guideline dialogue
12. manual additional clinical training may be available by the Company or yourlocal distributor For more information on training available please contact yourlocal representative 1 2 Conventions 9 Note Notes designate information of special interest Caution Cautions alert the userto precautionary steps necessary to properly operate the system Failure to observe these cautions may void the warranty Waming Wa mings alert the userto information that is of the highest importance and vital to the safety of the patient and user All procedures are broken down by numbered steps Steps must be completed in the sequence they are presented Bulleted lists indicate general information about a particularfunction or procedure They do not imply a sequential procedure Control names are spelled asthey are on the system and they appearin Bold text Page 8 Ulthera Inc e 2 2 1 Zid 2 3 2 4 Medical Safety Intended Use The Ulthera amp System is intended for lifting and sculpting of skin by way of the deposition of micro focused ultrasound energy at depths between 1 5 mm and 4 5 mm beneath the skin Deposition of ultrasound energy results in a change to the physiology resulting in stimulation of new collagen and elastin as part of the healing process The Ulthera System is also intended forthe treatment of Axillary Hyperhidrosis by way of the deposition of the micro focused ultrasound energy at depths between 3
13. of time has not yet been followed in a clinical environment A Caution It isthe responsibility of the physician to fully undertsand the indicationsfor use and safety considerations associated with the Ulthera System The Ulthera System hassixtypes of transducers Table 7 5 Types of Transducers TRANSDUCER SPECIFICATIONS DS10 1 5 Low energy level and 1 5 mm focal depth Low energy level 1 5 mm focal depth and a namowercontact area ii than the DS 10 1 5 DS 7 3 0 Low energy level and 3 0 mm focal depth DS 7 3 0N Low energy level 3 0 mm focal depth and a namrowercontact area l than the DS 7 3 0 DS7 4 5 Intermediate energy level and 4 5 mm focal depth DS4 4 5 High energy level and 4 5 mm focal depth 1 Checkthe expiration date on the transducer package 2 Openthe sealed pouch 3 Connectthe transducerto the handpiece by sliding the transducer into the handpiece until the passive latch locks into place Ulthera Inc Page 45 7 3 4 Page 46 Figure 7 7 Connecting the Transducer A tone will sound when the transducer has been corectly inserted The Treatment Guideline area on the DeepSEE screen will display the regions available fortreatment with the inserted transducer Caution If a waming orcaution message is displayed ora message that says Transducer Not Connected disconnect and reconnect the transducer If the problem persists contact your Ulthera representative Caution If the
14. 0 mm and 4 5 mm beneath the skin targeting the depth at which sweat glands reside Coagulation takes place in tissue located at the dermal hypodemal interface where the sweat glands reside using a surface contact applicator Sweat glandsare destroyed dunng coagulation Indications for Use The Ulthera System is indicated for e Use fornon invasive dermatological sculpting and lifting of the demis o UpperFace o LowerFace o Neck o D collet e Non invasive treatment of Axillary Hyperhidrosis Contraindications The Ulthera System is contraindicated for use in patients with e Open woundsor lesions on the face and orneck e Severe orcystic acne onthe face and orneck e Pacemakersand electronic device implants in treated area Precautions When not in use by trained personnel the Ulthera System Access Key should be removed from the system to help prevent unauthonzed use Keep the Ulthera System Access Key ina designated place accessible only to authonzed and trained personnel Ulthera Inc Page 9 The Ulthera System has not been evaluated for use over various materials Therefore treatment is not recommended directly over those areas with any of the following e Mechanical implants e Demal fillers e Implanted electrical devicesin the face and orneck e Metal stentsin the area of treatment e g face neck d collet center of chest e Breast implants Treatment energy is not recommended for use directly on an existing keloid
15. 1 Ulthera System AccessKey A Waming Do NOTfomat your Ulthera System Access Key Doing so could deactivate your key causing you to lose accessto yourUlthera System User Interface The main screen on the Ulthera System monitor has three tabs located in the upperright comerof the screen DeepSEE Patient Info and Setup The DeepSEE tab displa ysthe controls for imaging and treating soft tissue The Patient Info tab displays information and toolsfor beginning a treatment and setting up a patient record The Setup tab allows you to recall patient treatment information and change System settings Ulthera Inc Page 37 7 2 1 The DeepSEE Screen Figure 7 2 showsan example of the user interface when the DeepSEE tab is active Each element isdescnbed in Table 7 1 Ulthera Clinic Treating Clinician Jane Adams Patient Total 947 Energy Length D JA080812 89 Lines 14 of40 ps730 2400 0 30 J PS User Regions End Treatment Figure 7 2 DeepSEE Screen D Imaging Controls 2 Home Bar 3 Treatment Controls Table 7 1 Elements on DeepSEE Screen ITEM FUNCTION Higaeound imade Shows an ultrasound image of the tissues being imaged The horizontal green g line indicates the depth at which treatment will be delivered ea to the right of the depth indicator starts or stops scanning Large Sun icon Increases ultrasound image bnghtness during scanning Brightness Controls Small Sun icon Decreases ultrasound image brightness during scanning
16. 2 Page 12 System Description The Ulthera System integrates the capabilities of ultrasound imaging with those of ultrasound therapy The imaging feature allows the user to visualize the skin and sub demal regions of interest before treatment It also allowsthe userto assure proper skin contact in orderto deliverthe energy at desired depths The therapy feature directs acoustic wavesto the treatment area This acoustic energy heatstissue asa result of fictional losses during energy absorption producing discrete points of coagulation System Components and Features The Ulthera System consists of three primary components the control unit with integrated touchscreen the handpiece with cable and interchangeable tra nsducers see Figure 3 1 Figure 3 1 Main components of the Ulthera System control unit top handpiece bottom right and image treat transducer bottom left that inserts into the handpiece receptacle Ulthera Inc 3 2 1 Control Unit The control unit isthe tabletop information center forthe Ulthera System It houses the touchscreen monitor and Graphical User Interface GUI that allows the userto interact with the device This sc reen sets and displays the operating conditions including equipment activation status treatment parameters system messagesand prompts and ultrasound images Figure 3 2 illustrates the physical features of the control unit such asthe vanous connector ports and power controls
17. 25 6 Treatment Guidelines eeeeeeeeeeeeeeeee eene eene nnnnnnnnnnnnnnnnnn nnns 2 6 1 Preset Guidelines ANd Energy Levels eeeennm s 27 7 SV SE O61 a O TEN UTMmmT ESER 37 7 1 Ulthera System Access Key sseeeeeeeeeennnnnnnnnnmmenennnnnnnnnnn menn nnne nis 37 Page 6 Ulthera Inc T User Interfa Ce ooececcecccccccuccccccuccucuccuccucaucuuaucueaueaucueceeaucaecueaecaucueaecausutaueuaetaesaesenaess 37 Ta QDS NAUCIO PT 43 7 4 Adjunctive Functions eeeeeeeeeeeeeeenn nennen nennen nnne nnn nnne nns 50 L5 NOUDIGSQOOUIO ssion orrien nS TOE ENEN XU eas nade 54 SEE ULE Se SS A E O A E A A 56 cleanihg ond Ca mt 60 9 1 Cleaning the Transducer and Handpiece ccccccccccccsssssssseeeeeeeeeeeaeseeeeeeeees 60 92 GENES arm ofthe SVstelTiasssenonvtoike rne e YN EA aN RISCVEVENSE AN NoD aaa 60 Reorder Informa UOT uscee serere remet ien neni eec ene rn nei 62 Safety Standards and Regulatory Classifications 63 Ulthera Inc Page 7 el Introduction to Manual 1 1 Purpose This Instructions for Use manual provides a description of the System components its controls and displays instructions for its operation and other equipment information important to the user Waming Do NOToperate the Ulthera System before reading this manual thoroughly In addition to this
18. E EEA AA A TA 9 22 818 reise TOr UE MERE aaa anaa EEE a a Eeo ea aiaia 9 De COUN MENU ol OS gcc cece O ees eee 9 24 PROC OIG suede erac oris o esses secede E EEE es EEa au Urb USER NUTS SE 9 PA n Pallehib Sale A Yet DSEPUUITYS DOPO EGO VOR UK UR CDU SEE DANN PCR UR T RETO EUCRRAUN 10 2 6 Potential Side ol i RN T ena 11 2 7 Complantsand Advere EU S iissiisercsriisrsosisarsivnicoreneieriniiei iiien TURIN 11 3 tem O VEME W PR T TT 12 zL SYST DES ID COD orarin seraa BOR a a DR A ARa 12 3 2 System Componentsand Fegstul amp s asoasnasoocdpo nar erosion oO leone 12 4 NEM cece cag pu ud euim treater SIUE Ue Po OP HNIDUECMR UNI PESCE ERREUR UU 18 4 1 Electncaland Fire SdTeD ssseersuxebmvbkgpitidionpERVRO Nm FREUT GERE RR OR DUI ERE ER a KA AD AERA 18 4 2 Equipment Use and EL NETS 19 4 3 Ergonomic Safety NITET 20 4 4 Medical Ultrasound Safety sseeeeee nnne nnns 20 4 5 Electromagnetic Compatibility and Immunity eeeeennnee 20 25MM DDO A 21 X Sab Sy MOONS rena r E UNGEU TIN UR GIUDUEIUEMURIEHSEDNF MM EPPRTUIS DEPO OR IE FELDR KIA 22 J Setting Up for First Time USE ss sssessssssnrrrrrresssrrnrrrnnrersssrnnrrnnrrressrnnnrrnnreesssennrrnn 24 Se UC rE 24 Du PAV SAC NERV IONIC erres AEN TER 24 5 3 BlectncalRequilemiefileavenenedaoedon an Eve aree necs sped nea 25 5 4 Connecting COO SIS ie castes sapecd envidia std dictis tn tr aqtid D CE ppc NR
19. ORMATION SIGNALS per IEC 60601 1 8 INFO CODE MESSAGE DISPLAYED DESCRIPTION m m m Page 56 Code B Intemal handpiece temperature is too high If the problem persists please see the Users Manual for further information or contact Ulthera Support Code C Hardware halted Please restart the System If the problem persists please see the User sManual forfurther information or contact Ulthera Support Code E Communication halted Please restart the System If the problem persists please see the User s Manual for further information or contact Ulthera Support Code G Hardware halted Please restart the System If the problem persists please see the User s Manual forfurther information or contact Ulthera Support The intemal handpiece temperature is above its limit Allow the handpiece to cool down Hardware washalted due to an event detected in the control unit Communication washalted due to an initialization event detected in the control unit Hardware washalted due to an event detected in the control unit Ulthera Inc Code H Transducer motion not detected Please remove and reinsert the transducer If the problem persists please see the Users Manual for further information or contact Ulthera Support Code Communication halted Please restart the System If the problem persists please see the User s Manual forfurther information or contact Ulthera Support
20. Ulthera System Instructions for Use Featunng DeepSEE Technology for Ultherapy ilthera THIS PAGE INTENTIONALLY LEFT BLANK Page 2 Ulthera Inc March 2015 Published in the USA CAUTION UNITED STATES FEDERAL LAW RESIRICTS THIS DEVICE TO SALE BY ORON THE ORDER OF A PHYSICIAN THE ULTHERA SYSTEM IS INTENDED FOR USE ONLY BY PROPERLY TRAINED PHYSICIANS AND PROPERLY TRAINED PERSONS UNDER THE SUPERVISION OF SUCH A TRAINED PHYSICIAN HENC EFO RTH THE USER PRIOR TO OPERATING THE SYSTEM THE USER MUST THOROUGHLY READ AND UNDERSTAND THIS MANUAL IMPROPER USE OF THE SYSTEM MAY CAUSE PERSONAL INJ URY AND OR DAMAGE TO THE SYSTEM THAT MAY INVALIDATE THE WARRANTY AG REEM ENT THE ULTHERA SYSTEM IS INTENDED FOR LIFTING AND SCULPTING OF SKIN BY WAY OF DEPOSITION OF MIC RO FO C USED ULTRASO UND ENERG Y AT DEPTHS BEIWEEN 1 5 AND 4 5MM BENEATH THE SKIN DEPOSITION OF ENERG Y RESULTS IN A CHANGE TO THE PHYSIOLO G Y RESULTING IN STIMULATION OF NEW COLLAGEN AND ELASTIN AS PART OF THE HEALING PROCESS THE ULTHERA TRANSDUC ERS CAN BE REUSED UNTIL 2400 LINES OF TREATM ENT IS PROVIDED THE USEFUL LIFE OF THE ULTHERA CONTROL UNIT IS 4 YEARS AND HANDPIECE 5 YEARS BASED ON THE USEFUL LIFE OF THE COMPONENTS AND TESTING THIS STATEMENT DOES NOT IMPLY A WARRNTY COVERING THAT PERIOD OF TIME PLEASE SEE WARRANTY INFORMATION IN YOUR PURC HASE TERMS AND CONDITIONS Ulthera Inc Page 3 2015 Ulthera Inc All Rights Reserved
21. ated region is shown asa solid colorof the transducer that was used in that region with the total lines delivered forthe region being represented A Disabled region is transparent with a light gray border Disabled regions cannot be selected Displays a list of regions asdefined by the user Tap End Treatment button followed by Confirm End to end the treatment End Treatment earn TREATMENT CONTROLS Ulthera Inc Page 39 7 2 2 Tools Menu The Tools icon in the upper nght comer of the screen displays the Tools menu shown in Figure 7 3 and isdescnbed in Table 7 2 Ulthera Clinic Treating Clinician Jane Adams Patient Total 1 19 1090 JA080812 88 Lines of 40 DS7 30 2400 aw Marker End Treatment Figure 7 3 Tools Menu Table 7 2 Tools ITEM FUNCTION a Volume Buttons Decreasesorincreasesthe volume of the System The button with hash marks displays or removesthe Treat Line l green treat line displayed on the ultrasound image Image Buttons The Save button saves the currently displayed image Allows you to set markers for measuring distances Measurement d within a scanned image Marker Buttons Text The Text button displaysa keyboard for recording notes on an image Page 40 Ulthera Inc 7 2 3 User Regions The Ulthera System allows you to create and edit treatment guidelines to more accurately reflect and record how treatments are performed Treatment energies are not editable beyond the safety limits that
22. ck 5 0 PLUS ooy o Train Face Amplify Ooly 0 Tain Face 5 0 PLUS ooy o Train Hyperhidrosis ooy 0 To facilitate training with your System specific training guidelines have been pre programmed into the guideline list as well These are noted as Train These training guidelines should be used fortraining purposesonly where no energy delivery is desired Linesavailable forthe transducer will not be decremented while in a training guideline Guideline Name If regions otherthan those depicted in the preset guidelines are desired it is recommended that you utilize the User Regions function as described in section 7 2 3 Thisfunction will allow you to define text based regionsfor you to select and treat against Ulthera Inc Page 27 Each transducer is programmed with set energy levels Table 6 2 describes the energy levels available for each transducer Table 6 2 Transducer Energy Levels ENERGY LEVELS JJ Las ee um ow om oo Lese es os e em om ms es om ow os om ww es ee m os ow Note Energy level defaults may vary depending on the guidelines selected pnorto performing a treatment The userhasthe ability to adjust these energy settings by using the Energy control described in section 7 2 1 If adjusted the System will retain the setting across all regions for that particulartransducerand forthe duration of the treatment session O Note Removing and re insert
23. e control unit enclosure ortransducers Contact Ulthera Inc if service is required When not in use by trained personnel the Ulthera System Access Key should be removed from the System to help prevent unauthorized use Keep the Ulthera System Access Key in a desgnated place accessible only to authorized and trained personnel Ulthera Inc Page 19 4 3 4 4 4 5 Page 20 Ergonomic Safety Wa ming Ultrasound scanning hasbeen associated with repetitive motion injuries such astendinitis To reduce chances of such injury maintain a balanced comfortable posture while scanning avoid gripping the handpiece too tightly and keep handsand ammsina comfortable position while using Medical Ultra sound Safety A Wa ming Use this System only if you are trained and qualified to do so The Ulthera System hasa fixed non adjustable output power level for imaging well below the limits set by FDA guidelines However ultrasound exposure times should be limited to the shortest amount of time needed to complete the treatment The AFAP principle As Far As Possible can be followed by minimizing the examination time See explanation of AFAP in the Technical Information Manual If the System displays unusual inconsistent behavior discontinue use and contact Ulthera Inc Under some conditions for example high ambient temperature and long scanning period the transducersurface temperature may exceed 419C Scanning will be automat
24. emoved from the system to help prevent unauthorized use Keep the Ulthera System Access Key in a designated place accessible only to authorized and trained personnel The rearof the control unit hasa USB port an AC powerreceptacle and the main power switch The main power switch should be left in the powered position with the pressed inward In such a configuration the control unit may be tumed ON via the front panel On Off button and can be tumed OFF via either the front panel On Off button or via the graphical user interface Ulthera Inc S22 Handpiece The handpiece isa handle with an integrated receptacle for insertion of a transduceron one end and an electrical cable forattachment to the control system on the other end The handpiece hastwo typesof buttons one to image SEE and the otherto delivertherapy TREAT Figure 3 3 providestwo views of the handpiece including one showing it connected to an Image Treat transducer Table 3 2 isa description of the various components and features illustrated in Figure 3 3 Figure 3 3 Handpiece with Transducer Inserted top and side views Table 3 2 Handpiece and Transducer Description DESCRIPTION e Engages IMAGING state if not already imaging SEF Pushbutton e Places system in READY state Times out in 40 seconds e Stops TREATING if treatment is in progress seems Peeemmeme 0 bem emm mee meme 0 sense cane omen iet Ulthera Inc Page 15 32 3 Page 16 Tra
25. have been previously determined Under Treatment Settings select Edit User Regions from the drop down menu as shown in Figure 7 4 Ulthera Inc lreating Clinician Clinician Treating Clinician Treatment Settings Edit User Regions e No Transducer M Chest User Guidell General Regions Face amp Neck Train Face amp Neck Amplify Add Guideline Brow Train Chest User Guideline Brow Figure 7 4 User Regions first screen The User Regions displays regions as created by the user with functionality depicted in Table 7 3 below Table 7 3 User Regions Action Buttons ITEM FUNCTION Add Guideline Allows you to create a new guideline Edit Guideline Allows you to edit an existing guideline Delete Guideline Allows you to delete a guideline you created Ulthera Inc Page 41 Figure 7 5 and Table 7 4 display the process and functionality of creating a User Region User Regions Guideline Name Treatment Guideline Region Transducer Lines Energy list order Delete Region C OE EN ON E EREXIIERL IN ENEN ENEN ER EE N EE E ER EXENERER EXER ER ER FERES me e ET e E UE a Figure 7 5 User Regions second screen Close Table 7 4 User Regions Treatment Guideline Dialogue mw DESCRIPTION User Region Guideline TIE EE d Piet The name of the treatment guideline is entered in this field Name Field Clinician Field he name of the clinician treating
26. ically disabled if the intemal transducer temperature reaches 43 C Electromagnetic Compatibility and Immunity The Ulthera System s RF emissions are very low and are not likely to cause interference in nearby electronic equipment Ulthera is suitable for use in all establishments other than domestic and those directly connected to the public low voltage powersupply network that supplies buildings used for domestic purposes Mains AC power quality should be that of a typical commercial or hospital environment Floors should be wood concrete orceramic tile If floors are covered with synthetic material the relative humidity should be atleast 3096to avoid excessive static electric ity Ulthera Inc 4 6 Waming The Ulthera System should not be situated adjacent to or stacked with other electronic equipment If the System must be installed in close proximity to other equipment both the Ulthera System and the nearby equipment should be observed to verify nomal operation in that configuration A Caution EMI Electro Magnetic Interference from other electronic systems ma y cause degradation of the ultrasound image Ulthera has been desgned to meet the standards of IEC 60601 1 2 for electromagnetic compatibility however some computer equipment unintentionally emits strong interfering RF signals Portable RF communication devices may also affect Ulthera If image quality is degraded by EMI the System may need to be relocated
27. ing a transducer within a treatment session will put the transducer back to the energy setting used last not to the default forthe guideline 9 Note Ending the treatment session and starting a new session with the same or different guideline will put all transducers back to the default energy settings as prescribed by the guideline The preset guidelines asthey appearon the System for each transducertype are listed below The recommended line count foreach region isdepicted by the numerical value displayed Regions shown without a numerical value are regionsthat are available forthe treating clinician to select and treat at their discretion but a specific line count is not directed Page 28 Ulthera Inc 6 1 1 Face amp Neck Amplify 1 5mm 10MHz Ulthera Inc Page 29 6 1 2 Face amp Neck 5 0PLUS 1 5mm 10MHz Page 30 Ulthera Inc 6 1 3 Face Amplify Ulthera Inc Page 31 6 1 4 Face 5 0PLUS 1 5mm 10MHz Page 32 Ulthera Inc 6 1 5 Chest 1 5mm 10MHz Ulthera Inc Page 33 Hyperhidrosis 6 1 6 Ulthera Inc Page 34 6 1 7 Hyperhid rosis Note The Ulthera System is not indicated fortreating hyperhidrosis related to other body areasorgeneralized hyperhidrosis 6 1 7 1 Delivery of Focused Ultrasound Energy to the Arxilla Caution Pror to delivery of focused ultrasound to patient wipe all patient contact surface
28. l to facilitate transmisson of the acoustic energy is also required but is not provided as part of the System Ulthera Inc Page 17 e4 System Safety 4 1 Page 18 The following precautions and wamings must be reviewed and observed Electrical and Fire Safety Wa ming To avoid risk of electric shock always inspect the Ulthera transducer handpiece and cable before use Do not use a damaged cable ora transducerthat hasbeen damaged orisleaking fluid The Ulthera System is intended for indoor dry location use Avoid liquid spills and splashes Keep coupling gel away from the handpiece transducerconnections The Ulthera System comes with a three conductor AC powercord and plug Use a properly grounded outlet and always plug the Ulthera System directly into the outlet Never remove the ground conductoror compromise the ground conductorvia any AC adapter plugsor extension cords Disconnect the power cord from the outlet by pulling on the plug and not the cord AC powered USB printers or storage devices may pose a shock hazard Do not touch the USB connectorsand the patient at the same time Tum off the AC power switch and disconnectthe AC power supply before cleaning the control unit Do not remove the coverson the control unit orhandpiece the control unit contains hazardous voltages The Ulthera System contains no user serviceable components If the System requires service contact Ulthera Inc No modification of
29. magnetic Compatibility CISPR 11 class A Group 1 IEC 60601 1 4 Programmable electrical medical systems IEC 60601 2 37 Particular requirements for the safety of ultrasonic medical diagnostic and monitoring equipment Patient contacting materials comply with ISO 10993 1 NRTL Certification Canadian Standards Association CSA ISO 13485 Quality Assurance Standard Ulthera Inc Page 63 aee Ulthera Inc 1840 South Sta pley Drive Suite 200 Mesa Arizona 85204 Phone 1 480 619 4069 amp 1 877 858 4372 Ultherapy com Page 64 MedPass Intemational Limited Windsor House Bretforton Evesham Worcestershire WR11 7 J United Kingdom 1001393IFU Rev H Ulthera Inc
30. nd System performance he maximum number of imagesthat can be stored is 100 and the maximum number of treatment recordsthat can be stored is 200 If these numbers are exceeded the user will be asked to delete recordsorimages priorto continuing with treatments If a procedure isin progress when the database reaches its limit the additional records will be stored but at the beginning of the next treatment the user will be prompted to delete imagesand or treatment records in the database Browsing the database l lap the Setup tab 2 Tap the Records button to view stored treatment recordsortap the Images button to view images 3 When the data orimagesare displayed you can browse through displayed items on the screen save itemsto your Access Key or delete ite ms 9 Ulthera Inc Page 51 Page 52 Note It is advisable to save records before deleting them or pnorto sending the System in for repair if necessary Exporting data 1 On the Setup screen tap the Images button to view a list of treated patients like the one shown in Figure 7 10 08 08 2012 11 08 58 AM JA080812 Images Select All Date Time 7 Patient Name Patient ID Deselect All 012 11 06 36 AM 012 11 04 56 AM Delete Figure 7 105 Patient Image Record List 2 Tap an individual Patient ID to access that individual image ortap the Select All button to accessall stored images Note You may select multiple images by tapping on them individ
31. nsducers Figure 3 4 isan illustration of an image treat transducer The transducercan image and treat a region of tissue up to 25 mm long and can image a depth of up to 8 millimeters Treatment occurs along a line lessthan or equal to the transducer sactive length which isindicated by guideson the sidesof the transducer asdescribed in Table 3 3 An additional guide atthe front tip of the transducer represents the center of the treatment line In therapy mode bursts of sound energy create a linearsequence of individual discrete thermal coagulation points TCPs A label atop the transducer provides the transducertype expiration date and other information ve DS 4 4 5 25mm Figure 3 4 Image Treat Transducer Separated from Handpiece see Table 3 3 Table 3 3 Transducer Description DESCRIPTION Labeling Transducertype and other information Treat Guides Markers denoting maximum treatment line length and center of treatment line center of transducer Ulthera Inc 3 2 4 The types of transducers reflect variations in frequencies and treatment depthsasshown in Table 3 4 Table 3 4 Transducer Types TRANSDUCER TYPE TREAT FREQUENCY TREAT DEPTH IMAGE DEPTH SCAN LENGTH Essential Accessories Other essential components provided foroperation of the Ulthera System are the powercord that connectsthe Ulthera System to an AC poweroutlet and the proprietary Ulthera System Access Key Ultra sound ge
32. nted in case Technical Support isneeded Figure 7 11 showsa sample waming screen Code X Transducer cannot be read Ok Please remove and reinsert the transducer Uvu I the problem persists please see the User s Manual for further information or contact Ulthera Support Figure 7 6 Waming Screen Waming These dialogsindicate that a problem wasdetected See System Messages section for more details Poor Image Quality To improve image quality 1 Check that the display brightness is set appropriately forthe connected transducer 2 Checkthe gelon the transducer If these steps do not resolve the problem contact Ulthera Inc or your country representative forassistance Ulthera Inc 7 5 3 Shutting Down the System 1 Stop any imaging and ortreatment in progress pror to shutting down the Syste m 2 From the Setup screen tap the Shutdown button 3 Remove the Ulthera System Access Key to prevent unauthonzed usage 4 Leave the main power switch located on the rear panel of the control unit in the ON postion tum it off only when moving the System Ulthera Inc Page 55 99 System Messages The Ulthera System is designed with intemal checksto ensure that all aspects of the device are functioning appropriately In the event that an information message presents itself during use please follow the instructions on the screen or referto the information listed below These messages are classified asINF
33. ommended transducerto utilize based on the anatomical area you have selected to treat Remove the transducer indicated from its protective pouch To connect the transducer slide the transducerinto the handpiece asshown in Figure 5 2 Ulthera Inc Page 25 When the transducer is fully seated you wil heara tone indicating that it has been correctly inserted Figure 5 2 Connecting a Transducer To disconnect the transducer lift the latch at the tip of the handpiece and slide the transducer straight out of the handpiece Caution Do not apply force disolacement to latching cantilever without a transducer installed in the handpiece When the transducer is inserted the control unit automatically detects it and updates the graphical user interface 5 4 3 Connecting Accessones The Ulthera System Access Key should be inserted into one of the available USB ports otherwise the message No Key wil appearand the software will not allow useraccess Page 26 Ulthera Inc e6 Treatment Guidelines 6 1 Preset Guidelines and Energy Levels The Ulthera System is programmed with preset guidelines that have been established through clinical experience studies and or literature Table 6 1describesthe preset guidelines available on your System Table 6 1 Guideline Names and Energy Levels Energy Level Default Range Energy Level General Regions Face amp Neck Train Face amp Neck Amplify Ooly 0 Train Face amp Ne
34. or reconfigured Waming Use of accessories otherthan those specified may result in increased emissions ordecreased immunity of this System Disposal Depleted transducers should be disposed of in accordance with federal state and local regulations Ulthera Inc Page 21 4 7 Safety Symbols A variety of symbols appear on the transducer handpiece or control unit in accordance with regulatory guidance SYMBOL DEFINITION Type BApplied Part CE marking indicating manufacturer s declaration of compliance with appropriate EU product directives Canadian Standards Agency Consult instructions for use Date of Manufacture Serial Number Emergency Stop Power Standby Switch Indoor Use Only Keep electrical waste separate from municipal waste Recycle Packaging Mated handpiece and transducer protected from the effects of vertically dripping water Catalogue Number Page 22 Ulthera Inc Manufacturer Authonzed representative in the European Community Storage Temperature Limit Fragile handle with care Relative Humidity Limitation Use By Date Batch Code Atmosphenc Pressure Limitation Recycle Packaging Polyethylene Ulthera Inc Page 23 95 Setting Up for First Time Use Su 5 2 5 2 1 Died Page 24 Unpacking The control unitand handpiece are shipped together in one container Transducers are packaged and shipped separately from the control unit and handpiece
35. pping the appropriate transducer button on the left hand side of the screen When all regions have been treated tap the End Treatment button in the lower right comer of the DeepSEE sc reen and then tap Confirm End Ulthera Inc Waming The End Treatmentbutton must be tapped atthe end of each patient s procedure to ensure that the current sesson streatment record hasbeen saved Ulthera Inc Page 49 1 4 4 1 7 4 2 Page 50 Adjunctive Functions Measuring Distances To measure distance on an ultrasound image 1 2 Tap the Tools icon on the DeepSEE screen Tap the Markericon on the Tools menu A starting point marker will appearnearthe centerof the image Touch the markerand drag itto the starting point forthe measurement Lift your finger off the screen when the marker is positioned at the starting point The ending point marker will appear with a line between the two points Touch the ending point makerand drag itto the end point forthe measurement When you lift yourfinger from the ending point the distance between the markers will be displayed To measure another distance tap the Markerbutton on the Tools menu again and repeat steps 3 5 When imaging is restarted by pressing the See button on the handpiece orby tapping the Scan button on the DeepSEE screen the distance markers will disappearfrom the image Annotations When the Ulthera System is not actively imaging you may add commen
36. s with a CaviCide wipe and allow to dry Wipe patient contact surfaces once more with isopropyl alcohol then proceed Note Please note that in clinical studies localized sub dermal injections of lidocaine with epinephrine were used to anesthetize the axillae of patients priorto Ulthera py treatment Using the treatment grid Section 6 1 6 sequentially place lines of focused ultra sound energy to the axilla in groups of 10 lines per square using the DS 4 4 5 fortwo passes folowed by DS 7 3 0 fortwo passes fora total of 480 lines per axila Proceed to the contralateral axilla and repeat the delivery of focused ultrasound energy Ulthera Inc Page 35 6 1 8 General Regions Face amp Neck 1 5mm 10MHz Page 36 Ulthera Inc e fala 7 2 System Operation Ulthera System Access Key Your Ulthera System isequipped with a unique Access Key that gives you access to Ultherapy on your System You should keep this key in a safe and secure location that is only accessible to authorized personnel In addition to providing you secure accessto your System the Access Key also functions asa USB storage device fortransfemng information from your Ulthera System to an extemal computer To use your Access Key simply insert it into one of the available USB ports During regular use it is highly recommended that you insert the Access Key into the rear USB port so itisnot bumped ordamaged during continual use Figure 7
37. sin sealed pouches until ready for use 10 Take care to store transducersin a safe and secure location to prevent damage in between usage 11 Do not hold the handpiece in a mannerthat could damage the cord or strain relief while removing or inserting transducers Caution Alwayscheckthe expiration date on the transducerbefore using Expired transducers should not be used Ulthera Inc Page 61 e 10 Reorder Information Page 62 DESCRIPTION Ulthera Control Unit Ulthera 9 DeepSEE Handpiece Ulthera 9 DeepSEE Transducer DS 7 3 0 Ulthera 9 DeepSEE Tra nsducer DS 7 3 0N Ulthera 9 DeepSEE Transducer DS 4 4 5 Ulthera 9 DeepSEE Transducer DS 7 4 5 Ulthera 9 DeepSEE Transducer DS 10 1 5 Ulthera 9 DeepSEE Tra nsducer DS 10 1 5N Ulthera System Access Key Ulthera System C art O ptional Ulthera System C ase Please contact Ulthera Inc or your country representative to order transducers accessories or other items for your System CATALOG REORDER NUMBER UH 2 UT 1 UT 1N UT 2 UT 3 Ulthera Inc e 11 Safety Standards and Regulatory Classifications FDA Product Classification 878 4590 UL60601 1 IEC 60601 1 Medical Electrical Equipment Part 1 General Requirements for Safety Class device type B applied part non AP APG rated Ingress protection IPxO Ordinary Equipment for Control Unit IPx1 for mated transducerand handpiece Mode of operation Continuous IEC 60601 1 2 Electro
38. t This typically resolves within a few hours of treatment e Edema swelling The treated area may exhibit mild edema following treatment This typically resolves within a few days of treatment e Pain Momentary discomfort may be expenenced dunng the procedure while energy is being deposited Post procedure discomfort or tendemess to the touch is also possible e Bruising Mild bruising which iscaused by damage to soft tissue blood vessels may occuroccasionally and typically resolves within a few days of treatment e Nerve effects o Transient local muscle weakness may result after treatment due to inflammation of a motornerve o Transient numbness may result after treatment due to inflammation of a sensory nerve o Transient pain paresthesia and ortingling may be expenenced o No permanent injunesto facial nerves have been reported e Scamming The possibility for scar formation which may respond to medical Care may exist if incomect treatment technique is used Complaints and Adverse Events No serious adverse events were observed during the clinical study evaluation of the Ulthera System Ulthera follows MDR Medical Device Reporting rulesfor handling complaints and adverse events Should an adverse event be suspected orreported contact Ulthera Inc atthe numberon the back page of this document For those outside the U S contact your local Ulthera representative Ulthera Inc Page 11 e3 System Overview 3d 3
39. t Info Screen 2 Use the touchpad keyboard to enterthe patient name patient ID and the name of the clinician who will perform the treatment Clinician namescan be selected from the dropdown list by tapping the down arrow to the right of the field Unwanted clinician names may be removed from this list by 1 tapping the name 2 tapping the 47 key 3 tapping the Del key and then 4 tapping the Enter key Select the desired treatment guideline from the list located above the touchpad keyboard Treatment guidelines display recommended treatment parameters for the treatment regions These parameters are based on clinical trial results that determined safe settingsfor each treatment region Tap the Start Treatment button located in the upperright comer of the screen Note When the Start Treatment button has been pressed the patient name patient ID and treatment guideline may not be changed until the cument treatment is ended Ulthera Inc 7129353 Selecta Transducer Note The treatment guideline displa ys an overview of the various treatment regions with recommended treatment parameters for each asshown in the Treatment Guidelines Section 6 These treatment parameters are based on the results from clinical studies conducted by Ulthera that demonstrate safe and effective treatment forthe treatment region selected Clinical improvements have been verified ata period of 10 months Continuous improvement fora longer period
40. the coagulative points wil be placed along the horizontal plane For example with length set to 25 mm and a spacing of 1 5 mm centerto center a treatment line would have 17 TC Ps 5 Verify sufficient coupling between the transducerand the skin by ensuring that there are no dark vertical artifact barson the image Figure 7 9 showsthe difference between images when coupling is good Versus poor Good coupling produces Poor coupling produces dark vertical an image with no dark areas barson the tissue image Figure 7 9 Images Affected By Coupling the Transducerto the Skin If the transducer is jostled dropped orshaken while scanning it may pause to recalibrate its position before resuming nomal scanning Deliver Treatment Lines 1 Pressthe See button on the handpiece when you have confirmed adequate coupling and transducer positioning to enterthe Ready state When the System enters or exits the Ready state a tone will sound and buttons on the handpiece will be lit The Ready state isterminated after Ulthera Inc Page 47 Page 48 40 seconds if the Treat button is not pressed but can be reactivated by pressing the See button again Pressa Treat button on the handpiece to begin delivering treatment lines between the treat guides on the transducer Keep yourhand still and maintain a light constant pressure from the transduceron the patient s skin while delivering treatment lines The See button will light up momentaril
41. this equipment is allowed The Ulthera System should not be used nearflammable gasesor anesthetics Fire or explosion can result The Ulthera System is not AP or APG rated Ulthera Inc Avoid restricting ventilation underand behind the Ulthera control unit Maintain an open space of at least 4 inches 10 cm around the control unit If ventilation holesare obstructed the System could overheat The Ulthera control unit is rated asa Type B patient applied part It may provide a connection between the patient and protective earth This may present a hazard if the patient becomes connected to other equipment with excessive electrical current leakage Do not touch the handpiece electrical contacts and patient simulta neously To avoid a bum hazard remove the transducerfrom the patient before performing HF electrosurgical procedures 4 2 Equipment Use and Care A Caution Failure to observe these precautions may void the waranty The Ulthera handpiece connectors must be kept clean and dry Do not use the transducer if the connectors have been immersed in liquid See the instructions for cleaning the transducer Every effort has been made to make the transducers as rugged as possible however they may become pemanently damaged if dropped onto a hard surface orif the membrane is punctured Transducers damaged in this manner are not covered by the warranty The Ulthera System hasno userserviceable components Do not attempt to open th
42. ts on the ultra sound image To make a note on ultrasound images l 2 Tap the Toolsicon on the DeepSEE screen Tap the Texticon on the Tools menu A text box will appear nearthe center ofthe image and a keyboard will appear below the image If you want to reposttion the text box tap and drag it with your finger Use the keyboard to type yourcomments Ulthera Inc 7 4 3 5 Tap Enteron the keyboard when you are finished entenng comments and the text box isin the desired position 6 To repeat this procedure and enteranother comment tap the Texticon again and repeat steps 3 5 A total of two annotations may be added to an image After adding two annotations to an image the Text button will then serve to remove the previous annotations To save this image with annotations press the Tools icon and then press Save Database Records The Ulthera System hasa proprietary database for storing a limited number of imagesand treatment record information Images are saved when the user tapsthe Save button on the DeepSEE screen Treatment records are automatically sa ved after ending a treatment session The saved images and information can be browsed orexported to another storage device using the Access Key The database must be maintained by periodically exporting ordeleting unused orold imagesand treatment records The System is primarily designed for patient treatment and storing too much data reduces productivity a
43. ually Tapping a selected image again will deselect it You may also tap DeselectAll to deselect all images 3 Tap the Save button 4 lf you wantthe data to remain on the System after exporting to the Access Key tap the Close button to retum to the Setup screen Exporting treatment records may be done by following these same steps for Records Ulthera Inc Deleting data l Save the recordsto be deleted from the database onto the Access Key to be transferred to a computer for storage This step is not required but it is highly recommended 2 Tap the Delete button to remove an individual item ortap the SelectAll button and then the Delete button to remove all itemsfrom the database Note If you delete one or more patients by mista ke ta p the Undelete button to restore the items 3 Tap the Close button to retum to the Setup screen To recover deleted items from the database l To recoverone or more of the 50 previously deleted items ta p the Undelete button A maximum of 50 previously deleted items may be recovered 2 Selectthe imagesorrecords you would like to recover and tap the Undelete The selected items are restored to the cument database Ulthera Inc Page 53 12 fuod 7 3 2 Page 54 Troubleshooting Waming Screens System wamings provide information and instructions for resolving issues that may occur Follow the instructions provided but please make note of any code letters prese
44. und image The Ulthera System has been designed to meet the standards of IEC 60601 1 2 for electromagnetic compatibility however some computer equipment unintentionally emits strong interfering RF signals Portable RF communication devices may also affect the Ulthera System If image Ulthera Inc Ta 5 4 5 4 1 5 4 2 quality is degraded by EMI the System may need to be relocated or reconfigured Electrical Requirements The Ulthera System hasan intemational power supply standardsand may be used with 100 240 VAC 50 60 Hz power systems See Section 4 1 Electrical and Fire Safety foradditional information Connecting Components Connecting the Handpiece The handpiece connectorreceptacle islocated on the left side of the control unit s front panel asshown in Figure 5 1 To attach the handpiece connector align it with the white dot facing up and push it into the receptacle It will latch when seated properly Figure 5 1 Handpiece Connector Receptacle To disconnect the handpiece twist the coupling ring on the connector countercloc kwise while pulling outwards Identifying and Connecting Transducers Transducers are identified by the label on the top of the transducer which includesthe name of the transducer Ulthera DeepSEE treatment frequency and treatment depth DS X X a unique serial number a part number and date of manufacture The Treatment Guidelines on the control unit interface will display the rec
45. without saving any Close Button changesthat have been made 7 3 7 3 1 Operating Instructions Activate the Control Unit 1 Plug the powercord on the back of the System into the wall socket 2 Tum the main power switch to the ON position 3 The power switch may be left in the ON position when the System is not in use O Note Do NOTuse the power switch to shut down the System 4 Insert the Ulthera System Access Key into the USB port on the back of the control unit 9 The Ulthera System operates only with the authorized Access Key 5 Pressthe green On Off button on front of the control unit The System will perform a brief self test After passing the self test a NO KEY message will be displa yed if the Ulthera System Access Key hasnot yet been inserted otherwise the starting screen will be displayed Wa ming If the self test screen displays any information messages tum the System off by pressing the green On Off button and follow the instructions in the Troubleshooting section Ulthera Inc Page 43 7 3 2 Page 44 Set Up a Treatment Record 1 The Patient Info screen shown in Figure 7 6 isthe first screen displayed when you tum on the System Setup E o OOOO O Patient ID JA080812 Clinician Treating Clinician e Treatment Settings Ultherapy Face 800 e Wa es ED ee We Es ee ee es Re es eg es ea es ee ess 0 ee ED a ES ce We a ee IN IHHBERDDBCTS Enter Figure 7 6 Patien
46. y during the treatment the Treat button will not be lit while energy isbeing delivered A tone will sound quickly foreach TCP created and the green ruler will change to yellow to indicate that treatment is occurring You may adjust the volume of sounds by tapping the Tools button and adjusting it up ordown To deliverthe next treatment line within the same treatment region move the transducer 2 3 mm to adjacent tissue and pressthe Treat button If 40 seconds have elapsed since delivering the last treatment line press the See button on the handpiece to ready the System and then pressthe Treatbutton again Afterapproximately every five treatment lines visually check the image to determine if more gel needsto be applied A small film of gel adequate enough to achieve good coupling should coverthe window Continue delivering treatment lines until you complete the recommended numberforthe region To terminate therapy at any time pressthe See button on the handpiece or lift the transducer off the patient s skin Note In case of emergency pressthe red emergency Stop button on the front panel of the control unit To start treatment in another region tap the desired region The previously treated region will change to the color of the transducer that wasused and the selected region will become Active white Previous treatment regionstreated with a transducerotherthan the one Currently inserted may be reviewed by ta
Download Pdf Manuals
Related Search