Home

manual - Oligo Software

1. Thi 45 4 sec T 3 min 4 sec EEE Figure 5 17 The Hybridization Time window The Analyze Hybridization Time command calculates oligonucleotide hybridization time for various user selected lengths and concentrations in the Hybridization Time dialog box OLIGO uses the following formula for calculation of the time required to reach half of the equilibrium after this value half of all possible duplexes should be already formed tyo N In2 3 5 10 gL Cy Where N is the total number of base pairs in a non repeating sequence molecular complexity L is the oligonucleotide length in nt and Cn is the oligonucleotide concentration mol nucleotides liter For simplicity N L therefore tie gl In2 3 5 10 C Where C is oligonucleotide concentration moles liter Ref 15 When a new length or concentration value is entered the new hybridization time is displayed Note Because of high secondary structure potential and the presence of sequence repeats hybridization times for long DNA fragments is usually underestimated by this formula The hybridization time for standard length primers should be reasonably accurate The T value displayed in this window is 5 times the t1 2 that is sufficient to reach about 90 equilibrium 81 5 18 Analyze Concentrations ear Concentrations File BRCA 2 gene seg fe Constant Concentration gt Constant Vo
2. calculation that includes the dangling ends however the mismatches are not considered If the tm is displayed instead of the Tm in certain Oligo windows than the nearest neighbor method is used without consideration for the dangling ends Besides the T values the Composition and Tm windows display e The A260 A280 absorption ratio 63 Note The A260 A280 absorption data have been generated using a limited number of oligos e The molecular weight of the given oligo both single stranded and double stranded Some Lower Probe Composition File CBP seq Lower Probe CBP 62L27 Ty 70 5 nearest neighbor method Ta rg Be ag nearest neighbor method aA Aa Sequence Composition Tm 75 9 GC method File CBP seq Tm 76 2 A T 4 G C method Entire Sequence 1868 nt Tm RNA LLM Na 84 2 GC method Tm DNA RNA LM Na 77 2 GC method Tm 91 6 GC method Azgo Azg0 1 78 single strand Tm RNA LM Na 98 2 GC method Molecular Weight 8 3K one strand Tm DNA RNA LM Na 90 6 GC method Molecular Weight 16 7K two strands Azgo Azgo 1 96 single strand ug OD 47 8 dsDNA Molecular Weight 577 3K one strand Molecular Weight 1154K two strands Base Number amp ug OD 49 0 dsDNA A 6 22 2 C 7 25 9 Base Number amp G 4 14 8 A 576 30 8 T 10 37 0 C 309 16 5 A T 16 59 3 G 338 18 1 G C ll 40 7 T 645 34 5 A T 1221 65 4 DNA Melting Temperature in Various G C 647
3. column missing because the pairs get their scores based on individual primers It is a weighed number so the maximum score a pair or a set can get is 1000 points 8 5 Change GC of the Unknown Fragment This option is active only when the Forward or Reverse Primer or Upper or Lower Oligo position is manually set beyond the sequence file In this case it is not possible to calculate the Tm of the product without manually entering the GC of the unknown sequence fragment 8 6 Change Reading Frame This option controlls the translation result displayed in the Sequence window You may display nucleic acid translation in all 6 reading frames 8 7 Change Rev Translate Method 8 1 Reverse Translate Lathe The Lathe method is based on the most probable codons in mammalian MRNA 14 It gives more accurate codon prediction than the codon table method because it assigns codons in a broader context Usually larger GC clusters are not favourable This method yields sequences with less secondary structure 8 2 Reverse Translate Inosine When the Inosine method is selected an inosine universal substitute nucleotide is inserted at the third base position in certain degenerate codons 11 8 3 Reverse Translate Degenerate This method gives all possible oligonucleotide combinations using the standard biochemical symbols for degenerate codons N Y R etc see Appendix D Table 7 12 Usually degenerate primers per
4. 423 50 3 I 14 11 10 09 HumanelF 4E 12 AATAAACATTAATTTTGTGCAT 1 3 SC 421 48 0 Oligonucleotide Sets 9 Product Length is based on ID Numbers a Forward Reverse Upper Lower Product i Primer Primer Oligo Oligo Length l 1 4 110 2 2 5 474 3 3 6 440 _ 4 7 9 465 5 7 10 714 6 8 11 552 7 12 15 297 8 13 15 256 9 14 16 477 This database is linked to Human elF 4E seq On the top you d see the individual primers and on the bottom the sets You may sort data of any of the columns by clicking on the column title secondary sort when holding the option or Alt key pressed This applies also for the Sets portion of the window Product length is calculated from the ID Number description so if you make a set manually the product length may be incorrect or not show at all 9 From the Analyze menu choose Multiplex All Sets Minimize Reaction The bottom of the window shows the compatible sets of primers au LLJ LV UD TIUIaiicir e l MA ILAMA TAU ue eee VW Je aa e7 pn JV O Results of Multiplexing All Sets Select Minimize Reaction e SE Ss gt Group 1 3 1 1 4 2 2 5 8 13 15 i e B a e b ta aa i oar 200 10 where the set numbers are marked in red and in parenthesis you see the individual primer numbers Depending on the Database Options the results may vary You may change the Group display by clicking on the slider and when yo
5. Figure 6 7 The Primers and Probes Search Data window A search for consensus primers was conducted From this table you can see that the subsearch for consensus probes removed 172 primers and it is easy to spot that Chicken elF 4E seq was the least compatible sequence that caused removal of 159 primers only 6 forward and reverse primers were found 105 106 F The OLIGO Select Menu Select Forward Primer Select Reverse Primer Select Upper Oligo Select Lower Oligo Select New Current Oligo Position 108 108 109 109 109 107 7 The OLIGO Select Menu From the Select menu you can select Forward and Reverse Primers Upper amp Lower Oligos and a New Current Oligo Position Change View Window He Forward Primer U Reverse Primer a6 L Upper Oligo HU Lower Oligo d6L New Current Oligo Position dK Figure 7 0 The OLIGO Select menu Mac In Windows the same items are displayed but the short cut keys are different 7 1 Select Forward Primer The Forward Primer command from the Select menu selects the positive strand Current Oligo as the Forward Primer Once selected the Forward Primer is displayed in red on the Sequence window two lines above the Current Oligo and followed by a primer extension triangles pointing toward the 3 end of the sequence The Forward Primer is displayed in upper case letters except for nucleotides mismatched to the active sequence which are displayed in low
6. Td Tm k II Where k is a temperature correction for filter hybridization and in Ref 4 it is equal to 7 6 C Recently new thermodynamic values have been reported 5 eliminating the requirement for the k value k 0 therefore Ta Tm Tm calculated by nearest neighbor method The temperature for filter hybridization should be approximately 10 C lower than T The formula OLIGO uses for calculation of sodium equivalent of magnesium concentration is Na 4 x Mg2 IlI The bivalent cathion concentration has a profound effect in Tm calculations 16 2xAT 4xGC Method Add 2 for each A and T and 4 for each G and C nucleotide This is the simpliest but the least accurate method for oligonucleotide Tm calculations Note that the concentration of nucleic acid is ignored To roughly match these Tm 169 values with the nearest neighbor method values the oligonucleotide and salt concentrations should be set for the nearest neighbor method at 100 pM and 1 M respectively GC Methods To Tm of Long DNA Duplexes The Tm of long DNA duplexes TmPfOduct required in calculating the optimal annealing temperature for PCR Ta cannot be derived from equation I since the nearest neighbor model is not applicable Instead the formula of Wetmur 3 is used Kt TOWE 64 5 16 6log 1 0 41 G C 59 _ o mismatch m 1 0 7 K Len V RNA Tm Calculation OLIGO uses a similar equation for RNA Tm calculation 3
7. Tm Melting temperature the temperature at which 50 of nucleic acid molecules are in duplex and 50 denatured when the equilibrium is reached Tm depends on salt organic solvents and nucleic acid concentrations Terminal Stability Terminal stability is the free energy G for an oligonucleotide s 3 terminal end In OLIGO the terminal stability is expressed G values of the 3 pentamer in the Internal Stability window An oligo with a 3 end that is too stable has a greater tendency to false prime Too low a stability causes the primer to have a low priming efficiency Usually a value of approximately 7 5 kcal mol terminal pentamer is optimal Upper Oligo a positive strand oligonucleotide that has been selected for analysis The Upper Oligo can be manually selected by the user or automatically selected by OLIGO during TaqMan search Appendix B PCR and Sequencing Primer Selection Criteria There are three essential considerations in selecting PCR primers e The primer has the ability to form a stable duplex with the specific site on the target DNA 165 e The primer has no duplex formation with another primer molecule e The primer has no false priming sites on the target DNA Primer stability can be measured in terms of the length base pairs the GC AT ratio free energy expressed in kcal mol or in Tm C of a DNA duplex The most accurate methods for computing helix stability are based on nearest neighbor thermodynami
8. Upper Probe The most stable 3 dinmter of hydrogen bonds 2 AG 0 4 kcal mol Ls B E E ee a 3 AS TOSCOcTCACTCTTATCTTTOC 5 The mast stable dimer overall of hydrogen bonds 3 AG 1 1 kcal smal 5 cereal E i muss a 3 AGTCGCCTCACTCTTATCTTTECC 5 Forward Primer MLSMPLS 1593F21 with Lower Probe MLA3MP18 1723L26 Forward Primer The rmoost stable 3 dirmer of hydrogen bonds 5 AG 5 0 kcal mol 5 E T inane T a 3 OGATTGATACTOCCAACAGACACETT 5 bower Probe The most stable 3 dimer of hydrogen bonds 2 AG 1 1 kcal mol 5 ATTOSGCAATTCOCTTTAGTITGT 3 3 OGATTCATACTCOCCAACAGACACCTT 5 The most stable dirmer overall of hydrogen bonds 5 AG 5 0 kcal rmol 5 ATTOGCAATTOCCTTTAGTTGT 3 3 2GATTGATACTOCCAACAGACACeTT 5 Rewerse Primer MiLAMPLS LFP43R18 with Upper Probe MLIMPLS 1L615U23 Rewerse Primer Free 3 end Upper Probe The most stable 3 dirmer of hydrogen bonds 2 AG 0 4 kcal mol 5 ACGCCTGTAGCATTCOCAC 3 lI 3 AGTCGCCTCACTCTTATCTTTCOCC 5 The most stable dimer overall of hydrogen bonds 3 AG 2 0 kcal mol 5 ACGCCTGTAGCATTOCAC 3 3 AGTOSCCTCACTCTTATCTTTCC 5 Rewerse Primer MLAMPLS 1743R1858 with Lower Probe M13 MFP18 1723L26 Revwerse Primer The most stable 3 dimer of hydrogen bonds 2 AG 0 4 kcal mol 5 BOGCeTGTAGCATTOCCAC 3 3 OCGATTCATACTCOCAACAGACACCTT 5 bower Probe The most stable 3
9. C and converting them to M Once they display M they are cross compatible to all other oligos marked M After two or more multiplex oligos have been selected the 3 G value 136 displayed for each oligo now reports the 3 cross dimerization G between that oligo and the most stable of all the selected multiplexed oligos Oligos can be removed from a given group of multiplex oligos by highlighting them and choosing Deselect Multiplex under Analyze from the database window menu Please note that a much more efficient method of multiplexing is available from the Analyze Multiplex All menu described below Using this menu multiplexes all oligos instantly but the 3 Dim G column remains unchanged unlike using the manual multiplexing When the multiplexing mode is set to Probes check homology Change Menu than instead of 3 Dim AG field you d see Homology It is actually a inverse homology so that an A is homologous to a T not an A The listed number indicates how many bases would be able to hybridize with each other in a given probe For example sequence AAAAAAAA is self compatible SC with 0 homology and a palindrome AAAATTTT is 100 homologous HH for high homology After the multiplexing the numbers by the C compatible letters are the inverse homology to the multiplexed oligo A very high homology may cause priobes to stick to each other P E p e Priming Efficiency This field reports Ol
10. G Oligos can be rejected first on the basis of an excessively stable 3 dimer involving the 3 terminus This stability is determined by G measurement second oligos that form stronger internal dimers are rejected This subsearch checks oligonucleotides for for self dimerizing and in the case of PCR primers cross compatibility between positive strand and negative strand primers Cross compatibility in the OLIGO program refers to the lack of 3 dimers between two primers 93 6 1 3 3 Highly Specific Oligonucleotides Subsearch The Highly Specific Oligos 3 end Stability subsearch checks the 3 ends of potential primers selecting only oligos with two 3 terminal pentamers six bases that fall within the defined terminal stability ranges The default setting selects for oligos with moderately unstable 3 ends as these oligos will typically be specific not false prime yet still prime efficiently on the intended target This subsearch is designed to decrease false priming potential in genomic samples or samples containing unknown sequences The search parameter name responsible for this subsearch is 3 terminal Stability Range Oligonucleotides with less stable 3 ends are more specific because a longer stretch of homologous 3 nucleotides are required to false prime than are oligos with very stable 3 ends Thus there are statistically fewer sites where an oligo with an less stable 3 end can false prime A very low
11. Kt T 78 16 6 log a 0 7 G C 20 Ymismatch m 1 0 7 K Len VI DNA RNA Hybrids The DNA RNA Hybrid formula is calculated according to the following equation Kt T 67 16 6 log KI 0 8 G C 22 Ymismatch 1 0 7 K VID Optimal Annealing Temperature T_ 9 In order to calculate optimum annealing temperature Ta formulation is used 6 a modified empirical T OPT 0 3 T Pme 4 0 7 T_Product _ 54 VIII in which Tm is the calculated Tm of the less stable primer template pair and Tm ow is the Tm of the PCR product for primer Tm calculations its actual concentration in actual salt concentration should be used 170 OLIGO calculates free energy AG values according to the equation AG AH TAS IX Where H S and T are the enthalpy entropy and temperature respectively The default temperature used by OLIGO is 25 C Table 1 Free energy values of a nearest neighbor nucleotide used by OLIGO in kcal mol X 1 from Ref 1 and 2 adjusted to 25 Second Nucleotide dA dC dG dT A C G U gt First Nucleotide dA orA 19 1 3 16 15 1 1 24 19 1 1 dCorC 19 31 36 16 2 33 22 19 dG or G 16 31 3 1 13 27 38 33 24 dT or U 10 1 6 19 14 26 22 11 Initiation 3 5 Not listed nucleotides are treated as dT Initiation AG value is not included OLIGO AG calculations Although Oligo does not calculate Tms of PNA you may find important guidelines in 7 21 For example pe
12. codon table 2 4 8 Main Menu View The View menu lets you control Toolbar and Status Bar display in the Windows version 2 4 9 Main Menu Window The Window menu in Windows version lets you arrange the windows and bring to front any opened window 2 4 10 Main Menu Help This provides access to Help Topics and check our server for the OLIGO updates 2 5 The OLIGO Default Window When a sequence file is opened Oligo displays only one window by default called the Sequence You may choose to open more windows from the Preferences menu 21 af A Sequence File Human 4E seq DNA Sequence Selected Oligo Position Length Feature Location Sequence Length 1868 nt Ji B Forward Primer 563 21 l source 18 1850 Reading Frame 1 Ji B Reverse Primer 682 18 2 CDS 1 651 Current Oligo Length zlnt D B Upper Oligo 587 19 ID B Lower Oligo 659 18 Position 61l PCR Product 137 90 nt 700 800 300 joo 11002001300 aod 1500 160d oo GACTTCCTCCAAAGATAGTGA TEF GITATCAGTCCCACGCAGA gt k a e ro foe es GGACTTCCTCCAAAGATAGTGATTGGTTATCAGTCCCACGCAGACACAGE TACT AAGAGUGGC TOCACOACTAAAAATAGGTTTGTIGTTITAAGAAGACACCTTCTGAGTATTICTCA CCTGAAGGAGGTTTCTATCACTAACCAATAGTCAGGGTGCGTCTGTGTCGATGATICTCGCCGAGGIGGIGATITITATCCAAACAACAAATTCITCIGIGGAAGACTCATAAGAGT TOTGGAAGACTCATAAGA a L P PKIYIGYQ 5S HAODoT A TK S amp S amp amp T T K OW IR F YY DOD T F VW F Figure 2 5 The OLIGO Sequence window
13. import to database 143 open 31 save 35 window 22 Sequence Frequency Calculator 96 Sequencing primers search 90 Short cut keys 25 Single user license 6 Software requirements 9 Tq 163 165 Technical support 8 Terminal stability 165 Tm analyze composition and Tm 63 analyze graph 71 calculation 169 170 174 defined 165 hairpin loop 171 magnesium effect window Troubleshooting Tutorial Undo Upper Oligo composition and Tm display duplex formation edit export from database false priming sites hairpin formation homology restore select Virus detection software Warranty Window menu 169 71 147 14 183 26 46 138 209
14. of paired bases 5 loop 14 nt AG 1 8 kcal mol T 48 1 C 2730 an 2734 i i i i 2753 TAAAA 2749 3 TAAAACAGTGTT 2 of paired bases 3 loop 3 nt AG 0 3 kcal mol T 31 3 C 2742 Til 2744 5 ie ala a G 2750 AAC 2748 3 TAAAACA 3 of paired bases 3 loop 2 nt AG 0 1 kcal mol T 28 1 C 2728 wii 2730 sie and i 2735 CTT 2733 3 TARAACAGTGTTAGTTATCTIT 4 of paired bases 3 loop 7 nt AG 0 0 kcal mol Ty 25 7 C 2738 TAD 2740 5 iad iia ATT G 2750 AAC 2748 3 TAAAACAGT 5 of paired bases 3 loop 7 nt AG 0 2 kcal mol T 20 2 C 2741 ATT 2743 5 ATATGAATTTTCTATTGATTGTG II LI A 2753 TAA 2751 3 TAAAAC Figure 5 3 The Hairpin Formation Current Oligo window 5 4 Analyze Composition and Tm The Analyze Composition and Tm windows display the base composition and melting temperatures of the selected Forward or Reverse Primer Upper or Lower Oligo Current Oligo entire sequence or PCR product at various conditions by various calculation methods as displayed on Fig 5 4 Expression Ta is the melting temperature calculated by the nearest neighbor method for 100 nM oligos in 1M monovalent salt concentration between a given oligo and its complement so that the dangling ends and mismatches don t count The Tm for the nearest neighbor method is shown for the nucleic acid and salt conditions set in the Search Parameters window It is a full
15. or equal to this value Used by the Hairpin free Oligonucleotides sub search Those regions are displayed on the Sequence window as bright red lines and listed in Selected Bases window Search menu in row B 8 4 2 11 Max Acceptable False Priming Efficiency OLIGO eliminates primers that have a priming efficiency value P E at the potential false priming site that is greater than or equal to the selected priming efficiency value Used by the Elimiante False Priming Oligonucleotides sub search The priming efficiency value is calculated with a complex algorithm that considers the G of duplexes mismatches bulge loop sizes and the distance of these elements from the 3 end Priming is more likely when this value is over 220 points 8 4 2 12 Min Consensus Priming Efficiency When the Consensus Primers box is checked OLIGO will search for primers common to all selected files Primers with a higher or equal priming efficiency number than this parameter will be accepted as consensus primers Used by the Consensus Primers sub search 8 4 2 13 Max Acceptable Homology OLIGO eliminates probes that have a homology value at the potential false hybridization site that is greater than or equal to this selected value This parameter plays a role only in the search for hybridization probes Eliminate Homologous Probes sub search 8 4 2 14 Min Consensus Homology When the Consensus Probes box is checked OLIGO w
16. 0 kcal mol e Min GC Clamp Stability 7 6 kcal mol a A Window Size l 40 nt ee 65 6 2 0 EE e Max of G Bases in a Primer Probe 25 Tm of Probe Tm of Primer 5 0 1 0 C Tm of Loop Tm of Probe 7 0 3 0 5 Oligonucleotide Tm Limits 45 2 to 76 8 C Praguency Tani GAPRLTRG natin Search Method Compatible Pairs Search Method Compatible Pairs Defaults Apply Cancel Coxe Defaults Apply Cancel Co Figure 8 4 1 The Search Parameters global and individual parameters settings 8 4 1 1 Search Stringency The Search Stringency option provides you with the ability to change globally all search parameters in discrete increments preset in the OLIGO program using a single operation Using this option you can make expert decisions about your oligonucleotide selection process without Knowing the optimal setting of the various search parameters OLIGO has pre determined settings for the six search stringency options for each search type the search for PCR primers including search for TaqMan probes and molecular beacons for Sequencing primers hybridization and siRNA probes They are Very High High Moderate Fair Low Very Low Each stringency has 116 its own parameters settings Primers and probes are useful even when selected at the lowest stringency setting Note A search stringency you enter may be automatically lowered by OLIGO if no oligonucleotides or primer pairs are foun
17. 135 138 133 11 OLIGO Database The Database window allows you to create and save new databases for storing oligonucleotide and oligonucleotide sets data It is also a powerful analysis and multiplex search tool There are various format database files now compatible with OLIGO It could be a list of primer sequences each in a new line no descriptions it could be the FASTA format 23 or its modification as used by the AutoDimer an on line software from National Institute of Standards and Technology 24 All previous versions of OLIGO databases are compatible with OLIGO 7 a e amp Oligonucleotide Database File NewDatabase odb 48 O of Records 3 i Date ID Number Sequence 3 Dim AG P E TM tm 1 O47 7 06 CBP 174F19 AAACCTGCGGCTGATCTCO 0 6 SC 523 523 68 1 68 7 S 2 0449 7 06 CBP 330R23 TCAATGTAATTAGCCATCGETCOT 0 4 SC 472 472 67 4 66 1 3 04 77 06 CBP 287L29 CTCATCTTICOCACATAGGCTCAA O lt 2 SC 514 514 f2 6 f2 4 This database ts linked to CBP seq Figure 11 0 The Oligonucleotide Database window after importing oligos from the last search and choosing Analyze Priming Efficiency and Tm All Oligonucleotides option Primer sets generated by the OLIGO search may be imported to a single database from various sequence files The number of records is unlimited In the database oligos and oligo sets may be analyzed for dimer and hairpin formation and displayed in similar windows as describe
18. 26934 22523 0 70 Stul RPLGLVA7 9 21822 23085 597 23682 118 23800 495 24295 522 24817 972 25789 125 25914 742 26656 144 26800 22657 71 Swal l e LFK7yLN 3 18759 26148 342 26490 19 26509 22948 ba 6 After the search the rasults are displayed in a window with a very similar format to the standard Search for restriction enzyme sites window except that the degenerate protein site is listed instead of the actual DNA recognition site sequence all those symbols are explained in the Appendix E of the User Manual 205 19 GC method 170 2xAT 4xGC method 169 Accept Discard submenu 44 Access code loss 19 27 Active reading frame definition 162 display 49 Ambiguous bases 174 Amino acid symbols 176 177 Analyze all checked 83 composition and Tm 63 concentrations 82 deselect multiplex 137 142 duplex formation 60 143 false priming sites 64 frequencies 75 hairpin formation 63 hybridization time 81 internal stability 14 key info 58 LCR 70 menu 57 multiplex ing 136 137 142 PCR 69 primer pairs 60 priming efficiency 120 137 141 165 selected oligos 58 Tm graph 71 Appendices 161 Automatically change stringency 117 Back translate 53 Batch file processing 102 Change codon table 53 125 Current Oligo length 112 Current Oligo position 26 109 Database menu 144 DNA to RNA 51 TI edit submenu 51 menu 111 preferences 164 166 206 Index reading frame 52 123 rev translation method 52 124 search parameters 115 sear
19. 34 6 Salt and Formamide Concentrations C mm xSSC OK 10 50 DNA Melting Temperature in l 0 006 29 9 23 4 26 Salt and Formamide Concentrations C 10 0 06 46 4 399 139 mM xSSC 0 10 50 50 0 3 57 8 51 3 25 3 1 0 006 45 6 39 1 13 1 165 l 65 9 59 4 33 4 10 0 06 62 2 55 7 29 7 330 2 70 2 63 7 37 7 50 0 3 73 6 67 1 41 1 500 3 72 5 66 0 40 0 165 1 81 7 75 2 49 2 1000 6 75 9 69 4 43 4 330 2 85 9 79 4 53 4 500 3 88 3 81 8 55 8 Approximate tm of the mismatched oligo 1000 6 91 6 85 1 59 1 Mismatch tm Tg 1 2 mismatch mism tm mism tm 1 66 0 4 52 7 2 61 6 5 48 2 Figure 5 4 The Analyze Composition and Tm windows e The number and percentage of each base in the oligo plus the number and percentages of A T and of G C in the sequence e The melting temperature GC method of the selected nucleic acid molecules with their complements at various salt concentrations expressed both as mM and as multiples of the SSC buffer in 0 10 and 50 formamide e A calculation of melting temperatures nearest neighbor method for the short oligos only with up to five mismatches note Tm was replaced by tm no dangling ends considered 5 5 Analyze False Priming Sites The Analyze False Priming Sites windows display potential false priming sites for the Forward or Reverse Primer or Upper or Lower Oligo in both the sense and antisense strands of the active sequence 64 AOO Reverse Primer False Priming Sites
20. Calculations The priming efficiency number P E is a formulation unique to the OLIGO program a proprietary algorithm that quantifies the likelihood that a given oligonucleotide will prime at a given site on the template It has been determined that matching PCR primers by their P E gives better results than matching the primers by their Tms This is especially important in designing multiplex PCR experiments The priming efficiency considers e The stability G of primer template duplexes and their distance from the 3 end e Bulge loops and mismatches and their distance from the 3 end e The overall primer length 65 A priming efficiency number P E of above 200 for a given site may result in priming during PCR or cycle sequencing conditions A P E of 170 is the approximate lower limit for priming or false priming when using SEQUENASE 5 6 Analyze Homology The Analyze Homology windows display the best homology alignments for the Forward or Reverse Primer or Upper or Lower Oligo in both the sense and antisense strands of the active sequence Reverse Primer Homology File M13MP18 Reverse Primer ML3MP18 6310R19 positive strand Homology 68 5 6328 oo ie 6310 5 5 5616 ggctttececgtcaagctc 5634 5 Homology 53 5 6328 i i lt a 6310 5 5 5185 egtttttectgttgeaatg 5203 5 Homology 58 5 6328 gid icin anid BEE 6310 5 5 5744 ggtttttegecctttgacg S5762 5 Homolo
21. Change Menu The Change menu is used to change various parameters in the OLIGO program These include changing the oligonucleotide length to be searched or analyzed DNA active sequences to RNA and vice versa search ranges and parameters parameters used to calculate T and G non search parameters and parameters involving OLIGO displays View Window Help P i Current Oligo Length 36D 2 DNA to RANA 3 Search Ranges 1 Search Parameters 2 Reading Frame p Lathe Rev Translate Method b inosine Codon Table Degenerate Codon Table Figure 8 0 The OLIGO Change menu Mac In the Windows version the short cut lt D gt key is replaced by lt Ctrl D gt 8 1 Change Current Oligo Length OC Current Oligo Length Oligonucleotide length 19 nt Acceptable range 2 to 1868 Cancel OK Figure 8 1 The Change Current Oligo Length dialog box The Current Oligo Length command allows you to change the Current Oligo length for analysis in the program To change it enter a new oligonucleotide length within the allowable range of 2 to 5000 if the file size permits and click OK The Current Oligo is displayed graphically in the Sequence Melting 112 Temperature Frequencies Open Reading Frames and Internal Stability windows The Current Oligo length is listed in most Analysis windows If an oligonucleotide is saved as the Forward or Reverse Primer or Upper or Lower Oligo their l
22. Chimpanzee elF 4E seq d Files Sequences CPB Chimpanzee similar to elF 4E seq D Remove Files Sequences CPB Cow elF 4E seq T Files Sequences CPB Dictyostelium discoideum elF 4E seq pi Save Set j Files Sequences CPE Human elF 4E seq I Figure 6 5 1 Select Files for batch searches window After accepting the sequence files by clicking the OK button you will get back the Batch Processing window as shown on Fig 6 5 2 8 7970 Batch Processing a File 1 Chicken elF 4E seq 2 Chimpanzee elF 4E seq 3 Chimpanzee similar to elF 4E seq 4 Cow elF 4E seq 5 Dictyostelium discoideum elF 4E seq Method 6 Human elF 4E seq n N lanai niai Parameters 8 Rabbit elF 4E seq eel 9 Rat elF 4E seq t ooo 10 Rice elF 4E seg Ranges Search Method Compatible Pairs Save 3 results per file Cancel a Figure 6 5 2 Batch Processing window At this point you may need to select the search method PCR primers sequencing primers probes etc change the search parameters and search ranges in the same fashion as doing standard non batch searches When this is done click the Search button The last thing before the actual search starts is to name the search results file form this dialog 103 808 Save Search Results As Save As BatchResults txt W Desktop File Format f Full Analysis HH New Folder Cancel Save Figure 6 5 3 Save Search Results window This dialog als
23. Close from the Accept Discard menu and this way making it available to all other OLIGO functions In the New Sequence Window most of the options in the Edit menu are available These options are explained in Chapter 4 The OLIGO Edit Menu 30 3 2 File New Database The File New Database window allows you to create and save new databases for storing oligonucleotide data It is also a powerful analysis and multiplex search tool There are various format database files now compatible with OLIGO It could be a list of primer sequences each in a new line no descriptions it could be the FASTA format 23 or its modification as used by the AutoDimer an on line software from National Institute of Standards and Technology 24 All previous versions of OLIGO databases are compatible with OLIGO 7 3 2 1 New Database Menu Items WG edit Link Analyze Impe B New Sequence N E New Database OEN gt Open 20 Open Recent gt Close W Data TE Save Data as Revert to Previous Database lel Database 5 Print Setup Database as Print Save Options Reset Original Defaults Figure 3 2 1 The File menu with active Oligonucleotide Database window When the Database window is active the main File menu is essentially the same as the standard File menu but some options are different The Close function closes only the currently active database The Save function has less options and Revert to Pre
24. DNA listed in this window is calculated only for the template matching portion of the probe The length of the non complementary tail has no affect on Tm calculations 009 LCR File LAMBDA SEQ C 77489 to Position 2 489 MaQcOcOr Tail Length 4 nt Select mutation Primer Tm 65 0 C Mutated t 64 2 C 27 mer ataabGGTGGCACACAAAGCTTTGOCAA Original t 64 6 C 23 mer Common tm 69 7 C 31 mer EIEEE EESAN TOGATTGCGAGGCTTTGOTGOCTTCTCTGOGAGT GTTATGCAGGTCGTAGTOGGTOGCACACAAAGCTTTGCACTGGATTGCGAGGCTITGTGCTICTCTGGAGTOCGACAG CAATACGTCCAGCATCACCCACCOGTOTGOTTTCOAAACGTGACCTAACGCTOCOCGAAACACGAAGAGACCTCACGCTOTC CAGCATCACCCACCGTGTGTTTCOAAACGT EO Common t 69 4 C 30 mer Original tn 65 0 C 26 mer TACCTAACOCTCCLAAACACGAAGAGtOOa Mutated t 64 7 C 30 mer lt gt lt gt Figure 5 10 The LCR window To modify the probes the fill in LCR variation 1 Load the probes to an OLIGO database using the LCR Oligos command from the database Import menu 2 Edit the probes using Modify command from the database Edit menu Note Changing salt and nucleic acid concentrations in the Search Parameters dialog box affects the size of the selected probes 5 11 Analyze Tm Graph The Melting Temperature Graph command opens the Melting Temperature window 71 Melting Temperature File LAMBDA SEQ Gy MA lt 42 48502nt 25 mers pos 20153 tm 75 2 20130 20140 20150 20160 20170 20180 20190 2
25. EENM I lt A 21937 im ae 23162 gt A Ei l Ii al 2 COOH WE mm iM EO 0 N NH 3 ll tT Se CE e ORF Statistics Codons nanan by type R Fr Position Protein Molecular Weight Mean pKa mae Acidic EH E Met ee 2 22454 27004 1517 170223 0 7 1 Se eee EE Hydrophobic Aromatic E Proline P 122450 22460 22470 22480 224gd 132500 122510 132520 122530 22840 225 1 P S H D F RQRtIIQNVRQAQR Q L I C I N Q KYSHGK 2 NGN LV MY IS RGK ES YK WYSOKLKGNN YES ODVEL TK NI P M E K COOH 3 T S F LEAKNHATKCOATSSKVTIMNNLECEMELN P KIF P W K 5 AACCTAGTCATGAT I PCTAGAGGCAAAGAATCATACAAAATGTCAGACAAGCT CAAAGGTAACAATTATGAATCTGATGTTGAATTAACCAAAAATATTCCCATGGAAA 3 3 TIGGATCAGTACTAAAGATCTCCGTTTCTTAGTATGTTTTACAGTCTGTTCGAGTTTCCATTGTTAATACTTAGACTACAACTTAATIGGTTTITATAAGGGTACCTTT 5 l V D HN R SAFF V F H Y L EFTYVI I FRINF G F IN GH EF E 2 COOH F RTWHIELPLSODYLtIOS LSLtLPLEL SDdDSTSNVLFETI amp G amp M S N 3 L GL S K tc bf TT N C FT LCA LTC NRI OHRHROILEPFPTERNP R a Se gt Figure 5 14 1 The Open Reading Frames window The graphic part on the top is zoomed in to better show the amino acid composition in colors 76 1 i p PPE POP Te Pee coor r2 EII EIO I E 22122 en IERI 2 COOH oun mE NH Wi tit E m R son acca Codons colored by frequency highest on left R Fr Position Protein Molecular Weight Mean pKa 2 22454 27004 1517 aa 170223 0 7 1 E E M Figure 5 14 2 The Open Reading Frames wind
26. File M13MP18 Reverse Primer M13MP18 6310R19 positive strand Priming efficiency of the perfect match is 482 above the threshold Priming efficiency 482 above the threshold S eo T O 3 6328 ccaaaagggtcagtgctgec 6310 5 Priming efficiency 244 above the threshold 5 6328 GOTT PTC CAGTCACEACE 6310 3 3 626 agcaaatggtc tgctgc 610 5 Priming efficiency 193 above the threshold 5 6328 GETTPTCOCAGTERCGACE 6310 3 3 5125 tctaagtggtcagtg tgc 5108 5 Priming efficiency 191 above the threshold 5 6328 GGFR TEC CASTE RCEACE 6310 3 3 808 gtaatatggtcagtcctge 790 5 Priming efficiency 179 5 6328 GGTTTTCCCAGTCACGACG 6310 3 3 6315 tgctgcaacattttgctgce 6297 5 Reverse Primer ML3MP18 6310R19 negative strand Priming efficiency of the perfect match is 482 above the threshold Priming efficiency 105 5 6328 GGTTTTCCCAGTCACGACG 6310 3 3 5744 ccaaaaagcgggaaactge 5762 5 Figure 5 5 An example of a False Priming Sites window with M13MP18 segq loaded and 6310R19 primer analyzed it s an old commercial m13 reverse primer The site with P E of 244 points is the real false priming site as confirmed experimentally 20 The False Priming Sites search performs the following e A search for potential sites using a homology algorithm similar to FASTN 22 e A calculation of the priming efficiency number of potential sites found in the search Priming Efficiency
27. Hybridization Probes Parameters Ranges After successfull search show All Results HA Defaults Take a quick look at the Search for Primers dialog window At the top you see two tabs Search Options and Subsearches Below this there are two check boxes if both checked the search will proceed in both DNA strands The Search Mode is set to Select that is the search will start from scratch and not continue on already selected primers that s the Verify mode If you uncheck the Complex Substrate box good when working with plasmids not with total organism DNA a sub search to eliminate frequent oligos will not take place Below this box you see a list of possible search types that Oligo can perform Buttons on the right the Search button starts the actual search Cancel closes the window and Apply memorizes the current type of search so that when you Cancel the window and come back to it you d see the most recent setting Apply also sets the search parameters and accordingly modifies the Sequence and other relevant windows Button Parameters opens the search parameters windows including windows that define the stringencies and scoring system Button Ranges opens a complex dialog that controls not only the search ranges but the number of results you need within the ranges Button Defaults changes all parameters to the default values This chapter will guide you through various search types 19
28. II formats are OK The most common enzymes file used by OLIGO is NICE6 amp UP ENZ In this file only non degenerate sites larger than 5nt are listed You may open it with any word processor and change the list The format is quite simple and it is easy to follow Search To set the search 1 Click on the Entire button or the Portion button 2 If you select Portion enter the start and end position for the search range 3 If your sequence is linear click on the linear button If it is circular click on circular 101 Circular or Linear The Circular Linear button option selects for the correct calculation of the restriction fragment sizes upstream of the first restriction cut and downstream of the last cut on the active sequence If circular is selected these distal fragments are considered as one contiguous fragment in the fragment table If linear is selected they are considered two separate fragments After clicking on the Search button the search process starts and the results are displayed on the Analyze Restriction Enzyme Sites window see Chapter 5 for the details 6 4 Search Restriction Sites in Protein This function searches the amino acid sequence currently displayed on the Melting Temperature window for potential restriction sites The protein sequence is reverse translated using the degenerate method yielding all possible oligo sequence combinations before the sequence is searched The search pa
29. Ligase chain reaction LCR overview and applications in PCR Methods Appl Feb 3 4 S51 64 26 Rychlik W 2007 OLIGO 7 Primer Analysis Software in Methods in Molecular Biology Vol 402 PCR Primer Design Ed A Yuryev Humana Press Inc Totowa NJ pp 35 59 2 Bommarito S Peyert N and SantaLucia Jr J 2000 Thermodynamic parameters for DNA sequences with dangling ends Nucleic Acids Research 28 1929 34 181 182 T 4 Tutorial amp Examples Oligo 7 Installation 1 1 Installation 1 2 Registration File Opening and Viewing 2 1 Open a sequence file 2 2 Open a database file Navigating in OLIGO 3 1 Moving around a sequence file 3 2 Changing windows appearance 3 3 Open and Print all relevant windows with one mouse click Search for Primers and Probes 4 1 Searching for PCR primers a simple search 4 2 Searching for PCR primers an example to show the options 4 3 Searching for sequencing primers 4 4 Searching for consensus hybridization probes 4 5 Searching for TaqMan Probes amp PCR Pairs 4 6 Searching for Molecular Beacons amp PCR Pairs 4 7 Searching for siRNA Probes 4 8 Searching multiple files batch processing 4 9 Searching multiple files for PCR primer pairs and than multiplexing the selected sets 4 10 Searching a file for probes only in the selected regions Other Search Options 5 1 Search for a sequence string 5 2 Search for restriction enzyme sites 5 3 Search for r
30. M Current Current v Oligonucleotides n A Selected l Selected Key Info E i l Selected only Mm igs O All Opened pene l i o pene Duplex Formation wa mw 7 H O List only Full Analysis Hairpin Formation Exclude m Oligonucleotide Sets Exclude Composition amp Tm a E B Q l Selected only False Priming Sites A iming Si M Multiplexing Homology Internal Stability 5 Cancel Cancel i C urrent Oligo Forward Primer R everse Primer U pper Oligo Lower Oligo Mixed Oligos OK J o 3 Click the OK button From now on the short cut key Ctrl X Windows or Command X Mac is activated see the last item of the Analyze menu so with this keystroke you will open all the windows that you ve checked of course if you ve previously selected the primers Saving Results will also save multiple windows data 193 4 Search for Primers and Probes This section describes methods in searching primers and probes the Search for Primers amp Probes menu item A Search for Primers amp Probes Search D Search in Cancel Search Mode Select Apply vi Complex Substrate PCR Primers Compatible with the Forward Primer Reverse Primer TaqMan Probes amp PCR Pairs Compatible with the Upper Probe Lower Probe Selected Primers Molecular Beacons amp PCR Pairs Nested Primers Sequencing Primers
31. OK Figure 8 3 The Change Search Ranges window When a feature is marked use the Check Region s button to mark it you will be able to search for oligos only in the marked feature or features In such case the search ranges are dimmed as seen on Fig 8 3 The PCR product length fields establish the PCR product length by entering the upper and lower size limits of the desired product Make sure that your search ranges on the positive and negative strand can accommodate the PCR Product Length you want Note If you search for primers compatible with the Forward Primer whose position is close to the 3 end the search may not find any compatible primers even if the search range is the whole active sequence The minimum allowable length is the combined lengths of the smallest Forward and Reverse Primers plus 1 This window lets you choose sequencing primers and hybridization probes that would be spread out throughout the search ranges in one every selected number of nucleotides You may also choose to search only for non overlapping primers and probes In this case all overlapping primers with lower scores than the best primer are 114 removed despite that saved primers in other sequence regions would have lower scores than the removed ones Similarly when running a search for PCR pairs you may restrict primer sets that would make multiple products in one sequence region from showing up Another option is to cover t
32. OK Buttons These buttons either cancel all your changes or accept the changes and close the Search Parameters window 8 4 2 Search Parameters Search Parameters Options In addition to the global search stringency options this window gives access to control the parameters described below In all the windows you will find common objects that indicate parameters applicability If a small blue circle is displayed by the side of a given parameter it means that this parameter is going to be used by the currently selected in the Search for Primers and Probes window search type The opened lock means that a given parameter may be changed during the automatic stringency correction and the closed lock a parameter will not be changed The status of the dark locks may be changed by clicking at them while the gray locks indicate unchangeable parameters 8 4 2 1 Oligonucleotide Length Using this option you may select oligos from 5 to 255 nt long for searches The length is not an absolute number but has the ranges For example by choosing 21 3 nt OLIGO will search for primers 18 24 nt long Oligo automatically selects the length however when you choose a certain length you may have less choice of oligos of certain Tm Chart D1 p 174 may help you choose the right T oligo length depending on what GC content you are looking for 8 4 2 2 Acceptable 3 Dimer G The Acceptable 3 Dimer G option sets the stringency of the fi
33. Reverse Primer Date 04 18 2006 _ Kind Select tie Upper Oligo _ Lower Oligo ID Number Length 17 nt Sequence 5 3 Reference Comments tt E This database ts linked to CBP seq Figure 11 2 2 2 The Add Record sub window You can change the date add the ID number sequence and any other field in the record In addition standard short cut keys Cut Copy and Paste are available in the Edit Add Record window When youre done with the modifications click the Add button to accept the changes Edit Add Set This function allows you to associate database records with each other creating pairs triplets and quadruplexes Just type into the empty boxes numbers of up to four records to associate them with each other When the association is made all oligos may be exported to the linked sequence in one action Also you d be able to check the dimer formation between the associated oligos Le US fee FU MUMAN 40 7 SSP eS LAP Pht Piha th lUIALIIL ah 35 oo0 5 a Enter Record s Show All Add Forward Primer 1 Upper Oligo 2 Reverse Primer 3 Lower Oligo a This database is linked to Human 4E seq Figure 11 2 2 3 The Add Set sub window Edit Renumber This function allows you to renumber existing records in the database Useful after sorting or deleting some records when the numbering is not sequential any more 140 11 2 3 Link This feature will let you associate the database
34. Table In order to eliminate Frequent Oligos an oligonucleotide frequency table needs to be specified This table lists the frequencies of all oligonucleotide 6 or 7 mers combinations in various subsets of GenBank and is used by the Frequency Threshold parameter To choose a frequency table click on the Change button and select a table from the Frequencies folder 8 4 3 Search Parameters Sequence Constraints The Sequence Constraints search parameters window allows you to control sequence contents of the actual primers and probes You may type the actual 5 or OC Search Parameters DAF Search Parameters Parameters More Parameters Sequence Constraints Scores Parameters More Parameters Sequence Constraints Scores Oligonucleotide Selection Pair Set Selection Max Assigned Penalty Unit Parameter a a on Unit beyo lt e _ Forward Primer 3 Dimer AG 200 Is 40 0 Strongest Dimer AG 200 2 5 40 0 5i 3 3 terminal Stability 400 200 0 r 5 terminal Stability 400 200 0 e _ Reverse Primer Internal 12 mer Stability 400 80 0 5 3 GC Clamp Stability 80 8 0 40 0 Loop AG 50 0 0 2 0 Primer Tm 100 5 0 s z TaqMan Probe False Priming Efficiency 200 220 2 0 5 HH 3 Consensus Priming Efficiency 400 500 2 0 Homology 200 40 4 0 Consensus Homology 500 100 100 0 Mono Nucleotide Repeats 16 l 2 0 Di Nucleotide Repeats 20 0 5 0 Degeneracy 80 l 5 0 Sequence Frequency 50 900 0 2 of
35. The information shown in this window includes e The most stable 3 terminal dimer alignment of the primer or probe e The most stable primer dimer alignment overall e The most stable hairpin structure in the primer or probe if any e The stability values of the most stable uninterrupted duplex shown in colors in each alignment and of the hairpin structure expressed in kcal mol Tm of the hairpin is displayed when it is greater than 0 5 2 2 Duplex Formation Current Oligo eee Current Oligo Duplexes File MISMP18 Current Oligo 19 mer 1723 Current Oligo The most stable 3 dimer of hydrogen bonds 4 AG 1 2 kcal mol 5 GCTAACTATGAGGGTTGTC 3 3 CTGTTGGGAGTATCAATCG 5 Current Oligo The most stable 3 dimer of hydrogen bonds 2 AG 2 1 kcal mol 5 GACAACCCTCATAGTTAGC 3 3 CGATTGATACTCCCAACAG 5 The most stable dimer overall 4 of hydrogen bonds 6 AG 2 8 kcal mol 5 C aT T 3 3 CTGTTGGGAGTATCAATCG 5 Hairpin loop 7 nt AG 0 0 kcal mol T 24 9 C 5 kaat ni i G 3 CTGTTGGGA Figure 5 2 2 The Current Oligo Duplexes window The Current Oligo window displays e The most stable 3 terminal dimer alignment of the current positive strand oligo e The most stable 3 terminal dimer alignment of the current negative strand oligo e The most stable dimer alignment overall in the current positive strand oligo e The most stable hairpin structure in the positive strand of the Cu
36. X gt 7 13 1994 X02513 6290L17 GTAAAACGACGGCCAGT 20 univ M13 20 Primer 3 X 7 13 1994 X02513 6209U16 AACAGCTATGACCATG reverse M13 Reverse Primer 4 X 7 13 1994 X52330 670U17 gt CGAGGTCGACGGTATCG KS KS Primer 5 X 7 13 1994 X52330 720L17 gt TCTAGAACTAGTGGATC SK SK Primer 6 X gt 8 12 1994 X52330 774L17 gt ATTAACCCTCACTAAAG T3 alt T3 alt Primer Figure 3 3 3 4 OLIGO 7 database format Nonprintable characters are shown as arrows tabs dots spaces and symbols new line 3 3 4 File Open OLIGO Search Result This command opens previously saved by OLIGO Search Results to save use File Save OLIGO Search Result Positions of the saved primers and probes can be displayed in two Analyze windows Selected Oligonucleotides and Primer Pairs Probes 3 3 5 File Open Saved Work File This command opens Oligo with the same contents as the Saved Work file was saved in the past You would need to close all the sequence and database files currently opened in order to proceed with this option 3 3 6 File Open All Files This command makes all the files available for opening It s up to you to specify the kind of a file that is to be opened that is a nucleic acid seq but could be txt protein ami database odb but could be txt search results sre or saved work file wrk 3 4 File Open Recent The File Open Recent command gives access to the recently opened files in OLIGO 3
37. a plain text file Enter anew name or leave it as is Note that you may save the file in three different formats Simple List Full Analysis or Oligonucleotide Database Accept the name by clicking at the Save button 7 The Search Progress window displays how many files were processed and scheduled The search ends when this progress window disappears Open the BatchResults txt file with any word processor 199 4 9 Searching multiple files for PCR primer pairs and than multiplexing the selected sets 1 Start Oligo and choose Search Sequence files 2 Select files click the Select Files and than Add in the Select Files window 3 Make sure the File Format is set to Nucleic Acid and choose the Test sequences folder 4 Select three files Human Mouse and Rabbit elF 4E seq and click Add and than Done button Clicking OK button will accept the selected files but before clicking OK you may want to save the set of files for later use with the Save Set button 5 In the Batch Processing window set Save 3 results per file and click the Method button 6 Choose PCR Primers option and click the OK button 7 Click the Search button Before Oligo starts searching it asks you for a file name for the results data Default is BatchResults txt a plain text file Simple List You d need to save this file in Oligo database format so change the File Format low portion of the window into Oligonucleot
38. and or analyzed using most options under the Analyze menu When browsing the active sequence for a new Current Oligo you can open the Current Oligo window from the Analyze Key Info menu Click and drag on the Current Oligo window title bar to position the window in the most convenient part of the screen The Current Oligo data is visible amp updated simultaneously on all relevant windows Degeneracy The total number of base combinations possible in a sequence The list of ambiguous degenerate bases is in Appendix D Theories and Formulas Used in the OLIGO Program Degenerate Method Reverse translates a protein sequence into all possible combinations of a nucleic acid sequence Delta G G Free energy a measurement of nucleic acid duplex stability A DNA duplex is more stable when its G value is more negative The G expressed in kcal mol depends on the nucleotide sequence salt concentration temperature and other factors Only the temperature can be modified within the program Salt is fixed to 1M NaCl except that it varies in the Tm calculations for hairpin loop See Appendix D Theories and Formulas Used in the OLIGO Program for the formula 162 Dialog Box A window that requests information from the user before a function or command can be carried out Dimer Two nucleic acid molecules attached to each other with hydrogen bonds Dimer length refers to a string of contiguous base pairings between two strands of n
39. by the e Continue Above Search in Other File s thus eliminating primers that could also prime from the other sequences and the opposite search could also be performed by checking the e Consensus Primers and selecting the sequences on which the primers must prime as well The subsearches can also be customized by adding or deleting them from the standard settings or changing the search parameters The Search for Compatible Primer Pairs proceeds as follows e Search for optimized positive strand primers for PCR 88 e Search for optimized negative strand primers for PCR e Match cross compatible primers as potential primer pairs by checking the 3 dimer formation between them and balance their Tm or priming efficiency The primer pairs generated in this search have these characteristics the characteristics depends on the chosen search stringency e Free of 3 dimers and hairpins e With Tms or priming efficiencies within restricted ranges e Containing GC Clamp improves annealing efficiency e Have 3 ends with low false priming homology on the active file and other selected files e Free of homooligomers and dinucleotide repeats e Free of ambiguous bases e The primers may have incorporated sequence constraints specific bases at their ends and limited number of guanidine nucleotides e The amplicon is free of strong hairpins PCR Primers Compatible with the Forward Primer This option searches the negative strand
40. chances for lower quality oligos 6 1 3 15 Eliminate False Priming Oligonucleotides and Eliminate Homologous Probes Subsearches The Eliminate False Priming Oligonucleotides subsearch selects oligonucleotides that have no false priming sites on the active sequence This subsearch uses a proprietary algorithm that measures the stability of a false priming site regardless of mismatches The stability of a false priming site is expressed in a priming efficiency number The priming efficiency is calculated with a complex algorithm that considers the G of duplexes mismatches and or bulge loop size and the distance of these elements from the 3 end Priming is more likely when this value is above 200 points The selection filter for this subsearch is controlled by the e Max Acceptable False Priming Efficiency setting in the Parameters window and Perform the False Priming Sites amp Homology Search 97 e Within the search ranges only e The entire sequence in the Ranges window The Eliminate Homologous Probes subsearch is virtually the same but instead of priming efficiency a simple homology is checked This subsearch is active when the search for Hybridization Probes is chosen 6 1 3 16 Continue Above Search In Other File s Subsearch This subsearch continues false priming sites search in other files specified by the user It uses the same algorithm as the Eliminate False Priming Oligonucleotides subsearch excep
41. d like to use the reset functions but don t know the difference There are two levels of reset in the OLIGO program The Reset Data command resets all user generated results calculations and accumulated data generated since opening the active sequence This erases all search data erases any selected primers and resets the temperatures for G calculations to 25 It does not however change search parameters except the search ranges which are reset to the full sequence length The Reset Original Defaults command changes all parameters back to the original program defaults and closes all but the Sequence window but leaves the data and search ranges unaffected The examples don t work the way the manual says they should Make sure that all parameters and search ranges are set correctly Use the appropriate Reset option from the File menu and try the example again MBI may have changed OLIGO parameters and algorithms after the manual has been released and this way the results won t exactly match 12 2 2 System Problems The program works slowly Your search may take longer than expected especially when you are checking a large number of oligos for false priming sites The false priming sites subsearch checks oligos against the entire sequence file resulting in longer search times Check your search stringency and increase it if possible More stringent searches are faster than less stringent searches system crashes when
42. dirmer of hydrogen bonds 2 AG 1 4 kcal rmol 5 BOGOCTGTAGCATTCCAC 3 3 OQGATTGATACTOCCCAACAGACACCTT 5 The most stable dimer overall of hydrogen bonds 4 AG 3 0 kcal rmol 5 MOGCCTGTAGCATTOCAC 3 Ltd 3 OGATTGATACTCCCAACAGACACCTT 5 Upper Probe MLAMPLS 1L61L5U23 with Lower Probe MLIMPLS 1L723L26 Upper Probe The most stable 3 dirmer of hydrogen bonds 3 SG 1 3 kcal rmol 5 CCTTTOCTATTOTCACTCOCOGCTGA 3 3 COGATTGATACTCCCAACAGACACCTT 5 Lower Probe The most stable 3 dirmmer of hydrogen bonds 3 AG 2 5 kcal rmol 5 CCTTTCOCTATTCOCTCACTCOCOGCTGA 3 I 1d 3 CGATTGATACTCCCAACAGACACCTT 5 The most stable dimer overall of hydrogen bonds 3 AG 2 5 kcal rmol 5 OcrTrreTaATTcrTcacTCeccTGa 3 IIl 3 CGATTGATACTOCCAACAGACACCTT 5 Figure 5 2 3 The Mixed Oligos Duplexes window 62 9 3 Analyze Hairpin Formation The Analyze Hairpin Formation windows display potential hairpin loop structures in the Forward Reverse Primers Upper Lower or Current Oligo The hairpin stems are displayed in descending order of stability expressed in hairpin loop G and the Tm values These values are approximate since the thermodynamic data on hairpin loops as opposed on the duplexes especially on the large ones are not well established An example of this kind of window is shown below Current Oligo Hairpin Stems File M13MF18 Current Oligo 30 mer 2724 r l
43. important to understand that the top 6 functions of this menu above the horizontal separator line deal with copying pasting etc of the entire records and not individual fields or nucleotide symbols Edit Undo Redo Modify The Undo Modify option enables you to undo the last edit action After changing a record you may undo those changes by selecting Undo Modify Similarly you can Undo any other edit function such as Cut or Clear After undoing you may go back one step and redo cutting or pasting 138 Edit Cut The Cut option copies the selected record to the Clipboard and deletes it from the database Edit Copy The Copy option copies the selected record to the Clipboard You may paste this record to another or the same database afterwards Edit Paste The Paste option copies a database record from the Clipboard to the opened database You need to use the Cut or Copy functions to activate this item to fill in the Clipboard Edit Clear The Clear or Delete in Windows command deletes the selected record from your database You may use Undo Clear to reverse this action Edit Select All This function selects deselects all records for other edit functions To select a single record click on it To select a group of continuous or non continuous records use a shift click combination or a click Mac Ctrl click Win combination Edit Selected Record This function allows you to change record
44. in the database This opens the same format sub window as by clicking on Show Hide icon in the window toolbox and selecting Highlighted Record item to modify an existing record You can change the date add or change the ID number and sequence in the record You can also add and edit references and comments that are tied to the record In addition standard editing features Cut Copy and Paste are available in the Edit Add Record window but only through the short cut keys don t use the menus When you re done with the modifications click the Modify button to accept the changes Another way to modify database records is to double click at the modify able fields and simply begin the typing When you re done click on any other record and your changes would be accepted Edit Selected Set This function allows you to change the associations between the records Place the cursor in a desired point click and change or delete the number 139 Edit Renumber This function renumbers existing records in the database Useful after sorting or deleting some records when the numbering is not sequential any more Edit Add Record This function allows you to add a new record to the database This opens the same format sub window as by clicking on Show Hide icon in the window toolbox and selecting Highlighted Record item to modify an existing record Record 300 Add Forward Primer os rz
45. included and h excluded e The 3 G free energy of the 3 terminal pentamer e The degeneracy number for the Current Oligo e The Priming Efficiency number P E for the explanation see section 5 5 e The extinction coefficient properties of the positive strand Current Oligo expressed in nmol O D at 260 nm and in yg O D at 260 nm a Current Oligo File CBP seq Current Oligo strand 5 GCAAGCAAACCTGCGGCTGAT 3 Current Oligo strand 5 ATCAGCCGCAGGTTTGCTTOC 3 Length 2 1 mer Length 2 1 mer 5 Position 168 3 Position 168 Tra ft 74 5 73 1 C Tra fn 72 0 73 1 C AG Ag 25 C 35 3 34 5 kcal mol AG Ag 25 C 35 2 34 5 kcal mol AS As 450 4 448 7 cal K mol AS As 472 2 448 7 cal K mol AH AR 169 6 168 3 kcal mol AH Ah 176 0 168 3 kcal mol 3 AG 6 0 kcal mol JAG 7 1 kcal mol Degeneracy l Degeneracy l 555 566 L E 5 00 nmol Asgy L E 5 25 nmol Asgy 32 6 Ug Asea 34 1 pg z 50 Figure 5 1 1 The Current Oligo window When analyzing Current Oligos on the active sequence it may be helpful to get instant data updates from the Current Oligo window as you change position Current Oligo window data saved in a file also include the salt and nucleic acid concentrations used to calculate Current Oligo Tm 5 1 2 Key Info Selected Primers Probes These windows display the following calculations and specifications of the selected oligonucleotides e The names
46. initiate synthesis false priming The 5 end and the central part of the primer must also form a duplex with the target DNA site in order to prime efficiently 166 Conversely oligonucleotides with stable GC rich 3 termini need not anneal with the target along their entire length in order to efficiently prime resulting often in non specific product synthesis Examples of highly specific primers G1 and G2 non specific primers B1 and B2 for PCR and sequencing are presented in Figure B 1 Note the high 3 end stability of the non specific primers and the low stability of the specific primers The optimal annealing temperature range is unusually broad when primers exhibiting low 3 terminal stability are used This improves the chances of running PCR at optimal conditions without preliminary optimization experiments In addition to optimal primers the quality of the PCR product is dependent on the enzyme and the reaction buffer composition the active sequence substrate complexity the product length the product Tm and on PCR program times and temperature settings particularly annealing Under certain conditions primers with high 3 terminal stability perform satisfactorily in PCR Nevertheless oligonucleotides with 3 terminal pentamers less stable than 9 kcal mol are more likely to be specific PCR and sequencing primers particularly in complex samples Appendix C Effect of Primer Duplex Formation on PCR and Sequencing PC
47. its 3 end is tied up since this can cause internal primer extension eliminating a given primer from the reaction Hairpins near the 5 end however do not significantly affect PCR Non 3 end primer dimers are well tolerated in PCR Internal or 5 terminal dimer amp G may approach 20 kcal mol usually with only slight effects on PCR 168 Appendix D Theories and Formulae Used in the OLIGO Program The OLIGO program algorithms take into account several formulae Many of the formulae used in the OLIGO program are described here Tm Melting Temperature Nearest Neighbor Method The melting temperature of an oligonucleotide duplex awe is calculated using nearest neighbor thermodynamic values Formula 1 Since these values were obtained in 1M Na it is necessary to add a factor to correct for salt concentration 3 resulting in the equation Tm C DH DS R In C 16 6 log K 1 0 7 K 273 15 I Where AH and AS are the enthalpy and entropy for helix formation respectively R is the molar gas constant 1 987 cal C X mol and C is the concentration of the probe Values of AH and AS used by OLIGO are listed in Tables 3 and 4 For the TmP Mer calculations in the PCR window the expression C 4 is replaced by C since the primer and the active sequence concentrations are different Td Filter Dissociation Temperature For filter hybridization applications the dimer dissociation temperature Ta Is calculated
48. its products In order to provide you with the best support however please review these sections before calling You may find your solution here or will be able to provide more information to our technical support staff should you need to call 12 1 OLIGO Messages In this section OLIGO messages you may receive and possible solutions to the situation are listed in alphabetical order 3 end dimer in both primers This condition may cause low efficiency priming in PCR and sequencing Choose different primers if possible 3 end Reverse Primer dimer This condition may cause low efficiency priming in PCR and sequencing Choose a different primer if possible 3 end Forward Primer dimer This condition may cause low efficiency priming in PCR and sequencing Choose a different primer if possible 3 end stability range has been incorrectly set Check your stability range It may be out of the allowable limits or it may not be consistent with the PCR product size Can t open file file name Your sequence file may have some incompatible characters Sequence files interrupted with periods semicolons or other characters are truncated and can t be loaded Remove the characters using any standard word processing package and save the file as plain text Database is empty There are no oligo records in the database to export Choose a different database or go back to this database and import Upper and Reverse Primers LCR oligo
49. of the oligonucleotides assigned by OLIGO e The sequences of the Forward and Reverse Primers or Upper and Lower Oligos displayed from the 5 to the 3 end e The length of the Upper and Reverse Primers 59 99C Selected Probes File CBP seg CBP 856U35 CBP 62L2 5 TTTCCACTATCCCAATCAAAGAATTACAGTACATA 3 5 TAGCAACCTCCTGATTAGATTCCGTIT 3 Length 35 mer Length 2r mer Score 739 points Score 962 points 5 Position 856 3 Position 52 Tra dtn F2 1 70 8 C Ta Aten 1 7 70 5 C AG Ag 25 C 45 4 47 3 kcal mol AG Ag 25 C 39 4 38 7 kcal mol ASSAS 67 2 0 728 6 cal K mol AS As 559 3 560 5 cal K mol AH AR 245 8 264 6 kcal mol AH Ah 206 2 205 9 kcal mol 3 AG 5 4 kcal mol 3 AG 6 8 kcal mol Degeneracy l Degeneracy l P E 513 225 PLE 500 500 L E 2 06 Amal A gg l E 3 98 Amal A gg 30 7 LG Az6q 33 0 LG As6q Figure 5 1 2 The Selected Primers window e The 5 position of the Upper amp Forward oligos and the 3 position of the Lower amp Reverse oligos e The oligo s Tm dangling ends included and tm dangling ends and mismatches excluded calculated by the nearest neighbor method using the salt and nucleic acid concentrations displayed in the Non Search Parameters dialog box Change menu If there is a mismatch between a given oligo and the main sequence the Tm is with the mismatch e The G free energy calculated using temperature displayed in the Non Search Paramet
50. on Fig 5 7 Sorting the primer pairs by optimal annealing temperature Ta product length or GC content all in ascending order is performed by clicking on the column name Multiple sorts by clicking on the same and holding the Option key Mac or Ctrl key PC By clicking on any of the listed primer pairs amp probes rows in the table you select the listed sets Double clicking on a pair also calls up the PCR window that displays a graphic of the PCR product s location on the active sequence along with other data for running PCR with the selected primer pair The Sequence window is also updated at the same time Note The Primer Pairs window is not accessible unless a relevant search is performed first eee Primer Pairs Probes File BRCA gene seq Forward Reverse Probe Product Opt Primer Primer igidi 2 wih HGC Length Ta 2 3 4 1 l 23603 23821 23747 L 89 241 51 1 38 2 m 2 23602 23821 23747 LU 695 242 51 2 38 4 7 3 26257 26422 6333 L B94 185 50 2 35 1 D 4 23349 23515 3399 U B92 185 48 8 31 4 5 23349 23515 23399 U B92 187 48 9 31 6 i 6 23350 23515 23395 U 592 186 49 0 31 7 Figure 5 8 The Primer Pairs window By pressing the option key lt gt Mac or the lt Ctrl gt key Win and clicking a column name simultaneously you can perform secondary sorts 68 5 9 Analyze PCR The Analyze PCR window displays various data for PCR based on a user selected PCR primer pair The primer pair must be
51. operation has exceeded the memory of your computer You will need to reduce the search size or quit some functions and try again 150 Overlapping primers The positions and lengths of these primers have produced an overlap You will need to change the position of one or both primers and try again PCR product length has been incorrectly set Check your PCR product length setting It may be outside the allowable limit for the selected search range settings Print error Check your printer connections and settings Printer initialization failed Check your printer connections and settings Printing canceled Check your printer connections and settings Printing unavailable for this window This window cannot be printed from OLIGO If you need to print it take a Snapshot Mac version under the Window menu and then print it from the Clipboard In the PC Windows version use Alt Print screen key combination to copy contents of a front window to the clipboard Search ranges are incorrectly set Reset your search ranges and try again Sequence is too short The minimum sequence size accepted by OLIGO is nine nucleotides Terminal stability of the Reverse Primer is too high As PCR or sequencing primers these oligos may be susceptible to false priming in a complex nucleic acid sample Select oligos with a less stable 3 end if your sample is complex unless your application does not involve priming Terminal stability
52. or choose Protein from the Edit submenu Then load the protein file using Merge Sequence with and selecting File Merge Sequence With Current Oligo The Merge Sequence with Current Oligo merges the Current Oligo with the edited sequence at the current cursor position Merge Sequence With a Primer or Probe This option merges the selected oligonucleotide sequence with the edited sequence at the current cursor position Merge Sequence With Database The Merge Sequence with Database merges the highlighted database single record into the active sequence at the cursor position Merge Sequence With File The Merge Sequence with File merges a sequence file with the edited sequence at the cursor position When the Upper or Reverse Primer is merged with a file the total length of the combined sequences cannot be longer than 200 nt This option calls up the Merge From File window where the desired DNA RNA or protein file is selected 47 4 1 2 8 Edit Group By The Group By command changes the base grouping number in the Full Screen Edit window to either three five or ten contiguous bases or off displaying a string that is not interrupted by spaces 4 1 2 9 Edit Overwrite Insert The Overwrite Insert command toggles between the two editing modes In the Overwrite mode typed characters replace the old In the Insert mode newly typed characters are inserted at the cursor position 4 1 2 10 Edit S
53. other OLIGO searches The stringency of the search can be controlled using the search stringency settings global and or individual parameter settings in the Parameters window The following sub searches are used to find the PCR primers e Eliminate Ambiguous Bases by default selects non degenerate primers e Duplex free Oligonucleotides selects primers free of 3 end and internal dimers e Highly Specific Oligonucleotides 3 end Stability selects moderately stable 3 ends e Oligonucleotides with GC Clamp selects oligos with high internal stability regions e Oligonucleotides within Selected Tm Limits selects oligos with certain Tm range e Hairpin free Oligonucleotides e Eliminate Mono and Di Nucleotide Repeats selects oligos without internal repeats e Detect Sequence Repeats selects oligos without other repeats than the above option e Eliminate Frequent Oligonucleotides primers with most common in GenBank 3 ends 6 or 7 mers are eliminated e Omit High Secondary Structure Regions in the Template certain sequence areas will not be amplified due to high secondary structure e Check Primers Probe Sequence Constraints no constraints by the default but you may ask OLIGO not to choose primers that start with a specific base for example e Restrict the number of G Bases good for further multiplexing and overall non dimerization e Eliminate False Priming Oligonucleotides The sub search can be extended on other files
54. plain text format could be the GenBank format Choose any of the nucleic acid sequence files in the File Open dialog box by double clicking on the sequence file name or by highlighting it with a single click and then clicking the Open button The name of the selected sequence file is displayed in the top left corner of every window 32 If the sequence is long default is 250k bp Oligo would try to open only a portion of it You may change this default size as described on p 40 chapter 3 13 2 3 3 2 File Open Protein Protein sequences of various text formats can be opened using this option The sequence is automatically reverse translated into DNA it is important that the rev translation method you wish to use is chosen using the Change Rev Translate Method before the protein sequence is loaded Once the protein sequence is translated into DNA OLIGO functions are the same as with any native nucleic acid sequence file Default Oligo extension for protein files is ami 3 3 3 File Open Oligonucleotide Database You may store import export edit analyze and manage oligonucleotides generated by OLIGO in one or more user created oligonucleotide databases The File Open Database command opens a previously saved database file The Oligonucleotide Database window permits you to download analyze and save oligos and records associated with them All functions of the database are described in detail in File New Data
55. pos 57 You ve just selected a non degenerate probe You may check it on any relevant Analyze windows In the top right of the Selected Oligonucleotides window there is a check box Select consensus oligos If it s checked the selected probe would contain a few degenerate bases This is because it is a consensus probe You may check the alignment by dragging up the dot located at the bottom center of the Selected Oligonucleotides window see below a OA Selected Oligonucleotides File Human elF 4E seg Upper Oligos HH 14 Select consensus oligos 4 Oligo 3 Pentamer GC Clamp Position Length Score Tm AG AC 1 l 19 24 928 71 1 5 8 7 9 Fa 57 27 867 71 4 6 9 f 9 7 3 173 24 ba 74 9 6 3 9 6 Oligo ta Pel Degeneracy File 1 57U27 GGAGAAAACGGAATCTAATCAGGAGGT 100 70 7 1 File 2 67U27 GGAGAARACGGAATCTAATCAGGAGGT 100 70 7 1 File 3 71027 AGAGAAAACAGAATCTAATCAGGAGGT 93 68 1 1 File 4 76U2 GGARAAAACAGACTCTAATCAGGAGGT 89 59 2 1 File 5 58027 GGAGAAAACAGAGTCTAATCAGGAGGT 93 70 2 1 File 6 105027 GGARAAAACAGAGTCTAATCAGGAGGT 89g 59 2 1 Consensus 5 RGARAAAACRGARTCTAATCAGGAGGT 89 100 68 1 70 7 16 Analyzed files Human elF 4E seqg 1 2 Chimpanzee elF 4E seq 3 Cow elF 4E seg 4 Mouse elF 4E seq 5 Rabbit elF 4E seq 6 Rat elF 4E seq Note that the mismatches with the File 1 the principal sequence are marked in red 197 4 5 Searching for TaqMan Probes amp PCR Pairs Choose the
56. program that Version 7 00 searches for and selects oligonucleotides Wojciech amp Piotr Rychlik from a sequence file for polymerase chain R real time PCR an reaction d other diagnostics applications siRNA sequencing ite directed mutagenesis and various Molecular Biology Insights Inc hybridization applications 8685 U S Highway 24 West It calculates hybridization temperature and Cascade CO 80809 USA naa Ree e of oli ondary structure of oligonucleotides edon e T 1 719 684 7988 free energy values including m amp Java Version 1 5 0_13 3 13 2 Application Menu Preferences When OLIGO is started up for the first time the OLIGO Settings folder is created in your computer s personal folder This file contains several OLIGO parameters When OLIGO is started again the OLIGO Settings are checked before the windows appear In Windows systems Preferences are in the Edit menu oO Preferences This Parameters section allows you to RE Windows Update Startup Quit apply the search parameters settings to either the active sequence file or to all Pees Freire te open sequence files The Windows resis darman version has additional button allowing changing to the pdf file viewer application Mac OSX takes care of this feature so this button is not needed When the sequence file is large Oligo may be loading it for a long time Therefore by default Oligo loads into computer memory only up to 250 000 nucleoti
57. s only box 9 Check also the box No multiple products in one sequence region and Cover the entire search area with Overlapping products 10 Change the PCR product length to 150 to 300 11 Click the OK button You should get just the coding region covered with PCR products and the hairpin loop in the template gone from any PCR products 4 3 Searching for sequencing primers 1 Choose the Primers and Probes option from the Search menu 2 Click on Sequencing Primers button 3 Choose the DNA strand the primers should be made of leave checked Search in Strand if you want primers to sequence forward they would be annealing to the negative strand and uncheck the Strand 4 Choose the region you want the primers located click the Ranges button and type Positive strand search range 400 to 450 The negative strand search range is irrelevant 5 Make sure the No overlapping primers probes box is checked if you want to avoid multiple choices of almost identical primers 6 Click OK button 7 Click the Search button You should get only one primer in the Selected Oligonucleotides window 8 Double click on this primer in the Selected Oligonucleotides window You ve just selected a sequencing primer 4 4 Searching for consensus hybridization probes Choose the Primers and Probes option from the Search menu Click on the Hybridization Probes button Click on the Subsearches tab at
58. selected before this window can be called up Optimal annealing temperature for PCR Ta and the maximum annealing temperature Ta are given For your initial experiment use Ta P since it usually gives the highest yield The Ta may be rather used for diagnostic purposes because PCR is more specific in these conditions 06080 PCR File Human elF 4E seq fs F R Product U L Product Set Score amp 12 Optimal Annealing Temperature 51 3 C Max 63 6 C Position and Length Tea FEI GC e P E Score Product 134 80 8 41 8 nja n a Forward Primer zl4 18 53 1 44 4 434 434 636 Reverse Primer 329 19 52 6 47 4 429 429 916 Upper Oligo Lower Oliga 294 22 57 8 50 0 458 468 Product T Reverse Primer Ty 28 2 C Primers T difference 0 5 C Comments Concentration Forward Primer 200 0 nii Reverse Primer 200 0 nMi Upper Oligo 200 0 nMi Lower Oligo 200 0 nM Monovalent Cation 50 0 mwi Free Mo 2 0 7 mh Total Na Equivalent 155 8 mM Figure 5 9 The Analyze PCR window The following is provided relative to the prospective PCR product e Length in base pairs e Tm GC method e GC content e score for PCR Note scores for the Set are given in the top right part of the window See also the button F R Product and U L Product these control what type of product is displayed either Forward Reverse Primer product or Upper Lower Oligo product 69
59. stability at a primer s 3 end however makes it less efficient the optimal 3 end pentamer stability is approximately 7 5 kcal mol The current stability ranges set for this parameter are displayed in the Internal Stability window as grayed area between the two dotted lines 6 1 3 4 5 end Stability Subsearch This subsearch selects oligonucleotides that contain a certain stability range at its 5 end pentamer defined by parameter e 5 terminal Stability Range It is automatically included only in the siRNA Probes search but you may add this sub search to any other composite search to better control oligo characteristics 6 1 3 5 siRNA Internal Stability Subsearch As the name suggests this subsearch is automatically active only when siRNA Probes search is selected The parameter that controls this subsearch is called e Internal 12 mer Stability SIRNA 6 1 3 6 Oligonucleotides With GC Clamp Subsearch The Oligonucleotides With GC Clamp subsearch selects for oligonucleotides that contain a stable segment of nucleotides anywhere along its length Note that OLIGO selects also for less stable 3 ends to improve specificity oligos with 3 terminal GC clamps may not be optimal To form a stronger bond with the intended target and offset the reduction of priming efficiency because of an unstable 3 end the program selects for stable segments over the rest of the oligo The selection filter for this search is
60. starting OLIGO This is most likely due to loading a large sequence file OLIGO could not handle due to too small memory allocation After restarting the computer click on the OLIGO icon and press the lt gt and lt I gt keys simultaneously Mac Increase the memory used by OLIGO There are many reasons for crashes on Windows system Please contact the technicall support an describe the circumstances some of them are due to bugs in Oligo that can be fixed It is always a good idea to check for the recent version update Help Menu If your version has a different number download and install it on your computer according to the provided instructions 154 12 2 3 Working with the Windows on the Screen There are too many windows on the screen and you can t find the window you want to work with Use the Window menu to see all the open windows listed at the bottom of this menu Use the title bar click and drag to move each window to its optimal place so that you can view the windows better and close those you do not need 12 2 4 Searching The search is complete but doesn t produce any results Check that the Automatically change stringency box in the Search Parameters dialog box is checked This relaxes the search stringency setting and searches again if nothing is found at the original setting Check to see that your search ranges are sufficiently wide and that the PCR product size is consistent with the search rang
61. the active sequence as opposed to the entire active sequence default PCR product length limits may also be set in this window in addition to the positive and negative strand search range limits for primer and probe selection The setting of search ranges are most frequently used to shorten search times and or when a researcher has limited targets to which he can design primers Setting search ranges can also be used to limit the total number of primer pairs selected in a given PCR primer search since the computer s memory limits the total number of selected primer pairs This window also allows to choose primers probes PCR products every x bases greatly reducing search times when you want to uniformly cover a large sequence with primers or probes When the sequence has features listed and one of them is a list of all the exons you may narrow your searches for probes or primers to only the exon sequences All the searches for false priming sites may be broadened to the entire sequence using this window Full description of the Search Ranges dialog can be found in the Change section 8 3 6 1 5 Search for Primers and Probes Parameters The search parameters are the numerical thresholds and windows that control the selection of the filters used in OLIGO searches In this dialog box most parameters may be adjusted from default values In addition six discrete 99 settings are available in the dialog box for global control of search st
62. the mouse in any other box and initiate a recalculation of all other boxes except the volume or concentration box whichever was set constant 82 Note The right column of this window should read X micrograms of DNA RNA or Y optical density O D units or Z nanomoles in K microliters makes a N micromolar DNA RNA solution 5 19 Analyze All Checked The Analyze All Checked command X in Mac Ctrl X in PC opens all the windows checked in the File Print Save option If all those windows are already opened this option closes them This toggle works even when the printing of just only the Current window is selected in the Print Save dialog 83 84 Search Primers and Probes search Sequence String Search Restriction Sites Search Restriction Sites in Protein Search Sequence Files Search Show Selected Bases Search Primers and Probes Search Data The OLIGO Search Menu 86 100 101 102 102 104 105 85 6 The OLIGO Search Menu The Search menu includes OLIGO s searches the search for primers and probes the search for sequence strings and the search for restriction sites in DNA and protein sequence files The search for palindromes that used to be in Oligo 6 is now automatic and the results are displayed in the Sequence window There is also automatic search for hairpin loops in the template and the results of this search is automatically displayed in the Sequence window as well and they are
63. will find also on the Sequence window 4 4 Edit Preferences This option is described in Chapter 3 13 2 as it is located in the Edit menu only in Windows systems 55 56 5 1 5 2 5 3 5 4 5 5 5 7 5 8 5 10 5 11 5 12 5 13 5 14 5 15 5 16 5 17 5 18 5 19 5 The OLIGO Analyze Menu Analyze Key Info Analyze Duplex Formation Analyze Hairpin Formation Analyze Composition and Tm Analyze False Priming Sites Analyze Homology Analyze Selected Oligonucleotides Analyze Oligonucleotide Sets Analyze PCR Analyze LCR Analyze Tm Graph Analyze Internal Stability Analyze Sequence Frequency Analyze Open Reading Frames Analyze Restriction Enzyme Sites Analyze Restriction Enzyme Sites in Protein Analyze Hybridization Time Analyze Concentrations Analyze All Checked 58 60 63 63 64 66 66 68 70 71 74 19 76 78 81 82 83 57 5 The OLIGO Analyze Menu The Analyze menu allows you to perform analyses of oligonucleotide primers and probes the active sequence s PCR products and primer specific experimental conditions Key Info Duplex Formation Hairpin Formation Composition amp Tm False Priming Sites Homology Selected Oligonucleotides Primer Pairs Probes PCR LCR Melting Temperature Graph Internal Stability Sequence Frequency Open Reading Frames Restriction Enzyme Sites Restriction Enzyme Sites in Protein Hybridization Time Concentrations T
64. window or set of windows to a file with a new name that you are prompted to enter The saving contents is exactly the same as if using the Save Data command 3 6 3 File Save Sequence The Save Sequence command saves the active nucleic acid sequence to your computer disk You may use this function whenever you enter a new sequence via the File New command or when you alter a sequence using the Edit function The file is of a simple text format and besides the sequence it contains also the features list 3 6 4 File Save Sequence As The Save Sequence As command saves the active sequence under a new name Using this command you may modify a sequence and save it without altering the original file 35 3 6 5 File Save Primer Oligo The Save Forward Primer Save Reverse Primer Save Upper Oligo and Save Lower Oligo commands save simple text files to your computer disk containing only the base symbols of the selected primer or oligo usually a probe of the active sequence If you intend to use the primer sequences for other purposes than direct transfer to a DNA synthesizer it is more convenient to save the primers to an OLIGO oligonucleotide database 3 6 6 File Save Search Results The Save Search Results command saves the most recent results of search in a file to your computer disk It saves the contents of two windows Selected Oligonucleotides and Primer Pairs Probes in a special format files recognizab
65. with any open sequence file After the linking export and import functions are available as well as you get fully functional Priming Efficiency and Tm database features If only one sequence file is open there is no need for this manual linking the database is linked to the sequence automatically 11 2 4 Analyze The Database window has several analysis options showing certain features of the oligos stored in it Analyze Priming Efficiency and Tm The Analyze Priming Efficiency and Tm option calculates the priming efficiency for the selected primer s or for all the Selected Oligonucleotides fo ee and Tm A All Oligonucleotides Minimize Reaction Multiplex All _ a gt Find All Groups ets gt Duplex Formation gt Minimize Reaction Hairpin Formation Find All Groups Figure 11 2 4 1 The Analyze Database submenu oligonucleotides in the database Once the actual P E for the primer checked against the linked sequence and the highest theoretical P E values are calculated they are displayed in the two columns The same is true for the Tm display This feature affects only the numbers displayed in the left columns that show the actual P E and Tm of given oligo when annealed to the linked sequence Analyze Multiplex The Analyze Multiplex option checks the selected record against other database records for multiplex PCR experiments M appears in the 3 Dim G right field to indicate that this o
66. 0 10000 15000 20000 25000 30000 35000 2000 A5000 Tia S3000 a a 25000 pr pro ooo 30 Narl 31 Ncol LEA d 32 Ndel 33 Nhel 34 Pacl 35 Pmatl II 36 Prel 37 Pstl EET L LT LHE 38 Pvull II I ES l 39 Sac 40 Sacll 41 Sapl i 4 42 Scal I tt te ee e a S tine 43 SexAl 44 Smal 45 SnaBl 46 Spel L H I 47 Sphl E I 48 5rfl 49 Ssel8251 50 Sse8387l 51 Sse8647l 52 Sspl LL HT TO TA 53 Swal Li o b Enzyme Site Cuts Positions amp Fragment Sizes 46 Spel AACTAGT 26 3869 3870 3249 7119 259 7378 4411 11789 4849 16638 5048 21686 1536 23222 1388 24610 151 24761 696 25457 T 3622 29079 733 29812 2371 32183 1494 33677 386 34063 1768 35831 4754 40585 1846 42431 556 42987 6099 49086 3741 52827 7526 60353 862 61215 4806 66021 8909 74930 6555 681485 4616 47 Sphli GCATGAC 13 16947 16948 2530 19478 812 20290 14842 35132 309 35441 9124 44565 1384 45949 4791 50740 1713 52453 5432 57885 1505 59390 767 60157 22592 82749 3352 566 5607 85534 13719 13720 39926 53646 32455 D 22237 47858 70095 16006 1555 1556 5299 6855 23011 29866 664 30530 30 30560 26605 57165 6874 64039 22062 52 5spl AAT AATT 83 1737 1738 1463 3201 160 3361 1629 4990 1468 6458 Y ELIN OF 1 FACT
67. 01 9703 9775 2346 PrintSetu p q f Print y f Save Exit 4 Register Figure 2 3 1 1 The OLIGO Customer Registration window Note Your software license number is on the OLIGO CD User Manual or and in the e mail conformation of the purchase 3 When you enter the license number the Register button should become active If you re connected to the Internet click the Register button The registration e mail is sent to MBI automatically and upon its completion the window should display the message Registration form successfully sent If you perform the registration during the MBI s normal operation hours Monday through Friday 8 a m to 4 p m Mountain Time expct the returning Access Code within an hour Otherwise you may Exit the Oligo and start it again at later time when you d receive the Access Code Click the OK button to exit 3a If you re not connected to the Internet or your network does not permit e mails directly from Oligo please print out the Registration Form by clicking the Print button and fax it to MBI dialing 1 719 684 7989 or press the Save button the saved file attach to your e mail and send it to us 4 When you receive the Access Code from MBI go back to the registration window by bringing it to the front or by re starting Oligo enter it to the Access Code box and click the Confirm Code button The registration process is complete 19 To register your se
68. 0200 20210 20220 20230 20240 20250 20260 20270 80 0 78 0 76 0 74 0 l a X a O 2 72 0 ee o bag an 8 ia a ee E z i e ea Ao el OO G Qata 70 0795 S 20209 ye 7 LA 68 0 basa 9 oo A Ao d AT ae 66 0 es 8 y S00 gag poo 64 0 e d oF 62 0 a 2854 60 0 58 0 56 0 54 0 52 0 50 0 48 0 46 0 44 0 42 0 3 GCCGGACAGGCTGCATCGTCAGCTCAGGAAGCGTCCTCCGGCGCAGAAGCGGCATCAGCAAAGGCCACTGAAGCGGAAAAAAGTGCCGCAGCCGCAGAGTCCTCAAAAAACGCGGCGGCCACCAGTGCCGGTGCGGCGAAAACGTCAGAAACGAAT S Figure 5 11 1 The Melting Temperature window dot style using Zoom 1 option The Current Oligo length was set to 25 nt The Melting Temperature window shows a stability or degeneracy graph of the displayed on the bottom of the window sequence segment calculated using the nearest neighbor method if stability is displayed Each point or bar on the graph represents the Tm or G of an oligonucleotide the 5 terminus of which is located at the position listed on the top right of the window cursor position The Tm is calculated for oligonucleotide length that is set in the Current Oligo Length option from the Change menu the default is a 21 mer The currently set oligo length is displayed on the window tool bar The Current Oligo sequence is in red and its Tm is represented by a small red ball The Melting Temperature window toolbox displayed at the top portion of the window below the sequence file name A
69. 0928 11846 11895 11 5 misc_feat 12841 14548 6 misc_feat 27629 28079 7 repeat_re 27638 27739 7 D Cancel Accept 1 10000 15000 20000 25000 30000 35000 40000 45000 S0O00 5000 60000 65000 70000 75000 s0000 This selects all the mRNA regions in the gene 5a Note you may create a new feature for example if you want probes in the end and the beginning of the sequence only you may click the button at the low left of the window and type name of the featue such as ends double click in the Location column and type oin 1 1000 84468 85469 and click on the check box 6 When the Feature 3 is highlighted the bottom of the window shows a map of the regions where the search will be performed Click the Accept button returning to the Search Ranges window Note not only when you enter a new feature but even if you check another feature you myst click the the Accept button Later on Oligo will ask you to save the sequence to make this change permanent 7 Check the Find oligos in checked region s only as shown 201 Sequence file BRCA2 gene seq 1 to 86101 Search method Hybridization Probes Positive strand search range 1224 to 85469 Negative strand search range 1224 to 85469 vw Find oligos in checked region s only PCR product length 43 to 1500 Choose sequencing primers every 500 nt 50 Choose hybridization probes every 1000 bp 50 M No o
70. 127 REIG Loa RED Lore nean Search Entire Sequence Linear Restriction Enzyme Database NICE6 UF EMZ 48 Srfl Gccc4ocac 49 Ssel625 GG4GWCCC 50 5se83871 CCTGCA4GG 51 Sse86471 AGAGWCCT sd M Pal e Pd Pd Pd Lai Ti Figure 5 15 The Restriction Enzyme Sites window 5 16 Analyze Restriction Enzyme Sites in Protein This Analyze window is available after the Search for the Restriction Sites in Protein that is described in the Search menu section The window looks almost exactly the same as in the option described above with the same features displayed The bottom window shows the search range and the type of enzyme cuts that have been considered blunt ends 3 or 5 overhangs or other odd This search can be performed only on the positive strand sequence in any of the 3 reading frames It is helpful to use Open Reading Frames window select the ORF of interest from there and read the exact search range that needs to be performed This is the analysis of a protein so the actual nucleotide sequence has little to do with it The sites in the potential DNA sequence are calculated only from reverse translated protein using the degenerate method and the window displays all 79 possible restriction sites that could be used in the DNA sequence without changing the protein sequence Example of the window is shown below 6080 File BRCA2 gene seq Restriction Enzyme Sites in Protein EnzyMe 200 22600 22800 dia 2
71. 163 File menu 29 new 30 new database 31 138 open 31 40 open database 31 print 36 print save options 36 reset 38 revert to previous sequence database save quit OLIGO Files installed on HD Find edit short cut key string Forward Primer composition and Tm display duplex formation edit export from database false priming sites hairpin formation homology restore select Full screen edit GC Clamp subsearch stability Go to position Hairpin analyze defined loop Tm primers subsearch Hardware requirements Help Homooligomers eliminate Hybridization probes Hybridization time analyze calculation Inosine reverse translate Installation OLIGO Internal stability analyze defined Lathe reverse translate LCR analyze defined License transfer Long sequence files opening Loop DG Lower Oligo composition and Tm display duplex formation edit export from database false priming sites 36 10 92 81 172 92 124 163 17 19 74 163 92 124 164 70 164 T 40 164 91 25 61 44 144 64 207 hairpin formation homology restore select Melting Temperature Window Merge sequence with Multi user License Multiplex analyze defined deselect Mutagenesis window Nearest neighbor method Network license OD unit OLIGO folder Oligo registration Oligo 7 updating Open Reading Frames analyze 76 display on Sequence window 22 Palindromes search Paste key option
72. 3200 23400 23600 23800 24000 24200 24400 24600 24800 25000 25200 25400 25600 25800 26000 26200 26400 26600 26800 reor i i i K 10 BamHI 11 Bbvil L BE E Ie 12 Bci Lt 13 Ball CO I 14 Bsal ae ee E ae a E 15 Bsml a S 16 BspHi 17 BsrDI 18 BsrGI 19 BssHII 20 Cial a i a C 21 Earl a a A E i LIE I 22 EcoRI C A ae a Il 23 ESP3I nie It OO IE E 24 Fsel 25 Hindili LI E C ed 26 Kpni th 27 Mlul 28 Muni 29 Narl 30 Ncol 31 Ndel 32 Nhel Tl tT 33 Nsil a 34 Pstl a an ar iM wt l x I l Enzyme Site Cuts Positions amp Fragment Sizes 10 BamHI GS2DPzi6 4 21784 23123 345 23468 648 24116 2409 26525 22932 11 Bbvil ED2KTsR6 15 21348 23559 503 24062 186 24248 91 24339 456 24795 189 24984 150 25134 Y 308 25442 78 25520 285 25805 309 26114 358 26472 216 26688 30 26718 92 26810 22647 12 Bell 53Ddul4 9 22451 22456 1146 23602 578 24180 273 24453 1021 25474 249 25723 446 26169 52 26221 138 26359 23098 13 Bglll RS1DLvI7 13 22068 22839 99 22938 72 23010 579 23589 576 24165 84 24249 9 24258 313 24571 254 24825 928 25753 135 25888 48 25936 480 26416 23041 14 Bsal GL2VSzS6 17 21984 22923 164 23087 217 23304 30 23334 136 23470 214 23684 226 23910 39 23949 966 24915 228 25143 773 25916 10 25926 81 26007 57 26064 234 26298 255 26553 60 26613 22844 15 Bsml EC2NAsM6
73. 4 4 1 Searching for PCR primers a simple search This example takes you through a quick search for a pair of optimal PCR primers To run this search open Human elF 4E seq file and 1 Choose the Primers and Probes option from the Search menu 2 Verify that the Compatible Pairs button under PCR Primers in the dialog box is checked 3 Click Search to start the search The Search Status progress window appears and the message Search Completed appears when the search is complete 4 When the search is complete two windows open Oligonucleotide Sets and Selected Oligonucleotides You may also check the Primers amp Probes Search Data from the Search menu window to make sure that the final search stringency is acceptable OLIGO automatically reduces search stringency if it does not find any compatible pairs 5 There are six sort options on the Oligonucleotide Sets and Selected Oligonucleotides windows The sort order is indicated in the figure below by red arrows AOA Oligonucleotide Sets File Human elF 4E seq et j Forward ma so Product Dpt mem Prime Pri Length Ta 2 3 1 1 59 332 g32 294 52 5 40 5 2 101 336 920 256 51 6 39 8 You may change the sort order by simply clicking at the column name Option click or Alt click allows for multiple sorts You may also sort the data by product length or any other field not sorted in the example above 9 Click on a primer pair to select this primer pair or dou
74. 4 3 Change Reading Frame The Reading Frame command changes the current to the first second or third translation reading frame 4 1 4 4 Change Rev Translate Method Lathe The Lathe method is based on the most probable codons in human mRNA 14 The human codon table is used Inosine When the Inosine method is selected an inosine universal substitute nucleotide is inserted at the third base position in certain degenerate codons 11 Degenerate This method gives all possible oligonucleotide combinations using the standard biochemical symbols for degenerate codons N Y R etc see Appendix D Table 7 12 Codon Table This back translation method creates a non degenerate guess mer sequence from the most frequent codons for a selected species This is the default reverse translation method used in OLIGO OLIGO includes these codon tables e Arabidopsis e Pseudomonas e Bacillus e Rabbit e Barley e Rat e Caenorhabditis elegans e Rhizobium e Chicken e Rice chloroplast e Clostridium e Salmonella typhimurium Cow Soybean e Distyostelium discoideum Staphylococcus Drosophila Streptomyces e E coli e Tobacco e HIV e Tomato e Human e Trout e Influenza virus A Vaccinia virus e Mouse e Wheat e Neurospora crossa e Wheat chloroplast e Pea e Xenopus laevis Pig Yeast S cerevisiae Plasmodium 52 4 1 4 5 Change Codon Table The Codon Table command selects the codon frequency
75. 5 File Close and File Close Window The File Close file name command closes all windows associated with one document currently analyzed sequence or a database The File Close Window closes only a single top window 3 6 File Save The File Save commands save a variety of data to disk When the active document is a sequence you may save the items displayed on the left of Fig 3 6 1 and when the active document is the OLIGO database you may save what s shown on the right 34 Data OS Data OLS Data as Data as wl Sequence 2S Database 5 Sequence as Database as Forward Primer Reverse Primer Upper Oligo Lower Oligo Search Results Work Figure 3 6 1 The File Save options 3 6 1 File Save Data The Save Data command can save data from any or all analysis windows of the currently opened document The File Print Save Options command calls up a dialog box where you can specify what window information is saved Each subsequent window saved is appended to an open data text file After saving you can open this file and edit or print its contents with any word processor but not with OLIGO To save window graphics copy the window contents to the Clipboard by pressing lt Alt Print Screen gt PC or 4 key Mac Than save the Clipboard picture into a document opened with graphics compatible application 3 6 2 File Save Data As The Save Data As command saves any open
76. 6 Frequency of 6 mers from Oryza sp oat sequences GBPLNSAC FR6 Freq of 6 mers from Saccharomyces cerevisiae sequences GBPLNSAC FR7 Freq of 7 mers from Saccharomyces cerevisiae sequences GBPLNZEA FR6 Frequency of 6 mers from Zea sp corn sequences GBPRI FR6 Frequency of 6 mers from Primate sequences GBPRI FR7 Frequency of 7 mers from Primate sequences 10 GBPRIHOM FR6 Frequency of 6 mers from Homo sapiens human sequences GBPRIHOM FR7 Frequency of 7 mers from Homo sapiens human sequences GBROD FR6 Frequency of 6 mers from Rodents sequences GBROD FR7 Frequency of 7 mers from Rodents sequences GBRODMUS FR6 Frequency of 6 mers from Mus sp mouse sequences GBRODRAT FR6 Frequency of 6 mers from Rattus sp sequences 1 4 4 FreqSeq Folder These are organism specific repetitive sequence files included in the OLIGO program They are used to check against potential primers DROSFR LST A list of drosophila repetitive sequences DROSFR SEQ Drosophila repetitive sequences HUMANFR LST A list of human repetitive sequences HUMANFR SEQ Human repetitive sequences MOUSEFR LST A list of mouse repetitive sequences MOUSEFR SEQ Mouse repetitive sequences RATFR LST A list of rat repetitive sequences RATFR SEQ Rat repetitive sequences WHEATFER LST A list of wheat repetitive sequences WHEATFR SEQ Wheat repetitive sequences YEASTFR LST A list of yeast repetitive sequences YEASTFR SEQ Yeas
77. 6 21331 23576 31 23607 1887 25494 78 25572 266 25838 247 26085 23372 16 BspHl S 3HbrM4 6 22077 22830 775 23605 293 23898 322 24220 800 25020 648 25668 23789 17 BsrDI AM2QaxNS5 2 19427 25480 678 26158 23299 18 BsrGl CT3VduY4 2 19535 25372 686 26058 23399 19 BssHIl AR2RAxA6 5 22337 22570 741 23311 456 23767 1338 25105 985 26090 23367 20 Clal ID1SeyR7 11 22200 22707 219 22926 113 23039 253 23292 324 23616 297 23913 1005 24918 78 24996 336 25332 258 25590 711 26301 23156 21 Earl LF3SSwL6 23 22159 22748 627 23375 259 23634 169 23803 19 23822 61 23883 3 23886 237 24123 50 24173 491 24664 73 24737 422 25159 170 25329 219 25548 3 25551 459 26010 70 26080 67 26147 109 26256 64 26320 57 26377 149 26526 335 26861 22596 22 EcoRI EF2NSsI6 18 22035 22872 99 22971 378 23349 131 23480 610 24090 17 24107 382 24489 399 24888 210 25098 165 25263 63 25326 15 25341 258 25599 654 26253 95 26348 109 26457 32 26489 409 26898 22559 i Search 22454 to 27004 End Cut Type 3 overhang 5 overhang Figure 5 16 The Restriction Enzyme Sites in Protein window Besides the enzymes listed in the table you cannot enter your own enzyme for the searches OLIGO has 79 restriction enzymes that can be selected for the search bases All are six base cutters or longer and none recognize degenerate 80 9 17 Analyze Hybridization Time Hybridization Time File BRCA2 gene seq DNA Length 21 nt Concentration 200 0 nMi 1 298 ug mL b
78. 6 4 27 8 4 gt 60 11 5 8 4 1 18 6 7 28 8 6 gt 65 11 7 9 4 2 19 6 9 29 8 8 gt 70 11 9 10 4 3 20 7 1 30 8 9 gt 80 12 1 11 4 5 21 7 3 31 9 1 gt 90 12 2 12 4 9 22 7 5 gt 35 9 7 gt 100 12 3 Hairpin Loop Tm Hairpin loop Tm is calculated according to the equation Hairpin loop Tm Teco 2 1 x log salt n 1 X Where Tco is the temperature at which AG of the structure is equal to 0 and n is the hairpin loop stem length This equation is based on data of Groebe and Uhlenbeck 9 Inosine is Known to destabilize duplex formation Although the thermodynamic data are not complete OLIGO partially corrects loop AG calculations based on Ref 10 for T I G I and l l base pairs values of 0 6 0 8 and 0 9 kcal mol are added to the total hairpin AG Hybridization Time Hybridization Time is calculated according to the formula T12 NIn2 3 5 10 vL Cy XI Where N is the total number of base pairs in a non repeating sequence molecular complexity L is the probe strand length and Cn is the probe concentration mol nucleotides liter 14 For simplicity N L therefore Ty2 VL In2 3 5 10 C XII Where C is probe concentration moles liter 173 Table 3 Entropy values of a nearest neighbor nucleotide in negative entropy units cal K mol from Ref 1 2 and 5 Second Nucleotide dA dC First Nucleotide dAorA 24 0 17 3 dCorcC 12 9 26 6 dGorG 13 5 26 7 dT or U 16 9 13 5 Initiation 15 1 Not listed nucl
79. ACG 395 AAAACT 1812 AAAAGA 2945 AAAAGC 1529 So OANDORWN In this particular example the frequency number for the sequence AAAACG is 395 meaning that this particular hexamer is found 8268 times 19 J b 395x85736235 4096 000 in human sequences from GenBank release 100 By choosing oligos with infrequent 3 ends in a given database you are decreasing the likelinood of selecting a primer that primes on many sites in a complex substrate such as genomic DNA In other words using oligos with low frequency numbers decreases chance of unspecific PCR No significant difference in PCR performance was found when primers were selected from a mer frequency table or a 6 mer frequency table A frequency of 1000 is the average hexamer or heptamer frequency for a given database These data tables are also used in the Eliminate Frequent Oligos sub search for primers The toolbar of this window contains the following items The two first icons are for zooming in or out the sequence frequency display the Options ap icon allows for changing the window style from dots to bars and vice versa provides show hide the sub search threshold value and allows to change sequence frequency data from the Frequencies folder 5 14 Analyze Open Reading Frames AOO Open Reading Frames File BRCA2 gene seq Q eG amp lt 7 Min ORFSize 1 aa pos 22454 1 l aa i B IEI I MEE 2 NH If DCEO CARNE EY E Coo 3 6 E m lE li N ina Bai
80. Ambiguous bases which are recognized by the OLIGO program 12 For calculations of thermodynamic parameters all ambiguous bases and inosine are treated as deoxythymidine Symbol Meaning not A not C not G inosine GorT Aor C ACGT AorG CorG not T Corl AorT ACGT x S lt lt MNDZEZKuUTOO This symbol is not listed in Ref 12 175 Tm 0 PC 33 GC 40 GC 50 GC 60 GC 67 GC 14 16 18 20 ao a4 26 28 30 oi Oligonucleotide Length nt Figure D1 Tm dependence of oligonucleotides length and their GC contents Average Td values 100nM oligos and 1M salt For searching for sequencing and PCR primers subtract 9 degrees This chart may be useful when setting the Tm or and oligonucleotide search ranges manually Table 8 Restriction Endonuclease Cleavage Efficiency 13 Linearized plasmids were incubated with the indicated enzymes 10 U ug for 1 h More conservative values are presented Base Cleavage Cleavage Pairs Efficiency Efficiency from End BspE I BspE I 176 BsXxIi 1 Eco24 tt Hind 177 Appendix E Amino Acid Symbols Nondegenerate Amino Acid Symbols Symbol Name of Amino Acid Alanine Cysteine Asparatic Acid Glutamic Acid Phenylalanine Glycine Histidine Isoleucine I OTN MOQO gt Lysine Leucine Methionine Asparagine Proline Glutamine Arginine Serine Threonine Valine Tryptophan lt s lt HWOWROVZAZCR Tyrosine Termination Codon 178 Degenerate A
81. CR Product nt 900 1000 1100 1200 1300 14001800 1600 1700 CGATCAGATCGATCTAAGAT GGCGACTGTCGAACCGGAAACCACCCCTACTCCTAATCCCCCGACTACAGAAGAGGAGAAAACGGAATCTAATCAGGAGGTT GCTAACCCAGAACACT GCTAGTCTAGCTAGATTCTACCGCTGACAGCTTGGCCTT TGGTGGGGATGAGGATTAGGGGGCTGATGTCTTCTCCTCTTTTGCCTTAGATTAGTCCTCCAACGATTGGGTCTTGTGA cS DES K OAT VE PET TPT PNP PT TEE EK TES HO EVA HP EO lt G9 4 gt Clicking on CDS highlighted the coding region of elF 4E DNA sequence it is actually the mRNA sequence reverse transcribed to DNA 2 Move the horizontal bar You will notice that the yellow shaded box moves around the Tm graph Sequence in this box is displayed at the bottom of this window Click on any nucleotide displayed this window you just changed the Current Oligo position All the features of the Sequence window are described in the Manual Chapter 2 5 You may move down or up the sequence using the keyboard arrows page up or down 3 Keep the Sequence window opened and choose Open Reading Frames from the Analyze menu If you click on any nucleotide position you also change the Current Oligo position observe the Sequence window while playing with the ORF window You may change the reading frame just by clicking on the open reading frames displayed in the top portion of the ORF window 4 Close the ORF window for clarity and open the Melting Temperature Graph and or Internal Stability Current Oligo windows from the Analyze menu N
82. Features window Each feature takes one row in this window There are four columns in this table the check box column the feature number name of the feature and the position number s this feature is located on the sequence If the list is long a scroll bar appears on the right of the table Below this list a set of four icons and the Accept button is located When a box or boxes are checked and lt Accept gt ed you may be able to search for primers only on those selected regions 54 Click on the icon to enter a new feature The insertion bar will automatically move beyond the last feature OLIGO will create automatically the new and will prompt you to enter the new feature name next to it ee FEL POLL PLY 550 The feature name could be anything Move to the Location field by pressing the Tab key or simply click on the Location area in the same row Enter a single number or if it is a continuous region two numbers separated by two dots 100 282 or if it is a non continuous entity such as introns write it in this format join 100 150 230 355 2451 3781 omit the square brackets When you re done click on the lt Accept gt button and you may close the window When you click on a feature the entire row will be highlighted and on the bottom of the window you will see graphical representation where the feature is located on the sequence The same graph the zoomed graph as well the list of features you
83. For the primers amp probes the following information is given e 5 end position number for the Forward Primer and Upper Oligo and 3 end position number for the Reverse Primer amp Lower Oligo e Length in nucleotides e Tm is given at concentrations specified in the lower portion of the window these values are interactive and can be defined by you Note The primer and salt concentrations in this window are independent from the global salt and nucleic acid conditions specified in the Search Parameters e Priming efficiency numbers format real P E with mismatches if present theoretical P E without mismatches even if present PCR primers may be balanced by using their P E or by their Tms Excellent results have been obtained for multiplex PCR 10 pairs when all the primers were within a 450 500 P E range e The score the higher the score the more suitable primer And below the table you ll find e Tm difference between the product and the less stable primer Avoid a primer product difference of more than 29 since this may produce too much competition between template template and primer template annealing e Tm difference between the primers Avoid designing primers with a high Tm difference whenever possible When the selected primers have disparate Tms greater than 10 the more stable primer does not work optimally because the annealing temperature has to be reduced to compensate for the less stable pri
84. G Bases per Oligo 50 25 2 0 Ambiguous Bases K GT M AC R AG S CG WAT Y CT B not A D notC H not G Vinot T Niany Search Method TaqMan Probes amp PCR Pairs Search Method Compatible Pairs Defaults Apply Cancel OK Defaults Cancel Cory Figure 8 4 3 The Search Parameters Sequence Constraints and Scores windows 3 terminal sequence ambiguous bases are possible and OLIGO will select primers only with those desired sequences The check boxes in the Sequence Constraints window indicate whether or not the particular constrain will be 122 applied in the search despite the default setting indicated by the blue circle In the example on Fig 8 4 3 the search for TaqMan probes was selected and despite the scheduled search for Forward and Reverse primer the constraints will only be applied to the TaqMan Probe itself lack of GG at its 5 end and not to the primers no matter what would have been typed in the primer constraints boxes because the check box is unchecked Only in the case of molecular beacons probe the sequence shown in this window will be attached to the probe 8 4 4 Search Parameters Scores This section of search parameters consists of two windows The first one is displayed on fig 8 4 3 and the second one below The Oligonucleotide selection window consists of 7 columns The first indicates whether this parameter will be used or not in the currently set
85. J and you may also invoke the corresponding Key Info windows the same way as for the Current Oligo Clicking the non dimmed info icon in the PCR Product row will open the Analyze PCR window The box on the right displays all features annotations of the sequence a Feature Location l1 source 1 66101 2 gene 1224 854569 3 mRNA join l224 1411 2166 2271 4 CDS join 2205 2271 4821 5069 4 5 misc_feature 12841 14548 7 Figure 2 5 2 The OLIGO Sequence window the Features Box To browse the list use the vertical scroll bars if necessary By clicking at any feature the graphical representation light blue bar of this particular feature is highlighted and displayed in the Sequence window in two locations zoomed out center and zoomed in at the bottom of the window Feature in bold letters is a selected feature from the Edit Feature menu that is functional in Search Ranges you may search for primers only in this feature if you like Note if you select a feature Oligo will be able to save the sequence with this feature selected 2 5 2 The Zoom out Area Graphical representation of the sequence is displayed below the information boxes in two areas The top one is the zoom out area that shows the graph representing melting temperatures of all the oligos of the Current Oligo length in the entire sequence file graphical representation of the positions of selected oligos strong hairpin loops in the template weak
86. OLIGO PRIMER ANALYSIS SOFTWARE Version 7 Wojciech Rychlik License OLIGO Primer Analysis Software Version 7 Molecular Biology Insights Inc Cascade CO USA http oligo net 11th Edition November 2010 Copyright 1989 2010 Wojciech Rychlik All rights reserved OLIGO is a registered trademark of Wojciech Rychlik Macintosh is a registered trademark of Apple Computer Inc WINDOWS is a registered trademark of Microsoft Corporation SEQUENASE is a registered trademark of US Biochemical Corporation PCR is covered by US patents owned by Hoffman LaRoche Inc TaqMan is a trademark of Roche Molecular Systems Inc REBASE is a copyright of New England Biolabs Inc All other brands and product names are the trademarks and or copyrights of their respective owners All specifications stated herein are subject to change Table of Contents 1 Information About OLIGO 9 2 Getting Started 15 3 The OLIGO File Menu 29 4 The OLIGO Edit Menu 43 5 The OLIGO Analyze Menu 57 6 The OLIGO Search Menu 85 7 The OLIGO Select Menu 107 8 The OLIGO Change Menu 111 9 The OLIGO Window Menu 127 10 Oligo Help 131 11 Oligo Database 133 12 Troubleshooting 147 13 Appendices 161 14 Tutorial amp Examples 183 15 Index 206 1 1 1 2 n n O A OU Copyright License Agreements Warranty Copy Protection amp Technical Support Essential Criteria for Optimal PCR Primers Sequencing Primers and Hybridization Pro
87. Oligonucleotide Sets l Selected only _ Multiplexing Print Save Current Selected All Exclude Sele v Editors File Cancel Print Save Y Current Selected gt All Exclude Sele V Editors Cancel C Print Save Current Selected All Opened Exclude Cancel x there are letters C F R U L M on the top ot the window see Fig 3 11 1 These refer to windows describing Current Oligo Forward and Reverse Primers Upper and Lower Oligo and Mixed oligos respectively explained also at the windows bottom The Analyze 2 window gives control to the other windows printing see Fig 3 11 2 The Search Data Print Save window allows to save specific information from various Search windows Fig 3 11 3 Figure 3 11 3 The Print Save Options window Search Data Printing format of the Databases can be controlled with the fourth Print Save Options window shown on the following Figure Figure 3 11 4 The Print Save Options of the Database You may save various sets of the Database the oligo sequences oligo sets and multiplexed oligos Besides the individual entries or sets can be saved as plain listings or in Full Analysis format 3 12 File Reset There are two levels of reset in the OLIGO program 3 12 1 Reset Data The Data command resets all user generated results calculations and accumulated data generated since
88. Oligonucleotides with GC Clamp TaqMan Probes amp PCR Pairs m Oligonucleotides within Selected Tm Limits Compatible with the Upper Probe C Lower Probe M Hairpin free Oligonucleotides O Selected Primers Mi Eliminate Mono and Di Nucleotide Repeats M Detect Sequence Repeats Molecular Beacons amp PCR Pairs i Eliminate Frequent Oligonucleotides O Nested Primers M Omit High Secondary Structure Regions in the Template O Sequencing Primers M Check Primers Probe Sequence Constraints O Hybridization Probes _ M Restrict the Number of G Bases es Parameters _ M Eliminate False Priming Oligonucleotides recente _ _ and Continue Above Search in Other File s Ranges After successfull search show All Results eA l Cl Consensus Primers Defaults Defaults Figure 6 1 The Search for Primers and Probes windows The Ranges and Parameters dialogs may be accessed by clicking on the respective buttons in the Search for Primers and Probes windows These options are also available from the Change menu You can change the search parameter values individually or globally using the Parameters button You may specify the search ranges using the Ranges button and change all parameters to defaults at a given stringency level except the ranges using the Defaults button 6 1 1 Available Search Modes Search in or Strand You can search in the positive strand negative strand or both jus
89. PCR analyze duplex formation effect inverse search PCR Primers criteria search PCR Product composition and Tm 24 104 26 47 69 167 117 88 9 11 118 63 P E see Priming efficiency 165 Polymerase chain reaction see PCR Preferences Previous Oligo restore Previous Primer restore Priming efficiency database function defined analyze false priming Print Save options Reading frame change edit window find open r f References Registration Restore previous Primer Oligo 208 40 54 19 137 165 141 64 36 123 52 76 178 18 54 Restriction enzymes cleavage search Reverse Primer composition and Tm display duplex formation edit export from database false priming sites hairpin formation homology restore select Reverse translate edit menu main menu Save as Save Search batch processing consensus primers duplex free oligos false priming find find next frequent oligos GC clamp hairpin free oligos hairpin loop stems highly specific oligos homooligomers hybridization probes menu modes molecular beacons nested primers palindromes PCR primers primers and probes ranges restriction sites restriction sites in protein sequence string sequencing primers siRNA probes stringency TaqMan probes Select Current Oligo Oligo Primer new current oligo pos short cut keys Sequence edit 53 124 35 34 102 99 93 97 26 51 100 26 109 108 109 25 44 48 export
90. Primers and Probes option from the Search menu 2 Click the TaqMan Probes amp PCR Pairs button 3 Click the Search button The sets are found and displayed in the Oligonucleotide Sets Table 4 Click once on a set to select it or click twice to choose it and open the PCR analysis window at the same time 5 If you don t like the default Tm difference between the primers amp the probe before the search you may alter it by changing the Tm of Probe Tm of Primer search parameter in the Constraints window 6 If you need only a specific DNA region to work with before the search you may set the search range by choosing it from the Search Ranges window click the Ranges button and enter the positive and negative strand search range in the top of the window following by the OK button hk 4 6 Searching for Molecular Beacons amp PCR Pairs Choose the Primers and Probes option from the Search menu Click the Molecular Beacons amp PCR Pairs button Click the Search button The sets are found and displayed in the Oligonucleotide Sets Table 4 Double click on a set to select it and open the PCR analysis window at the same time Note that you get a seemingly disturbing comments The Upper Oligo does not match the template and 3 end Upper Oligo dimer This is a sign that the beacon probe was selected successfully 5 To see the alignment with the template choose the Sequence window and move the h
91. R primers should be free of significant complementarity at their 3 termini as this promotes the formation of primer dimer artifacts that reduce product yield Formation of primer dimer artifacts may also cause more serious problems such as non specific DNA synthesis due to an unbalanced primer ratio asymmetric PCRs fail more frequently than standard reactions PCR yield dependence upon the G of 3 terminal duplexes is illustrated in Figure C 1 PCR Yields 167 oe o 2 gt aa O A 4 8 12 3 terminal duplex AG kcal mol Figure C 1 PCR Yields Dependence of PCR yield upon the amp G of 3 terminal primer duplexes The amp G values are calculated according to the equation VI T set to 25 The values shown in Figure C 1 are approximate since the PCR yield also depends on the annealing temperature the specificity of primers and other parameters not considered here The high dependence of yield on 3 dimer formation tendency is the result of the very high processivity of thermostable polymerases Duplexes need not be stable to prime DNA synthesis Very little time is required for the enzyme to recognize a 3 terminal duplex and start polymerization In general oligonucleotides forming intramolecular duplexes with negative G should be avoided Although self complementary PCR primers with hairpin stem G approaching 3 kcal mol at 25 are suitable in certain cases a hairpin loop forming primer is troublesome when
92. S Gi g allow the window customization To the right of the toolbox the sequence length and the length of Current Oligo is displayed and on far right the two boxes display the position and Tm of an oligo starting at this position of the cursor vertical gray bar The first icon is the zoom in and the second zoom out Use them to decrease or increase magnification of the graph Only the fully zoomed in window displays the actual sequence By default the Melting Temperature window displays the tm plot of every 21 mer of the active sequence However there are three display modes of Tm 3 of G values and one of GC composition and degeneracy You can change the M display from the Graph window by clicking the Graph icon The display options are described below 12 Degeneracy Figure 5 11 2 The Graph options of the Melting Temperature window The default display is the melting temperature without consideration for dangling ends marked tm throughout the entire OLIGO The T shows the melting temperature of forward half of the Current Oligo size oligos and the T of its complement For both Tm values appropriate dangling ends correction are given The analogous set is for the G values where g symbolizes the free energy value without the dangling ends Selecting GC will show the GC AT ratio in the Current Oligo length fragments and if the sequence is degenerate you may select the degeneracy plot also the wind
93. Search Method the second the parameter name the third is the maximum score a primer may receive if this parameter falls within the Range The fourth and fifth column describe that Range and the sixth column is the unit name the Ranges are shown The last column shows the penalty per one Unit if a given oligo s parameter falls outside the Range You can t edit the dimmed grey values but otherwise you may change the numbers in the 3rd 5th and 7th column This may have a profound effect on the score given oligo or the entire set receives Because each search may consist of a different number of sub searches the maximum score is not a simple sum of all scores but it is a weighed score that may reach maximum of 1000 points regardless of the number of subsearches OC Search Parameters Parameters More Parameters Sequence Constraints Scores Oligonucleotide Selection Pair Set Selection Unit Penalty Unit within Range beyond Range e 3 Dimer AG 2 5 40 0 Template Loop AG 5 0 5 0 Tm Difference between Primers 1 0 5 0 P E Difference between Primers 10 2 0 Tm of Probe Tm of Primer 50 0 Tm of Loop Tm of Primers 5 0 100 0 Parame ter Min Template GC 30 0 3 0 Max Template GC 40 0 6 0 Gap between Primer and Probe 20 1 0 Search Method Compatible Pairs Defaults Cancel OK Figure 8 4 4 The Pair Set Selection Scores window 123 The Pair Set Selection Scores window has the Max Score
94. String Search in Strand dialog box appears You may also define any number of mismatches in the string of interest by typing any number greater than 0 default in the Allow n mismatches box 100 6 3 Search for Restriction Sites The Restriction Sites function searches a nucleic acid active sequence for restriction enzyme recognition sites and displays the resulting data in a table of positions and fragment sizes and or on a position map The nucleic acid sequence can be treated as circular or linear DNA When circular the first and last fragments on the active sequence from a given enzyme cut are treated as one When you access this option the Search for Restriction Sites dialog box appears where you set search range circular linear and the desired Enzyme Database Text 8 OC Search for Restriction Sites File NICE6 amp UP ENZ Search Sequence Circular Linear _ Portion Limit Limit the number of sites Maximum of restriction sites 5000 Select Enzyme Database Cancel Search Figure 6 3 The Search for Restriction Enzymes dialog box The Start and End search positions are dimmed when the Sequence button is ON lf you would like to update the restriction enzyme database you may download OLIGO compatible REBASE files from the New England Biolabs site http rebase neb com or search Google for Rebase and choose format similar to the one given with the OLIGO package Type
95. This window is the core window of the OLIGO program It includes the elements functions and capabilities described below 2 5 1 Information Boxes At the top there are three information boxes The one on the left shows the sequence length in nucleotide number current reading frame translated protein is on the bottom part of this window more reading frames are displayed in the Open Reading Frames window Current Oligo length for which you see the Tm graph below and its 5 end position number along with its Tm in standard conditions 100nM DNA in 1M salt In the lower left corner of this box there is a small info icon and clicking on it will open Analyze Key Info Current Oligo window containing basic information about the shaded sequence fragment The central box displays information on four selected oligos Forward Reverse Primers and Upper Lower Oligos as well as the length of a PCR product when the Primers are selected Selected Oligo Position Length Ji B Forward Primer 214 18 Ji B Reverse Primer 329 19 O Upper Oligo E Ji amp Lower Oligo 294 22 Ji PCR Product 22 Figure 2 5 1 The OLIGO Sequence window the Central Box after the search for TaqMan probes and selecting a triplet Lower Oligo is the probe in this example This box has also info and a square icons 3 By clicking on the square icon you are selecting corresponding Primer Probe After the selection the icons change their appearance
96. YF YY Y Y hd All Checked ob X Figure 5 0 The Analyze menu 5 1 Analyze Key Info 5 1 1 Key Info Current Oligo Forward Primer Selected Primers Reverse Primer Selected Probes Upper Probe Lower Probe Current Oligo Forward Primer Reverse Primer Mixed Oligos in Forward Primer Reverse Primer Upper Probe Lower Probe Current Oligo Entire Sequence PCR Product Forward Primer Reverse Primer Upper Probe Lower Probe This option calls up the Current Oligo window that displays the Current Oligo specifications in two columns The left column is for the positive strand and the right is for the negative in the following order e The sequence of the Current Oligo displayed from the 5 to the 3 end e The Current Oligo length e The 5 position of the Current Oligo positive strand and the 3 position of its negative strand complement 58 e The Current Oligo s Tm dangling ends included and tm dangling ends excluded calculated by the nearest neighbor method using the salt and nucleic acid concentrations displayed in the Non Search Parameters dialog box Change menu e The G free energy calculated using temperature displayed in the Non Search Parameters dialog box Change menu The G value is for dangling ends included and g excluded e The S entropy The S value is for dangling ends included and s excluded e The H enthalpy The H value is for dangling ends
97. _ Edit File CBP seq Otea dit elea Edit Search Change Rev 1 J Accept Accept amp Close Discard amp Close Revert to Previous Sequence Adjust Oligo Position for Max Homology Adjust Oligo Position for Max P E a No Adjustments Figure 4 1 1 The Edit window Accept Discard menu 4 1 1 1 Accept Discard Accept The Accept command saves editing changes in computer memory without closing the window Sequences may be saved to disk only by using one of the save commands from the File menu The short cut key is lt Enter gt PC or lt return gt Mac The Accept action refreshes all windows associated with this sequence 4 1 1 2 Accept Discard Accept amp Close The Accept amp Close command accepts new changes to the sequence and closes from the Edit window The new primer or sequence is saved only in RAM at this point Sequences may be saved to disk by using only one of the save sequence commands from the File menu The short cut key is lt Shift Enter gt PC or lt enter gt Mac 4 1 1 3 Accept Discard Discard amp Close The Discard amp Close command discards any changes to the edited primer or sequence and closes the edit window 4 1 1 4 Accept Discard Revert to Previous Sequence This command reverts the edited sequence to the original state that was prior to the editing 4 1 2 Edit Window Menu Edit All operations under the Edit command are performed on the base immediately to the left of the cur
98. abase is linked to Human elF 4E seq 5 Click on record 3 From the table you can read that it forms a 3 dimer of 4 kcal mole and that this value is above the parameters threshold to change the thresholds you d have to use Options button 6 To see the actual dimer go to the Analyze menu database has a different Analyze menu and choose Duplex Formation When you check this window you may close it 7 The database has a powerful multiplexing option Click on Analyze Multiplex All Oligonucleotides Minimize Reaction Oligo automatically finds compatible oligo sets among the entries labeled SC that stands for Self Compatible You may view those sets by clicking on the triangles located at the lower right 4 4 Group 1 3 269 10 The example above shows Group 1 consisting of oligos 2 6 9 and 10 in the database All those four oligos do not form 3 end dimers among themselves within currently set search parameters in the Database Options Note if your database contains probes instead of primers you need to change the multiplexing mode from checking for 3 dimers to checking homology or rather inverse homology to find out what probes stick to each other In this case use the Change menu and choose Multiplexing Mode gt Probes check homology View Window Help 4 Options Multiplexing Mode a v Primers check 3 dimers Probes check homology 8 Let s make a new set of primers in the datab
99. al Stability s B AB A FB Cancel i Current Oligo Fjorward Primer Rjeverse Primer Upper Oligo Dower Oligo Mixed Oligos Figure 3 11 1 The Print Save Options window Analyze 1 Default setting is to print or save only the Current Oligo window the most recently used When Print Save option is set to Selected you would get a print out of all selected in the Analyze and Search Data windows In the example above only the Key Info window contents would be printed along with what s not 37 shown but checked in the other three Print Save options windows Note that r e b A Figure 3 11 2 The Print Save Options window Analyze 2 r 38 Print Save Options Analyze 1 Analyze 2 Search Data Database Sequence Current Graph Open Reading Frames _ Hybridization Time _ Concentrations M PCR Sequence Frequency Composition amp Tm Sequence Composition amp Tm PCR LCR _ Selected Oligonucleotides List only Full Analysis _ Oligonucleotide Sets List only Full Analysis Print Save Options Analyze 1 Analyze 2 _ Search Data Database Primers amp Probes Search Data l Restriction Sites Restriction Sites in Protein Selected Bases _ Template Hairpin Loops Hairpin Loop Stems Palindromes String Search Results Print Save Options Analyze 1 Analyze2 Search Data Database v Oligonucleotides _ Selected only List only Full Analysis v
100. alifiers Details Nucleic Acid O Protein Format Nucleic Acid Oligonucleotide Database New Folder Cancel Open and you would be able to choose any of the three types of files If you d choose All Files Oligo would show a slightly different window shown below from which you d need to choose the kind of file with Open As pull down menu 187 Open File jj Test sequences Y DEVICES D FreaSeq HD1T jj Frequencies Z HD 1T libOligoLibrary jnilib Y PLACES 4 roll beni si J oligo_7_manual p Deskt i oligo_7_tutorial pdf a wr Tables A Applications Jj Test sequences Utilities hea Previewer a gt 5 gt cbp odb 4 amp Chicken elF 4E seq r Chimpanzee elF 4E seq Chimpanzee elF 4E seq Name Cow elF 4E seq Cow elF 4E seq Kind Nucleic Acid o Database 6 0db Size 2 KB y Dictyosteli elF 4E seq y 1 997 bytes g u amp Human elF 4E gene seq Modified 8 14 08 8 26 AM l 7 OLIGO sequence data VER 1 ACCESSION NM_174310 FEATURES Location Qualifiers Se Details me Format All Files New Folder Nucleic acid file is selected Open As a gt Open 3 ee TE Cancel iis Nucleic Acid 7 All Files Protein Oligonucleotide Database OLIGO Search Result aved Work File Y Nucleic Acid Protein Oligonucleotide Database Search Results S
101. also accessible through the Show Selected Bases menu option for Primers amp Probes oe for a Sequence String a Strand for Restriction Sites Strand for Restriction Sites in Protein I Sequence Files Show Selected Bases Primers amp Probes Search Data Figure 6 0 The Search menu 6 1 Search Primers and Probes The Search for Primers and Probes allows you to search for optimized PCR primer pairs Sequencing and nested primers TaqMan probes molecular beacons hybridization probes or even siRNA probes in the active nucleic acid sequence Each of these searches consist of several simple procedures listed in the Subsearches window If you click the Subsearches button you will see all available subsearches OLIGO may perform You may manually check uncheck each button to activate or deactivate that sub search option 86 O Search for Primers amp Probes Ea Search for Primers amp Probes Search Options Subsearches Search Options Subsearches Search Search method PCR Primers Search in 2 Cancel Cancel Search Mode Select Apply Mi Eliminate Ambiguous Bases Apply M Complex Substrate M Duplex free Oligonucleotides m Highly Specific Oligonucleotides 3 end Stability PCR Primers M 5 end Stability Compatible with the Forward Primer Reverse Primer M siRNA Internal Stability m
102. and A nucleic acid sequence complementary to the sequence loaded from a sequence file In OLIGO it is displayed in blue on the Melting Temperature window Nested Primer Pair Two cross compatible pairs one positioned within the other used to amplify a difficult template OD Unit The quantity unit for nucleic acids and other light absorbing compounds based on light absorption One unit of nucleic acid dissolved in 1 ml of a buffer gives an absorption of 1 using a spectrophotometric quartz cuvette with a 10 mm path length Approximately 30 OD260 is equal to 1 mg of single stranded DNA Optimal Annealing Temperature Ta9P The annealing temperature calculated by OLIGO that gives the highest product yield when no false priming and primer dimerization occurs Usually with complex templates the optimal annealing temperature is higher due to the increased likelinood of false priming In these situations use Ta which is three degrees higher than the Tm of the less stable primer However in certain circumstances short primers high GC template using the Ta may yield no product Positive Strand A nucleic acid sequence strand identical to the sequence loaded from a sequence file It is displayed on the Melting Temperature window 164 Primer Extension Arrow An arrow extended from the 3 end of the Upper Reverse Primer to show the potential polymerization direction Priming Efficiency P E This number is a formula
103. and export this oligo or the set as Forward or Reverse Primer Upper or Lower Oligo or Oligonucleotide Set When you go back to the Sequence window you can work with these primers probes in any of OLIGO s Analyze functions When several sequence files are opened make sure that the intended sequence file is linked to the Database To un select a single record Citrl click PC or d6 click Mac on it Export Checked Oligonucleotides This transfers all the checked oligos not necessarily highlighted from the database to the Selected Oligonucleotides and Oligonucleotide Sets windows of the sequence linked to this database Make sure that you are exporting oligos that originated from the same sequence The selected oligonucleotides exported this way replace the latest search results so you may further analyze the oligos by selecting them for further analysis from the Selected Oligonucleotides and Primer Pairs Probes windows as Primers or Oligos usually probes Note if you ve modified a record in the Database exporting it will not carry this modification because it only exports indexes finds best matches in the sequence not the actual oligos Exporting sets consisting of molecular beacons may alter the beacons by replacing their 5 tails into sequences given in the Sequence Constraints Search Parameters window Export Check Uncheck Selected This checks all selected highlighted records If you see Uncheck instead this h
104. anslation method substitutes the Inosine base universal substitution nucleotide for a certain degenerate base This method is described in Appendix D Theories and Formulas Used in the OLIGO Program Inverse PCR DNA amplification of unknown sequences flanking a known sequence When using OLIGO 3 ends of primers should point to the outside of a linear active sequence The actual DNA template however must be a circular DNA sequence for the inverse PCR application Internal Stability This refers to the stability of subsequences within a nucleic acid OLIGO displays internal stability as the G of pentamers Optimal primers are usually very stable on their 5 ends and less stable on their 3 ends but still relatively stable The variable stability within an oligo is determined by measuring the G of the various overlapping pentamers within it The internal stability of the 3 end of an oligo can be used to predict its specificity in a PCR or sequencing reaction Lathe Method This reverse translation method is based on the most probable codons on mammalian mRNAs and the codon bias Ref 14 For more information see Appendix D Theories and Formulas Used in the OLIGO Program 163 LCR Ligase Chain Reaction Is a method of detecting small concentrations of target DNA molecules usually at mutation sites originally described by Barany et al Ref 17 Currently there are four basic variations of this technique blunt end ligati
105. appens when the top record is already checked then all selected records are unchecked Export Uncheck All This unchecks all records regardless of their selected status 144 11 2 7 Change The Change Menu has two items Options and Multiplexing Mode Change Options eO Database Options Database Options Parameters Display Options 4 _ Parameters Display Options Acceptable 3 Dimer AG 2 5 kcal mol Display the following fields Max Acceptable Homology 75 Monovalent lon Concentration 50 0 mM MI 3 Dim AG Hommogy Free Mg 2 Concentration 0 7 mM mM P E p e Total Na Equivalent 155 8 mM M Date M Tm tm Nucleic Acid Concentration 200 0 nM M ID Number Ref Temperature for AG Calculations 25 0 C M Sequence Comments Use the linked sequence parameters Defaults C o Defaults C oK Figure 11 2 7 1 The Database Options menus The Options window consists of two parts The first part displays all parameters the database is using to calculate properties of listed oligos as shown on Fig 11 2 7 1 Parameters such as salt and nucleic acid concentration have direct effect on the Tms of oligos displayed in the Database When the Use the linked sequence parameters box is checked than search parameters from the linked sequence are used instead The Display Options window is shown to the right of the Parameters window This window controlls what fields
106. arameters window 6 1 3 13 Check Primers Probe Sequence Constraints This new option allows for selecting primers that contain or do not contain certain bases at their ends For example in the TaqMan probe search the default 96 sequence starts with HH at the 5 end that means no G s are allowed You can add or change the constraints in the Parameters Sequence Constraints window There are 3 options oligos to use you may place the constraints on the 3 and or 5 ends of e Forward Primer e Reverse Primer e TaqMan Probe The search will find the primers with pre defined sequences and not add new template unmatching sequences to them Note the 4 sequence that can be controlled in the Sequence Constraints window Is e Molecular Beacon Probe but the sequence typed there is artificial and will not match the template main sequence 6 1 3 14 Restrict the Number of G Bases Subsearch This subsearch selects oligonucleotides with limited number of guanosine nucleotides Primers and probes will not have more G bases than the value specified in Parameters window by e Max of G Bases in a Primer Probe This is very important if the selected oligos are going to be multiplexed it significantly improves chances of finding compatible not dimer forming oligos Another reason to avoid several G bases in your primer is that this nucleotide gives usually most problems in synthesis therefore increasing
107. art Oligo open Human elF 4E seq and choose Search for a Sequence String strand 2 Type a degenerate sequence CAYNNNNRIG It s an Msl I recognition site and click the Find button String Search in strand Sequence String CAYNNNNRTG Allow QO mismatches v Translate ambiguous bases K GT M AC R AG S CG W AT Y CT B not A D not C H not G V not T INX any p 3 The results pop up in the Selected Bases window in the Strings column Click the last position 1813 You should see the following window aoe Selected Bases File Human lF 4E seq b String search results Loops Stems Palindromes Strings 18 13 17 T 12 16 a i 15 10 l4 9 11 8 10 7 oO 512 156 5 The pos 1813 is highlighted At the same time the Current Oligo pos 1813 is selected and you can see this in the Sequence window CATATATATG gt e eo o TGTGAACAGCATAAGTTTGGAGCACTAGTTTGATTATTATGTITATTACAATTTTTAATAAATTGAATAGGTAGTATCATATATATGGAAAAAABBAAAAAB AAA MAR AAAS ACACTTGTCGTATTCAAACCTCGTGATCAAACTAATAATACAAATAATGTIAAAAATTATITAACTTATCCATCATAGTATATATACCTITIT MITT TI TIT ITT TTT TI TIT The arrows point to pos 1813 marked in orange This position is at the beginning of a 10 bp long palindrome marked in green The palindrome itself was selected as the Upper Oligo shown above as the top sequence in red 203 5 2 Search for restriction enzyme sites Start Oligo open Human elF 4E seq and
108. ase From the Edit menu choose Add Set The lower part of the window changes and shows four edit boxes under Enter Record s 9 Enter to the Forward Primer box 9 and to Reverse enter 10 The Add button activates 10 Click the Add button followed by Show All button 11 You should see a new row added to the database If the window is not tall enough use the slider a dot separating individual oligo entries from sets and drag it up 12 Close the Database window without saving 189 3 Navigating in Oligo Note if you want to duplicate the results in the search examples open Human elF 4E seq for your sequence file 3 1 Moving around a sequence file After the registration described in the User Manual Chapter 2 3 you may open a sequence file or a database This example describes how to move around and what features are immediately available to you after opening a sequence file 1 Open a sequence file use File Open and in the Test sequences Folder choose Human elF 4E seq Click on the CDS row displayed at the top right of the window You should see the Sequence window as depicted on the figure below OOA Sequence File Human elF 4E seq DNA Sequence Selected Oligo Position Length Feature Location Sequence Length 1868 nt O Forward Primer l source 18 1850 Reading Frame 1 O Reverse Primer 2 CDS 1 651 Current Oligo Length 21 nt O Upper Oligo Position 18 O Lower Oligo ka P
109. atible Primer Pairs except that not two but three oligos are selected One of them is the TaqMan probe and as a default its melting temperature is 5 higher than that of the primers All three oligonucleotides are compatible with each other that is they do not form dimers at their 3 ends By default OLIGO will choose the probes that lack G residues at the two last 5 terminal bases This could be changed in the Sequence Constraints window of Search Parameters This search may be initiated with an already pre selected either probe or a primer pair and proceeds as the Search for PCR Primers The primers have to be compatible with the TaqMan probe and as a default their melting temperature is about 5 lower than that of the probe The newly found primer pairs or a probe are stored in memory as sets of three oligos two primers and the probe Molecular Beacons amp PCR Pairs This option searches for and selects optimal PCR primer pairs and Molecular Beacon probes This is essentially the same search as for PCR primer pairs but to the 3 and 5 ends of the probe two complementary hexamers not complementary to the probe sequence are added default is CGTCAC GTGACG The sequence of the complementary tails can be entered in the Sequence Constraints window of Search Parameters OLIGO searches for the probes that the other complementarities within the probes play no or minimal role on the overall hairpin loop stability Also the secondar
110. aved Work File 4 By choosing Format Protein and than choosing Human elF 4E ami you would open this protein file and automatically reverse translate it to DNA The default reverse translation method is Lathe choosing most probable codons for human proteins but if before opening a protein file you would Change Rev Translate Method to Degenerate you would end up with an entirely different DNA sequence this time a degenerate one Please try it 5 When you open a protein sequence file in a degenerate mode you ll see lots of degenerate nucleotide symbols in the Sequence window but the translation will not look exactly like the original amino acid file because some degenerate symbols would cover more than one amino acid kind Instead of arginine symbol R for example you will get low case r indicating that arginine is most likely but also that some other amino acid ma exist at certain position 6 Choose Melting Temperature Graph from the Analyze menu 7 Click at the graph A button and choose Degeneracy You should get this window e09 File Human elF 4E amilZ FL EQ lo e 651nt 21 mers Degeneracy pos 1356 Degeneracy 64 130 149 teow NNE eit HIGH 1 0E5 150 160 170 160 RAAYMGNTGGGCNYTNT GGT1 71 YAARAAYGAYAARWSNAARACNTGGCARGCNAAYY TNMGNYTNATH Baki Fatt 8 At this point the scale displays degeneracy Those numbers are usually high for a default size of Current Ol
111. ay find that an explanation applies to other functions as well 12 2 1 Getting Started can t start the OLIGO program When you install the OLIGO program you need to go through a registration process that identifies a workstation code for your computer Each computer has a separate workstation code For each workstation code you will need to contact NBI or one of our affiliates for an access code in order to start up OLIGO can t load a sequence file Check that your file is in a format that OLIGO can read Acceptable file formats include GenBank EMBL text and the formats included in most sequence analysis packages typically text lf your sequence analysis file won t open in OLIGO it probably contains incompatible characters A sequence interrupted with periods semicolons or other characters such as gt or are truncated and can t be loaded Remove these characters using any standard word processing package and save the file as plain text Note The character gt begins a comment line See the CPB SEQ file for an example of the proper format Comments should precede the sequence If your sequence file was created in a word processing program and won t open it may not have been saved as an text file Files saved as standard word processing files appear to have no illegal characters but may have hidden characters that prevent OLIGO from reading the file properly Try resaving the file as a text file 153 I
112. base chapter This command opens OLIGO database as a separate document and not as a sequence related document OLIGO accepts various text format databases The formats are shown in the four figures below 13 1994 X02513 6309L19 GGTTTTCCCAGTCACGACG gt 40 gt M13 40 Primer 13 1994 X02513 6290L17 GTAAAACGACGGCCAGT 20 univ M13 20 Primer 13 1994 X02513 6209U16 AACAGCTATGACCATG reverse M13 Reverse Primer 1994 X52330 670U17 gt CGAGGTCGACGGTATCG KS KS Primer 13 1994 X52330 720L17 gt TCTAGAACTAGTGGATC SK SK Primer 12 1994 X52330 774L17 gt ATTAACCCTCACTAAAG T3 alt T3 alt Primer NU e WNP on aynan he UJ Figure 3 3 3 1 OLIGO 6 database format Nonprintable characters are shown as arrows tabs and dots spaces GGTTTTCCCAGTCACGACG GTAAAACGACGGCCAGT AACAGCTATGACCATG CGAGGTCGACGGTATCG TCTAGAACTAGTGGATC ATTAACCCTCACTAAAG Figure 3 3 3 2 The plain format file Each oligo sequence is in one line gt M13 40 Primer X02513 6309L19 GGTTTTCCCAGTCACGACG gt M13 20 Primer GTAAAACGACGGCCAGT3 gt M13 Reverse Primer AACAGCTATGACCATG gt KS Primer CGAGGTCGACGGTATCG gt SK Primer TCTAGAACTAGTGGATC gt X52330 774L17 T3 alt Primer ATTAACCCTCACTAAAG Figure 3 3 3 3 AutoDimer software format file Each entry takes two lines The top one is the description and the second is the primer sequence 33 Oligonucleotide Database VER 1 1 X 7 13 1994 X02513 6309L19 GGTTTTCCCAGTCACGACG gt 40 gt M13 40 Primer 2
113. bes Hardware and Software Configurations Files Present With the OLIGO Program New Features and Enhancements Information About OLIGO 10 12 1 Information About OLIGO 1 1 Copyright License Agreements Warranty Copy Protection amp Technical Support OLIGO is a copyrighted software program As an OLIGO user you are obligated to abide by the following license agreement 1 1 1 Copyright The OLIGO software copyright is owned by Wojciech Rychlik Molecular Biology Insights Inc is a manufacturer and primary distributor of the software All copyrights are protected under the US Copyright Law and International Treaty provisions Therefore you may not copy or reproduce the software its documentation or other package components with the exceptions noted under the specific licenses By abiding by this contract you agree not to reverse engineer decompile disassemble or otherwise attempt to discover the source code of the software 1 1 2 Single user License The single user license is intended for one principal investigator s use in his her laboratory or other research environment The single user license allows for two copies of the program in the lab or office computers Each additional computer license needs to be purchased separately and the standard single user license may be expanded to maximum of 4 computers For every one computer license the copyright owner permits one additional home computer installation The
114. ble click on a pair to view the PCR window for the selected pair 10 Choose the primers from the Analyze Key Info menu or other Analyze menu windows to view the primer sequence and or related data 4 2 Searching for PCR primers an example to show the options 1 Choose the Primers and Probes option from the Search menu 2 Verify that the Compatible Pairs button under PCR Primers in the dialog box is checked 3 Click the Parameters button At this point you see the General Parameters as indicated at the top of the window adn Search Parameters Parameters Sequence Constraints Scores General Constraints More Constraints This will let you change the search stringency globally change sequence frequency table and salt and primers concentration in the reaction mix By default the stringency search is set to High If you experience a long search time you may shorten the search by starting froma lower stringency type Otherwise Oligo will reduce the stringency automatically if needed as long as the Automatically change stringency box is checked Search Stringency High H f wi Automatically change stringency 4 Choose the Fair search stringency 5 Check the Constraints and More Constraints options Each sub search option that will be active for a given search method has a blue dot on the left The irrelevant sub searches have no blue dots To the right of this dot you should see an
115. c parameters 1 Calculations of melting temperature Tm according to the nearest neighbor method is complicated and therefore not practically determined without computer software A duplex stability measure of similar accuracy however may be achieved by a simpler method by calculating the free energy of duplex formation See Table 1 in Appendix D Theories and Formulas Used in the OLIGO Program Internal Stability Primers that are stable at their 5 termini but somewhat unstable on their 3 ends perform best in sequencing and PCR reactions This primer structure greatly ACTTGG GATT GGGCT TCCGG TTCGA CAGTCGCC G O lt lt G1 P G2 CCG GCGCAGAAGCGGCATCAGCAAA CAGCGCCA CATACATCAT Figure B 1 Internal Stability Graph Primers B1 and B2 are poorly functioning Primers G1 and G2 are efficient sequencing primers Primers G1 and G2 perform better than average with almost any other compatible primer in PCR The G values were calculated for all pentamers in each primer The last symbol in each inset represents the amp G value of the 3 terminal pentamer reduces false priming on unknown sample sequence These findings based on primer internal stability are supported by the experimental data presented in Figure B 1 Internal Stability Graph A primer with low stability on its 3 end will function well in PCR because the base pairings at and near the 3 end with non target sites are not sufficiently stable to
116. cated in the Oligo 7 folder i Test sequences subfolder Oligo example database is in Oligo 7 folder universal primers odb 2 1 Open a sequence file Oligo opens variety of file types such as DNA RNA protein sequences and databases 1 Choose File Open from the File menu 2 Navigate to the Test sequences folder by clicking at the bar displayed at the top of the window 3 At he bottom of this window you may choose a file format available to you The default is Nucleic Acid so that the DNA and RNA sequence files can be opened instantly by clicking on the Open button However when you click on the Nucleic Acid pull down menu you would get this ANOO Open File C Test sequences H4 Y DEVICES O FreqSeq y cbp odb r HD1T jj Frequencies F Chicken elF 4E seq E HD 1T libOligoLibrary jnilib Chimpanzee elF 4E seq Y PLACES 2 Oligo 7 app Chimpanzee elF 4E seq ee be oligo_7_ma nual pdf gt Cow eF 4E seq oligo_7_tutorial pdf Database 6 odb oS we D Tables Dictyosteli elF 4E seq Applications Jj Test sequences Human elF 4E gene seq ba Utilities universal primers odb Human elF 4E seq ER E ji Documents M13MP18 seq Kind Nucleic Acid J Files gt masa seq Size 2 KB J Photos Mouse elF 4E seq 7 1 997 bytes v Ga PikesPeakPhoto NewDatabase odb Modified 8 14 08 8 26AM Previewer OLIGO sequence data VER 1 ACCESSION NM_174310 FEATURES Location Qu
117. ce Using the mouse point the cursor to the position you want and click OLIGO automatically shifts the graph on both windows and displays updated information Besides changing positions with the mouse the following keys on your keyboard are active in the mentioned above windows e Right Arrow move the Current Oligo one position forward e Left Arrow move the Current Oligo one position backward e Up Arrow move the Current Oligo 3 positions forward e Down Arrow move the Current Oligo 3 positions backward e Page Up move the Current Oligo one screen forward e Page Down move the Current Oligo one screen backward 109 e Use short cut key Mac lt K gt Win lt Ctrl K gt e Click on any row in the Analyze Selected Oligonucleotides table e Click on any row in the Search Selected Bases table When browsing the active sequence for a New Current Oligo Position it is helpful to first call up Current Oligo from the Analyze Key Info menu or relevant analysis windows A amp O Current Oligo Position Position number 451 Acceptable range 18 to 1832 Cancel Figure 7 5 The Current Oligo Position window 110 Change Current Oligo Length Change DNA to RNA Change Search Ranges Change Search Parameters Change CG of the Unknown Fragment Change Reading Frame Change Rev Translate Method Change Codon Table The OLIGO Change Menu 112 113 113 115 123 123 124 125 111 8 The OLIGO
118. ceive the access code for your OLIGO program if you cannot use internet 1 1 9 Technical Support Technical support is available to registered users For the assistance please contact your OLIGO distributor for technical support When you request technical support have the following information available or include it on your fax or E mail e Your name e Name of the licensed end user if different e Institution e OLIGO license number The software updates may be downloaded from MBI web page www oligo net by using Oligo Help menu option This service is free of charge MBI is the manufacturer of Oligo and you may contact the company with regards to technical help 1 2 Essential Criteria for Optimal PCR Primers Sequencing Primers and Hybridization Probes OLIGO is a multi functional program that searches for and selects oligonucleotides from a sequence file for polymerase chain reaction PCR DNA sequencing site directed mutagenesis and various hybridization applications It calculates hybridization melting temperatures and secondary structure of oligonucleotides based on the nearest neighbor thermodynamic values Ref 1 2 5 Oligo also searches for restriction enzyme sites analyzes open reading frames and more Oligo 7 citation recommendation is the reference number 26 There are three essential criteria for optimal PCR sequencing primers and for optimal hybridization probes 1 2 1 Specificity Primers and prob
119. ch ranges 113 strands 51 positions on the active sequence 162 Choosing a specific position 26 109 Close 34 45 Codon Table change 53 125 Compatible pairs search 88 Composition and Tm analyze 63 Computer requirements 9 Concentrations analyze 82 Copy database record 139 file Save as 35 36 protection 7 18 Crash system 154 Current Oligo change length 112 composition and Tm 63 defined 162 duplex formation 60 go to 26 109 hairpin formation 63 Cut 78 79 101 Database analyze functions 141 edit 138 export functions 143 import functions 143 link sequence file with 141 new 31 141 new record add 140 open 31 save 36 38 save as 36 Definitions used in OLIGO 162 glossary 162 Degeneracy definition 162 display 73 selecting 73 symbols 174 Deselect multiplex 142 DG acceptable 3 dimer 118 136 database field 136 defined 163 graphics 13 loop 24 25 61 63 terminal stability 94 167 Dimer acceptable 3 61 118 effect on PCR 167 Discard and close 65 DNA to RNA change 51 113 Duplex formation analyze 60 Current Oligo 61 primers 61 Duplex vs dimer 163 Edit entire sequence 44 features 54 full screen 48 menu 44 mutagenesis 49 Primer or Oligo 44 49 protein 50 restore 54 reverse translate 53 Entire Sequence analyze concentrations 82 composition and Tm 63 edit 44 reverse translate 53 False priming analyze false priming sites 64 Continue false priming search in other files 98 defined
120. choose Search for Restriction Sites option Click the Select Enzyme Database The files are located in the Tables sub folder Click the 5 amp UP ENZ file containing most 5 cutters and higher and the Select button Choose Linear sequence and click the Search button You should see the results in the Restriction Enzyme Sites Analyze window O Restriction Enzyme Sites File Human elF 4E seq IS SNS Enzyme ji a 3u jbo bo Ara p0 So auo 1600 1100 1200 1400 1400 1500 100 1700 68 Mph11031 69 Msel To TA Hi y 70 Msil 71 Mval269 72 Nsil 73 Ppul0l 74 Pvul 75 Sau96l 76 Sdul 77 SfaNl i 78 Sfcl i 79 Spel om cet I Enzyme Site Cuts Positions amp Fragment Sizes ell LFau DOW 70 Mell CAYNNANNRTG 6 415 398 368 766 136 902 383 1285 132 1417 396 1813 37 7l Mval269 GAATGC 1 1 1 1331 1314 536 72 Nsil ATGCAAT 2 1097 1080 290 1370 480 73 Pouldl AATGCAT 2 1097 1080 290 1370 480 74 Pyul COAT4CG 1 395 378 1472 75 Sau96l GAGNCC 1 934 917 933 p 76 Sdul GDGCH4C 3 145 126 90 218 1537 1755 95 7 SfaNl GCATC S 9 1 1096 1079 771 78 5fcl CATRYAG 3 64 47 66 115 317 432 1418 7 Search Entire Sequence Linear Restriction Enzyme Database 5 amp UP ENZ This window consists of two parts The top one is a graphical representation the entire row represents the length of the sequence file and the blue vertical lines are the recognition sit
121. cond and following computers you need to complete the same registration process each time Note If you ever need to re load OLIGO write this message to the Comments field 2 3 2 Multi user and Network License Registration Each OLIGO owner under a multi user license or IT manager under a network license must register by following the instructions described in chapter 2 3 1 2 4 The OLIGO Main Menu Oligo File Edit Analyze Search Select Change View Window Help At first the main menu of OLIGO displays only the menu bar at the top of the screen until you load a sequence file or enter one using the File New command Once you load or enter a file the OLIGO Sequence screen appears To call up menu items on any of OLIGO s screens pull down the menu using the mouse You may also use the shortcut keys The shortcut keys are displayed to the right of the command it represents in the menu As you use the OLIGO program there are some features that are available at a given time and others that are not OLIGO uses the standard System convention of graying out items that cannot be accessed on that particular screen or at that particular time For information on when a menu item or option is available refer to the individual item descriptions in this manual 2 4 1 Main Menu Oligo The Application Name menu Oligo located between the Apple and File menus displayed only in the Mac contains the following items About Oligo Preferenc
122. controlled by the e Min GC Clamp Stability 94 setting in the Search Parameters window 6 1 3 7 Oligonucleotides Within Selected Tm Limits Subsearch This subsearch selects oligonucleotides with Tms that fall within the default values set by OLIGO or values you have entered in the Search Parameters window e Primer Tm Range OLIGO settings are based on the premise that optimal PCR primers should have moderate Tms and optimal sequencing primers and hybridization probes should have high Tms The program sets the following default stability values for the various primer probe searches when the search stringency is set to Very high PCR Primer Pairs Between the 40th percentile to the 75th aqMan amp Beacons Searches percentile of the range between the lowest and he highest Tm oligos percentile percentile When the search stringency setting is reduced these default ranges are progressively broadened The actual upper and lower stability Tm thresholds are displayed as a grayish block between dotted lines on the Tm window graph 6 1 3 8 Hairpin free Oligonucleotides Subsearch The Hairpin free Oligonucleotides subsearch selects _hairpin free oligonucleotides from the active sequence It is active in the default configuration for all the primer probe automated searches This subsearch is controlled by the e Min Acceptable Loop G setting in the More Parameters window 6 1 3 9 Eliminate Mono and Di Nucl
123. d The score makes the primer selection easier especially if there are many oligos to choose from instead of looking at several parameters individually you may sort the results by this number and see the top scoring oligos instantly Note certain applications require different scoring systems as some parameters are more important than others used for standard sequencing purposes for example You may rely on this scoring system only if searching for generic primers or probes If your oligos are to be used in specialized assays where the other factors count more than in standard settings then you d either don t need to pay attention to the actual scores or re define the scoring system This is the only reason why this feature was not implemented in earlier OLIGO versions The Parameters settings are essential because the search outcome depends on them It is therefore very important to fully understand the meaning of each 115 default value before you attempt to improve it A powerful method of changing the search outcome is to change the scoring system Another simple way to influence the search results is to remove or add non default subsearches in the Search for Primers and Probes windows At the bottom of the window you will find the currently set Search Method the parameters are for This is important as the default parameters are different for different types of searches Changing the search method in the Search for Primers am
124. d The sequence frequency is a relative number and does not represent absolute number of hits in a given database It is normalized such that frequency of 1000 is the average frequency for a given 6 or mer Sequences below this number are less frequent The actual formula is the following of Hits x 1000 x 4096 Table size number of analyzed 6 mers in a database The search parameter controlling this function called e Frequency Threshold Oligos with 3 ends above this threshold are rejected By choosing oligos of which 3 ends are infrequent in a given database you are decreasing chances of selecting a primer that primes in several sites on a complex substrate such as genomic DNA or in other words you are decreasing chances of unspecific PCR You may create your own frequency tables including FR8 for 8 mers files by using Sequence Frequency Calculator available with appropriate instructions from the http oligo net downloads html page 6 1 3 12 Omit High Secondary Structure Regions in the Template Subsearch This subsearch checks for hairpins the entire potential PCR template and rejects those sequence regions from amplification that contain strong secondary structure There are two search parameters controlling this subsearch e Template Loop G Threshold Template Loop Window Size The hairpin loops are detected only within the specified sequence length called here the Window Size These parameters are in the More P
125. d in Analyze Duplex Formation section The database window is in a table format Each row represents one database record Each column gives the following information the check uncheck status the sequential number of the record its ID number oligonucleotide sequence 3 dimer data showing either the AG value of self dimerization or the value between the most incompatible primer after the manual multiplexing is performed priming efficiency P E and the melting temperature of each oligo in four columns The first from left P E and Tm columns show the actual values as if those oligos would have been annealed to the linked sequence file with the dangling ends and mismatches considered The numbers in the second P E and Tm columns indicate what those values are when annealed to the perfectly matching complementary strand of the same length Because sometimes dangling ends increase duplex stability the Tms in the first column may be higher than the perfect match with its complement labeled as tm There are two more columns not displayed by default Reference and Comments where you may 134 manually enter any relevant information about the oligo These columns could be introduced through the Database Options from the Change menu The database provides for fully automatic multiplexing The multiplexing is performed on all oligos in the database and OLIGO selects compatible groups Within each single group all oligos are compat
126. d that meet or exceed the search stringency when the Automatically change stringency box is checked Your search stringency setting is then gradually reduced by the program 8 4 1 2 Automatically Change Stringency The Automatically Change Stringency option when active enables the OLIGO program to automatically reduce the selected search stringency setting to the next lower stringency level if no primers primer pairs or probes pass through all the selection filters of the search Initially OLIGO changes only those parameters which eliminate most potential primers When primers are found this way the stringency setting is called Customized lf no primers are found the message No matches found appears At this time it is a good idea to review the Primers amp Probes Search Data Search menu to determine what sub search eliminated most oligos and then perform one of the following e Broaden the search range settings e Select a different region of the active sequence to search e Deactivate one or more of the subsearches e Change specific search parameters that eliminate most oligos The Automatically Change Stringency option can be disabled for any individual search parameter by using the search parameter locking feature Clicking the lock icon adjacent to a given search parameter keeps that value unchanged throughout the search This gives you more control over the search process in oligonucleotide selection The Automat
127. d to make the Register button active The Fax number should be entered only to get the Print button active Leave the Access Code field blank 8 0 OLIGO 7 Customer Registration Welcome to OLIGO 7 Primer Analysis Software In order to protect your program license and provide you with prompt technical support please complete this customer registration form and click Register button If you are not connected to the Internet please Print and fax this form to 1 719 684 7989 After this you may Exit Oligo and when you receive the Access Code back from us you may re start Oligo enter the Code and click the Confirm Code button The registration would then be completed for this particular computer Principal Investigator or Manager s Name Institution and Department Address Phone Number Ext Fax Number E Mail Comments License Workstation Code Access Code 9703 9775 2346 Print Setup Exit The OLIGO Customer Registration window Note Your software license number is on the OLIGO CD User Manual or and in the e mail conformation of the purchase 3 When you enter the license number the Register button should become active as shown below 185 Principal Investigator or Manager s Name license and provide you with prompt technical support please complete this customer registration form and click Register button If you are not connected to the I
128. des This value can be changed Defaults Cancel within the Parameters tab of the Preferences window as shown below All opened documents and vi Save as default Long sequence analysis Analyze entire sequences up to 250 K bp Figure 3 13 2 1 The Preferences dialog Parameters tab Windows version If the sequence file is longer than this number Oligo opens a dialog window before loading the sequence and asks to choose the relevant fragment for analysis as depicted on Fig 3 13 2 2 This window shows the sequence features so you can easier decide on your fragment choice Enter the sequence positions to be loaded to Oligo and do not exceed the Analyze entire sequences up to xyz K bp number 40 OQ Choose Sequence Fragment Figure 3 13 2 2 Choose Sequence Fragment Sequence length 8576922 nt dialog window The sequence exceeds 100K bp Please choose part of it for analysis Inn Location The Windows dialog shown on Fig ro hihi Ae 3 13 2 3 permits you to save size and aM bee ed eer position of selected OLIGO windows Dee eaeenre eee When the Save size and position ee box is checked the positions and mRNA complement join 23877 23941 24026 24227 25013 25 Y sizes of all windows are recorded during program exit and recalled in subsequent OLIGO sessions Default Cancel Open window s that are displayed at the program start up may be changed using the Add Remove button
129. displayed in upper case letters and in lower case when they mismatch the active sequence 2 5 4 Keyboard Support Besides changing positions with the mouse the following keys on your keyboard are active in the Sequence window e Right Arrow move the Current Oligo one position forward e Left Arrow move the Current Oligo one position backward e Up Arrow move the Current Oligo 3 positions forward e Down Arrow move the Current Oligo 3 positions backward e Page Up move the Current Oligo one screen forward e Page Down move the Current Oligo one screen backward e Space Bar center the Current Oligo on the window The menu short cut keys described below are also available 2 6 OLIGO Short Cut Keys You can use OLIGO keyboard interface Here is a listing of available accelerator keys in the OLIGO program and where these keys may be used 2 6 1 File Menu The following keys are available from the File menu Command PC Windows Macintosh New Sequence Ctrl N d6 N New Database Cirl 7S N M N Open Ctrl O d6 O Close document Ctrl W M W Close Window Ctrl W 36 W Print Ctrl P 36 P Quit Oligo Ctrl Q 36 Q Save Data Ctrl 48 S d6 S Save Sequence Ctrl S d6 S A Shift 25 2 6 2 Select Menu The following keys are available from the Select menu Command PC Windows Forward Primer Ctrl U Reverse Primer Ctrl L Upper Oligo Ctrl U Lower Oligo Cirl 48 L New Current Oligo Position Ctrl K 2 6 3 Change Menu The fo
130. e Open File Open Recent File Close and File Close Window File Save File Revert to Previous Sequence Database File Print File Print Preview File Page Setup File Print Save Options File Reset File Exit and the Application Menu The OLIGO File Menu 29 3 The OLIGO File Menu The File menu is used to e Create new sequence files and databases e Open DNA RNA protein sequence and database files e Import saved search results to the opened sequence e Save and print e Reset data and parameters e Open recently closed sequence database files e Check for and download newer OLIGO versions from the web Note You must open an existing file or create a new file before you can access most of the options from the Edit Search Select and Analyze menus on the main menu bar ma 8 8 FSt New Sequence N New Database SEN c Open 0 Data 25 Open Recent b Data As E Sequence 5S Close LAMBDA SEQ TEW Sequence as Close Window W Forward Primer Save gt Reverse Primer Upper Oligo amp Print 36 P Lower Oligo Print Preview Search Results Print Setup Print Save Options Data Reset gt Original Defaults Figure 3 0 The OLIGO File menu 3 1 File New Sequence The File New Sequence command opens the New Sequence window and activates the text editor for keyboard entry Once a new active sequence is entered you may accept it by choosing Accept amp
131. e sets The sets are created during the search for PCR primer pairs or the TaqMan probes a AA Selected Oligonucleotides File CBP seq Forward Primers HH 317 Dliga Score 4 Pentamer GC Clamp i Position iiaii Tm AG AG 119 1139 19 563 65 1 6 6 8 3 p 120 116 19 561 66 6 7 5 8 4 H 121 1565 o4 B61 65 6 5 7 7 4 Q L22 115 20 659 65 9 7 5 8 4 1 l23 801 el a59 66 7 0 1 8 7 Primer P E ta PC Degeneracy File 1 1565F24 CAGTCCCATTCATATTAAGACAGT 453 453 54 5 1 File 2 1654F24 CGGTCCCATTCATATTAAGACAGT 432 464 66 6 1 File 3 1560F24 CGGTOCCATCCATATTAAGACAGT 390 471 68 3 l File 4 1542F24 CNGTCTCATTCATATTAAGACAGT 394 444 62 1 4 File 5 1LS586F24 CGGTCCCATCCATATTAAGACAGT i290 4 1 58 3 l Consensus 5 CNGTCYCATYCATATTAAGACAGT 390 453 52 1 68 3 16 Analyzed files 1 CBP seq 2 Dog 4E seq 3 Mouse 4E seq 4 Rabbit 4E seq 5 Rat 4E seq Figure 5 7 The Selected Oligos window showing consensus primers Although PCR primer search data can be displayed using this option the window is primarily for displaying sequencing primer and hybridization probe search data Accordingly the data table lists Tm of the oligo the 3 terminal pentamer G specificity and GC clamp G stability the most stable pentamer in the oligo associated with each oligonucleotide starting at Forward Upper or ending with Reverse Lower the displayed position If you ve searched for consensus primers or probes you may pull down the window separator to r
132. earch If the frequency of all sub sequences 6 or 7 mers would be identical than each 6 mer sub sequence would have frequency of 1000 Sub sequences less abundant than average have lower numbers than 1000 More on this subject is described in Chapter 5 13 8 4 2 20 Template Loop AG Threshold OLIGO checks the template for strong secondary structure If the primer extension would have to go through those structures the entire PCR pair is rejected from results This applies to the template only and not to the sequence of the actual primers Used by the Omit High Secondary Structure Regions in the Template sub search Those regions are displayed on the Sequence window as dark red lines and listed in Selected Bases window Search menu in row A 8 4 2 21 Template Loop Window Size The sub search for hairpin loops in a template does not use Current Oligo length as the maximum size of the loop stem structure Instead it uses the value of this parameter This and the previous parameter are used by the Omit High Secondary Structure Regions in the Template sub search 121 8 4 2 22 Max of G Bases in a Primer Probe OLIGO will eliminate all primers or probes that have more than this number of guanosine residues if the Restrict the Number of G Bases sub search is turned on This helps in finding primers or probes of a less secondary structure especially when multiplexing is considered down the road 8 4 2 23 Frequency
133. ecently used search parameters e Preferences a file containing user settings accessible through the Preferences menu e RecentFiles a file containing recent files opened with Oligo e Windows a file containing information on the window sizes and positions e FileSets Folder containing file sets used for certain types of searches unique consensus and batch There may be other Oligo files present on your computer but they are not created by Oligo only by the operating system itself 1 5 New Features and Enhancements Oligo 7 has been re written from scratch to make it fully compatible with ever changing operating systems Most of the source code is written in Java and processor intensive sections were written for specific hardware to maximize speed of calculations Compared to the version 6 OLIGO 7 has several changes The major enhancements are listed below 1 5 1 New interface Starting up the program shows only one but more informative window The Tm graph shows the entire sequence Position of up to 4 previously 2 oligos is graphically displayed This window also displays primers Tm PCR product strong loops in DNA RNA template potential loops in oligos palindromes features read from annotations and other data 1 5 2 New thermodynamic parameters Oligo 7 implements unified nearest neighbor thermodynamics assembled by John SantaLucia 1 2 Values for single mismatches and dangling ends are incorporated T
134. elects oligos without internal repeats e Detect Sequence Repeats selects oligos without other repeats than the above option e Eliminate Homologous Probes those that may anneal to more sites on the DNA For consensus probes it checks the homology not the priming efficiency The default stability Tm setting is high for the hybridization probe search The stability maximum is not limited and the stability minimum decreases along with the stringency settings SIRNA Probes This search finds RNA oligonucleotides that have certain pentamer stability ratios between 3 and 5 ends and the internal 12 nucleotide segment of the probe essentially as described by Khvorova et al 22 and are relatively hairpin free This search is available only when the main sequence is RNA If you re working on a DNA file use Change DNA to RNA option before attempting this search The following sub searches are used to find the siRNA 19 mers e Eliminate Ambiguous Bases by default selects non degenerate primers e Duplex free Oligonucleotides selects primers free of significant dimers e Highly Specific Oligonucleotides 3 end Stability selects moderately stable 3 ends 92 e 5 end Stability e SIRNA Internal Stability e Hairpin free Oligonucleotides e Eliminate Mono and Di Nucleotide Repeats selects oligos without internal repeats e Detect Sequence Repeats selects oligos without other repeats than the above option 6 1 3 Prim
135. emperature Graph window All 8 different values may be displayed there including actual Tm with dangling ends and mismatches G degeneracy etc Scale Bar Forward Primer Upper Oligo Cursor Position Cursor Position Data Lower Oligo Current Oligo Reverse Primer ATCGATCTAAGATGGCGAC GCGACTGTCGAACCGGAAA CGATCAGATOGATCTAAGATGGCGACTGTCGAACCGGAAACCACCCCTACTCCTAATOCCOCGACTACAGAAGAGGAGASAACGGAATCTAATCAGGAGGATGCTAACCCAGAACACTATATTAA GCTAGTCTAGCTAGATTCTACCGCTGACAGCTTGGCCTTTGGTGGGGATGAGGATTAGGGGGCTGATGTCTICICCTCTTITIGOOTTAGATTAGTCCTCCABCGATTGGGTCTTGTGATATAATT TGOLTTAGATTAGTCCTCC ACGATTGGGTCTTGTGATA RS OR S K A T VE P ETT PiTP A P PTTee K TES WH QE VAP EH YT RK Palindrome Selected Feature Hairpin Loop in the Template Weak Hairpins tn the Oligos Translated Sequence Search for a String Results i 2 Figure 2 5 3 The OLIGO Sequence window zoom in area From the scale bar down is the zoom in area Below the scale bar are the rows for Forward Primer Upper Oligo original sequence as saved in the file its 24 complement Lower Oligo and the Reverse Primer Below these there is the protein sequence translated from the DNA RNA active sequence in the selected reading frame set in Change Reading Frame Tm window sub menu or from the ORF window followed by the sequence secondary structure and features in the same order as in the zoomed out area as shown on the figure 2 5 3 Sequences of the selected oligos are normally
136. ems are located in the Windows Files menu and Macintosh s Application menu 42 4 The OLIGO Edit Menu Edit Sequence Primers Oligos Edit Window Menu Accept Discard Edit Window Menu Edit Edit Window Menu Search Edit Window Menu Change l Edit Window Menu Reverse Translate Edit Restore Edit Features Edit Preferences 43 4 The OLIGO Edit Menu The Edit menu on the main menu bar allows you to change nucleic acid sequences and add delete sequence features Entire Sequence Forward Primer Reverse Primer Upper Oligo Forward Primer Lower Oligo Reverse Primer Upper Oligo Restore Lower Oligo Features Figure 4 0 The Edit menu The entire menu is shown on Fig 4 0 4 1 Edit Sequence Primers Oligos This section describes editing the entire sequence forward and reverse primers and upper and Lower Oligos There are two kinds Edit sequence windows For editing primers or probes the default is the mutagenesis window and for editing the entire sequence the default is the full screen edit window You may edit entire sequence as well as single oligos in either window Each Edit window contains its own menu You select the mode in which you wish to edit from the Edit window Edit menu Below is the description of the Edit window menu 4 1 1 Edit Window Menu Accept Discard The Accept Discard menu is where you decide the disposition of your changes to the edited sequence 44 eee
137. engths are not changed following the change in the Current Oligo length setting Therefore oligonucleotides of different lengths can be searched for and analyzed Note Several analysis features are inactive when the oligo length is set above 200 bases 8 2 Change DNA to RNA The DNA to RNA command changes the active sequence from a DNA sequence to RNA and vice versa All calculations including molecular weight melting temperatures and absorbtion values are changed accordingly When the sequence is RNA G U pairings are displayed Note This option changes the active sequence only in memory There is no effect on the sequence file unless it is saved after the change using the Save Sequence command from the File menu DNA RNA hybrid Tms are calculated either as DNA DNA or RNA RNA in the Composition amp Tm window 8 3 Change Search Ranges Using the Search Ranges dialog box you can set the range of searches to be run on the active sequence and the length of PCR products to be selected for in the various PCR searches In the default configuration searches are conducted over the entire length of the active sequence However you can set any beginning and or ending nucleotide position in either or both strands to limit the searches Note that where a search is actually conducted positive strand negative strand or both it is controlled by the check boxes at the top of the search for Primers and Probes window The PCR prod
138. ense strand of a siRNA probe Check the Internal Stability window Analyze Internal Stability Lower Oligo It should like similar to this one Lower Oligo Internal Stability File Human elF 4E seq K 19nt F end 92 pos 11 Ag 10 0 14 0 13 0 12 0 11 0 10 0 a 9 0 oO 8 0 A 704 g 18 6 0 l aa 5 0 3 The negative strand probe always a 19 mer should start from a pentamer of 7 5 kcal mol or so its 3 end should be slightly more stable than 5 end the internal 12 mer stability should be about 22 kcal mol should not form significant internal hairpin loops should not have sequence repeats and should be as unique as standard hybridization probes 9 Add manually TT or attach dinucleotides corresponding to the original mRNA to the 3 ends of 4 OoakkWND the oligos use Edit Upper Lower Oligo options The dTdT is preferred for a better probe stability 8 Searching multiple files batch processing Start Oligo and choose Search Sequence files Select files choose the entire Test sequences folder Choose the Method of search Hybridization Probes Click the Ranges button and check the Choose hybridization probes every 1000 bp Click OK and another OK to get back to the Batch Processing window Click the Search button Before Oligo starts searching it asks you for a file name for the results data Default is BatchResults txt
139. eotide Repeats Subsearch This subsearch checks for oligos with strings of the same nucleotide AAAAA for example or strings of dinucleotide repeats CGCGCGCG for example and eliminates these from the selection process Oligos with nucleotide repeats may not align correctly on the intended target causing subsequent deletions or insertions Also such sequences frequently occur and thus are more likely to false prime There are two search parameters controlling this subsearch e Max of Mono Nucleotide Repeats e Max of Di Nucleotide Repeats 95 Oligonucleotides with more repeats than these parameters are eliminated 6 1 3 10 Detect Sequence Repeats Subsearch This subsearch checks for any repetitive strings longer than 2 nt Longer repetitive stretches contribute in false priming This subsearch is focusing on relatively short repeats that false priming sites search may miss The search parameter is called e Max Length of Repeated Sequence and the default is 5 nt 6 1 3 11 Eliminate Frequent Oligonucleotides Subsearch This subsearch eliminates oligonucleotides having too common 3 ends the last 6 7 or 8 nucleotides which occur in a subset of GenBank for the species you are working on The user selected frequency tables located in the Frequencies folder contain normalized frequencies of either 6 FR6 or 7 mers FR7 of GenBank sequences The header of each frequency file describes in detail how each table was create
140. eotides are treated as dT dG 20 8 27 8 26 6 12 9 dT 23 9 20 8 17 3 24 0 A C 18 4 26 2 27 8 29 7 35 5 34 9 22 6 35 5 10 8 G 19 2 19 4 29 7 27 8 U 15 5 19 2 26 2 18 4 Table 4 Enthalpy values of a nearest neighbor nucleotide in kcal mol from Ref 1 and 2 Second Nucleotide dA dC gt First Nucleotide dAorA 9 1 6 5 dC orC 5 8 11 0 dGorG 5 6 11 1 dT or U 6 0 5 6 dG 7 8 11 9 11 0 5 8 dT 8 6 7 8 6 5 9 1 A 6 6 10 5 13 3 8 1 l Not listed nucleotides are treated as dT AHini 0 C 10 2 12 2 14 2 13 3 G 17 6 8 0 12 2 10 5 U 5 7 7 6 10 2 6 6 Table 5 Extinction coefficient values gt in A260 units umol from Ref 11 Second Nucleotide dA dC First Nucleotide dA 13 7 10 dC 10 6 Fag dG 126 8 8 dT 11 7 8 1 dl 9 3 7 1 dN1 12 1 8 7 A C A 13 7 10 C 10 5 7 1 G 12 6 8 7 U 12 3 8 6 9 3 7 1 N 12 1 8 7 dA 15 4 dT 8 7 dC 7 4 dl 7 2 dG 11 5 dN 10 T Not listed nucleotides are treated as dN 174 dG 12 5 10 8 10 0 9 4 QOP dT dl dN 12 2 10 5 10 2 9 9 9 9 11 0 Nearest neighbor method X ABCDE 2 X AB BC XCD DE XB XC YD Table 6 Molecular weight M values used by OLIGO A 329 21 dA 313 21 C 305 19 dC 289 19 G 345 21 dG 329 21 U 306 17 dT 304 20 330 20 dl 314 20 N 321 44 dN 308 95 M ABCDE M A MB M C M D M E 18 02 for H20 Table 7
141. eotides with GC Clamp 91 810 Free Mg 2 Concentration 0 7 mM Highly Specific Oligonucleotides 3 end Stability 435 36 7 Total Na Equivalent 155 8 mM Eliminate Mono and Di Nucleotide Repeats 412 350 Nucleic Acid Concentration 200 0 nM Detect Sequence Repeats 407 347 Temperature for AG Calculations 25 0 C Hairpin free Oligonucleotides 295 229 Duplex free Oligonucleotides 215 182 Search Ranges Check Primers Probe Sequence Constraints 215 182 Positive strand search range 1to 651 Eliminate False Priming Oligonucleotides 215 182 Negative strand search range Lto 651 Consensus Primers 18 1 Conditions for Upper and Lower Oligos Total Oligo Checked 3103 3108 Primer Length 19 to 23 Total Oligos Accepted 6 6 Acceptable 3 Dimer AG 2 5 kcal mol eer Strongest Dimer Overall AG 7 5 kcal mol Files Searched for Consensus Primers 3 terminal Stability Range 7 2 0 8 kcal mol File Oligos Accepted Oligos Rejected Min GC Clamp Stability 7 7 kcal mol Chicken elF 4E seq 43 159 Min Acceptable Loop AG 0 3 kecal mol Chimpanzee elF 4E seq 4 1 Primer Tm Range 59 3 3 0 C Cow elF 4E seq 32 10 Max Acceptable False Priming Efficiency 190 points Mouse elF 4E seq 30 2 Min Consensus Priming Efficiency 380 points Rabbit elF 4E seq 30 0 Max of Mono Nucleotide Repeats 3 nt Rat elF 4E seq 30 D Max of Di Nucleotide Repeats 2 At Total 207 172 Max Length of Repeated Sequence 5 nt Max Degeneracy 1 variant
142. equence area in the form of hat cannot misalign Repeat Checks Select only insertions or deletions Hybridization jon the active oligonucleotides which do not Sequence contain strings of the same nucleotide or sequence repeats 158 12 4 OLIGO Technical Support Your OLIGO software supplier provides technical support for all its software products and research services In order to obtain technical support for software you must be the licensed user or work for the licensed user Complete the OLIGO installation and customer registration procedures to register your OLIGO program 12 4 1 Seeking Help Use the standard Windows help feature If you still need assistance contact your MBI oligo net When contacting for technical support please have the following information available or include it on your fax or E mail e Your name e Name of the licensed end user if different e OLIGO license number e Phone or the E mail address 159 160 Appendices Appendix A Glossary of Terms Appendix B PCR and Sequencing Primer Selection Criteria Appendix C Effect of Primer Duplex Formation on PCR and Sequencing Appendix D Theories and Formulas Used in the OLIGO Program Appendix E Amino Acid Symbols Appendix F References 162 165 167 169 178 180 161 Appendix A Glossary of Terms Active Reading Frame The reading frame currently displayed in the Edit window set to Mutagenesis mode Act
143. er case letters You can also select the Forward Primer by clicking on the square icon in the middle info box of the Sequence window or enter and or modify it via the keyboard see the Edit menu The short cut key Mac lt U gt Win lt Ctrl U gt 7 2 Select Reverse Primer The Reverse Primer command from the Select menu selects the negative strand Current Oligo as the Reverse Primer Once selected the Reverse Primer is displayed in blue on the Melting Temperature window two lines below the Current Oligo and followed by a primer extension triangles pointing toward the 5 end of the sequence The Reverse Primer is displayed in upper case letters except for nucleotides mismatched to the active sequence which are displayed in lower case letters You can also select the Reverse Primer with the short cut key Mac lt L gt Win lt Ctrl L gt 108 7 3 Select Upper Oligo The Upper Oligo command from the Select menu selects the positive strand Current Oligo as the Upper Oligo Once selected the Upper Oligo is displayed in light red on the Sequence window one line above the Current Oligo and followed by a primer extension triangles pointing toward the 3 end of the sequence The Upper Oligo is displayed in upper case letters except for nucleotides mismatched to the active sequence which are displayed in lower case letters You can also select the Upper Oligo by clicking on the square icon in the middle info box o
144. erformance Application Design Remedy Selection Feature Problem PCR Select oligonucleotides 3 Stability Window Determine Sequencing ith high specificity stability G of the 3 ends of genomic or other DNA oligonucleotides select only those samples with much ith low or moderate stability unknown sequence Multiple PCR product PCR Select only False Priming Check Determine bands due to false Sequencing oligonucleotides that the propensity of false priming priming within and ill not false prime using stability XG calculations near the intended ithin and near the select oligos with no strong amplification region PCR product on the priming affinity to any region on active sequence he active sequence Sequencing Select oligonucleotides Fa se Priming Check Against hich will not false Other Sequence Files Check for much of the sample is prime on known alse priming sites in all the known but scattered Sequence outside the sequence files selected by the over many active active sequence user sequences Select oligonucleotides Fa se Priming Check Against o false priming in Sequencing hich will not false Repetitive Sequence Database repetitive active prime in repetitive File Check for false priming sites Sequences such as active sequences in repetitive active sequences selected by the user 156 Very low efficiency PCR Select oligonucleotides Duplex Formation Check Check PCR or sequencing Sequencing ith low dime
145. ering OLIGO The OLIGO Main Menu The OLIGO Default Window OLIGO Short Cut Keys Help 2 Getting Started This section covers the basics on getting started with OLIGO 2 1 Basic System Elements amp Symbols The OLIGO program presumes you are familiar with the basic functions of Macintosh OS or Windows interface If you are unfamiliar with it please refer to your System manual If you need a brief refresher of System elements review this section 2 1 1 Mouse Pointer Cursor In OLIGO the mouse pointer or cursor is either a cross hair a vertical bar or an arrow When you are on the main menu bar the hand becomes a pointer or arrow Position this arrow marker directly on the object you want to select or activate 2 1 2 Close Box The close box is located in the upper left corner Mac or upper right corner Win J of most OLIGO windows next to the title bar When you click on this box you close the window 2 1 3 Title Bar The title bar displays the name of the window The non active window title bar is dimmed You can choose different types of window arrangements from the Window menu You can move most windows by clicking on and dragging the title bar 2 1 4 Menu Bar The menu bar is located at the top of the screen It lists the functions available in the application To access a function click and drag down with the mouse to select a particular suboption or click once quickly so that the menu will rema
146. ers dialog box Change menu The G value is for dangling ends and mismatches included and g excluded e The S entropy The S value is for dangling ends included and s excluded Mismatches are considered e The H enthalpy The H value is for dangling ends included and h excluded e The 3 G free energy of the 3 terminal pentamer Mismatches are considered e The degeneracy number for the oligo e The Priming Efficiency numbers The first number is as if there would be a perfect match with the main sequence and the value after the slash is the actual P E number e The extinction coefficient properties of the oligo expressed in nmol O D at 260 nm and in yg O D at 260 nm 5 2 Analyze Duplex Formation The Analyze Duplex Formation command calls up the Duplex Formation windows that display potential duplexes in the oligonucleotides Potential dimers between all the pair combinations may also be displayed 60 G and hairpin loop Tm values are calculated and displayed in association with each duplex dimer or hairpin If the Tm is not displayed for a given hairpin then it is not likely that it can form Tm gt 0 Note The minimum number of contiguous bases required for the display of a potential dimer structure in this formation is two If fewer than two contiguous bases match a no dimer formation message appears 5 2 1 Duplex Formation Forward and Reverse Primer Upper and Lower Oligo
147. ers Probes Subsearches In the Subsearches portion of the Search for Primers and Probes window there are 17 subsearches that are activated in various combinations in OLIGO s composite searches for primers and probes By clicking on any subsearch box however you can add or subtract the subsearch from any composite primer probe search The subsearches filter oligonucleotides according to search parameter values These search parameters are automatically set by the OLIGO program to values that depend on the specific search selected and the search stringency setting These can be overwritten by values you enter Search parameters and search stringency settings are on the Parameters window called up by clicking on the Parameters button 6 1 3 1 Eliminate Ambiguous Bases Subsearch This simple search selects sequence regions of lower of equal degeneracy as set in the Parameters window e Max Degeneracy The default is 1 so that no ambiguous bases at all can be found in a selected primer or probe 6 1 3 2 Duplex free Oligonucleotides Subsearch The Duplex free Oligonucleotides subsearch is included in the default composite PCR searches and sequencing primers searches It is not included in the default search for hybridization probes This subsearch checks the designated search ranges of the active sequence for duplex free oligos applying the following search parameters e Acceptable 3 dimer G e Strongest Dimer Overall
148. ers in the Selected Oligonucleotides window you will not only change the Current Oligo position but also you will select the actual primer observe the Sequence window how it changes 3 2 Changing windows appearance The display of certain windows can be customized The Edit windows for example have two display modes as well as all the Analyze windows with the Options g button 1 Open the Edit Entire Sequence window You should get the Full Screen Edit window 2 This window has its own menu Click on Edit item You should see the following menu 80 c 6 Edit Sequence File Human elF 4E seq Accept Discard 2 i Search Change Rev Translate ETE Can t Undo Z 10 t Can t Redo t Z E CGATCAGATC GA Cu ay CCACCCCTAC TCCTAATCCC CCGACTACAG AA ut TTGCTAACCC AGAACACTAT ATTAAACATC CC Copy C TTAAAAATGA TAAAAGCAAA ACTTGGCAAG CA JB Pacte apy CTGTTGAAGA CTTTTGGGCT CTGTACAACC AT i Clear GCTGTGACTA CTCACTITIT AAGGATGGTA TT Clear AACGGGGAGG ACGATGGCTA ATTACATTGA AC GCTTTTGGCT AGAGACACTT cTeTcccTTA TT Select All oA ATGTATGTGG CGCTGTTGTT AATGTTAGAG CT CTGAATGTGA AAACAGAGAA GCTGTTACAC AT Merge with b GACTTCCTCC AAAGATAGTG ATIGGTTATC AG GCTCCACCAC TAAAAATAGG TITGTIGTIT AA se AGACTGCGTC AAGCAATCGA Clipboard kempy f Overwrite INS DNA Z Sound On Readback On Group by a Full Screen Edit Mutagenesis Nucleic Acid Protein 3 Note a dot by the Full Screen Edit It indicates the current window style 4 Cl
149. es Search ranges should be at least 100 nt whenever possible particularly for PCR primer searches Shift your positive strand or negative strand search ranges particularly if the program has selected positive and negative strand primers but no cross compatible pairs lf you want to keep the search stringency high but the search yields nothing turn off the Automatically change stringency button and select Primers and Probes Search Data from the Search menu Review the individual subsearch statistics If one subsearch has removed most of the oligos typically the GC Clamp consider relaxing that single parameter and try the search again 12 2 5 Printing The program doesn t print OLIGO uses a standard system printer driver If the program is not printing for you first check your printer connections If they are OK check to see if your printer driver was installed correctly Refer to your printer manual The printout doesn t look right OLIGO uses a non proportional font for all its printouts Make sure you have a font like Courier available on your system n_ If the text is too large or too small use Macintosh Page Setup File menu and type a new value into Reduce or Enlarge box If you need a specially formatted document save the data in a text file open it with your favorite word processor reformat and print it 155 12 3 Design Problems and Possible Solutions OLIGO Oligonucleotide Search Selection Criteria P
150. es The bottom part is the enzyme listing ended at the bottom with a list of non cutting enzymes scroll the bar down to see it the picture above does not show it The actual recognition sites are listed in black and the fragment sizes are in green 5 3 Search for restriction enzyme sites in protein This search reverse translates a protein sequence into all combinations of reading frames and finds all possible restriction enzyme sites that could be made This feature is useful in gene construction projects The example below shows how to find a protein of interest set the proper reading frame and then find the restriction sites only in this protein 1 Start Oligo open BRCA gene seg and open the Open Reading Frames window from the Analyze menu 2 Find the longest pen reading frame in the sequence This is the one we d like to analyze for potential restriction enzyme sites Click on the graphical representation of it to set the proper reading frame see the graph below You may use the zoom in slider located at the top left of the window for a better view 204 66 Ogen Rendy Frames ERAJ gett bby S JA uin Cater r UU AAA POS EEEE fh YUP aie WTA oO ue oe hc sts Pte MHP ANNA ae BUNA MA SOM a en Y Haaa Mee RL ee CROC oa fife at DET Startins EFT Pea kipibiali Weigh bika atta peZ 22054 ANGOA ASETA ORIG ri 8 Prr cL E el of aJ i 3 odom colored by frequency highnwt on oft io
151. es Services Hide Oligo Hide Others Show All and Quit Oligo Most of these items are identical in other applications 2 4 2 Main Menu File The File menu includes options that relate to opening existing sequence files creating new sequence files working with oligonucleotide databases saving data printing and exiting In most cases you will need to have a file open to perform functions listed under this and other menus 2 4 3 Main Menu Edit You must have a sequence file loaded to use the Edit menu options In most cases OLIGO will prompt you to save your changes after editing 20 2 4 4 Main Menu Analyze The Analyze menu contains the program options you select to analyze a single oligonucleotide oligo groups oligo lists PCR and other information pertaining to specific oligonucleotides and their uses 2 4 5 Main Menu Search The Search menu provides multi functional automated searches for primers and probes palindromes subsequences restriction sites and more 2 4 6 Main Menu Select On the Select menu you may select primers and probes as well as the Current Oligo position on the active sequence All these could be also done by mouse clicking in the Sequence window 2 4 7 Main Menu Change The Change menu allows you to change oligo length a DNA active sequence to an RNA active sequence or RNA to DNA search ranges and parameters reading frame in the Sequence window reverse translation method and the
152. es should be highly specific for the intended target sequence and not hybridize to other sites in the nucleic acid sample Because sequencing conditions are typically not very stringent and the formation of primer template duplexes with imperfect homology may be significant specific primers are essential PCR or sequencing results are generally poor because of high background if there is base pairing between the primer 3 position and sites other than the intended target in the active sequence 1 2 2 Free of Dimer and Hairpin Structures Another important requisite of primers but not hybridization probes is that they do not form dimers and or hairpins during reactions Oligonucleotides that form dimers or hairpins function poorly in site directed mutagenesis and in sequencing reactions especially if double stranded DNA is used Dimer and or hairpin forming primers are particularly troublesome when 3 termini are tied up this can cause internal primer extension which eliminates the primer from the reaction and may contribute to false priming 1 2 3 Form Stable Duplexes Primers and probes should form stable duplexes with the active sequence under the intended conditions GC rich regions are more stable than AT rich regions Generally primers should not have 3 ends that are too stable This increases the chance of false priming For more information on false priming refer to Chapter 7 The OLIGO Analyze Menu The OLIGO program is de
153. estriction enzyme sites in protein 184 184 184 187 187 189 190 190 191 193 194 195 196 196 198 198 199 199 200 201 203 203 204 204 183 1 Oligo 7 Installation 1 1 Installation Oligo software can be installed only if you have administrator privilages for this particular computer If you cannot save files to the Program Files or Applications Folder you need to log out and log in with the account that has administrator privileages or ask your IT manager to install Oligo for you 1 1 1 Installation form the Internet Download the zipped Oligo package Oligo Mac_Installer zip Macintosh or Oligo 7Win_Installer zip Windows to your hard drive Some systems unpack the files automatically and some require manual unzipping Double click on the zip file to unpack the contents Double click on the Oligo7Mac_Setup installer package Mac sometimes you see the pkg at the end of the name or on the Oligo7Win_Setup PC sometimes you see the exe at the end of the name to start the installation process and follow the on screen instructions In Macintosh Oligo is installed in Oligo sub folder in the Applications folder In PC the default folder is C Program Files Oligo 7 Start Oligo 7 fill out the registration form and register it as described in Chapter 1 2 1 1 2 Installing OLIGO from a Compact Disk To load the OLIGO program to your hard drive 1 Insert the Oligo 7 Disk into computer s CD d
154. eveal all sequence alignments and the consensus sequence At the default setting the window sorts oligonucleotides by descending score ascending position and descending length You may also sort the table by Tm 3 G or GC clamp by clicking on the sort button above that column You may implement secondary tertiary sorts and so on Simply hold down the lt option gt key Mac or lt Ctrl gt key Win and click on the name of the row The primary sort field button will be labeled 1 and the secondary 2 tertiary 3 etc 67 As you click on different positions in the table the Current Oligo position is updated accordingly Double click on a displayed number selects this oligo as a relevant primer or probe 5 8 Analyze Oligonucleotide Sets The Analyze Oligonucleotide Sets window contains a table of primer pairs data from the most recent PCR primer TaqMan Molecular Beacons or nested primers search The following information is included in the table e The primer probe set number e The primers and probe positions on the and strand active sequences e The PCR product score e The length of the PCR product the pair would generate e The calculated optimal annealing temperature recommended for PCR using this primer pair e The percent GC content of the PCR product generated by this pair By default primer pairs are displayed by the score in descending order primary sort see the order of sorting below the column names
155. f the Clipboard the sequence that can be inserted with the Paste command e Keyboard type mode insert or overwrite e Sequence type 49 8020 Edit Forward Primer File CBP seq Accept Discard Edit Search Change Rev Translate Sequence Length 21 nt Lae 67 4 C Reading Frame 3 AG 30 7 kcal mol Degeneracy 1 Loop Tm 52 2 C Loop AG 1 5 kcal mol RT Method Lathe Codons for Arginine AGA AGG CGA Coc CGG CGT 10 9 11 1 6 0 11 0 11 4 4 7 20 H 40 50 AT CCC CTA CAG AAC AGA TGG G P L Q N R W 5 ATCCCCTACAG 3 GGGTAGACA Clipboard 3 AAC INS DNA Figure 4 2 13 1 Mutagenesis Edit window The various colors of residues in the amino acid sequence represent the codon frequencies of each residue according to the codon table selected in the Change submenu The following six colors designate the relative codon frequencies in OLIGO Black Most frequent codon for the selected organism Blue Second most frequent codon for the selected organism Green Third most frequent codon for the selected organism Pink Fourth most frequent codon for the selected organism Red Fifth most frequent codon for the selected organism Yellow The least frequent Leu Arg or Ser codon for the selected organism 4 1 2 14 Edit Nucleic Acid Protein Toggle In the Full Screen Edit window the Nucleic Acid command changes the editing sequence type You may either edit a nucleic acid sequence or translated protein from it As a p
156. f the Sequence window or enter and or modify it via the keyboard see the Edit menu The short cut key Mac lt Shift U gt Win lt Shift Ctrl U gt 7 4 Select Lower Oligo The Lower Oligo command from the Select menu selects the negative strand Current Oligo as the Lower Oligo Once selected the Lower Oligo is displayed in light blue on the Sequence window one line below the Current Oligo and followed by a primer extension triangles pointing toward the 5 end of the sequence The Reverse Primer is displayed in upper case letters except for nucleotides mismatched to the active sequence which are displayed in lower case letters You can also select the Lower Oligo by clicking on the square icon in the middle info box of the Sequence window or enter and or modify it via the keyboard see the Edit menu The short cut key Mac lt Shift L gt Win lt Shift Ctrl L gt 7 5 Select New Current Oligo Position The New Current Oligo Position command calls up the Current Oligo Position dialog box where you can choose a new Current Oligo by entering a new 5 position number oligo upper strand After entering a new position click OK The Current Oligo position also can be changed by using one of the following methods 1 Move the scroll bar on the bottom of Sequence melting Temperature Internal Stability Frequencies and Open Reading Frames windows to position the graph approximately where you want to move in the sequen
157. for optimal Reverse Primers that are compatible with a pre selected Forward Primer The Forward Primer may be selected from the active sequence or entered with the keyboard see the Edit menu Note You must have selected a Forward Primer for this option to be available When you choose this option with the default subsearches OLIGO selects negative strand primers that are e free of dimers with the Forward Primer and have the same characteristics as the primers found in the Search for Compatible Primer Pairs listed above At the bottom of the window there is a pull down menu allowing to choose which windows should be automatically displayed after a successful search It could be the selected oligos primers pairs probes or both windows default All Results setting When the consensus primer sub search is selected OLIGO checks the priming efficiency number not the homology PCR Primers Compatible with the Reverse Primer This option searches the positive strand for optimal Forward Primers that are compatible with a pre selected Reverse Primer The Reverse Primer may be selected from the active sequence or entered with the keyboard in the Edit menu 89 The search proceeds analogously to the search for PCR primers compatible with the Forward Primer TaqMan Probes amp PCR Pairs This option searches for and selects optimal PCR primer pairs and compatible with them TaqMan probes This search proceeds as the Search for Comp
158. form poorly in PCR so it is better to use guess mers as even significant mismatches are tollerable especially on the 5 ends of primers 8 4 Reverse Translate Codon Table This back translation method creates a non degenerate guess mer sequence from the most frequent codons for a given organism OLIGO includes these codon tables 124 Arabidopsis Pseudomonas Bacillus Rabbit Barley Rat Caenorhabditis elegans Rhizobium Chicken Rice chloroplast Clostridium Salmonella typhimurium Cow Soybean Distyostelium discoideum Staphylococcus Drosophila Streptomyces E coli Tobacco HIV Tomato Human Trout Influenza virus A Vaccinia virus Mouse Wheat Neurospora crossa Wheat chloroplast Pea Xenopus laevis Pig Yeast S cerevisiae Plasmodium You may modify or enter your own codon table by editing the Codon Usage Tables file see the next Chapter 8 8 Change Codon Table The Codon Table command selects the codon frequency table for a given organism To add a new codon frequency table to the list modify the codon table file Codon Usage Tables in the Tables folder Note When you change the codon table the reverse translation method automatically sets to Codon Table There are four lines in each codon table file 1 The name of the organism 2 The codon frequencies for that organism as described in Nucleic Acid Research 18 and updated on the web 3 The codons listed in order of frequency
159. formed on large number of sequence files at a time Results of this type of search is automatically stored in a results text file 1 5 11 Database functionality Has been greatly improved The main change is a possibility of fully automatic multiplexing Besides single oligos storage the Database can store also primer sets You may also check oligos for dimerization directly from the Database menu 1 5 12 Improved features All previously existing windows have been re designed They have more pleasing graphics and usually show more information than in Oligo 6 Some windows have greater functionality For example you may read consensus sequences from the list of primers Analyze Selected Oligonucleotides window or read the info on four instead of two primers from the PCR window 1 5 13 Dropped features PrimeForm option that was designed in Oligo 6 to help making primer orders to commercial facilities has been abandoned due to lack of customer s interest 1 5 14 Change to the Manual Oligo Tutorial has been removed from the main text of the Manual and it is a separate document It is an open source of protocols You are invited to send us new protocols or instructions not yet covered in the Tutorial by e mail to mbisupport oligo net New protocols would be incorporated in the text of the tutorial with proper acknowledgements 14 2 Getting Started Basic System Elements amp Symbols Installing the OLIGO Program Regist
160. gonucleotide Database Details OLIGO Search Result a Saved Work File Format All Files All Files New Folder Cancel Open Y Nucleic Acid Nucleic acid file is selected Protein Oligonucleotide Database Open As Nucleic Acid Search Results Saved Work File Figure 3 3 The File Open dialog box with All Files set to open 3 3 1 File Open Nucleic Acid This option selects DNA or RNA sequence files from your computer disk Sequence files that have acceptable file formats may originate from several sources including GenBank EMBL and other database files Text files generated and saved without formatting in a word processing program files generated from most DNA sequence analysis programs and sequence files created in OLIGO are also acceptable files Note Sequence files from other software applications that do not open using this function may not be text files or may contain incompatible characters Sequences interrupted with periods semicolons greater than and less than symbols or some hidden word processing characters cannot be loaded Here s how to deal with a file that will not open and you suspect has incompatible characters 1 Remove the characters using any standard word processing package and save the file as plain text preferably with a different file name so you can go back to the original 2 Open your sequence file by the software that created it and check its save options Choose the
161. gs is also updated in the Sequence Window 5 15 Analyze Restriction Enzyme Sites This Analyze window is available after the Search for the Restriction Sites that is described in the Search menu section There are two parts of this window that display results of the search in two formats the top is the graphical and the bottom is the table listing The graphical part consists of three columns The first two are the same as in the table listing below the number of an enzyme in the restriction enzyme file that was used to perform the search and the enzyme name The third column shows at the top the nucleotide position scale of the entire sequence file and below the recognition sites as vertical blue lines spanning from top to bottom of each row representing the space for a given restriction enzyme The list besides the number and the enzyme name has 3 more columns depending on the window width displaying the actual recognition site the number of sites in the entire active sequence file and the recognition sites positions in black The position sites are interrupted by the fragment sizes displayed in green Below the table there is listing of enzymes that do not cut the sequence At the window bottom the two search parameters are displayed the type of sequence linear or circular and the file name of the restriction enzyme database used in the search 78 808 Restriction Enzyme Sites File BRCA2 gene seqg Enzyme l S00
162. gy 57 5 6328 Te re 6310 5 5 779 tttetteccaacgtectgact 79935 Homology 53 5 6328 i a ae 6310 5 5 601 ggtttttategtcegtctgg 619 5 Reverse Primer ML3MP18 6210R19 negative strand Homology 100 above the threshold S cea A AHA CLL LT aa 5 6328 ggtttteccagtcacgacg 6310 5 Homology 74 above the threshold 5 6328 i il a WW Dl 6310 5 5 808 cattataccagtcaggacg 790 5 Homology 74 above the threshold 5 6328 da ia a 1 i Ul 6310 5 5 5125 agattcaccagtcac acg 5108 5 Homology 71 above the threshold ee i nn te 5 1984 ggttttgctcagtaccaggeg 1964 5 Homology 58 5 6328 sail Tia kG 6310 5 5 626 tegtttaccag lt acgacg 610 5 Figure 5 6 An example of a Homology window The same m13mp78 primer is analyzed to show the difference between the false priming sites algorithm The homology search is using the Lipman and Pearson s FASTN algorithm 23 5 Analyze Selected Oligonucleotides The Analyze Selected Oligonucleotides window displays a table listing all oligonucleotide selections from the most recent search Choose the kind of oligos to display Forward Primers Upper Oligos etc with the button at the upper left corner of the window The table shows all the oligos found in the last search but if the check box Hide unpaired oligos is checked the table shows 66 only the oligos that match with other oligos in the table that creat
163. hairpin loops in all oligos of the Current Oligo length palindromes results of search for a string and a selected feature as depicted on Fig 2 5 2 The Tm graph area shaded in yellow is the zoom in area displayed at the bottom part of the Sequence window 23 1 100 Th 300 Scale Tm graph Forward Primer Upper Oligo line PCR product Lower Oligo Reverse Primer stronger template hairpin loops uun Weak hairpins in oligos Structural features a ee ee ee ee L Palindromes Search for a string results oa Feature Area in the yellow box represents the contents Fi of the zoom in area L hh Selected oligos Figure 2 5 2 The OLIGO Sequence window zoom out area Each blue one pixel wide vertical block of the Tm graph represents the Tm of an oligonucleotide or an average of several oligos if the screen has less pixels than the number of bases in the sequence The Tm is calculated for an oligonucleotide length that is set in the Current Oligo Length command from the Change menu the default is a 21 mer 2 5 3 The Zoom in Area The zoom in area is located at the bottom of the window and starts from the boxes showing the cursor position and corresponding tm of an oligonucleotide at that position Note Not always the tm is displayed tm being a standard or raw melting temperature calculation without consideration for dangling ends in this window The display type is the same as in the Melting T
164. he entire search area with either overlapping products or non overlapping products with defined maximum size of gaps When all 3 boxes are checked No overlapping primers No multiple products and Cover the entire search area with Overlapping products expect only small regions duplicated with no primers that would overlap The last feature of this dialog concerns with how the searches for false priming sites or homology should be performed You may choose either to search for the sites in the entire sequence regardless of the search ranges or search only within the search ranges Defaults and other buttons The Defaults button re sets all the parameters displayed in this window to default settings Clicking the OK button accepts the changes and Cancel does not both buttons close this window 8 4 Change Search Parameters The Search Parameters windows are accessed by clicking on the Parameters button in the Search for Primers and Probes window or choosing the Search Parameters item from the Change menu The Search Parameters are laid out in four separate windows The first one provides access to global stringency settings and to some of the subsearch defaults The second window contains the remaining subsearch parameters and the third Sequence Constraints From the 4 window you may change the primer scoring system as this OLIGO version assigns a one number score to each primer or probe that is selecte
165. his complicates expression of the melting temperature values Oligo reports standard melting temperatures without mismatches amp dangling ends as tm and with mismatches and dangling ends as Tm 1 5 3 More primer probe options Introduced the ability to select 4 oligos for analysis Oligo 6 only handled 2 This was done to enable searches for TaqMan Probes and nested primer sets Oligo also can search automatically for molecular beacons and siRNA A series of 12 user editable design constraints have been added so you may search for oligos with certain bases or sequences built in 1 5 4 New search criteria and the entire search algorithm Oligo 7 is no longer constraint to a fixed length of a probe primer during a single search You may now select a range of lengths for your primers The number of sub searches was increased so you may restrict not only 3 stability but also 5 end stability to aid in siRNA selection In addition a search for strong hairpin loops in the template was added This does not include primer design by itself but with this search you may avoid hard to amplify regions The sequence constraints option lets you find primers with certain bases at the 3 and 5 ends There is also an option to restrict the number of guanosines in your primers that greatly enhances possibility of multiplexing 1 5 5 The quality of oligos and pairs are scored in a single number Many Oligo users requested this option because
166. ible with each other show no 3 end dimer formation By clicking on the Select button all oligos within a given group are selected highlighted and become available for export to the linked with the database sequence saving or analysis Below is the detailed description the database fields 11 1 Database Fields The fields displayed with each oligonucleotide record are described here Each field can be sorted by clicking at the field name You may perform a secondary sort by pressing another field name while holding the lt option gt key Mac or lt Ctrl gt key Win Immediately below the field name the digit shows the sort order number Number This column displays the sequential number of each record in the database As oligo records are deleted the number of later entries receive new higher numbers and not the first available numbers To clean up the order choose Renumber from the Edit menu The number of entries is not restricted Date This field lists the dates when the records were created The date is automatically assigned by the program using the computer s clock calendar You may change the date by double clicking on the date or using the record editor window by clicking on Show Hide mn icon in the window toolbox and selecting the Highlighted Record item ID Number The ID number is automatically created by OLIGO It is a composite of the file name from which the oligo was imported its lowest nucleotide pos
167. ically Change Stringency option ensures maximum optimization of oligos or oligo pairs for a given set of search ranges on a given active sequence When this option is active the program proceeds until primers or probes are selected at the highest possible stringency for a given search condition 8 4 1 3 Inverse PCR When the Inverse PCR box is checked OLIGO selects primers in the opposite direction Forward Primers downstream Reverse Primers upstream permitting PCR searches to be useful for circular templates The PCR window displays the inverse PCR product and predicts experimental conditions 8 4 1 4 Penalize for Tm P E Discrepancy This changes the scoring for primer pairs selection OLIGO adjusts the primer probe sizes automatically within the selected ranges and this re sizing minimizes the Tm or priming efficiency discrepancies whichever button is selected is colored and has a black dot insight 117 8 4 1 5 Maximum Number of Selected Primer Pairs This field controls the max number of selected PCR primer pairs If the search finds more pairs it stops and asks whether to proceed with further search Usually 3000 pairs default is sufficient 8 4 1 6 Defaults Button This button changes all customized parameters to default settings for a given search stringency Note When you change any given global stringency all parameter settings for this stringency will become default will be reset 8 4 1 7 Cancel and
168. ick on the Mutagenesis item The window changes its appearance see the following figure If you d be editing a primer this type of window would open automatically 191 G x aA eA Edit Sequence File Human elF 4E seq Accept Discard Edit Search Change Rev Translate 5 18 J sR E ele Al pos 1 Sequence Length 1868 nt tm rer li E Reading Frame 1 AG 96 9 kcal mol Degeneracy 1 Loop Tm 54 5 C Loop AG 2 1 kcal mol RT Method Lathe Codons for Arginine AGA AGG CGA CGC CGG CGT 10 9 11 1 6 0 11 0 11 4 4 7 10 dk EE E 120 30 40 CGA TCA GAT CGA TCT AAG ATG GCG ACT GTC GAA CCG GAA ACC ACC CCT ACT CCT AAT CCC R 5 D R S K M A T V E P E i H P T P N P oA Pir 5 CGATC III A 3 CCCTAATCCTCATCCCCACCAAAGGCCAAGCTGTCAGCGGTAGAATCTAGCTAG Clipboard is empty INS DNA 5 Close the Edit window and open the Melting Temperature window 6 Click on the Options button You should see this fz AH Melting Temperature File Human elF 4E seg a aA 1868nt 21 mers pos tm lee sve SE E LIIIJL L alirirrirrrrrlal 66 04 Show Mean Value Bars 54 0 war ee v Show Threshold Values 3 60 0 e a y Dots Pe Sao pote aw 54 0 g b 9 52 0 4a 8 50 0 48 0 46 0 44 0 42 0 40 0 CGATCAGATCGATCTAAGATGGCGACTGTOGAACCGGASACCACCCCTACTCCTAATCCCCCGACTACF T pa 2 7 Click on the Bars Now the Tms of the oligos is displayed as bars instead of dots This type of change is avai
169. ide Database Enter a new file name on the top or leave it as is Note the destination folder and if it is not correct change it Accept the name by clicking at the Save button 7 The Search Progress window displays how many files were processed and scheduled The search ends when this progress window disappears Open the BatchResults odb file with Oligo 8 The database window should look like this 0 OO Oligonucleotide Database File BatchResults odb Bl of Records 16 Date ID Number Sequence 3 Dim AG P E p e Tm th 5S 1 11 10 09 X61939 242F21 TTGTCTAGTAATTTAATGCCT 2 3 SC 422 49 2 4 2 11 10 09 X61939 841F20 TTTAATTTTGGCTAGAGTGT SC 421 49 3 5S 3 11 10 09 X61939 875F20 AAAGAATTACAGTACACGTA 0 8 SC 411 484 4 11 10 09 X61939 333R19 AACGTAATTAGCCATCGTC SC 431 519 3 5 11 10 09 X61939 1294R21 AAAATTACCAAAGAATGCACA 1 7 SC 436 515 6 11 10 09 X61939 1295R20 AAAATTACCAAAGAATGCAC SC 423 494 3 7 11 10 09 M61731 1296F22 AATAAACATTAAATTTGTGCAT 1 3 SC 421 48 0 3 8 11 10 09 M61731 1461F20 CTAGAATTACTATCTCTGCC SC 429 49 1 9 11 10 09 M61731 1740R21 AACATAATAAACTAGTGCTCC SC 431 499 I 10 11 10 09 M61731 1990R20 TATATACTTTCCTTACGCTA 0 7 SC 422 46 7 11 11 10 09 M61731 1990R23 CTCTATATACTTTCCTTACGCTA 0 7 SC 455 512 IJ 12 11 10 09 HumanelF 4E 60F GAAAACGGAATCTAATCAGG SC 424 50 6 3 13 11 10 09 HumanelF 4E 10 ATATTAAACATCCCCTACAGA 0 2 SC
170. igo of 21 bases To get more manageable degeneracy change the Current Oligo length using the Change menu to 17 At this time you should be able to find oligos with relatively low degeneracy 188 9 Click on the Analyze menu Note that in place of former Melting Temperature Graph item you d find Degeneracy Graph You may change the display back to tm analogously as described in point 7 2 2 Open a database file 1 Choose File Open from the File menu 2 Choose Oligonucleotide Database as File Format 3 The Test sequences folder doesn t have any database files so all the files are greyed out Go up one folder higher by choosing Oligo 7 folder form the top menu 4 Open universal primers odb You should see the database window 8600 Oligonucleotide Database File universal primers odb j of Records 18 n Date ID Number Sequence 3 Dim AG P E p e Tm tm m 1 07 13 94 X02513 6309L19 GGTTTTCCCAGTCACGACG 5 5 D 482 578 a M 2 07 13 94 X02513 6290L17 GTAAAACGACGGCCACT 1 2 SC 479 540 3 07 13 94 X02513 6209U16 AACAGCTATGACCATG 40 OD 381 46 7 0 4 07 13 94 X52330 670U17 CGAGGTCGACGGTATCG 9 5 D 453 557 5 07 13 94 X52330 720L17 TCTAGAACTAGTGGATC 37 D 376 446 6 08 12 94 X52330 774L17 ATTAACCCTCACTAAAG 1 9 SC 369 437 S 7 08 12 94 X52330 633U21 ACTCACTATAGGGCGAATTGG SC 504 564 Ss 8 08 12 94 X52330 779L18 CGCGCAATTAACCCTCAC SC 516 56 0 This dat
171. igo priming efficiency number in two columns The number in the right column shows the P E of an oligo if annealed to its perfect complement and the number in the left column p e is the result of Priming Efficiency and Tm analysis performed against the entire linked with the database sequence Therefore if there s a mismatch the real P E is lower than theoretical p e the value displayed in the right column By default the P E column is empty until you check the priming efficiency manually using the Analyze menu The priming efficiency check tests database oligos against every potential priming site on the linked sequence within the established search ranges and reports the highest priming number on the most stable site for each oligo Priming efficiency checks of large oligo databases can be used to find previously synthesized primers that can be reused on other sequences particularly for sequencing Oligos may be exported from the database to the linked sequence where they will be automatically aligned with their most stable sites Tm tm Melting Temperature This field reports the T of database oligos in two columns The right column reports the theoretical melting temperature of each oligonucleotide using the nearest neighbor method if the oligo is annealed to its complement column marked as tm The Tm in the left column is the result of T analysis performed against the entire linked with the database sequence Theref
172. ill search for probes common to all selected files Hybridization probes with a higher or equal homology than this parameter will be accepted Used by the Consensus Probes sub search 120 8 4 2 15 Max of Mono Nucleotide Repeats Set the maximum number of sequence mono nucleotide repeats Repeats can be a homooligomer such as GGG Used by the Eliminate Mono and Di Nucleotide Repeats sub search 8 4 2 16 Max of Di Nucleotide Repeats Set the maximum allowable number of di nucleotide repeats in primers amp probes Repeats can be such as ACACAC Potential oligonucleotides containing trinucleotide repeats and higher are not removed by this parameter Used by the Eliminate Mono and Di Nucleotide Repeats sub search 8 4 2 17 Max Length of Repeated Sequence Set the maximum allowable length of sequence repeats longer than 2nt Repeats may be not touching themselves but minimum 2 need to exist in one oligo to be detected and eliminated Used by the Detect Sequence Repeats sub search 8 4 2 18 Max Degeneracy This option filters out potential primers and probes containing degeneracies The default degeneracy setting is 1 indicating that the oligo under consideration has only one unique sequence Any degeneracy threshold setting may be entered Used by the Eliminate Ambiguous Bases sub search 8 4 2 19 Frequency Threshold This variable is used by Eliminate Frequent Oligonucleotides sub s
173. in open when you move the cursor 2 1 5 Scroll Bars The scroll bars are the long gray or blue strips along the bottom horizontal scroll bar and or side vertical scroll bar of a window They contain both scroll arrows and a scroll box Only some windows contain them 16 You can move through a window or document by clicking and dragging the scroll box along the bar clicking directly on the bar or clicking on the arrows at either end of the bar 2 1 6 Zoom Minimize Box This is the button in the upper right corner of most of the windows Click on the green button Mac or icon D PC to change the window size or click or to minimize 2 1 7 Size Box To resize a window point to the right bottom window corner Mac or any window corner Win and drag the cursor You can resize the window horizontally and vertically 2 2 Installing the OLIGO Software 2 2 1 Installation form the Internet Download the zipped Oligo package Oligo Mac_Installer zip Macintosh or Oligo Win_Installer zip Windows to your hard drive Some systems unpack the files automatically and some require manual unzipping Double click on the zip file to unpack the contents Double click on the Oligo7Mac_Setup installer package Mac sometimes you see the pkg at the end of the name or on the Oligo7Win_Setup PC sometimes you see the exe at the end of the name to start the installation process and follow the on screen instructi
174. in the Applications folder These files include OLIGO 7 Application Icon the OLIGO application universal primers odb example of an oligonucleotide database file FreqSeq folder collection of repetitive sequences Frequencies folder tables containing oligonucleotide frequencies assembled from GenBank Tables folder files containing restriction enzymes information and codon usage tables Test sequences DNA and protein sample files 1 4 3 Frequencies Folder These files are in the Frequencies folder They are used to create the Sequence Frequency window and in Eliminate Frequent Oligos sub search for PCR primers The list of oligonucleotide frequency table files generated from Gen Bank is given below You may create your own frequency file See p 96 GBBCTBAC FR6 Frequency of 6 mers from Bacillus subtilis sequences GBBCTESC FR6 Frequency of 6 mers from Escherichia coli sequences GBINVCAE FR6 Frequency of 6 mers from Caenorhabditis sp sequences GBINVCAE FR7 Frequency of 7 mers from Caenorhabditis sp sequences GBINVDRO FR6 Frequency of 6 mers from Drosophila sp sequences GBMAMBOS FR6 Frequency of 6 mers from Bos sp cow sequences GBMAMORY FR6 Freq of 6 mers from Oryctolagus sp rabbit sequences GBPHG FR6 Frequency of 6 mers from bacteriophage sequences GBPLNARA FR6 Frequency of 6 mers from Arabidopsis sp sequences GBPLNCHL FR6 Frequency of 6 mers from chloroplasts sequences GBPLNORY FR
175. in the database has been employed the field reports cross compatibility to the multiplexed oligo plus its G value The G value of the 3 dimer formation is displayed on the left side of the field while the oligo s dimer forming propensity either at the 3 end or overall is displayed on the right side The full list of codes than can be displayed in this column is SC Self Compatible not self dimerizing or self hybridizing C Compatible NC Non Compatible D forming a dimer M Multiplexed oligo compatible with all other marked as C In the Probe checking mode HH is High self Homology a self sticky probe See the Database Options accessible by clicking on the icon for definitions A simple Multiplex command checks compatibility of only the selected primer against the remaining oligos in the database and marks the primers in the right column of the 3 Dim AG In order to select a primer for multiplexing it must first be free of self dimerizing potential and if it s not the case you may relax the Acceptable 3 Dimer G threshold set in the Database Options The 3 G values displayed after the multiplexing reports the G of cross dimerization between the multiplexed oligo M and all other oligos In order to identify 3 4 or more oligos from a database suitable for a multiplex assay however you must continue the multiplex operation by clicking on oligos displaying
176. in the organism 4 The amino acid symbols A time saving way to add a new user specified codon table is to open the Codon Usage Tables file with a word processor copy the last codon table record change the organism name and codon frequencies accordingly and save the file The new updates of codon usage tables can be found on the web site http www kazusa or jp codon 125 126 9 The OLIGO Window Menu 9 1 Window Menu 128 127 9 The OLIGO Window Menu While working with OLIGO many windows may be open at one time You can move each window manually by clicking on and dragging its title bar so that the main window may be seen However some windows may remain obstructed The Window menu options help you view all opened windows There are different menu items for the Macintosh and Windows versions so they need to be described separately 9 1 Window Menu You can also use the Window menu to keep track of open windows and bring to front any previously opened with Oligo window Help Show One Document List of opened Document Switch List gt sequence files and databases Cascade Tile y Sequence List of opened windows Figure 9 1 The OLIGO Window menu Mac 9 1 1 Window Show One Document This option displays only windows for the currently analyzed sequence file You may have other open sequence files and this option allows you to choose windows belonging to one of these open sequence files I
177. it Oligo to send e mails to us press the Save button and this saved text file attach to your e mail and send it to mbisupport oligo net No screen shots please If your computer is not connected to the Internet please print out the Registration Form by clicking the Print button and fax it to MBI 1719 684 7989 4 When you receive the Access Code from MBI go back to the registration window by bringing it to the front or by re starting Oligo enter it to the Access Code box and click the Confirm Code button The registration process is complete To register your second and following computers you need to complete the same registration process each time Any further updates are automatic but may be also performed by using Oligo s Help menu Note If you ever need to re load OLIGO write this message to the Comments field 186 2 File Opening and Viewing The tutorials in this section give you an opportunity to learn how the features of the OLIGO software can assist you in your research Some of the tutorial examples are intended to provide a general guide from which you can construct your specific application Others are specific so that you can duplicate if you wish similar results similar not exact because future revisions of the software may be slightly different in default parameters Note if you want to duplicate the results in the search examples open Human elF 4E seq for your sequence file It is lo
178. it is trivial to find the best primer that way Unfortunately different applications require different approach and emphasis on different parameters or features of a primer probe This led to a fairly complex and user customizable scoring system In most cases however it is not essential to modify the definitions 1 5 6 Enhancements to the search for primers amp probes protocol The primer and probe search protocol allows the user to lock every parameters such as Tm range or 3 stability G settings so that the automatically change stringency setting which incrementally relaxes each parameter is more controlled during a search In addition the user can choose to balance PCR Primers according to the priming efficiency number rather than Tm which has been shown to provide better amplification results The priming efficiency algorithm has been slightly modified 1 5 7 Automatic OLIGO updating In the Help Menu the item Check for Update has been added This enables automatic installation of new versions from the MBPs server In all previous versions this was a manual cumbersome process 1 5 8 Open reading frame This new analysis window provides information on all ORF and gives basic information on translated proteins including molecular weight and pKa 1 5 9 Homology analysis Besides the false priming sites check you may also view homologous sites 1 5 10 Batch processing Now searches for primers and probes can be per
179. ition on the file the kind of oligo F Forward Primer R Reverse Primer U Upper Oligo and L Lower Oligo and its length in the number of nucleotides If the file is from GenBank the accession number is displayed rather than the file name Sequence This column lists the oligonucleotide sequences from 5 to 3 end 135 Ref Reference In order to see the Reference field you need to change the default database fields display by clicking on the a icon that opens Database Options window followed by clicking on the Display Options button This is a field in which you can enter your initials a literature reference and or synthesis specifications or other short notes you want tied to the record You may re size the column to view more characters by positioning the cursor on the line next to the letters Ref and click and drag the cursor to the right You can also enter view all of the fields when you click on Show Hide icon in the window toolbox and selecting the Highlighted Record item This action opens the database editor sub window Comments To see the Comments field you need to change the default database fields the same way as the Reference column described above This field is available for additional notes 3 Dim G for the primers or Homology for the probes This field displays the 3 end dimer formation G value of the oligonucleotide record Also if the multiplex function
180. ive Sequence The nucleic acid sequence currently analyzed OLIGO has the capability of loading several sequence files into memory Only the front window or most recently selected file however is the active sequence Ambiguous Base A degenerate or unknown base wobble Symbols are listed in Appendix D Theories and Formulas Used in the OLIGO Program Check Box A small box next to selectable options in a dialog box The options can be turned on marked with an X or off blank box by clicking directly on them Click and Drag A mouse technique used to move icons highlight text reposition windows and move other options on the screen Position the pointer on the target click and hold the left mouse button and drag the target across the screen Release the button to position the target Codon Display In a single line edit window this display shows the relative frequency of each codon present in a given organism Codon Table Method This reverse translation method creates a guess mer made of the most frequent codons for a given organism Current Oligo The Current Oligo is the oligonucleotide displayed in a gray background block in the Sequence window or in red in the Melting Temperature and Internal Stability windows The Current Oligo includes both the positive and negative strands and is updated with each position change on the active sequence A Current Oligo may be saved as Forward or Reverse Primer or Upper or Lower Oligo
181. lable on Internal Stability and Sequence Frequency windows as well 8 Click on the small graph icon M You should see this menu o as a ee Melting Temperature File Human elF 4E seq a EQ PA 1868nt 21 mers pos tm E 1 LIIILIJII l 19 LILII 1340 LIEILILJIIJI l 30 LIILIIIJI 40 LILII l F 660 2 Tm 64 0 Tir 7 pa J mi 62 0 Tiia Pea gf aA Pa 002 m Ag a a p 28 07 m AG not eR ae 56 0 al ee Le 54 05 W AG b 90 Oe 52 078 GC F 50 0 4go Degeneracy 46 0 44 0 42 0 40 0 CGATCAGATCGATCTAAGATGGCGACTGTCGAACCGGASACCACCCCTACTCCTAATCOCCCGACTACE 4 gt pape Zs At this point you may choose a different kind of Current Oligos representation The default was tm showing melting temperature graph of oligos without dangling ends Tm shows the same but with the dangling ends and Tm shows Tm with dangling ends of oligo complements Similarly AG and AG shows free energy graph with dangling ends of Current Oligos and their complements respectively while Ag represents the standard values without the dangling ends CG shows the CG content and Degeneracy active when the sequence is degenerate shows the number of possible sequence combinations 192 9 Close the Melting Temperature window and open the Open Reading Frames window When you Click the Options button you ll be able to change Min ORF Size laa loid s Aminoacid Type Wl Codon Frequency EMI the meaning of o
182. le by OLIGO so you may restore contents of these windows at later time 3 6 7 File Save Database This option is visible only when the Database window is active The Save Database command saves the current database to an open oligonucleotide database file This option is displayed instead of Save Sequence when any database window Is activated 3 6 8 File Save Work You may save position of all the windows search results and all the current state of Oligo memory into a Work wrk file In order to open automatically this type of a file at the Oligo start up you need to change the Preferences 4 th tab data see page 42 3 6 9 File Save Database As This option is visible only when the Database window is active The Save Database As command saves the current database to a new database file under a new file name you enter This option is displayed instead of Save Sequence As when any database window is activated 3 7 File Revert to Previous Sequence Database The File Revert to Previous Sequence Database command changes the active sequence with its annotations or the database whichever window is active back to their unaltered state previously saved on your computer disk This operation cannot be undone so if you ve done meaningful changes to those files better save them using Sequence as or Database as under a different name 36 3 8 File Print The File Print command generates a pri
183. le does not contain valid sequence data Check your sequence file It may have some characters OLIGO does not recognize Sequence files interrupted with periods semicolons or other characters are truncated and can t be loaded Remove the characters using any standard word processing package and save the file as plain text Too many potential primers not all pairs analyzed The number of primer pairs found exceed the program s memory Increase your search stringency and or reduce your search ranges and try again Two step PCR recommended 70 94 The two step two temperature cycling PCR procedure for these primers run at these temperatures should yield a product with less background A typical two step PCR for these temperatures is Denaturation at 94 C for 30 seconds 152 followed by annealing and extension at 70 C for 60 seconds repeated several times Two step PCR recommended 68 94 The two step two temperature PCR procedure for these primers run at these temperatures should yield a product with less background Denaturation at 94 C for 30 seconds followed by annealing and extension at 68 C for 60 seconds repeated several times 12 2 Troubleshooting Situations This section describes specific problems and solutions you may have while working with the OLIGO program They are loosely organized into Getting Started System Problems Working With the Windows on the Screen Searching and Printing You m
184. lected Oligonucleotides Figure 11 2 5 The Import menu and selected primer probe sets as records to your database To add a record choose from the menu the appropriate oligo you want to add If you choose the Oligonucleotide Set all oligos displayed in the Sequence window are imported as a set Use All Oligonucleotide Sets or All Selected Oligonucleotides to import all oligos found during the most recent search for Primers amp Probes those displayed in the Oligonucleotide Sets or Selected Oligonucleotides windows respectively If you have designed and selected LCR oligos and have not closed that window you may choose the LCR Oligos option from the Import menu to add the selected LCR oligos to the database 11 2 6 Export Exports a single highlighted selected oligo or primer pair triplet to the linked sequence as probes or primers and exports all checked i oligos or pairs to the Selected Oligonucleotides or Oligonucleotide Sets windows associated with the linked sequence Those windows may be closed at the exporting time 143 Single Selected as p E E Checked Oligonucleotides a T Check Selected Upper Oligo Uncheck All Lower Oligo e Oligonucleotide Set Figure 11 2 6 The Export menu Export Single Selected as To transfer an oligonucleotide or a set of oligos from the database to the linked sequence select highlight the record by clicking on it or on the oligonucleotide set in the database window
185. ligo is compatible with all the C marked oligos in the database When the multiplexing mode is set to Probes check homology Change Menu than Oligo would check whether other probes won t be hybridizing with each other based on overall homology Following the multiplex check primers with a C in the 3 column are cross compatible with all M marked primers Primers with NC in this column following a multiplex check are not cross compatible with all the oligos from the multiplex group The lowest G value of the most stable 3 end dimer for all 141 multiplexed primers is given as well Note that the letter C for Compatible means that the 3 terminal duplex is less stable than the value set in the Database Options window Open the Database Options by clicking on the icon Analyze Deselect Multiplex Multiplexed primers may be un multiplexed by choosing the Analyze Deselect Multiplex option This will deselect the primer that has been multiplexed last regardless of which oligonucleotide record is highlighted Analyze Multiplex All The Multiplex All analysis checks all entries or sets in the database against all others and displays the results as compatible groups in the bottom of the Database window Each group may be displayed separately by clicking on the scroll bar above the list and each oligo in the group may be highlighted by clicking on the Select button located also above the list Two modes of
186. llowing key is available from the Change menu Command PC Windows Current Oligo Length Ctrl D 2 6 4 Edit Submenu Database The following keys are available Command PC Windows Cut Ctrl X Copy Ctrl C Paste Cirl V Undo Ctrl Z select All Ctrl A 2 6 5 Edit Submenu Edit The following keys are available only from the Edit windows Command PC Windows Cut Cirl X Copy Ctrl C Paste Cirl V Undo Ctrl Z Select All Ctrl A Accept lt Enter gt Accept amp Close lt S Enter gt 2 6 6 Edit Submenu Search The following keys are available only from the Edit windows Command PC Windows Find Ctrl F Find Next Ctrl G 26 Macintosh 36 U L U M L K db d6 db H Macintosh d D Macintosh o6 X d6 C d6 V d6 Z 38 A Macintosh 36 X d6 C db V db Z db A lt return gt lt enter gt Macintosh df F d6 G 2 Help MBI provides live help line during standard hours of operation Monday through Friday between 8 a m and 4 p m Mountain Time UTC 7 If you send Oligo registration within this time expect receiving back your access code within one to two hours sometimes less and occasionally more Most issues can be resolved by e mail to mbisupport oligo net Oligo provides Help menu containing mostly the text of this Manual If your computer is connected to the Internet you may use this menu to check for the free Oligo updates 27 28 File New Sequence File New Database Fil
187. lter that selects or rejects oligos or oligo pairs on the basis of the stability of any 3 terminal dimer hybridized to itself or to another oligo It controlls the Duplex free Oligonucleotides sub search 118 8 4 2 3 Strongest Dimer Overall G This option sets the stringency of a dimer filter that accepts or rejects oligos strictly on the basis of the strongest dimer G The dimer does not need to start at the 3 terminus position It controlls the Duplex free Oligonucleotides sub search 8 4 2 4 3 terminal Stability Range This option controls the 3 end stability of primers The G value is for the last five nucleotides in the primer Oligos outside the displayed stability limits will be rejected by the Highly Specific Oligonucleotides sub search 8 4 2 5 5 terminal Stability Range This option controls the 5 end stability of SIRNA probes The G value is for the first five nucleotides in the siRNA probe Oligos outside the displayed stability limits will be rejected by the S end Stability sub search 8 4 2 6 Internal 12 mer Stability SIRNA This option controls the internal stability of SIRNA probes The G value is for the twelve internal nucleotides pos 3 to 14 in the siRNA 19 mer probe Oligos outside the displayed stability limits will be rejected by the siRNA Internal Stability sub search 8 4 2 7 GC Clamp Stability The GC Clamp Stability search parameter sets the mini
188. lume fe Current O0ligo 4 11 nmol OD 31 7 po fOD gt Current Oliga 4 40 nmol OD 34 2 pg OD 31 7 ug _ Entire Sequence ds 0 001 nmol OD 48 1 pg OD z or 1 0 OD 260 _ Forward Primer 5 62 nmol OD 34 0 pg OD or 4 105 nmol Rewerse Primer 4 91 nmol OD 34 2 pg OD in 410 5 yL PCR Product ids 0 209 nmol OD 47 4 pg OD S Eat yields 10 0 pM Upper Probe 4 11 nmol OD 31 7 po fOD Lower Probe 4 40 nmol OD 34 2 ya OD Figure 5 18 The Concentrations window The Analyze Concentrations command calls up the Concentrations window and calculates concentration volume absorption and molecular weight conversions for the following sequences from the OLIGO program e Current Oligo positive strand e Current Oligo negative strand e Entire sequence active sequence e Forward Primer e Reverse Primer e PCR product e Upper Oligo e Lower Oligo There are two calculation modes in the Concentrations window e Constant Concentration where the concentration of a nucleic acid sample in solution is held constant while allowing the other values to vary e Constant Volume where the total solution volume of a nucleic acid sample is held constant while allowing other values to be recalculated The right side of the Concentrations window provides five data entry boxes where g OD nmole L and M values may be entered Once a new value is entered in a given data box you can click
189. mer Removing nucleotides from the 5 end of the more stable primer in order to match Tms does not decrease PCR efficiency On the other hand increasing the length of the less stable primer to match the Tm of the more stable primer will typically improve PCR The Comments box on the bottom right indicates possible problems that may arise from using selected oligos as PCR primers 5 10 Analyze LCR LCR Ligase Chain Reaction is a diagnostic technique designed to confirm the sequence in a target DNA sample 25 The LCR function designs two pairs of complementary LCR primers for a wild type DNA sample and optionally an additional pair to detect a point mutation To use the LCR feature in OLIGO 1 Load the sequence file containing the target oligo sequence 2 Locate the site of the potential point mutation and position the 5 end of the Current Oligo at that position 3 Choose LCR from the Analyze menu 4 Click on Select to automatically select the four probes 70 The two sets of probe pairs overlap by one base creating 5 recessed ends The mutation specific probes have an approximate Tm of 65 C while the common probes have an approximate Tm of 70 C OLIGO automatically adds a non complementary tail to mutagenic probes so you can distinguish them from the wild type probes 5 Click on one or more of the remaining three buttons to select the appropriate mutation The melting temperature of the probes detecting a mutated
190. mino Acid Symbols Used in Search for Restriction Sites in Protein Symbol Amino Acid Equivalent CW DE FL HQ IM KN RS Y FLIV GR LIV LMV KEQ PAST SRGC YNDH WRG AEGIKLPQRSTV AEGKLMPQRSTVW ACDFGHILNPRSTVY SKRIMNT VADEG QRLPH SYFLCW J Q Fr Oo Qa 0 OJ OD NOOR WN AN lt lt x g lt c 179 Appendix F References 1 SantaLucia J Jr 1998 A unified view of polymer dumbbell and oligonucleotide DNA nearest neighbor thermodynamics Proc Natl Acad Sci USA 95 1460 1465 2 Xia T SantaLucia J Jr Burkard M E Kierzek R Schroeder S J Jiao X Cox C and Turner D H 1998 Thermodynamic parameters for an expanded nearest neighbor model for formation of RNA duplexes with Watson Crick base pairs Biochemistry 37 14719 14735 3 Wetmur J G 1991 DNA Probes Applications of the Principles of Nucleic Acid Hybridization Criti Rev in Biochem and Mol Biol 26 227 259 4 Rychlik W and Rhoads R E 1989 A computer program for choosing optimal oligonucleotides for filter hybridization sequencing and in vitro amplification of DNA Nucleic Acids Res 17 8543 8551 5 Sugimoto N 1993 Relationship between Structure and Function of Nucleic Acids The Study Using Nearest Neighbor Parameters Konan University internal publication Kobe Japan 33 61 67 6 Rychlik W Spencer W J and Rhoads R E 1990 Optimization of the annealing temperat
191. multiplexing individual oligos and the entire sets are available The Minimize Reaction is perhaps the most useful option This method selects the smallest number of compatible groups where each primer or set appears only once in all the groups The option Find All Groups shows all possible groups but each given primer or set may be repeated in several groups For multiplexing large databases the only practical is the Minimize Reaction option This option may give different results depending on how the oligos are sorted 0 OPA Oligonucleotide Database File BatchResults odb amp E T 4 Ai e of Records 32 Date ID Number Sequence 3 Dim AG P E p e Tm tr 3 20 10 27 08 XM_523824 1204 CCGAAATCAGAATCACT 0 2 SC 388 56 7 5 21 10 27 08 X83399 923F17 AATTACAGTATACGTCA sc 376 517 v 3 22 10 27 08 X83399 1196F17 TTAATTTATTTGCTTCC SC 369 495 5 23 10 27 08 X83399 1192R17 GCAAATAAATTAACATC SC 352 48 5 3 24 10 27 08 X83399 1460R17 AATTATGGTGTTACATT 0 2 SC 359 50 4 25 10 27 08 X83399 1326U18 AACATTACATTTGTGCAT 03 X 395 56 0 S 26 10 27 08 X83399 1113L17 AAAGCTGTACTTAGACT 2 7 SC 378 545 0 27 10 27 08 X83399 1416L17 TCACACAGCATAGATCA SC 391 57 7 D 28 10 27 08 HumanelF 4E 116 TTAATTTATTTGTTTCCCTA 09 SC 387 53 4 p A TOHIIPIINO Llhumnanna IEC AC 11 c RATETA i es oe ee ee ee ee nn a 27N A I Results of Multiplexing All Sets rwan EST Group 3 4 ew Mi
192. mum stability of a GC clamp that must reside along each selected oligo s length excepting the 3 end The free energy of pentamers is calculated across the entire oligo Used by the Oligonucleotides with GC clamp sub search This feature counterbalances the effects of unstable 3 ends The net effect of the 3 terminal Stability Range and the GC Clamp Stability search parameters is oligonucleotides that are specific yet prime efficiently on their intended targets 8 4 2 8 Primer T Range OLIGO limits the primers selection to this melting temperature range Used by the Oligonucleotides within Selected Tm Limits sub search Oligo automatically selects the Tm range however when you choose a certain oligo length you may have less choice of oligos of certain defined Tm Chart D1 p 174 may help you choose the right T oligo length depending on what GC content you are looking for 119 8 4 2 9 Tm of Probe Tm of Primer Sets the acceptable temperature difference between the PCR primers and the TaqMan probe Used by the Oligonucleotides within Selected Tm Limits sub search 8 4 2 9 Tm of Loop Tm of Probe Sets the acceptable temperature difference between the molecular beacon probe s Tm and a hairpin loop Tm in it Used by the Oligonucleotides within Selected Tm Limits sub search 8 4 2 10 Minimum Acceptable Loop G OLIGO eliminates oligonucleotides with hairpin loop stability values greater than
193. n of Nucleic Acids Immobilized on Solid Supports Analytical Biochemistry 138 267 284 16 Wetmur J G 1994 Personal Communication on Magnesium Concentrations 17 Barany F 1991 Genetic Disease Detection and DNA Amplification Using Cloned Thermostable Ligase Proc Natl Acad Sci USA Vol 88 189 193 18 Wada K Wada Y Ishibashi F Gojobori T and Ikemura T 1992 Codon Usage Tabulated from the GenBank Genetic Sequence Data Nucleic Acids Research Vol 20 Supplement 2111 2118 19 Nakamura Y Gojobori T and Ikemura T 1998 Codon Usage Tabulated from the International DNA Sequence Databases Nucleic Acids Research Vol 26 No 1 Database Issue 334 20 Steffens D L Sutter S L and Roemer S C 1993 An Alternate Universal Forward Primer for Improved Automated DNA Sequencing of M13 BioTechniques 15 580 582 21 Giesen U Kleider W Berding C Geiger A Orum H and Nielsen P E 1998 A Formula for Thermal Stability Tm Prediction of PNA DNA Duplexes Nucleic Acids Research 26 5004 5006 22 Khvorova A Reynolds A and Jayasena S D 2003 Functional siRNA and miRNAs Exhibit Strand Bias Cell 115 209 216 23 Lipman D J and Pearson W R 1985 Science 227 1435 1441 24 National Institute of Standards and Technology Link http yellow nist gov 8444 dnaAnalysis index do 25 Wiedmann M Wilson WJ Czajka J Luo J Barany F Batt CA 1994
194. n this case a document is any Oligo file Default display is to show all opened documents 9 1 2 Window Document Switch List This option allows you to switch between Oligo documents It displays a list of open files and allows you to select the one you want to view 9 1 3 Window Cascade The Cascade command arranges all opened Oligo windows one over another such that for all covered windows only the title bars are visible 128 9 1 4 Window Tile The Tile command arranges all opened Oligo windows such that all of them are visible and non overlapping It is most useful when only a few windows are opened and each of them takes up a reasonable screen area 9 1 5 Window Sequence Sequence is only an example pointing to the default Oligo window This part of the menu lists all open Oligo windows Choosing any of them brings it to the front of the screen 129 130 T 0 OLIGO Help Oligo Help menu has only two items Help Topics and Check for Update Help Topics Check for Update Fig 10 0 The Help Menu 10 1 Help Topics This provides access to Help Topics window 10 2 Check for Update This provides access to new updates found on MBPs server If a newer version of Oligo exists on the server it would be downloaded to your computer automatically Follow the on screen instructions to update the software 131 132 11 1 11 2 11 Database Fields New Database Menu Items OLIGO Database
195. ncies File CBP seq E 42 1868nt 6 mers GBPRI FRE pos 182 Frequency 170 130 140 150 160 17d 180 190 200 210 220 6000 4000 3000 2000 1300 1000 700 500 400 300 200 130 100 1980 230 CCTACAGAACAGATGGGCACTCTGGTTTTTTAAAAATGATAAAAGCAAAACTTGGCAAGCASACCTOCOGCTGATCTCCAAGTTITGATACTOTTGAAGACTTTTGGGCTCTGTACAACCATATC lt gt gt Figure 5 13 The Frequencies window bar style display This window shows the relative frequency of nucleic acid subsequences 6 or 7 mers throughout the entire loaded sequence Oligonucleotides with 3 ends common in a specific database subset of GenBank have a greater likelinood of false priming The tables of frequencies located in the Frequencies folder are user selected and contain normalized frequencies of GenBank sub sequences 6 or 7 mers The header of each frequency file describes in detail how each table was created For example the first 20 lines of GBPRIHUM FR6 are shown below GBPRI SEQ Genetic Sequence Data Bank 15 April 1997 NCBI GenBank Flat File Release 100 0 Primate Sequences 68547 loci 90213435 bases from 68547 reported sequences Organism Homo Frequency of 6 mers from 57478 records greater than 99 nt tot 86452438 nt expressed as HITS x 1000 x 4096 Table size K The average frequency for a given 6 mer is 1000 K the number of analyzed 6 mers is 85736235 AAAAAA 10020 AAAAAC 2138 AAAAAG 2857 AAAAAT 4055 AAAACA 2699 AAAACC 1536 AAA
196. ned The active window is checked and in this example it shows that the active sequence file is BRCA2 gene txt and this sequence has two windows opened the Sequence and Current Oligo Duplexes You may select any other window as active push in front of the screen by selecting the window name With this menu you may arrange the windows in Cascade or Tile fashion Choosing Show One Document item will hide all windows not associated with this document The document is either a single sequence or a database To show back all the documents click also the first menu item which will read Show All Documents at this time Help Show One Document Document Switch List gt 5 CBP seq NewDatabase odb eascare Ww BRCA2 gene txt v Sequence Current Oligo Duplexes Figure 11 2 9 The Window menu 11 2 10 Help This menu gives access to the help file In addition to this Windows users can read the info about the current OLIGO version by choosing the About Oligo item Macintosh menu has this item in the Application menu The Check for Update is the second option Use it to check MBI s server for the newest Oligo free updates 146 12 1 12 2 12 3 12 4 12 Troubleshooting OLIGO Messages 148 Troubleshooting Situations 153 Design Problems and Possible Solutions 156 OLIGO Technical Support 159 147 12 Troubleshooting Your OLIGO distributor provides thorough technical support for all of
197. nimize Reaction 8 16 18 19 9 16 18 20 10 17 18 20 12 22 24 25 13 22 24 27 14 28 30 31 This database is linked to Human elF4E seq Figure 11 2 4 2 The Database window showing one of the multiplexed groups of sets By pressing the Select button you highlight all records within the displayed group and Export Check Selected checks all of them see Print Save Options on what you can do with the selected oligos The displayed group can be changed by the scroll bar located immediately above the listed record numbers 142 Analyze Duplex Formation Each oligo in the Database may be analyzed for duplexes This option works if at least one single record or primer pair probe set is highlighted If more records are highlighted then only the top record is displayed in the Duplexes window The main menu Analyze Duplex Formation window is described in the Chapter 5 the Oligo Analyze Menu Analyze Hairpin Formation Each oligo in the Database may be analyzed for hairpins This option works if at least one record is highlighted If more records are selected then the first from the top is displayed The Hairpin Formation window is described in the Chapter 5 in the Oligo Analyze Menu 11 2 5 Import Using the Import menu you can add individual primers and probes LCR oligos Forward Primer Reverse Primer Upper Oligo Lower Oligo Oligonucleotide Set LCR Oligos All Oligonucleotide Sets All Se
198. ntamer d AACTG AG is AGAACTG AG AA AG AC AG CT AG TG 1 9 1 3 1 6 1 9 6 7 kcal mol For full value of AG you d need to add the initiation values for both Gs at the ends and the dangling end values if present Table 2 Free energy values of dangling ends from ref 27 Explanation how to read the table teune TCTICTGTTTTGCAGA gt the ane TTTGCTLTICTGTITTGCA AT 444 CGAGAAGACAAAACGT TA 3 end dangling G 5 end dangling G in the table listed as 3 CT in the table listed as 5 AC 171 Table 2 continued AG values calculated for 37 C OO ES ATT 096 042 A O1 01 on O Q 44 0 42 0101 01 4 gt AJOIN aN CO I N O 3 3 9 oo PIOIOIHIPIOIO OIOIOIOIOIOQIOI O g1 gt 9 gt on or gt 1 G gt gt 6 4 1 1 1 6 5 1 4 0 o 07 08 048 4 4 2 6 4 4 7 4 1 2 9 o jo gt OQ C2 Aya OJO 44 149 O19 M k a o 0 0O 47T 142 0288 3 OQ 02 OQ gt 29 104 029 RER 12 ak 2 O o P2 PIPIO gt G2 2 gt A O 172 Table 3 Free energy values of hairpin loop formation used by OLIGO in kcal mol from Ref 2 and 9 extrapolated Size G Size G Size G Size G 3 52 13 5 2 23 7 7 gt 40 10 2 4 4 5 14 5 6 24 7 9 gt 45 10 6 5 4 4 15 5 8 25 8 1 gt 50 11 0 6 4 3 16 6 1 26 8 3 gt 55 11 3 7 4 1 17
199. nternet please Print and fax this form to 1 719 684 7989 After this OLIGO 7 Customer Registration Welcome to OLIGO 7 Primer Analysis Software In order to protect your program you may Exit Oligo and when you receive the Access Code back from us you may re start Oligo enter the Code and click the Confirm Code button The registration would then be completed for this particular computer Mark Brown Institution and Department lowa State University Address Dept of Molecular Biology 4321 Campus Dr A 2345 Phone Number Ext Fax Number E Mail 123 456 7890 321 123 456 0987 mb isu edu Comments If you re re installing or replacing a komputer write it here License Workstation Code Access Code 7 1001 9703 9775 2346 Print Setup 3 f Print Save Exit Register If you re connected to the the Internet click the Register button at this point 3a 3b The registration e mail will be sent to MBI automatically and upon its completion the window should display the message Registration form successfully sent If you perform the registration during the MBI s normal operation hours Monday through Friday h 8 16 Mountain Time expect the returning Access Code within an hour Otherwise you may Exit the Oligo and start it again at later time when you d receive the Access Code Click the OK button to exit If your network does not perm
200. ntout of an open window or group of windows as specified in the Print Save Options dialog box To print window graphics copy the window contents to the Clipboard by pressing lt Alt Print Screen gt PC or 4 key Mac Than print the Clipboard picture directly or paste the Clipboard contents into a document opened with another application and print from it 3 9 File Print Preview The File Print Preview command displays the contents of the actual print out Use this option when you re not sure what is going to be printed 3 10 File Print Setup The File Print Setup command calls up the Page Setup dialog box where you can change printer and paper size Using this dialog box you can also select the paper orientation and the print scale size 3 11 File Print Save Options This option allows customization of what is going to be printed or saved with the Print and Save Data and Data as commands For printing any window contents you don t need to have these analysis windows open Only check the appropriate boxes in this dialog window and this will select the contents to be printed or saved z Fa E a 7 BOO Print Save Options Analyze 2 Search Data Database Print Save C F R U L M Y Current key Info a wi FA FA vw D Selected Duplex Formation HO B B O B B EAN Hairpin Formation O O O O B lade Composition amp Tm O O 0O f amp B elected False Priming Sites SHY 8 8 B Ji Editors Homology H FHF K Intern
201. o allows for saving the search results in a simple or in a full analysis formats By pressing the Save button the batch search process starts Oligo automatically saves the BatchResults log Same name as the search results txt file only a different extension a text file containing information when the proces started and ended and how many results were saved The batch processing does not open any results tables or analyze windows or save any files other than that described above You need to use your favorite word processor to open those search results files 6 6 Search Show Selected Bases It opens a table that displays all selected bases af eA Selected Bases File BRCA2 gene seg Sa String search results Loops Stems Palindromnes Strings 1250 i i 23 l 44 1251 7 6 7 24 7 34010 1252 0 7 0 25 a 34495 1253 8 26 40208 1254 g 27 58258 1255 10 28 67159 1256 19 137 68092 1257 20 138 68444 1258 21 139 69493 1259 22 i 140 71258 17AM 7 74 7 1a1 7 R711A T 444 32439 8458 11 i G r Figure 6 6 Selected Bases window The Loops column shows all nucleotide positions that form stable loops in the template marked dark red on the Sequence window the Stems column display positions of weak stems in oligos of Current Oligo size marked light red on the Sequence window the Palindromes column show all nucleotide positions involved in palindromes not shorter than 6 bp The last column St
202. o pentamer is represented by a red ball or a deep green bar while the rest of the sequence pentamers are represented by green balls or light green bars The colors are uniform for the other Internal Stability windows that show short oligos The cursor position number displayed at the top right shows the pentamer number in a given oligo or the position number of the sequence Current Oligo window Besides this cursor position you can read also the G value of the pointed on pentamer the cursor points at its 5 end This window can be used to check whether a given oligo has GC clamps or other variabilities in its stability An oligo with a slightly unstable 3 end but with higher stability along the remainder of its length is likely to be an efficient and specific primer assuming that other design characteristics are optimized 80080 Internal Stability File CBP seq a og 1868nt 25 mers pos 537 Ag 7 3 480 490 500 510 520 530 540 550 560 570 580 590 600 10 0 9 5 9 0 8 5 92 8 0 7 37 o 9000 o e TAAAGGTGATAAGATAGCAATATGGACTACTGAATGTGAAAACAGAGAAGCTGTTACACATATAGGGAGGGTATACAAGGAAAGGTTAGGACTTCCTCCAAAGATAGTGATTGGTTATCAGTCCCACGCAGACACAG Figure 5 12 The Internal Stability Current Oligo window The Internal Stability window has the same toolbar except that the Graph icon is missing as the Melting Temperature window that serve the same functions 14 5 13 Analyze Sequence Frequency Aa A A Freque
203. o see that employees agents or other persons under the direction of or in collaboration with the user abide by the terms of this agreement 1 1 6 Limited Warranty Molecular Biology Insights Inc MBI does not and cannot warrant the performance or results you obtain as a result of using the software or documentation MBI is not liable for any special indirect incidental or consequential damages in any way relating to the use or arising from the use of this software or program disks MBI gives a 30 day money back guarantee You may return this software within 30 days from the date of purchase for a full refund minus the shipping and handling cost 1 1 7 Governing Laws amp General Provisions This agreement is governed by the laws of the State of Colorado USA The user agrees that the software and documentation will not be shipped transferred or exported to any country or used in any manner prohibited by the United States Export Administration Act or any other export laws restrictions or regulations 1 1 8 Copy Protection OLIGO 7 customers must register their software license in order to use the program Note The program will not run on your computer until it is registered The OLIGO 6 registration process is included with the installation procedures on a separate insert which comes with this manual Once the workstation code is generated contact MBI Inc or its affiliates to submit the workstation code and re
204. of the Upper and Reverse Primers is too high As PCR or sequencing primers these oligos may be susceptible to false priming in a complex nucleic acid sample Select oligos with a less stable 3 end if your sample is complex unless your application does not involve priming 151 Terminal stability of the Forward Primer is too high As PCR or sequencing primers these oligos may be susceptible to false priming in a complex nucleic acid sample Select oligos with a less stable 3 end if your sample is complex unless your application does not involve priming That access code is incorrect Check your access code and re enter it If it is still incorrect call fax or E mail for technical support The computer s memory has been exceeded must exit OLIGO Quit the program and restart it with fewer windows and or applications open The number is not within the allowable range range specified Check the parameters again You may have entered something outside of the allowable range The position numbers you wish to read may be unrelated to the current sequence Check your sequence file and or the source of the position data This file does not contain valid oligonucleotide data This is probably not a Memory Table data file Select a Memory Table data file and try again This file does not contain valid oligonucleotide database This is probably not an oligonucleotide database file Select a database file and try again This fi
205. on single base sticky end ligation fill in ligation and deblock and ligation OLIGO automatically selects probes for the single base sticky end ligation Loop G Hairpin The stability of the hairpin stem plus the destabilizing effects of the hairpin loop expressed in kcal mol Lower Oligo a negative strand oligonucleotide that has been selected for analysis The Lower Oligo can be manually selected by the user or automatically selected by OLIGO during TaqMan search Melting Temperature Tm The temperature at which 50 of oligonucleotides are in duplex and 50 single stranded or 50 of a long molecule is in duplex and 50 partially melted For the default Tm calculations 1 M salt Na or K neutral pH and 100 pM nucleic acid concentrations are used The OLIGO program provides Tm values for oligonucleotides based on the nearest neighbor thermodynamic method that are in line with but approximately four times more accurate than the 2xAT 4xGC method Melting temperature calculations for longer nucleic acid molecules 50 100 nt and longer however are most accurately determined by the GC method Multiplex Primers Primers that do not form 3 terminal dimers with each other that are used for PCR in one incubation mixture The dimer stability threshold can be modified by changing search parameters Nearest Neighbor The most accurate method for calculating Tm of oligonucleotides see Appendix D for the formulas Negative Str
206. ons In Macintosh Oligo is installed in Oligo sub folder in the Applications folder In PC the default folder is C Program Files Oligo 7 Start Oligo 7 fill out the registration form and register it as described in Chapter 2 3 2 2 2 Installing OLIGO from a Compact Disk To load the OLIGO program to your hard drive 1 Insert the OLIGO 7 Disk into computer s CD drive 2 Mac double click on Oligo7Mac_Setup pkg installer package and follow the instructions displayed on screen PC Double click on the Oligo7Win_ Setup exe icon displayed in the CD drive window Follow the on screen instructions You would be asked for the folder name and location of the Oligo 7 application 3 Once the installation is complete double click on the Oligo 7 icon to start it and register your program license Alternatively you can start Oligo by choosing Start from the desktop followed by Programs Please follow the instructions given in Chapter 2 3 below 2 2 3 Troubleshooting the Installation If installation fails check to see if one of the following conditions is apply Computer Configuration Make sure your system meets the requirements listed in Section 1 4 Hardware and Software Configurations If not you may need to upgrade your system to run the OLIGO program Virus Detection Software sometimes virus detection software can interfere with installation programs If you have virus detection software that affects the installation tempo
207. open or closed lock This represents whether a given parameter can be changed during automatic stringency search You may wish to permanently fix a specific parameter to the displayed value by clicking on an open lock The lock should close Some parameters Oligo is not able to change automatically These sub searches are labeled with grey out locks The image below shows one of the sub searches in the More Constraints window 195 Template Loop AG Threshold 20 0 kcal mol This is active parameter for Compatible Pairs search blue dot on the left and the automatic stringency may change it if necessary For sake of this example increase this value to 6 kcal mol and lock this value and click OK You ve just set the parameter of a sub search that will eliminate all the PCR products not the primers that would make a hairpin with a AG larger than 6 kcal mol with the size of this hairpin not larger than 40 nt if the Template Loop Window Size was set to 40 nt Note that this test sequence has only one loop like this around pos 160 200 Sequence window marks it in maroon color 6 Click the Ranges button Instead choosing the search ranges manually click the Check Region s button 7 From the Features window select the 2 CDS coding sequence so you should see this ao 8 Features Feature Location E 1 source 18 1850 aw 2 CDs 1 651 and click the Accept button 8 Check the Find products in checked region
208. opening the active sequence This erases all search data closes relevant windows erases any selected primers and resets the temperature for G calculations to 25 It does not however change search parameters and other program parameters except the search ranges 3 12 2 Reset Original Defaults The Original Defaults command changes all search and non search parameters back to the original program defaults It does not reset data or close windows 3 13 File Exit and the Application Menu The File Quit OLIGO Mac or File Exit Win command quits the OLIGO program In the Mac OS X interface the Quit Oligo item is in the Application menu About Oligo Preferences Services p Hide Oligo wH Hide Others M H Quit Oligo 0 Figure 3 13 0 The Application Menu in Mac OS X In Mac OS X a new menu is added by the operating system that is called the Application menu It contains items that existed in other menus of OS 9 and earlier About Oligo has been moved from the Apple menu Preferences from the Change menu Services new system added item not functional in Oligo interface options Hide Oligo Hide Others and Show All and the last item Quit Oligo 39 3 13 1 Application Menu About Oligo This window displays credits MBI address and phone number and most importantly the Oligo version number mn Bigo l 2 Fig 3 13 1 About Oligo window Primer Analysis Software OLIGO is a multi functional
209. or by using the Remove and Select Deselect buttons after highlighting the listed window name This window is the same in Mac and PC systems be Open sequence from pos 1 to pos 100000 Preferences Figure 3 13 2 3 The Preferences dialog Windows tab Parameters Windows Update Startup Quit M Save size and position Add Remove C The next option the Update shows the server address from which Oligo When a sequence file is opened show windows in the update may be downloaded Please order indicated in the following list do not change this path unless MBI would inform you about any changes needed When you uncheck the box Automatically check for updates Oligo will not self update automatically You will still be able however to update it manually Sequence Defaults Cancel Figure 3 13 2 4 The Preferences dialog Update tab RO Preferences Parameters Windows _ Update Startup Quit v Automatically check for updates In the Windows version there is additional Restore file associations to Update the OLIGO software from Oligo 7 button It is useful when http www oligo net you d have Oligo 6 on your computer and if you d happen to start this old version after Oligo 7 installation Oligo 6 would automatically make sequence and database files belong to itself so that Oligo 7 would not recognize the icons any more By clicking this button Oligo 6 databases Default
210. ore if there s a mismatch the real Tm is lower than the value displayed in the right column This Tm is usually different than the tm because it considers the corresponding dangling ends in the sequence Depending on the sequence the dangling ends may have destabilizing or stabilizing effects The nucleic acid and concentrations used to calculate the T can be found in the Database Options window or if the Use the linked sequence parameters check box is checked the concentrations may be changed in the Search Parameters of the linked sequence 137 11 2 New Database Menu Items The menu items for the Database menu are described here The entire main menu changes when the Database window is active 11 2 1 File The File menu is essentially the same as the standard File menu but some options are different Close function closes the currently active database and nothing else Function Save has less options and Revert to Previous Database brings back the database previously saved so that the all edit operations made after the save are discarded 11 2 2 Edit The Edit allows you to modify delete and view oligonucleotide records Undo Modify az Cut HX 35 Copy C il Clear Select All ab A Edit Selected Record Edit Selected Set Add Record Add Set Renumber Figure 11 2 2 1 The Edit submenus Mac interface The only difference with PC is that instead of the short cut key 3 there is the Ctrl It is
211. orizontal scroll bar to see the probe AOA Sequence l File Human elF 4E seq p DNA Sequence Selected Oligo Position Length Feature Location Sequence Length 1868 nt Ji B Forward Primer 216 19 1 source 18 1850 Reading Frame 1 Ji B Reverse Primer 295 21 2 CDS 1 651 Current Oligo Length Zilnt J amp Upper Oligo 243 30 Position 213 O Lower Oligo PCR Product 1100 Sa nt prta sta aba 1000 1100 1200 1400 1400 1500 1600 1700 l TTGGGCTCTGTACAACCAT gt Em T en T C r MeCOCICIGTACAACCATATCCAGTTOTCTAGTAATITAATGCCTOGCTGTGACTACTCACTITITAAGGATGGTATTGAGCCTATGTOGGAAGATGAGAAAA GAAAACCCGAGACATGTT GGTATAGGTCAACAGATCATTAAATTACGGACCGACACTGATGAGTGAAAAATTCCTACCATAACTCGGATACACCCTTICTACTCTITI i CTCGGATACACCCTTCTACTC FRALYNHIQUSSNIMPGCDYSLFRDGTEPNWED EKA TOE ja 4 6 View the probe under various Analyze windows especially Analyze Hairpin Formation Upper Oligo 198 4 7 Searching for siRNA Probes akon eo N Open Human elF 4E seq Choose DNA to RNA from the Change menu Choose the Primers and Probes option from the Search menu Click the siRNA Probes button Click the Search button The oligos are found and displayed in the Selected Oligonucleotides Table Double click on the first record You ve selected the sense strand of a siRNA probe Choose Lower Oligos from the pull down menu top left of the window Double click on the first record You ve selected the antis
212. ote that by clicking on the nucleotide symbols or the graph itself you are actually moving to the new positions If you zoom out the Tm window by clicking on the loupe symbol with sign you still can change the Current Oligo position by clicking on the graph 5 Close all but the Sequence window and choose Selected Bases from the Search menu You will see 4 columns there Loops showing strong stems of the sequence and Strings columns are empty because you haven t searched yet for the strings and there are no strong stems below 12 kcal mol a default search parameter setting for Template Loop AG 190 Threshold with the Template Loop Window Size of 40 nt in this DNA sequence file Columns Hairpin loop Stems and Palindromes are filled with numbers as those searches are initiated automatically as soon as you open a sequence file By clicking on any of those numbers you change the Current Oligo position 6 Another method to change the Current Oligo position is to open the Select New Current Oligo Position from the Select menu and entering the desired position number 7 Make a quick search for Sequencing Primers Search gt for Primers amp Probes gt click Sequencing Primers followed by Search buttons After the search you ll see the Analyze gt Selected Oligonucleotides window You may also select the Current Oligo by clicking on any row displaying Forward or Reverse Primers By double clicking on these prim
213. ound On Off The Sound On Sound Off command activates deactivates sequence read out 4 1 2 11 Edit Read back On Off The Read back command reads back the key presses you make while entering a new sequence 4 1 2 12 Edit Full Screen Edit The Full Screen Edit window displays an oligo or the entire sequence Either nucleic acid or protein sequences can be edited here e99 Edit Sequence Fila CBP seq Accept Discard Edit Search Change Rev Translate gl 48 J Ti A fd to HA pos 165 18 CGATCAGATC GATCTAAGAT GGCGACTGTC GAACCGGAAA CCACCCCTAC TCCTAATCCC CCGACTACAG AAGAGGAGAA 63 AACGGAATCT AATCAGGAGG TTOCTAACCC AGAACACTAT ATTAAACATC CCCTACAGAA CAGATGGGCA CTCTGGTTIT 1435 TTAAAAATGA TAAAAGCAAA ACTTGGCAAG CAAACCTOCG GCTGATCTCC AAGTITGATA CTGTTGAAGA CTTTTGGGCT 223 CTGTACAACC ATATCCAGTT GTCTAGTAAT TTAATGCCTG GCTGTGACTA CTCACTTITTT AAGGATGGTA TIGAGCCTAT 3 3 GTGGGAAGAT GAGAAAAACA AACGGGGAGG ACGATGGCTA ATTACATTGA ACAAACAGCA GAGACGAAGT GACCTCGATC 383 GCTTTTGGCT AGAGACACTT CTGTGCCTTA TTGGAGAATC TTTTGATGAC TACAGTGATG ATGTATGTGG CGCTGTTGTT 463 AATGTTAGAG CTAAAGGTGA TAAGATAGCA ATATGGACTA CTGAATGTGA AAACAGAGAA GCTGTTACAC ATATAGGGAG S25 O6TATAC AAG GAAAGGTTAG GACTICCTO ASAGATAGTO ATTOGTTATC AGTOCCACGC AGACACAGCT ACTAAGAGL Clipboard E CACAAAGG INS DNA Figure 4 2 12 1 Full Screen Edit window The Toolbar functions are listed in Fig 4 2 12 2 Besides the Toolbar information the full screen edit window displays e The
214. ow A fragment of the same window as shown on Fig 5 14 1 but with a different color coding is shown This window displays all open reading frames of the loaded sequence They are displayed graphically on the top and as text on the bottom part of the window The toolbar is located just below the sequence file name and contains the following elements e The zoom in and out slide bar to accurately control the size of the graphic display e The Options ap icon allowing for changing meaning of the colors By default the codon frequencies are displayed in various colors but you may change this to amino acid type where acidic amino acids are labeled in red basic in blue hydrophobic and aromatic in brown except the tryptophane and methionine nucleophilic small in black cysteine in yellow and proline in green e The minimum size of an open reading frame that this window displays can be changed by typing the number on the Min ORF Size box Typing a larger number will eliminate short ORFs from the display thus somewhat cleaning up the window e The cursor position is displayed at the right The bottom window indicates this position by a vertical grey line ORFs are displayed graphically below the tool bar The yellowish rectangle dividing the positive and negative strand ORFs has a green box representing the range of the lower portion of the window with amino acid symbols and the DNA sequence The extent of the zoomed graph show also
215. ow for calculation of the degeneracy is of the size of the Current Oligo length There are two display styles available for this window bars and dots that may be switched by clicking the Options _ icon at the top of the window The full Apian menu of the Melting Temperature window is displayed below 1869nt 24 mers v Show Mean Value Bars Show Threshold Values eo er 44 Dots i mm Figure 5 11 3 The Melting Temperature window Options menu The other two items of this menu are e Hide Show Mean Value When the show option is selected a dotted line is displayed in the Melting Temperature window The line represents the mean Tm G GC or degeneracy of all the oligonucleotides of the selected 73 length in the active sequence This mean value is shown as the center line on the Tm plot e Hide Show Threshold Values The other two lines represent the upper and lower Tm threshold settings currently controlling the Oligonucleotides Within Selected Stability Limits sub search which is used by the PCR primer sequencing primer and hybridization probe searches 5 12 Analyze Internal Stability These windows plot the G of pentamers internal stability of the active sequence Current Oligo and all individual primers and probes There are two display styles available for this window bar and dot that may be switched egapads BATE a bt oT using the Options icon Each base of the Current Olig
216. p Probes window causes re setting the parameters to their default values 8 4 1 Search Parameters Global Settings The Search Parameters include global and individual search stringency settings sequence constraints and scoring windows The Search Parameters option can be accessed from the Change menu or from the Search menu via the Search for Primers and Probes window oc Search Parameters oc Search Parameters Parameters More Parameters Sequence Constraints Scores Parameters More Parameters Sequence Constraints Scores E Search Stringency High A e Min Acceptable Loop AG 0 0 kcal mol v Automatically change stringency e Max Acceptable False Priming Efficiency 185 points s Jimem Min Consensus Priming Efficiency cd points e Penalize for Tm P E discrepancy Max Acceptable Homology 70 Max of Selected Primer Pairs 3000 Min Consensus Homology 95 Primer Length 21l 2 nt Max of Mono Nucleotide Repeats 3 nt e Acceptable 3 Dimer AG 2 8 kcal mol Max of Di Nucleotide Repeats 2 nt e Strongest Dimer Overall AG 7 5 kcal mol Max Length of Repeated Sequence 5 nt e 3 terminal Stability Range 7 0 0 8 kcal mol e Max Degeneracy 1 variant s 5 terminal Stability Range 8 5 1 0 kcal mol Frequency Threshold 1300 points Internal 12 mer Stability siRNA 22 0 2 0 kcal mol Template Loop AG Threshold 12
217. pen reading frames color coding from amino acid type to codon frequency 10 Note a slide button at the top left of the ORF window amp O amp By dragging it to the right you ll see zooming in the ORF graph This feature is very useful when the opened sequence is large 3 3 Open and Print all relevant windows with one mouse click You can open or print all the windows of your choice with just a one click To set this up you need to 1 Open the File Print Save Options window The default is to print or save only the top current window as shown below Print Save Options Analyze 2 Search Data Database Print Save C F R U L M Current Selected Key Info All Opened Duplex Formation Hairpin Formation Exclude Composition amp Tm False Priming Sites Homology Internal Stability 4 Cancel i C urrent Oligo F orward Primer R everse Primer U pper Oligo Dower Oligo Mixed Oligos OK 2 Click the Selected button and than check the appropriate boxes In this example we check the Key Info for the Forward and Reverse primers and Duplex Formation windows for the Forward Reverse and mixed primers and also we ve changed a different database print output to Full Analysis and the Multiplexing data as shown below O O Print Save Options Print Save Options Analyze 1 Analyze2 Search Data Database Print Save Analyze 1 Analyze2 Search Data Database Print Save F R U L
218. r human DNA Drosophila mouse rat wheat and yeast If you are working with other organisms you can create your own frequent or repetitive sequence file s by extracting them from GenBank Once the files are selected and the search is started OLIGO rejects any oligonucleotide sequence that would false prime on any target in a repetitive sequence file 98 This subsearch is controlled by the same search parameters as the Eliminate False Priming Oligonucleotides subsearch 6 1 3 17 Consensus Primers Probes When you click in this box you may select other file s homologous to the active sequence to find primers common to all files Consensus primers are those which prime at least with the e Min Consensus Priming Efficiency or e Min Consensus Homology probes a variables set in the Parameters window Clicking this check box calls up the Select Files dialog from which you may select homologous sequence files for consensus primer design in an analogous way as it s in the Continue Above search In Other File s subsearch With this method unique non degenerate primers or probes will be found that prime or hybridize to all selected sequences These primers probes may have mismatches but their P E or homology to the other selected sequences will be above or equal to those two parameters listed above 6 1 4 Search for Primers and Probes Ranges The search ranges window allows you to limit searches to specific segments of
219. r or he 3 ends of all oligos using reactions because of hairpin formation Stability algorithms eliminating potential at their 3 hose with dimer or hairpin end potential Performance Application Design Remedy Selection Feature Problem Reduced efficiency PCR Select oligonucleotides GC Clamp Determine stability PCR or sequencing Sequencing ith high or G of the 5 end and center reactions due to low moderately high segments of oligonucleotides primer Tm Stability along their select only those with high or lengths except for the Imoderately high stability 3 end Very low efficiency Select cross Cross compatibility Check PCR reactions compatible Upper and Check the 3 ends of Reverse because of 3 Reverse Primers Primers against the 3 ends of dimerizing between primers with low 3 Forward Primers using stability he Upper upstream dimer forming potentialjalgorithms eliminating those and Lower between them pairings with dimer potential downstream primers Match the Tms of the Tm Matching Add nucleotides to alse priming of the Upper and Reverse __ the 3 end of the Lower Tm primer higher Tm primer in a Primer until its Tm most closely matches PCR reaction he higher Tm primer Reduced efficiency Sequencing Select oligonucleotides Tm Window Select only oligonucleotides with Tms within Upper and Lower Tm thresholds 157 Mutations in the primerjSequencing Select oligonucleotides Homooligomer and S
220. rae TEE SCTOLL BA DO ABE ces eens 2 22454 27004 1517aa 170223 0 7 1 3 Choose Search for Restriction Sites in Protein option It should indicate Reading Frame 2 Search for Restriction Sites in Protein Search Sequence Reading Frame 2 E Portion Start 22454 End 27004 End Cut Type v Blunt v 3 overhang v Odd v 5 overhang Limit v Limit the number of sites Maximum of restriction sites 5000 Cancel Search 4 Type in the Start and End position numbers of the protein You should find those numbers in the ORF window 5 Click the Search button if you want to find all possible enzyme Cut Types 0 09A Restriction Enzyme Sites in Protein File BRCA2 gene seq 2hezyme 122500 23000 23500 24000 24500 25000 125500 26000 26500 i allel banaba i E EE a LLE I A 55 Pvul 56 Pvull L E E M 57 RIeAl 58 Sacl TEN _ Il 59 Sac 60 Sall im D 61 Sapl IL 62 Scal a ip 4 63 Smal 7 Enzyme Site Cuts Positions amp Fragment Sizes 68 Spll RT3VRwYS 4 21775 23132 1409 24541 1663 26204 159 26363 23094 69 Sspl NILicvY7 22 22369 22538 325 22863 173 23036 135 23171 280 23451 v 102 23553 287 23840 139 23979 14 23993 198 24191 i 162 24353 54 24407 163 24570 429 24999 192 25191 696 25887 144 26031 273 26304 111 26415 215 26630 96 26726 208
221. rameters and output are the same as for the restriction sites search OLIGO has 79 restriction enzymes that can be selected for the search All are six base cutters or longer and none have degenerate bases In the table displayed after the search under the Site field protein sites that are recognized during the search are listed OLIGO uses its own symbols for various degenerate amino acids see Appendix E Degenerate Amino Acid Symbols Standard amino acid symbols are listed in Appendix E Non degenerate Amino Acid Symbols 6 5 Search Sequence Files This function lets you choose sequence files for automatic batch processing When you start a search for Primers amp Probes those files will be searched and the results stored in a file specified by you default name is BatchResults txt There is no separate Analysis window display to show the search results from multiple files The search protocol starts from displaying the empty Batch Processing window First you d need to click the Select Files button and select the sequence files see Fig 6 5 1 When you re done with selection you may save the set of files under its own name and use this set in subsequent batch searches The dialog box allows for the removal of files from a given set and also removal of the entire sets 102 eOoe Select Files File Sets Select Set Remove Set Search in Files Sequences CPE Chicken elF 4E seq i Add _ Files 5equences CPBE
222. rarily remove or disable it and try installing the OLIGO program again Refer to the manual for your particular software package for more information on this Disk Compression Software If you are using disk compression software and have a small amount of available disk space it could interfere with installation Try to make more space available on your hard drive or disable the compression software before attempting to reinstall the OLIGO program Installer Doesn t Work Oligo software can be installed only if you have administrator privilages to install new software If you cannot save files to the Program Files or Applications Folder you need to log out and log in with the account that has administrator privileages or ask your IT manager to install Oligo for you 2 3 Registering OLIGO In order to protect your copy of the OLIGO program and provide you with prompt technical support we need you to register as an OLIGO user with your distributor prior to accessing OLIGO or seeking technical support The registration form takes a few minutes to complete and you should receive your access code within an hour after contacting your distributor during normal business hours Because each installation creates a unique workstation code you will need to register each computer separately 2 3 1 The License Registration To register your OLIGO software on each computer follow these steps 1 Double click on the OLIGO icon to call up the
223. registration procedures 2 Once the Customer Registration window appears complete each field Use either the mouse or lt Tab gt to move to each field This window must be completed for each workstation you are registering See Figure 2 3 1 1 18 Your e mail address must be entered to make the Register button active The Fax number should be entered to get the Print button active if you have no access to the Internet Leave the Access Code field blank OLIGO 7 Customer Registration Welcome to OLIGO 7 Primer Analysis Software In order to protect your program license and provide you with prompt technical support please complete this customer registration form and click Register button If you are not connected to the Internet please Print and fax this form to 1 719 684 7989 After this you may Exit Oligo and when you receive the Access Code back from us you X may re start Oligo enter the Code and click the Confirm Code button The registration would then be completed for this particular computer Principal Investigator or Manager s Name Mark Brown Institution and Department lowa State University Address Dept of Molecular Biology 4321 Campus Dr A 2345 Phone Number Ext Fax Number E Mail 123 456 7890 321 123 456 0987 mb isu edu Comments If you re re installing or replacing a komputer write it here License Workstation Code Access Code 7 10
224. ringency With this window you may also define the scoring system for primers amp probes For more information on Parameters including detailed descriptions of the functions in the Search Parameters window see Chapter 8 4 6 2 Search for Sequence String The Search for Sequence String command searches the positive or negative strand of the active sequence for a sequence string of nucleotides that you select The position data of the strings can be found in the Selected Bases window and are represented graphically in the Sequence window as a yellow bar A search in the positive strand marks the 5 terminal bases of any sequence strings found and a search in the negative strand marks the 3 terminal bases String Search in strand sequence String GGGGATC Allow QO mismatches K Translate ambiguous bases K GT M AC RAG S CG WAT Y CT B not A D not C Hinot G Vinot T INX any k Cancel Find Figure 6 2 The Search in the Strand dialog box Sequence strings that include ambiguous bases can be used in this search option A search for AGN for example marks the positions of every AGA AGC AGG and AGT string in the active sequence When you select Search for Sequence String choose from the submenu a search in either the positive or negative strand After selecting the positive strand the String Search in Strand dialog box appears After selecting the negative strand the
225. rings displays only the first nucleotide position of the searched string By clicking on any 104 number on this table you move the Current Oligo to this particular position number watch the Sequence window 6 7 Search Primers and Probes Search Data The Primers and Probes Search Data window shows the search settings and raw data for the most recent Primers amp Probes search conducted This data window reports all subsearches that took place and the Search Parameters settings that were used Along with the list of subsearches it reports the number of accepted oligos that passed a given subsearch routine This window is especially useful when searching for consensus primers or probes it is easy to spot non homologous sequence files and eliminate them from consideration in the next search see Fig 6 7 This window does not report the search parameters that were not used in the last search despite that they were displayed in the Parameters window aoe Primers amp Probes Search Data File Human elF 4E seg Search Results ee ti i Oligos Accepted File Name Human elF 4E seq Subsearches Search Method Sequencing Primers Strand Strand 7 7 i E Eliminate Ambiguous Bases 3108 3109 Conditions for Tn and AG Calculations Oligonucleotides within Selected Tm Limits 1120 1003 Monowalent lon Concentration 50 0 mM Oligonucl
226. rive 2 Mac double click on Oligo7Mac_Setup pkg installer package and follow the instructions displayed on screen PC Double click on the Oligo7 Win_ Setup exe icon displayed in the CD drive window Follow the on screen instructions You would be asked for the folder name and location of the Oligo 7 application 3 Once the installation is complete double click on the Oligo 7 icon to start it and register your program license Alternatively you can start Oligo by choosing Start from the desktop followed by Programs 1 2 Registration In order to protect your copy of the OLIGO program and provide you with prompt technical support we need you to register as an OLIGO user with your distributor prior to accessing OLIGO or seeking technical support The registration form takes a few minutes to complete and you should receive your access code within an hour after contacting your distributor during normal business hours Each installation creates a unique workstation code so you will need to register each computer separately 184 To register your OLIGO software on a computer please follow these steps 1 Double click on the OLIGO icon to call up the registration procedures 2 Once the Customer Registration window appears complete each field Use either the mouse or lt Tab gt to move to each field This window must be completed for each workstation you are registering See the figure below Your e mail address must be entere
227. rotein sequence is edited its adjoining nucleic acid sequence is modified according to the current reverse translation method however this is not 50 displayed in the protein sequence editor in the Full Screen Edit window but only in the Mutagenesis window 4 1 3 Edit Window Menu Search Search Change Rev T QA Find HF Find Next G Current Oligo Position Go to t Position Figure 4 1 3 The Edit window Search menu 4 1 3 1 Search Find and Find Next The Find command searches for a sequence string entered from the keyboard in the entire edited sequence The first occurrence of the sequence is highlighted Use the Find Next command to search for the next occurrence 4 1 3 2 Search Go to The Go to command moves the insert bar to the Current Oligo position or prompts you for a new position number in the active sequence and moves the insert bar to the position you enter 4 1 4 Edit Window Menu Change Change Strands al DNA to RNA 2 sLathe Reading Frame p 3 Inosine Rev Translate Method W Degenerate Codon Table Codon Table Figure 4 1 4 The Edit window Change menu 4 1 4 1 Change Strands The Strands command creates and displays the complementary strand of the edited sequence instead of the original 4 1 4 2 Change DNA to RNA The DNA to RNA command changes a DNA sequence to RNA and vice versa The menu display toggles back and forth between DNA and RNA 51 4 1
228. rrent Oligo 61 e The stability values of the most stable duplex shown in red in each alignment and of the hairpin structure expressed in kcal mol Tm of the hairpin is displayed when it is greater than O 5 2 3 Duplex Formation Mixed Oligos This window displays all possible alignments between the all selected oligos up to 4 pairs Forward amp Reverse Primers Upper amp Lower Oligos Each pair is aligned in 3 ways 1 2 The most stable dimer alignment pairing the 3 terminus of one of the oligos to any segment of the other and vice versa 3 The most stable dimer structure overall between the two oligos The stability values of the most stable uninterrupted duplex in each alignment expressed in kcal mol O 2 amp Mixed Oligos Duplexes File MISMP1 Forward Primer MLAMPLS 1593F21 with Rewerse Primer MLAMPLS 1743R18 Forward Primer The most stable 3 direr of hydrogen bonds 6 AG 1 1 kcal mol 3 CACCTTACGATGTCCGCA 5 Rewerse Primer The most stable 3 dimer of hydrogen bonds 2 AG 0 9 kcal mol Ls S ee ee are ee 3 3 CACCTTACGATGTOCGCA 5 The most stable dimer overall of hydrogen bonds 6 AG 1L 1 kcal rmol 5 PENSA EEO ik ellie doa a 3 CAROCTTACGATGTCCGCA 5 Forward Primer MLIMPL amp S 1593F21 with Upper Probe MLISMPLS 1615U23 Forward Primer The most stable 3 dirmer of hydrogen bonds 2 AG 0 1 kcal mol 5 iat a 3 3 PISTOGCCTCACTCTTATCTTTOC 5
229. s Cancel gt and sequences would be opening 41 again with Oligo 7 automatically The fourth Preferences tab is Startup Quit A Preferences Parameters Windows Update When quitting the OLIGO save its memory content to 2 fA SavedWork wrk Yes No When opening the OLIGO without any document read the memory content from the above file Yes No Defaults Cancel C ok Figure 3 13 2 5 The Preferences dialog Startup Quit tab By default when you quit Oligo and re start it you will need to open or edit a new sequence This parameter lets you open Oligo with all the windows and searches you had before quitting the application This is a similar feature that was implemented in Oligo 6 but the old SavedWork files are not compatible with new versions of Oligo If you need to permanently save your search results and oligo sets please save the database or search results using the File menu Saved Work file can also be saved independently through File Save Work but be adviced that future Oligo versions may not be able to open it 3 13 3 Application Menu Other Items Services option displays other applications but it is not functional in Oligo Hide Oligo hides all Oligo windows and Hide Others hides all non Oligo applications windows Show All brings all the hidden windows to the desktop Quit Oligo Mac or Exit Oligo Windows quits Oligo application These it
230. s and or multiplexed primers 148 Error Try your last OLIGO operation again You may have inadvertently tried a function that is not operable in combination with the features you are using Error encountered during print Check your printer and its connections Excessive difference between product and primer melting temperatures This difference may contribute to false priming of the higher Tm primer Remove nucleotides from the 5 end to reduce and match Tms or choose different primers Expecting a float number Check your last entry and re enter it There may be a decimal point a letter or an illegal character in your entry Expecting an integer number It s possible that there is a decimal in your entry Remove the decimal and try again Expecting a negative number A positive value may have been entered Make sure the entry is a negative number and try again Expecting a positive number A negative value may have been entered Make sure the entry is a positive number and try again Hairpin loop in the Reverse Primer Check hairpin stability Consider redesigning the oligo if the hairpin is stable particularly a 3 hairpin Hairpin loop in the Forward Primer Check hairpin stability Consider redesigning the oligo if the hairpin is stable particularly a 3 hairpin Invalid sequence The sequence file may contain illegal characters or it may be an invalid sequence format Refer to Troubleshooting Situations Ge
231. selects oligos with certain Tm range e Hairpin free Oligonucleotides e Eliminate Mono and Di Nucleotide Repeats selects oligos without internal repeats e Detect Sequence Repeats selects oligos without other repeats than the above option e Eliminate False Priming Oligonucleotides To run the search for sequencing primers from the Search for Primers and Probes dialog box 1 Select Primers and Probes from the Search menu 2 Click on the Sequencing Primers button 3 Click in either or both boxes at the top of the window to select Strand Search Strand Search or both 4 Click on the Search Ranges button to check your search ranges The default is to check the entire sequence 5 Establish your subsearches by clicking on the subsearch boxes you want optional 6 Click on the Parameters button to check your search stringency and other search parameters optional For most searches a high stringency setting is recommended since the program automatically relaxes settings if no oligos are selected at higher settings However the Automatically change stringency box must be checked for OLIGO to relax the settings Note Turn off the Automatically change stringency box Search Parameters dialog when you manually set search parameters You may lock certain parameters by clicking at the lock button When the parameter is unlocked it may be changed automatically during the search Stringencies are automaticall
232. sequence file name top left e The edited sequence with the first nucleotide in each line numbered e Contents of the Clipboard e The keyboard insert mode e The type of the edited sequence DNA RNA Protein 48 Epa F position the sequence begins at this number Cut Copy Paste Undo Redo Read back Cursor position in acce Gu l J Hi VA gt elaiiaia t yi l pi LN ci 10 H pos 1731 as Bl v 3 A T i Figure 4 2 12 2 Functions of the Edit windows Toolbar 4 1 2 13 Edit Mutagenesis The Mutagenesis window displays a single line of 50 100 bases at a time for viewing or editing depending on the width of the Edit window You can switch from a nucleic acid sequence to a protein sequence in this edit mode by re positioning the cursor This window also displays the most stable hairpin codon probabilities and several other characteristics of the displayed sequence Besides what displayed on the Toolbar single line edit information includes e Sequence Length e Active Reading Frame e Degeneracy e tm low case indicates that the nearest neighbor method does not consider the dangling ends with the template G e Loop Tm e Loop G e Reverse Translation Method e Codon Frequency for a selected organism the sum of all 64 codons is equal to 1 000 e Nucleotide sequence with position numbers e Translated Protein Sequence e The strongest hairpin of the above displayed sequence e Contents and size o
233. should be displayed in the Database window Columns Select Deselect and cannot be hidden so they are greyed out Change Multiplexing Mode There are two methods of multiplexing the Database records The first default is for primers multiplexing that is Oligo checks for the presence of 3 dimers between the records The second is for multiplexing hybridization probes In this case Oligo checks whether the oligonucleotides in the database would not stick to each other based on inverse homology For example two probes GGGGC 40 homology to itself 2 sticky bases in a 5nt long probe and GGGGA 0 homology to itself would be compatible but GGGGC and ACCCC 0 homology to itself are not compatible 80 homology to each other The Homology field in the database displays the following letters that stand for SC self compatible D forming a dimer HH high self homology C compatible with multiplexed M multiplexed NC non compatible All these qualifications depend on the Parameters settings of the Change Options menu 145 11 2 8 View The View Menu has only two items Toolbar and Status Bar You may hide or display those window elements These are functional only under Windows systems 11 2 9 Window The Window Menu displays variable number of items depending on the number of opened sequence files and windows The figure below shows all the items when two sequence files and one database is ope
234. signed specifically to search for and list the position sequence and other data of all oligonucleotides or primer pairs that optimally meet these major requirements plus several other criteria outlined in this manual 1 3 Hardware and Software Configurations 1 3 1 Requirements Pacinos pw Computer Type Mac with Power PC Pentium and up G3 G4 or G5 or Intel processors Operating System System 10 3 or Windows 95 and higher higher Disk space RAM 20M 128M 20M 128M Table 1 3 1 Hardware amp Software Requirements 1 3 2 Compatible Sequence Files Acceptable Nucleic Acid Sequence File Formats Text ASCII EMBL GenBank Entrez Flat Files and files from most sequence analysis programs capable of generating plain text files 1 3 3 Monochrome Monitors OLIGO is designed to work on a color monitor Throughout this manual you may find references to particular on screen colors used to identify information If you are working on a monochrome screen you will not see clearly these color distinctions however the functions work the same 1 4 Files Present With the OLIGO Program Following is a list of the OLIGO files stored by default in the OLIGO Folder 1 4 1 Oligo 7 Software Oligo 7 interface is written in Java and the search analyze engine is written in native codes for PC Windows and Macintosh OSX 1 4 2 Supporting Files By default all files for the OLIGO 7 are located in the OLIGO folder installed
235. single user license requires that the principal investigator or license holder register with an authorized distributor 1 1 3 Multi user License This multi user license permits the installation of this software on the computers that belong to several principal investigators Each principal investigator in the multi user agreement receives his her own single user license and is obligated to abide by the terms of the single user license for 1 computer The multi user license requires that all principal investigators or their assigns register with an authorized distributor 1 1 4 Network License The network license permits the installation of this program on your facility s network and its use simultaneously on given number of client computers nodes specified in the license contract The license does not permit the installation of the program on computers other than those stated The network license requires that the network administrator or the users register with an authorized distributor 1 1 5 License Transfer The authorized distributor licenses software to a particular user You may not rent sublicense or lend the software to another user You may however transfer the full software license and documentation package to another user If the license is transferred contact your distributor to update the license This assumes that the software is removed from the original machines The user must make all reasonable efforts t
236. sor More than one base can be selected for editing by highlighting them as a group using the click and drag technique with the mouse When at least three characters are displayed in the Edit window all codon probabilities for a given amino acid and a given organism may be observed by positioning the cursor on any portion of the sequence or protein 45 The edit functions in the Edit window are accessible from the Edit menu or from the icons listed here Most of these functions are not accessible until at least one base has been entered and highlighted These edit functions are standard Windows Macintosh functions and perform in the same manner in the OLIGO program as they do in other Windows Macintosh applications Edit Forward Primer Edit Search Change Rev 2 Undo Paste gZ Redo Paste Z Cut 3X Current Oligo ES Copy 3C Forward Primer J Paste eV Reverse Primer T Clear Upper Oligo Lower Oligo Select All BA Database NewDatabase odb Merge with File Group by b Off Overwrite 3 Sound On Readback On 210 Full Screen Edit e Mutagenesis e Nucleic Acid Protein Figure 4 1 2 The Edit window Edit menu 4 1 2 1 Edit Undo Redo 4 ES Clicking on these icons Undo is on the left reverses the last editing action including Clear if it is selected immediately after that command You may also select these actions from the window Edit menu or use a short cut Z Mac keys combina
237. t check or uncheck the appropriate boxes search Mode The Search Mode is controlled by the Select and Verify buttons The Select search mode is standard for all composite searches and subsearches wherein all the oligonucleotides in the sequence within a given search range are tested In the Verify search mode all oligos previously found by the search are verified whether they still pass all the tests This could be useful after a search at lower stringency followed by increasing the search stringency parameter s Oligos that fail to pass through the various subsearch filters are removed leaving only oligos that passed those two subsequent searches When the Complex Substrate box is checked two additional subsearches are performed the Highly Specific Oligos subsearch that eliminates primers with excessively stable 3 ends and the Eliminate Frequent Oligos subsearch that eliminates primers having 3 ends which occur more frequently in a given database of sequences If the substrate for your PCR or sequencing reaction is not complex i e plasmid checking this box is not typically necessary 87 6 1 2 Composite Search Options PCR Primers This option generates optimal PCR primer pairs from a nucleic acid template Compatible primer pairs can be selected across the entire active sequence or they can be selected from specific regions on the file by setting search ranges Setting search ranges also speeds up this and
238. t repetitive sequences 1 4 5 Tables Folder The Tables Folder includes the following files 4 ENZ A restriction enzyme site database of sites containing least 4 cutters 5 amp UP ENZ A restriction enzyme site database of sites containing at least five non degenerate cutters 7 amp UP ENZ A restriction enzyme site database of sites containing at least 7 cutters Codon Usage Tables A codon usage table an editable text file NICE6 amp UP ENZ A restriction enzyme site database of six base and greater non degenerate cutters rebase enz comprehensive restriction enzyme database from NEB transcription factors txt a file that may replace enz files to search for transcription factor recognition sites while using the search for restriction enzymes option type Il commercial enz available on the market restriction enzymes another file containing enzyme recognition sites 1 4 6 Test Sequences Folder BRCA2 gene seq one of the human breast cancer genes ACCESSION AY436640 an 85469 nt long sequence with several annotated features organism name elF 4E seq collection of protein synthesis factor 4E sequences for testing consensus primers searches 14 files Human elF 4E ami protein sequence sample file M13MP18 seq bacteriophage sequence sample file 1 4 7 Files Present Outside the Oligo Folder In the personal folder Oligo sets up Oligo Settings folder containing e Parameters a file containing r
239. t that it searches in files other than the active sequence file This may be helpful if you want to find a primer that distinguishes closely related sequences Click on the subsearch box to call up the Selected Files dialog box The dialog box lists the directory of sequence files stored in the OLIGO folder and provides access to other drives and folders where you may have your sequence files To add files to the list to search 1 Click on the Add button in the Select Files window 2 Click on the file name you want to add to the search You may need to change the folder first 3 Click on the Add button You can add as many files as you want to check The files are going to be checked sequentially for false priming sites 4 When you are finished selecting files click the Done button to return to the Search for Primers and Probes dialog box To remove files from the list 1 Click on the file name you want to remove from the list 2 Click on the Remove button Note If you are conducting searches for PCR and sequencing primers that are to be used in genomic or other complex DNA samples this subsearch has a special FREQSEQ folder frequently occurring or repetitive sequences in various organisms where files may be called up to filter out oligos in the active file containing repetitive sequence Click on the FREQSEQ folder to call up the individual organism files The FREQSEQ folder includes sequence files fo
240. table for a given organism To add a new codon frequency table to the list modify the codon table file Codon Usage Tables There are four lines in each codon table file 1 The name of the organism 2 The codon frequencies for that organism as described in Nucleic Acid Research Ref 18 3 The codons listed in order of frequency in the organism 4 The amino acids A time saving way to add a new user specified codon table is to copy the last codon table in a file and then change the organism name and codon frequencies The recent codon tables can be found web search for Codon Usage Database Note When you change the codon table the reverse translation method automatically sets to Codon Table 4 1 5 Edit Window Menu Reverse Translate Entire Sequence selected Block Figure 4 1 5 The Edit Rev Translate menu Note Reverse translation is automatic when you load or enter any protein by the last method set 4 1 5 1 Reverse Translate Entire Sequence The Entire Sequence command reverse translates the entire current protein sequence into DNA RNA according to the active reverse translation method 4 1 5 2 Reverse Translate Selected Block The Selected Block command reverse translates only the selected highlighted block of amino acids into DNA RNA according to the active reverse translation method 53 4 2 Edit Restore These commands restore the Upper or Lower Oligo and Forward or Reverse Primer that may ha
241. the nucleotide numbers of the most to the right and to the left nucleotides represented in the graph area If you click on any of the ORF displayed graphically or by the letters the given ORF block is underlined in bright green the ORF Statistics table will show its reading frame number positions on the DNA sequence size of the protein in the number of amino acids and molecular weight as well as the mean pKa value that often approximates its isoelectric point To the right of the ORF Statistics table there is a table explaining the meaning of colors used to present ORFs in the graphic style above as well as in the letter style in the zoomed area below T In the zoomed area at the bottom of the window you can see the DNA sequence in the middle above it its translation of the positive strand and below the translation of its negative strand in all reading frames The amino and carboxy termini of the proteins are labeled on the sides The scale on the top indicates the nucleotide position of the sequence You may move the sequence around in this window not only by clicking the mouse pointer but also by the keyboard the same way as in the Sequence window described in Chapter 2 5 4 using the arrows PgUp amp Down and space bar keys Note If you move around the Current Oligo in the ORF window all other relevant windows update automatically including the choice of ORF displayed in the Sequence window The amino acid color codin
242. the top of the window Click on the Consensus Probes box at the bottom of the window A new window Select Files pops out and you need to select other homologous sequences Click the Add button and navigate to the Test sequences folder supplied with the software by default it is located in the Oligo 7 folder in the Applications folder ROWDND O1 196 6 Choose the files as shown on the image below er 7 090 OCA Select Files File Sets Select Set Remove Set Search in Files Oligo 7 folder Test sequences Chimpanzee elF 4E seq Add Files Oligo 7 folder Test sequences Cow elF 4E seg Files Oligo 7 folder Test sequences Mouse elF 4E seq Remove Files Oligo 7 folder Test sequences Rabbit elF 4E seq Files Oligo 7 folder Test sequences Rat elF 4E seq Save5Set by repetitively clicking on a file name and the Add button 7 Click the Done button and return to the Select Files window The window should look similar to the one depicted above 8 You may click OK now but if you d like to memorize this set so that you can use it at later time click the Save Set button and give it a descriptive but short name than click OK 9 Go back to the Search for Primers amp Probes and click the Search button 10 The results are displayed in the Selected Oligonucleotides window Sort it by Oligo Position by clicking on the Oligo Position title 11 Double click on the second oligo
243. tion In PC replace the key with lt Ctrl gt 4 1 2 2 Edit Cut dt Clicking on this icon removes any highlighted portion of text from the screen and places it in the Clipboard You may also select these actions from the window Edit menu or use a short cut 4X Mac keys combination 4 1 2 3 Edit Copy Ep Clicking on this icon places a copy of any highlighted text to the Clipboard where it can be pasted to the active cursor position You may also use a short cut C Mac or Ctrl C PC keys combination 46 4 1 2 4 Edit Paste Clicking on this icon inserts all Clipboard contents at the current cursor position It is also possible to paste a sequence that has been copied from another application You may also use a short cut V Mac or Ctrl V PC keys combination 4 1 2 5 Edit Clear or Edit Delete i Clicking on this icon deletes any highlighted text This text can be retrieved with the Undo function if Undo is selected immediately after the Clear command 4 1 2 6 Edit Select All The Select All command highlights the entire sequence for cutting copying or clearing 4 1 2 7 Edit Merge Sequence With The Merge Sequence with command merges the sequence from different locations or from a sequence file to the edited sequence To load a protein sequence open an empty edit window using File New Then position the cursor on the protein edit line lower while editing in the mutagenesis edit mode
244. tion unique to the OLIGO program that quantifies the likelihood that a given oligonucleotide will prime at a given site on the active sequence The priming efficiency calculation is derived from an algorithm that considers mismatches duplex stability bulge loops and the distance of these elements from a primer s 3 end Reverse Translation Prediction of a DNA sequence from a protein sequence Salt Concentration The concentration of monovalent ions sodium or potassium for example but not magnesium Search Stringency The level at which the search parameters are set in the OLIGO program to select oligonucleotides optimized for the various search applications OLIGO gives the user six global stringency options that automatically set the eight individual search parameters in the Search Parameters window to appropriate pre set values These stringency settings can be automatically relaxed to a lower global setting by the program in the event that no suitable oligo positions remain after a search SSC Sodium Chloride Citrate Buffer 1x SSC is 0 15 M NaCl in 0 015 M Sodium Citrate pH 7 0 NaOH Tg the temperature at which 50 of a nucleic acid probe is retained ona hybridization filter after five minutes of incubation in 1 M salt A concentration of 100 nM oligo is used to calculate Ta by the nearest neighbor method Note that Ta may be used irrespective of salt and nucleic acid concentration like the 2xAT 4xGC and the GC methods
245. tting Started for suggestions on solving this 149 Manually modified by the user You have modified the active sequence file No info saved for this window You saved a window that does not have savable data in it so OLIGO saved a blank window No match found No nucleotide string of this sequence was found in this file No primer pairs No cross compatible primers were found in this search You may want to change your search parameters and or search ranges and try again No stems longer than X bp All hairpin stems are shorter than the minimum display setting that is selected in the Forward Primer Reverse Primer Current Oligo hairpin stems window Not accepted The entry is not recognized by OLIGO Check your entry and try again You may be trying to enter information that cannot be accepted by a particular field OLIGO cannot determine whether the sequence is DNA or RNA Is it DNA The sequence file may contain illegal characters or it may be an invalid sequence format Refer to Troubleshooting Situations Getting Started for suggestions on solving this Oligo Tm range has been incorrectly set Check your Tm range settings Your entry is probably outside the allowable range Out of disk space This operation has exceeded the space available on your hard drive If you re trying to save a file you may need to erase unwanted items on your drive or reduce the size of the file you are saving Out of memory This
246. u click the Select button all the primers in a displayed Group get highlighted You may select those primers by clicking on the check boxes individually on the left of the window or check all selected primers from the Export menu Checking may be important for saving or printing data depending on how is the priting set from the Print Save option in the File menu The Show Hide icon to the left of the checkbox icon Highlighted Record Oligonucleotide Sets Multiplexing Results Hide may be used to show either the first highlighted record oligonucleotide sets or multiplexing results Hide option conceals the bottom part of the Database window 4 10 Searching a file for probes only in the selected regions 1 Start Oligo and open BRCA2 gene seq located in the Test sequences folder 2 Open Search for Primers amp Probes dialog window and choose Hybridization Probes 3 Make sure that the Parameters Search stringency is set to Moderate it actually may be anything but the window snap shots here would be when the Moderate stringency is used 4 Click the Ranges button and click the Check Region s button at the lower left 5 When you open the Features window check the third check box from the top as shown below Aa oO Features x Feature Location l1 source 1 86101 a 3 2 gene 1224 85469 a 3 mRNA _ join 1224 1411 2166 2271 4821 5069 10820 10928 1184 S 4 CDS join 2205 2271 4821 5069 10820 1
247. ucleic acid Duplex A double stranded nucleic acid It may be contained in one molecule hairpin stem in two molecules dimer or many molecules False Priming The initiation of a nucleic acid synthesis from an unintended site This occurs when the 3 end of a primer has significant homology with more than one site on an active sequence See Priming Efficiency Number P E Filter Dissociation Temperature Ta Ta is the temperature at which 50 of the nucleic acid probe is retained on a hybridization filter after five minutes of incubation using 1 M NaCl To arrive at correct Ta values OLIGO uses 100 pM oligonucleotide concentration however during filter washing the concentration of the oligo in the washing solution is variable but always low relative to the concentration used during hybridization Hairpin A nucleic acid strand forming stable hydrogen bonds with G lt zero The hydrogen bonded region is referred to as a stem and the single stranded region between the two stem regions is called referred to as a loop Hairpin Loop The single stranded region in a nucleic acid hairpin between the double stranded stem Hairpin Stem The double stranded region of a hairpin Hybridization Process of hydrogen bond formation or duplex formation between nucleic acid molecules Hybridization Probe an oligonucleotide used to detect a specific nucleic acid sequence using a hybridization method Inosine Method This reverse tr
248. uct range setting limits the primer pairs selected to those that generate the correct product size The default is 150 bp to the end of the active sequence but shorter product sizes can be set The minimum is the minimum Forward Primer length plus the minimum Reverse Primer length plus 1 The PCR product length may not always be compatible with search range In such cases the search range is the primary selection criteria For example if the positive strand primer search range is 1 100 the negative strand is 200 300 and PCR product length is 150 1 000 then possible product lengths are limited to 150 300 nt Note Narrowing search ranges can speed up searches considerably and eliminate unwanted data from search results Also low stringency settings typically yield many selected primer pairs This may make further analysis difficult 113 O Search Ranges Sequence file Human elF 4E seq 18 to 1850 Search method PCR Primers Positive strand search range 18 to 1850 Negative strand search range 18 to 1850 _ Find products in checked region s only PCR product length 39 to 1500 M No overlapping primers probes 1 Allow only one overlapping external primer M No multiple products in one sequence region Cover the entire search area with Perform False Priming Sites or Homology Searches Within the search ranges only On the entire sequence Check Region s Defaults Cancel
249. ure for DNA amplification in vitro Nucleic Acids Res 18 6409 6412 7 Griffin T J and Smith L M 1998 An Approach to Predicting the Stabilities of Peptide Nucleic Acid DNA Duplexes Analytical Biochemistry 260 56 63 8 Suggs S V Hirose T Miyake E H Kawashima M J Johnson K L and Wallace R B 1981 Using Purified Genes in ICN UCLA Symp Dev Biol D D Brown ed Academic Press Inc New York Vol 23 pp 683 693 9 Groebe D R and Uhlenbeck O C 1988 Characterization of RNA hairpin loop stability Nucleic Acids Res 16 11725 11735 10 Martin F H Castro M M and Tinoco Jr 1985 Base pairing involving deoxyinisine implications for probe design Nucleic Acids Res 13 8927 8938 11 Handbook of Biochemistry and Molecular Biology 1975 Fasman G D ed 3rd edition Nucleic Acids Vol 1 pp 589 CRC Press Cleveland OH 12 Nomenclature Committee of the International Union of Biochemistry 1985 Nomenclature for incompletely specified bases in nucleic acid sequences Eur J Biochem 150 1 5 180 13 New England BioLabs 2007 08 Catalog Cleavage close to the end of DNA fragments p 331 MBI Fermentas Catalog 96 97 p 112 Stratagene Catalog 1997 98 p 284 14 Lathe R 1986 Synthetic Oligonucleotide Probes Deduced From Amino Acid Sequence Data Theoretical and Practical Considerations J Mol Biol 183 1 12 15 Meinkoth J and Wahl G 1984 Hybridizatio
250. ve been overwritten using one of the following program functions e Selecting either a Primer or a Probe from the Select menu or from the Sequence window e Editing them in any of the Edit windows e Conducting an automatic search 4 3 Edit Features This window allows adding deleting and changing sequence features usually associated with GenBank sequences as annotations The features are not only graphically displayed in the Sequence window but are the integral part of the searches as they may serve as the search ranges When you save a sequence with OLIGO those features will be saved as well in a simple text format file This format is specific to OLIGO only but sequence file saved by this software may be opened by any word processor at later time e800 Features File BRCA gene seg Feature Location El 1 source 1 86101 d B 2 gene 1224 85469 O 3 mRNA join 1224 1411 2166 2271 4821 5069 10820 10928 11846 11895 11987 12 4 CDS join 2205 2271 4821 5069 10820 10928 11846 11895 1198 7 12027 12244 ge 5 misc_featu 12841 14548 B 6 misc_featu 27629 28079 B 7 repeat reg 27638 27739 Cl amp repeat reg 27740 28037 B 9 repeat_reg 28038 28105 E 10 repeat_reg 28239 28512 11 repeat_reg 28513 28811 B 12 repeat reg 28812 28901 T l B iii H t E T 35000 40000 45000 s0000 S50 so00 7oodo 75000 soon A Figure 4 3 The Edit
251. verlapping primers probes Allow only one overlapping external primer No multiple products in one sequence region Cover the entire search area with Overlapping products Non overlapping products with max 100 bp gaps Perform False Priming Sites or Homology Searches Within the search ranges only On the entire sequence _ Check Region s Defaults Cancel o Note that another option to search in discontinuous regions could be Choose hybridization probes every x number bases 8 Click OK and in the Search for Primers amp Probes window click the Search button 9 The search returned 151 Upper Oligos and 148 Lower Oligos located only in the mRNA regions 00O Selected Oligonucleotides File BRCA2 gene seq Upper Oligos r 151 it Bis aal Length Score T 3 ee ie ne 1 l 1230 23 861 72 5 8 8 9 6 a 2 1287 21 810 73 0 5 6 9 6 0 3 1328 22 917 72 1 5 5 8 5 4 1367 22 947 71 2 6 4 9 1 5 2215 22 912 68 7 5 9 8 4 6 2247 21 815 65 0 6 0 8 5 7 4866 24 976 67 3 6 3 7 7 8 5018 24 934 68 5 4 7 8 6 9 10843 24 962 66 4 5 9 8 5 10 11987 22 901 68 5 5 9 7 6 11 12271 24 946 73 0 6 5 7 7 v 202 5 Other Search Options 5 1 Search for a sequence string Oligo s search for string is not just a plain Find function commonly implemented in most editing software It allows searching for mismatches and for ambiguous bases This example shows the process 1 St
252. vious Database brings back the database previously saved so that the all edit operations made after the save are removed The OLIGO Database functions and menus are described in Chapter 10 3 3 File Open The File Open command selects by default a nucleic acid sequence file from disk By default all types of files are displayed in the File Open dialog box however you may view only single type files by selecting the type from File Format pull down menu Besides Nucleic Acid sequence files you may display protein sequence files or Oligonucleotide Databases OLIGO opens different types of files itemized above and in the Fig 3 3 so if you are not familiar with 31 OLIGO file names and their extensions the File Format option will help you not make a mistake when opening an intended file Open File E Test sequences 74 DEVICES 4 jj FreqSeq 4 y cbp odb a i HD1T J Frequencies Chicken elF 4E seq r TS un libOligoLibrary jnilib Chimpanzee elF 4E seq 3 HD 1T PLACES rail ai Lodf f ar Name Cow elF 4E seq Desktop r bi m 1go_ PNN di ia aie Kind Nucleic Acid N oligo_7_tutorial pdf Database 6 odb Size 2 KB re ee E Tables y Dictyosteli elF 4E seq y 1 997 bytes t A Applications C Test sequences 1 Human elF 4E gene seq Modified 8 14 08 8 26 AM G Utilities via 4 gt gt I Previewer ACCESSION NM_174310 m FEATURES Location Qualifiers Protein Oli
253. y changed in a smart way such that a parameter that causes most oligos to be removed is relaxed first When too many oligos are selected OLIGO may automatically increase the search stringency 91 7 Return to the Search for Primers and Probes dialog box and click OK to start the search During the search the Search Status window displays the progress of each subsearch in each strand and the number of oligonucleotides accepted and rejected 8 At the conclusion of the search you may check stringency settings using Search Primers amp Probes Search Data option To review the selected sequencing primers click on the Selected Oligos button at the bottom of the window to call up the Selected Oligos window 9 After selecting the sequencing primers you can download them to the database or otherwise save the relevant window data as Results a simple text file Hybridization Probes The Hybridization Probes search option searches for and selects optimal hybridization probes in either or both strands of the active sequence When OLIGO conducts the hybridization probe search it uses the following e Eliminate Ambiguous Bases by default selects non degenerate primers e Oligonucleotides with GC Clamp selects oligos with high internal stability regions e Oligonucleotides within Selected Tm Limits selects oligos with certain Tm range e Hairpin free Oligonucleotides e Eliminate Mono and Di Nucleotide Repeats s
254. y structure of the amplicon is minimized that means the search removes DNA regions that form stronger hairpin loops from consideration Nested Primers This option searches PCR primer pairs as described above and additionally selects the nested primer pairs within the first larger amplicon The nested primers are compatible multiplexed with the external pair of primers so there is no dimer formation between any of the 4 primers The nested primers are selected and called Oligos as sometimes these nested oligonucleotides may be utilized rather as probes than primers Sequencing Primers The Sequencing Primers search option searches for and selects optimal sequencing primers in either or both strands of the active sequence The OLIGO program automatically adjusts and or deactivates search parameters in order to emphasize those characteristics most desirable in a sequencing primer 90 When a standard search for sequencing primers is conducted using the programs default settings the following sub searches are used to find the sequencing primers e Eliminate Ambiguous Bases by default selects non degenerate primers e Duplex free Oligonucleotides selects primers free of 3 end and internal dimers e Highly Specific Oligonucleotides 3 end Stability selects moderately stable 3 ends e Oligonucleotides with GC Clamp selects oligos with high internal stability regions e Oligonucleotides within Selected Tm Limits
255. yy oe Prrg rhe ree Tha reba crn p ig EERE EHA BEENI LELEI tr toe peed EMN te teh EENI tebe bii pi biii H eqgetrtt Hyg i i i 4 ELEF T l SIET Ig E E MH H L H 5 BRB amp EEL T E H 3 BEL E G RF Y EL S OCYELF k a F H t ENG E y LALE C R EMEYTELRLPFPE RTS p as F af x an r D KF n Li n i Tot 0 E 4 coni T amp wR H T T YT ET MEE WG fs PEI IIETLS E E BL EST t 5 5 F CAETH EATCATTTETAAGZMAACAAT unica AS PURETAT TATE TAT TT TTC TTC at cc ANGATGTATGTOLCTTT fe SAAMATTATARAARCS Trae Tie Tid im CMA TMT iM PT LE TTEMMERARGE curs ian CAMARA E r m Taua op ae TE TEET ai Pde tT UA TTA TTET T Ta T Ta Pee ener Ra a Bm Pa A eR PO ma pa a ag Pa PLBLAPDGEASPECAAET EC EPEC ASG TEMAS TeGeE i HE DS amp Y F LEFTYIITFAT EFFING E rT Ss E E HL 1 oF rw este a SLTFLewrewvwed STEL rece s ayer sess SOSTSHYLELTEHS i E FISSER EGESETEAI TARS CLLFTEENL DFT FELTI EF W aE ke cer A L Y E EHI QHKHKHQ ILEFTEE Pr L c LEFFE T eT eT F F I SLURERTELFP Pw I EF LELLLEF i l The zoom in slider When you click on this ORF it gets underlined in green and Wie VOU A Mol Sm the information about this particular protein is shown in the ORS Statistics table This green rectangle shows what part of the sequence a aaa dante tofth TAE d i ORF Statistics IS UIS ave In E LOWED Dari mW 200m nt th il b th R Fr Position Protein Molecular Weight Mean pKa are Vlove the sc F pee at ree pee

manual - Oligo Software

Contents

Download Pdf Manuals

Related Search

Related Contents