Home
MethyQA User Manual
Contents
1. ERRPR if a is set as cutadapt Y lt path_python gt has to be specified in command line For a it is very likely that the python version is not set up properly For b the python version is not set up yet When using cutadapt to do adapter trimming python2 6 or python version 2 6 is required changing the Y option to be Y python2 6 will fix the problem 3 It is not suitable to set a cutadapt and T fix at the same time This is because it is not meaningful to trim off reads with a fixed number of bases after adapter trimming 4 As for the plots of comparing DNA sequencing structures we recommend that the user check the number of target regions in each of those high and low coverage or bisulfite conversion region files using the wc l unix linux command If there is a very small number e g less than 10 of target regions in the low bisulfite or coverage region files then the users may not worry about their data For example the following is the line count for each respective sequencing file It shows that there are only 6 target regions with relatively low bisulfite conversion rates 5298 meta users sun May30 2013 test partial 1 5 30testP chr22 highBS seq 3835 meta users sun May30 2013 test partial 1 5 30testP chr22 highCoverage seq 6 meta users sun May30 2013 test partial 1 5 30testP chr22 lowBS seq 82 meta users sun May30 2013 test partial 1 5 30testP chr22 lowCoverage seq 4 References for sof
2. start means the start position of the target region to analyze and end means the end position of the target region to analyze Box 3 chr start end chr5 103805 104899 chr5 106111 107264 There could be additional columns in the target input file however the important parts are the first 3 columns i e the chr start and end values The target regions will be sorted numerically by chromosome and target region start position in step 4 1 of the pipeline 2 2 4 Chromosome List File The chromosome list file shows the location of the reference genome for the chromosomes the users want to analyze Box 4 home reference hg18 chr5 fa home reference hg18 chr10 fa 2 3 Step 1 FastQC FastQC is already detailed online so this section will only briefly describe the input and output for this step of the pipeline For more information the documentation for the FastQC software is located at www bioinformatics bbsrc ac uk projects fastqc 2 3 1 FastQC input The input for the FastQC software is a fastq file This will be the initial input for the complete pipeline 2 3 2 FastQC output The output for the FastQC software will be packaged in a zip file and a folder in the output directory 2 4 Step2 Trim 2 4 1 Adapter Trimming An adapter trimming algorithm removes adapter sequences from high throughput sequencing data The user will be able to utilize either the adapter trimming tool cutadapt o
3. export PKG_CONFIG_PATH usr local lib pkgconfig SPKG_CONFIG_PATH Now to install fastx toolkit the user may copy the following command lines S wget http cancan cshl edu labmembers gordon files fastx_toolkit 0 0 12 tar bz2 S tar xjf fastx_toolkit 0 0 12 tar bz2 S cd fastx_toolkit 0 0 12 configure S make S sudo make install After following the above steps the software packages will work If the user needs any more help please refer to the respective websites listed above 2 Pipeline Walkthrough 2 1 Usage 2 1 1 Using the complete pipeline The complete pipeline runs analysis for the workflow step 1 5 as shown in 1 1 with the following usage perl MethyQA pl i lt FASTQ_input gt t lt TARGET input gt c lt chr gt p lt prefix gt d lt path_MethyQA gt R lt reference_directory gt r lt reference_name gt OPTIONS Command options i lt file gt t lt file gt d lt dir gt c lt string gt p lt string gt R lt dir gt r lt file gt f lt string gt a lt string gt A lt string gt T lt string gt N lt int gt n lt int gt B lt real gt b lt real gt L lt real gt I lt real gt u lt logic gt v lt logic gt Y lt string gt Q lt string gt M lt string gt K lt string gt J lt string gt X lt string gt FASTQ input file Target input file i e a list of target regions specified f
4. 2 8 2 Target region Analysis Description Step 4 3 of the pipeline begins the analysis at the target region level Its purpose is to read data from each target region and then produce a summary table and histogram to summarize the bisulfite rates from each region 2 8 3 Target region Analysis Output Step 4 3 of the pipeline analyzes all of the target regions for each chromosome and outputs a target summary table and a mean median histogram A sample of the target summary table is illustrated in box 8 13 Box 8 chri target summary table txt for the good dataset chr start end NCGC NCGCwC percent Min X1st Qu Median Mean X3rd Qu Max chr4 100005824 100006023 27 3 0 1111 1 1 1 1 1 1 chr4 100026183 100026258 16 0 0625 1 1 1 1 i i chrX target summary table txt for the bad dataset chr start end NCGC NCGCwC percent Min X1st Qu Median Mean X3rd Qu Max chrX 100694449 100694704 45 11 0 2444 0 9565 0 9891 1 0 9921 1 1 chrX 101657993 101658329 99 18 0 1818 0 0 0 01106 0 1745 0 0321 1 The above summary table is similar to the one from step 4 2 i e chromosome level summary tables in Box 7 However this summary table allows the user to analyze each target region individually In Box 8 for the bad dataset we see that some target regions have very low bisulfite rate summary results Figure 3 and 4 illustrate two examples of the figure mean median ps file that will be generated at the target region level using the
5. home appl apps bin acgt count v1 2 4 default is to use the one complied in MethyQA pipeline Path to fastx function e g home appl apps bin fastx default is to use the one complied in MethyQA pipeline C lt string gt Path to cutadapt function e g home appl apps bin cutadapt default is to use the one complied in MethyQA pipeline The complete pipeline ties the software and source code together with appropriate dataflow to ensure correct output is achieved At this point the user needs to have perl R FastQC and BRAT software installed on their system and be able to enter commands in a Unix Linux environment The initial target and fastq input files will be discussed in section 2 2 The output directory is the path specified by the user to which the output files will be written All output files will be written to the current working directory set by the user The c argument is used to specify one chromosome for analysis i e chr1 or chr17 or chrX etc It is also important to note that for all chromosome positions 1 based values are used throughout the pipeline Example command line adapter trimming with cutadapt target region analysis on chr2 perl home MethyQA code MethyQA pl i home MethyQA input sample fastq t home MethyQA input targets file d home MethyQA c chr2 p sample name R home reference hg18 r home MethyQA input hg18 chr2 fa filename txt a cutadapt Y python2 6 2 1 2
6. Using the partial pipeline If the users have already generated the BRAT alignment output file or have obtained the methylation ratio data using other alignment tools they can start to run the analysis of Step 4 and 5 using our partial MethyQA pipeline whose usage is given below perl partial MethyQA pl i lt BASE_input gt t lt TARGET_input gt c lt chr gt p lt prefix gt d lt path_MethyQA gt R lt reference_directory gt OPTIONS Command options i lt file gt Base input file the BRAT ACGT count output file t lt file gt Target input file i e a list of target regions specified for analysis F if do not perform target analysis d lt dir gt Path to MethyQA directory e g home user downloads MethyQA c lt string gt Chromosome number e g chr1 chr2 chr17 chrX chrY etc p lt string gt Prefix i e the prefix written to the output file names R lt dir gt Reference directory i e the directory with the genome reference files B lt real gt Cutoff value for selecting high bisulfite conversion regions Range 0 1 default B 0 99 Note if the median bisulfite conversion rate of all nonCGc sites in a target region is greater than or equal to B this region is elected as a high bisulfite conversion region b lt real gt Cutoff value for selecting low bisulfite conversion regions Range 0 1 default b 0 6 Note if the median bisulfite conversion rate of all n
7. above summary table They plot the mean and median bisulfite rates for all target regions on a specific chromosome In particular Figure 3 represents a set of data with high bisulfite conversion rate i e bisulfite rate almost 1 Figure 4 represents a set of data with low bisulfite rate such that many target regions have mean or median bisulfite rates much lower than 1 chr1 Median Bisulfite Rate chr1 Mean Bisulfite Rate Q amp e 2 2 ao oO Q Q wo wo oO oO r T T T T 1 f T T T T 1 00 02 04 06 08 1 0 0 0 02 04 06 08 1 0 Bisulfite rate Bisulfite rate Figure 3 Histogram of mean and median bisulfite rates for target regions in chromosome 1 This figure represents mean and median bisulfite rates in a good dataset and is associated with the data from Figure 1 Note the target regions are RRBS intervals not CpG islands 14 chrX Median Bisulfite Rate chrX Mean Bisulfite Rate N o 2 o 4 lt O O o D 2 el a a N 7 7 NF g q 7 An v la Walp F Aa 22 2 i T T T T 1 T T T T T 1 0 0 02 04 0 6 0 8 1 0 0 0 02 04 0 6 0 8 1 0 Bisulfite rate Bisulfite rate Figure 4 Histogram of mean bisulfite rates from a bad dataset the same dataset employed in Figure 2 Note the target regions are CpG islands 2 9 Step 5 Sequence Structure Analysis 2 9 1 Sequence Structure Analysis Input The input for step 5 is the target summary table
8. chromosome level as well as at the target region level the target input file is to be provided by the user The user will also obtain graphical summaries analyzing the sequence structure for regions with high vs low coverage and bisulfite conversion rates This pipeline is developed with the aim of providing insights for experimental scientists in a timely manner In particular our pipeline can provide quality assessment for tens of millions of reads in less than one hour The workflow of the pipeline is illustrated below Workflow of the Pipeline MethyQA Step 1 Assess sequencing qualities using FastQC Step 2 Trim sequencing data Step 3 Align reads using BRAT and obtain methylation ratios at all cytosine sites Step 4 Examine bisulfite rates using nonCGc sites p Step 5 Compare sequence structures of different regions Note the last two steps were developed by our research team utilizing various scripts included in the MethyQA code file We demonstrate the use of MethyQA using a publicly available bisulfite treated methylation sequencing dataset GSE27003 for the cell line MCF10A and another dataset named s7 in section 2 MCF10A data is considered to be the example of a good dataset with no obvious sequencing problems and s7 is considered to be a bad dataset that has a low bisulfite conversion rate 1 2 Installation Perl recommend v5 8 8 or later R recommend v2 13 0 or later and python recommen
9. from step 4 3 2 9 2 Sequence Structure Analysis Description Step 5 examines the reference sequence structure for regions with high or low bisulfite conversion rate and for regions with high or low coverage to provide insight for experimental scientists The code in this step of the pipeline separates lines of the target summary table from step 4 3 according to high and low values set by the user for bisulfite rate and the coverage For example the user may specify to study the average reference structure of regions with bisulfite conversion rate higher than 90 and lower than 20 or any value desired in the command line The same principle can also be applied to coverage of the reference structure of particular regions 2 9 3 Sequence Structure Analysis Output The output from step 5 will consist of a boxplot e g Figure 5 and 6 analyzing the percentage of A C G T C G CGc nonCGc and the percentage of repetitive bases for regions with high or low coverage or bisulfite conversion rate 15 Figure 5 is for a good dataset that has no obvious sequencing problems so there are no obvious DNS sequence structure differences Figure 6 is for a bad dataset that has obvious bisulfite sequencing problems so there are dramatic DNA sequence structure differences Lo 70 80 90 50 60 40 70 30 40 50 60 20 10 20 30 40 50 60 o high low ACGce t 7 i i J o ae eee high low 100 40 50 60 70 8
10. 0 90 L______ high low 40 60 80 100 20 oT high low low_count high low Figure 5 Boxplots comparing regions with high vs low coverage in chromosome 1 from the good data the same dataset employed in Figure 1 Note target regions are RRBS intervals 16 hG 38 17 5 18 20 36 16 5 16 32 15 5 14 3 14 5 28 high low high low high low C G ononCGc low_count 26 28 30 32 24 22 20 high low high low Figure 6 Boxplots comparing regions with high vs low coverage in chromosome X from the bad data the same dataset employed in Figure 2 Note target regions are CpG islands Because the bad dataset we used has the incomplete bisulfite conversion problem we also compared the DNA sequence structures for high and low bisulfite conversion regions see Figure 7 Figure 7 shows that high bisulfite conversion regions tend to have relatively higher percentages of G and GC but lower percentages of C and nonCGc This comparison results show that regions with more Cs and nonCGcs tend to have incomplete bisulfite conversion problems in this sequencing experiment 17 40 35 30 25 80 75 70 65 G high low nonCGc high low 14 16 18 1 1 12 20 15 oT high low low_count high low Figure 7 Boxplots comparing regions with high vs low bisulfi
11. 5 1 BRAT Large BRAT Large handles the alignment of the data The input is the output from Step 2 and the output will be labeled brat a sample of which is shown below in box 6 For more information see the BRAT user manual section BRAT large Box 6 trim single 1M brat 1 CGGGGAGTTAGCGTGAGAGGGGGGTTGGGTTAGTTAGTGTTCTTTTTTT chr2 3296772 13296771 9 TGGGAAATTATAATGAGATTTGGTTTTCGAGAGTATT chr2 74594669 0 74594669 13 TGGGTTTAAGTAATTITTTTTGTTTTAGTTTTTTAAGTAGTTGAGATC chr2 45050947 0 45050947 2 5 2 ACGT count The input for this part of the pipeline is a bit unusual Even though it utilizes the output from BRAT large the input that is supposed to be included in the execution is actually a one line file containing the name of the output from BRAT large The output of ACGT count is illustrated in box 2 of section 2 2 2 10 2 6 Step 4 1 Data Parser The remaining steps were developed by our research team 2 6 1 Data Parser Input The input for the data parsing step includes the BRAT ACGT count initial input file and the target region input file that are explained in sections 2 2 2 and 2 2 3 2 6 2 Data Parser Description The first step for examining bisulfite rates using nonCGc sites is one of the most time consuming portions of the pipeline The main goal of this step is to prepare the large data files to be read into R software so that the analysis output files are produced If one were to examine the script executed in thi
12. MethyQA User Manual Shuying Sun ssun5211 yahoo com Aaron Noviski ajn21 case edu Xiaoqing Yu xxy39 case edu June 5 2013 Case Western Reserve University Contents 1 General Overview and Installation Page 2 1 1 General Overview Page 2 1 2 Installation Page 3 2 Pipeline Walkthrough Page 4 2 1 Usage Page 4 2 2 Initial Input Page 7 2 3 Step 1 FastQC Page 9 2 4 Step 2 Trimming Sequence Data Page 9 2 5 Step 3 BRAT alignment and ACGT count Page 10 2 6 Step 4 1 Data Parser Page 11 2 7 Step 4 2 Chromosome level Analysis Page 11 2 8 Step 4 3 Target region Analysis Page 13 2 9 Step 5 Sequence Structure Analysis Page 15 3 Additional Notes Page 19 3 1 System Requirements Page 19 3 2 Running Time Page 19 3 3 Example Page 19 3 4 Warning and troubling shooting notes Page 19 4 References Page 20 1 General Overview and Installation 1 1 General Overview The MethyQA pipeline is meant to assist the user in assessing the quality of bisulfite treated methylation sequencing data It achieves this goal by utilizing efficient perl and R scripts to first parse the data and then summarize them in useful formats To execute the process the user enters a command line in a Unix Linux environment and the pipeline will begin and update the user with the overall progress of the assignment By the end of the process the user receives summary tables and plots analyzing bisulfite conversion rates at the
13. RAT is a fairly simple process After unzipping the BRAT package the user only needs to run make to build executable files An example follows S wget http compbio cs ucr edu brat downloads brat 1 2 3 tar gz S tar zxvf brat 1 2 3 tar gz S cd brat 1 2 3 S make For additional information the user can learn more on BRAT s website http compbio cs ucr edu brat 1 2 4 Installing Cutadapt The user can choose to utilize Cutadapt s adapter trimming function or Fastx clipper s adapter trimmer or neither of them If the user chooses to go with Cutadapt it should be a fairly simple installation The user must have Python 2 6 and then easy_install can be used to quickly install Cutadapt The only command needed follows S easy_install cutadapt Additional help can be found at http code google com p cutadapt 1 2 5 Installing Fastx Installing Fastx is a bit more involved than BRAT and Cutadapt because it involves additional software to work For more details the user can visit http hannonlab cshl edu fastx_toolkit index html To start the user needs wget pkg config g g compiler and libgtestutils O 6 The script to install libgtextutils is below S wget http cancan cshl edu labmembers gordon files libgtextutils 0 6 tar bz2 S tar xjf libgtextutils 0 6 tar bz2 S cd libgtextutils 0 6 S configure S make S sudo make install this part is optional Tell pkg config to look for libraries in usr local lib too
14. ded v2 6 or later are required on the user s system Then the user can simply download the MethyQA package and after unzipping it is ready to go because FastQC BRAT Fastx and Cutadapt are already pre compiled in the MethyQA resources folder 1 2 1 Installing MethyQA MethyQA requires a Linux Unix system with proper versions of Perl R and python installed To install MethyQA the user can download the pipeline from http hal case edu sun MethyQA v2 zip After unzipping the file unzip MethyQA v2 zip the user gets a folder include 2 documents and 3 subfolders MethyQA user manual pdf a copy of this user manual README txt about how to unzip install and run MethyQA pipeline with detailed example scripts Code a folder containing all perl and R scripts used for MethyQA pipeline Input a folder containing all example input data as mentioned in README txt Resource a folder containing all third party software packages that are already pre compiled in the MethyQA including FastQC BRAT Fastx and Cutadapt Now it is ready to go If the user wishes to download the third party software separately he can follow the tutorial provided below 1 2 2 1 2 5 1 2 2 Installing FastQC To install FastQC the user should go to http www bioinformatics babraham ac uk projects fastqc Then the user needs to unzip the package and the latest version of FastQC will be ready to run 1 2 3 Installing BRAT Installing B
15. ference genome Additionally the run time of the partial pipeline Steps 4 and 5 is generally about 20 minutes 3 3 Example We have provided a README file with the file name README txt that can be downloaded from http hal case edu sun MethyQA v2 zip In the end of this file we have included the script of running both the complete and partial MethyQA pipeline and the screen output of running these pipelines In addition in this README file we have also given the explanation of the code and input folder 3 4 Warning and trouble shooting notes 1 If only the usage and command options are printed out when users are running the pipeline methyQA pl or partial methyQA pl this problem may be due to one of the following reasons a not all required options i t d c p R r are provided b even though they are provided they are not provided correctly c perl R and or python are set as earlier versions Thus we recommend that users first check required options and the versions of perl R and python carefully 2 If users get the following error messages a Error message Traceback most recent call last 19 File meta users sun May30 MethyQA v3 resources cutadapt bin cutadapt line 9 in from cutadapt scripts import cutadapt File meta users sun May30 MethyQA v3 resources cutadapt cutadapt scripts cutadapt py line 71 from import seqio _ version__ A SyntaxError invalid syntax b
16. ion regions Range 0 1 default b 0 6 Note if the median bisulfite conversion rate of all nonCGc sites in a target region is less than b this region is elected as a low bisulfite conversion region Cutoff value for selecting high coverage region Range 0 1 default L 0 5 Note Let N be the number of nonCGc sites and n be the number of nonCGc sites with coverage in a target region For a given target if n N gt L it is selected as a high coverage region Cutoff value for selecting low coverage region Range 0 1 default I 0 1 Note Let N be the number of nonCGc sites and n be the number of nonCGc sites with coverage in a target region For a given target if n N lt it is selected as a low coverage region Bisulfite flag it is an option to initiate boxplot of high vs low bisulfite rates either TRUE default or FALSE Coverage flag it is an option to initiate boxplot of high vs low coverage either TRUE default or FALSE Path to python when running cutadapt i e python python2 6 home bin python Path to FastQC e g home appl apps bin fastqc default is to use the one complied in MethyQA pipeline Path to BRAT trim function e g home appl apps bin trim v1 2 4 default is to use the one complied in MethyQA pipeline Path to BRAT large function e g home appl apps bin brat large v1 2 4 default is to use the one complied in MethyQA pipeline Path to BRAT ACGT count function e g
17. mple file shown in box 1 lists its position values in O based offset Upon execution of Step 4 of the pipeline the first process is to 7 an separate the CG type and Coverage columns by removing the based offset and changing the position values to 1 Box 2 chr position position CG type Coverage Methylation Strand chr5 63004 63004 CHH 0 0 chr5 63005 63005 CHH 0 0 chr5 63006 63006 CHH 0 0 chr chromosome number position 0 based chromosome position of a cytosine site CG type the CG type of a cytosine site whether it is CG site or a nonCG site coverage number of reads methylation this column displays the methylation ratio and the bisulfite rate at nonCGc sites can be obtained as bisulfite rate 1 methylation ratio strand chromosome strand or Note that the header of the sample was added in this document for clarification The ACGT count input has been well sorted in the original output as done by the BRAT software 2 2 3 Target Input File The target input is a list of target regions desired for analysis by the user It includes the chr name the start and end positions While the position input file is produced from the BRAT software the target input file is to be produced by the user This is due to the fact that the user will provide specific target regions to analyze An example of a target file is shown in box 3 In this box chr means the chromosome number
18. ome level Analysis Output Sample summary tables for good and bad datasets are shown in box 7 Box 7 chri summary table txt for the good dataset chr TNCGC TNCGCwC percent Min X1st Qu Median Mean X3rd Qu Max chr1 44683043 622926 0 01394 0 1 1 0 9961 1 1 chrX summary table txt for the bad dataset chr TNCGC TNCGCwC percent Min X1st Qu Median Mean X3rd Qu Max chrX 28558180 54784 0 0019 0 0 4725 1 0 7431 1 1 11 The summary table is structured to include chromosome number total nonCGc sites total nonCGc sites with coverage and the percentage of nonCGc sites with coverage compared to the total number of nonCGc sites The last 6 columns display a summary of the bisulfite rate for the entire chromosome including the minimum value the 25 quartile the median average the 75 quartile and the maximum value For the good dataset there are 44683043 nonCGc sites in chr1 and 622926 or 1 394 of those sites with coverage for the bad dataset there are 28558180 nonCGc sites in chr1 and 54784 or 0 2 of those sites with coverage This summary table shows the bisulfite conversion rate is very high in that the 25 percentile and mean are 1 and 0 996 respectively The bottom chrX summary table in Box 7 is for a dataset with low bisulfite conversion rate in that the 25 percentile and mean are 0 47 and 0 74 respectively Figure 1 is the histogram of bisulfite rates from chromosome 1 in a good dataset In thi
19. onCGc sites in a target region is less than b this region is elected as a low bisulfite conversion region L lt real gt Cutoff value for selecting high coverage region Range 0 1 default L 0 5 Note Let N be the number of nonCGc sites and n be the number of nonCGc sites with coverage in a target region For a given target if n N gt L it is selected as a high coverage region I lt real gt Cutoff value for selecting low coverage region Range 0 1 default l 0 1 Note Let N be the number of nonCGc sites and n be the number of nonCGc sites with coverage in a target region For a given target if n N lt it is selected as a low coverage region u lt logic gt Bisulfite flag it is an option to initiate boxplot of high vs low bisulfite rates either TRUE default or FALSE v lt logic gt Coverage flag it is an option to initiate boxplot of high vs low coverage either TRUE default or FALSE As outlined in the manuscript Steps 1 3 of the pipeline utilize available software packages to prepare the data for Steps 4 and 5 If a BRAT ACGT count output file already exists the user can opt to start the pipeline from Step 4 which is the start of the process developed by our research team The ACGT count input file will be discussed in section 2 2 The users may have obtained the methylation ratios using some other alignment tools In this case they can still use partial MethyQA They ju
20. or analysis F if the users do not perform target analysis Path to MethyQA directory e g home user downloads MethyQA Chromosome number e g chr1 chr2 chr17 chrX chrY etc Prefix i e the prefix written to the output file names Reference directory i e the directory with the genome reference files Reference name i e the file name of the reference that the user will use FASTQ format i e sanger or illumina Adapter trimming 1 no no adapter trimming default 2 fastx fastx adapter trimming 3 cutadapt cutadapt adapter trimming If cutadapt is set the Y option needs to be specified in the command line Adapter sequence the default is Illumina adapter sequence AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG Quality trim flag 1 no no quality trimming 2 brat brat dynamic trimming default 3 fix fixed quality trimming For fixed quality trimming the users specify the number of bases to be trimmed at the 5 end default is 5 For fixed quality trimming the users specify the number of bases to be trimmed at the 3 end default is 10 Cutoff value for selecting high bisulfite conversion regions Range 0 1 default B 0 99 Note if the median bisulfite conversion rate of all nonCGc sites in a target region is greater than or equal to B this region is elected as a high bisulfite conversion region Cutoff value for selecting low bisulfite convers
21. r the fastx_clipper by specifying which tool to use in the global variables section at the beginning of MethyQA pl The user could also choose to skip adapter trimming by entering a string no note that the default setting is no adapter trimming For more information on cutadapt the user can visit the website code google com p cutadapt For more information on fastx_clipper the user can visit the website hannonlab cshl edu fastx_toolkit index html 2 4 2 BRAT Trim Documentation on the BRAT trim function can be found in the BRAT user manual which can be found at the website http compbio cs ucr edu brat 2 4 2 1 BRAT Trim input The input file for BRAT Trim is the initial FASTQ file used in step 1 of the pipeline Although detailed information can be found in the BRAT user manual we will briefly describe some of the default parameter settings in the pipeline as demonstrated in the following script line trim s SARGV O P Spref q 1 L 64 m 2 In this command q represents the quality score threshold of bases L specifies the smallest value of the range of base quality scores in ASCII representation 64 for Illumina format fastq file and 33 for sanger format fastq file and m is the number of allowable internal N s 2 4 2 2 BRAT Trim output There are a few parameter options that are discussed in the BRAT user manual and the specific parameters we ve implemented are briefly described in the source code no
22. s instance an analysis of chromosome 1 would produce a histogram named prefix chr1 BS jpg in the output directory which is illustrated in Figure 1 also illustrated in Figure 1A in the main manuscript chr1 Bisulfite Rate 15 20 Density 10 l T T T T 1 0 0 0 2 0 4 0 6 0 8 1 0 Bisulfite rate Figure 1 Histogram of bisulfite rates from chromosome 1 in a good dataset i e a dataset with complete bisulfite conversion 12 Figure 1 indicates that the bisulfite rate is very high and there is no evidence of incomplete bisulfite conversion If a sequencing dataset has very low bisulfite conversion rates the histogram will be very different from the plot shown in Figure 1 With low bisulfite conversion rates the user will observe data points much less than one see Figure 2 Figure 2 is a representative of a dataset with low bisulfite conversion rates and many of the sites have a zero value implying that they are not converted at all chrX Bisulfite Rate 12 10 Density Oo CM A AD A A ee A AZZAZPTALZLAZZFAZIAZIALF T 0 0 0 2 0 4 0 6 0 8 1 0 Bisulfite rate Figure 2 Histogram of bisulfite rates of chromosome 1 from a bad dataset i e a dataset with incomplete conversion 2 8 Step 4 3 Target region Analysis 2 8 1 Target region Analysis Input The input for step 4 3 includes the nonCG covered out file from part 2 and the nonCG match file from step 1
23. s section the user would note that this parsing stage is completing many various tasks First and foremost the script separates positions belonging to an individual chromosome from the rest of the dataset Then the script matches every base pair position to the corresponding target region if a target file is provided Next the CG type is examined for each site and CGc types are filtered from the data until only nonCGc sites remain After a few minor adjustments the data are now ready to be input into the final steps of the pipeline In section 2 7 and later for a good dataset we mean the results are from the quality assessment of MCF10A data for a bad dataset we mean the results are from the quality assessment of s7 data 2 7 Step 4 2 Chromosome level Analysis 2 7 1 Chromosome level Analysis Input The input for step 4 2 consists of the base files from Step 4 1 of the pipeline 2 7 2 Chromosome level Analysis Description Step 4 2 is the first part of the analysis for the quality assessment of bisulfite treated reads Its purpose is to read each chromosome and produce a summary table so that the user can analyze each chromosome separately It also produces a histogram to examine the bisulfite conversion rate for a specific chromosome specified by the user At this point the pipeline only deals with bisulfite treated reads at the chromosome level Analysis at the target region level will be described in Step 4 3 2 7 3 Chromos
24. st need to make sure the methylation ratio files are prepared to have the same format as BRAT output The BRAT methylation ratio output contains the following basic and standard information for each cytosine site chromosome position cytosine type i e CG CHH and CHG total coverage and methylation ratio For more details regarding BRAT methylation ratio output see section 2 2 2 Example command line target region analysis on chr2 perl home MethyQA code partial MethyQA pl i sample acgt_forw txt t home MethyQA input targets file d home MethyQA c chr2 p sample name R home reference hg18 2 2 Initial Input 2 2 1 FASTQ Input File The FASTQ input file contains the raw data that will be analyzed in the upcoming steps A sample of a FASTQ formatted file is shown below Box 1 FASTQ input file 1 read methy MCF10A SRR097806 1 HWW EAS217_0007 6 2 0 815 length 50 NGGTGTTTTTTGGGTTTTAGTAGTTNNGGTTCGTGGTTAGTNNGATTTGT methy MCF10A SRRO97806 1 HWW EAS217_0007 6 2 0 815 length 50 9768 8547 989526 AHHHHHHHHHHA HE HHHHHHH With FASTQ format there should be 4 lines attributed for every read The FASTQ input file is the direct input for Steps 1 and 2 and from there the output files produced will be used as inputs for the remaining steps 2 2 2 ACGT count Input File only used as initial input for the partial pipeline see section 2 1 2 The ACGT count file is produced from the alignment software BRAT The sa
25. te rates in chromosome X from the bad data the same dataset employed in Figures 2 4 and 6 Note target regions are CpG islands 18 3 Additional Notes 3 1 System Requirements To run the MethyQA pipeline the user will need the following software e A Unix or Linux environment e Installed Perl on system in many cases Perl comes pre installed in Linux and Mac systems enter perl v to see what version you have if you do not have Perl then you can download the latest version here http www perl org get html e Installed R on system you can download the R software environment here http www r project org e FastQC software located here http www bioinformatics bbsrc ac uk projects fastqc e BRAT software located here http compbio cs ucr edu brat e The user will also need a reference genome to do alignment 3 2 Running Time The main challenge of methylation sequencing quality assessment is to process large amounts of data in a reasonably short amount of time Current test runs on our pipeline have produced a run time of less than one hour from initiation of Step 1 through the completion of Step 5 for 20 million reads These test runs were done in a Red hat Linux server with dual quad core 2 66 GHz Xeon E5430 CPUs and 4 GB of RAM An important note however is that the completion time of Step 3 BRAT alignment and ACGT count also depends on the number of reads for sites in the re
26. tes However the output file important for the progression of the pipeline will be labeled prefix_reads1 txt and a sample is shown below in box 5 Box 5 prefix_reads1 txt GGGTTTGGTGGTTGGTATTTGTATGTAATTTTAGTTATTTGGGAGGTTG 1 0 ATCGGAAGAGCGGTTCAGCAGGAATGCCGAGAGCGGAAGAACGGCGTAC 1 0 ATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGATCGGTTCAT 1 0 In the above sample output the first column contains the data from the second line of each fastq read followed by the number of bases trimmed at the 5 end and the 3 end in the second and third columns respectively 2 4 3 Fixed Trim i e trimming off fixed number bases An alternative to BRAT s dynamic trimming function is a standard fixed trimming option we ve included in the pipeline While utilizing this option the user has direct control over how many bases to trim from the 5 end and the 3 end by setting the options N and n respectively in the command line The input and the output for the fixed trim option are the same as the input and output for BRAT large so see section 2 4 1 for more information Please note that it is good to use this trimming option if the users know exactly how many bases they want to trim off and no adaptor sequences have been trimmed yet However if the users have already trimmed the adapter sequences then the reads length varies it is NOT good to use this trimming option any more 2 5 Step 3 BRAT Alignment and ACGT count 2
27. tware packages 1 Andrews S 2010 FastQC http www bioinformatics bbsrc ac uk projects fastqc 2 Harris E Y et al 2010 BRAT bisulfite treated reads analysis tool Bioinformatics 26 572 573 3 Marcel Martin 2010 Cutadapt code google com p cutadapt 4 Hannon G J 2009 FASTX Toolkit http hannonlab cshl edu fastx_toolkit 20
Download Pdf Manuals
Related Search
Related Contents
RF ELECTRONIC PRESET METER 設計変更ガイド Brodit ProClip 854772 Assembly Manual Manuel d`assemblage Douleur - Accueil, Oncolor, réseau de soins en cancérologie, cancer 取扱説明書 MOUSSES, ALGUES, LICHENS 125cc RL - TaG - IAME USA West Copyright © All rights reserved.
Failed to retrieve file