Home

Affy 500k Assay Manual

1. i HITTIEM En Sau R zi Pr ae Pass GeneChip Mapping 500K Assay Manual r P N 701930 Rev 3 For research use only Not for use in diagnostic procedures Trademarks Affymetrix AY GeneChip HUSNP GenFlex Flying Objective CustomExpress CustomSeq NetAffx Tools to Take You As Far As Your Vision The Way Ahead Powered by Affymetrix and GeneChip compatible are trademarks of Affymetrix Inc All other trademarks are the property of their respective owners Limited License Subject to the Affymetrix terms and conditions that govern your use of Affymetrix products Affymetrix grants you a non exclusive non transferable non sublicensable license to use this Affymetrix product only in accordance with the manual and written instructions provided by Affymetrix You understand and agree that except as expressly set forth in the Affymetrix terms and conditions that no right or license to any patent or other intellectual property owned or licensable by Affymetrix is conveyed or implied by this Affymetrix product In particular no right or license is conveyed or implied to use this Affymetrix product in combination with a product not provided licensed or specifically recommended by Affymetrix for such use Patents Arrays Products may be covered by one or more of the following patents and or sold under license from Oxford Gene Technology U S Patent Nos 5 445 934 5 700 637
2. 090O0090 0000900900090 azm Be sure to keep two wells as blanks water only on each plate product to test 6 Repeat this procedure and prepare three plates of diluted PCR J 2 Cc Q Par A Aa a 19 99 0 9 6 L D00009 a D99990 yn 0909090090 2 00009090 2 L 899 9 9 9 9 mG VEK GAR ER few O dO GO O AA 999999 9 o 9990066 amp 000000900 3 _ 92 amp 009090000 lt gt 1 a le en bs Ge Gen Ge Ge 6 as 2099090900909 E 3 00000 J 89 9 9 9 9 Eg 2 F999 9 09 96 6 Ra atin m dez fo z MBOHOOOSSS 0009000 Ol o 9099 9 909 9 9 5 ll AL 90990900000 a QD QOOOO 5 ele Ol uZ 5 09000000 D o r h498999 99 lJeesessse E 0000000 Loading Optical Plates with Purified Sample Figure 4 5 90 GeneChip Mapping 500K Assay Manual QUANTITATE THE DILUTED PCR PRODUCT To quantitate the diluted PCR product 1 Measure the OD of each PCR product at 260 280 and 320 nm OD280 and OD320 are used as process controls Their use is described under Process Control Metrics below Determine the OD260 measurement for the water blank Determine the concentration of each PCR product as follows A Take 3 OD readings for every sample 1 from each opt
3. 50 51 52 53 54 55 56 Bignell G R Huang J Greshock J Watt S Butler A West S Grigorova M Jones K W Wei W Stratton M R Futreal P A Weber B Shapero M H Wooster R High resolution analysis of DNA copy number using oligonucleotide microarrays Genome Res 14 287 95 2004 Janne P A Li C Zhao X Girard L Chen T H Minna J Christiani D C Johnson B E Meyerson M High resolution single nucleotide polymorphism array and clustering analysis of loss of heterozygosity in human lung cancer cell lines Oncogene 23 2716 26 2004 Herr A Grutzmann R Matthaei A Artelt J Schrock E Rump A Pilarsky C High resolution analysis of chromosomal imbalances using the Affymetrix 10K SNP genotyping chip Genomics 85 392 400 2005 Lieberfarb M E Lin M Lechpammer M Li C Tanenbaum D M Febbo P G Wright R L Shim J Kantoff P W Loda M Meyerson M Sellers W R Genome wide loss of heterozygosity analysis from laser capture microdissected prostate cancer using single nucleotide polymorphic allele SNP arrays and a novel bioinformatics platform dChipSNP Cancer Res 63 4781 5 2003 Ishikawa S Komura D Tsuji S Nishimura K Yamamoto S Panda B Huang J Fukayama M Jones K W Aburatani H Allelic dosage analysis with genotyping microarrays Biochem Biophys Res Commun 333 1309 1314 2005 Zhao X Weir B A
4. Molecular Biology Grade Water Bio Whittaker Molecular Applications Cambrex P N 51200 Biomek Seal and Sample Aluminum Foil Lids Beckman P N 538619 Jitterbug 115 VAC Boekel Scientific P N 130000 e Vacuum Regulator for use during the PCR clean up step QIAGEN Vacuum Regulator QIAGEN P N 19530 The Clontech protocol requires 600 mb vacuum If your lab does not have an internally regulated vacuum source this vacuum regulator is strongly suggested Follow the steps as outlined below Consult the Clontech Clean Up Plate Handbook for the general procedure and ordering information 1 Connect a vacuum manifold to a suitable vacuum source able to maintain 600 mbar e g QIAvac Multiwell Unit QIAGEN Place a waste tray inside the base of the manifold 2 Place a Clean Up Plate on top of the manifold Cover wells that are not needed with PCR plate cover To cover the unused wells a PCR plate cover or an aluminum foil lid can be placed on top of the Clean Up Plate Apply pressure to make the cover stick to the plate Cut the adhesive film between the used and unused wells Remove the portion that covers the unused wells you want to use 3 Add 8 pL0 1 M EDTA to each PCR reaction Seal plate with plate 1 Clontech also supports the Millipore MultiScreen Promega Vac Man 96 and Bio Rad Aurum vacuum mani folds for use with the Clean Up Plates CAUTION CAUTION CAUTION IMPORTANT Hi IMPORTANT Hi
5. The sample in each well must be normalized to 2 pg pL in RB Buffer 90 pg in 45 pL RB Buffer Do NOT determine an average concentration to use for every well The amount of DNA added to the arrays has been optimized for the best performance Since not all wells will contain the same amount of DNA after purification the eluted PCR products must be carefully normalized to 2 pg pL before continuing to Stage 7 Fragmentation Normalize samples using RB Buffer not water to maintain the correct pH for subsequent steps The accuracy of the OD measurement is critical Carefully follow the steps below and be sure the OD measurement is within the quantitative linear range of the instrument 0 2 to 0 8 OD The spectrophotometer plate reader should be calibrated regularly to ensure correct readings This protocol has been optimized using a UV spectrophotometer plate reader for quantitation NOTE The NanoDrop will give different quantitation results This protocol has not been optimized for use with this instrument In chapter 4 96 Well Plate Protocol 87 addition the NanoDrop quantifies a single sample at a time and is not amenable to 96 well plate processing PREPARE THE REAGENTS EQUIPMENT AND CONSUMABLES Turn on the Spectrophotometer Plate Reader Turn on the spectrophotometer now and allow it to warm for 10 minutes before use Prepare Your Work Area To prepare the work area 1 2 Place a double cooling chamb
6. User is attempting to run a FS400 script on FS450Dx Download proper FS450Dx script and continue Valve Motion Error Run Home script and run desired script again If problem persists contact Affymetrix for service Valve Not Homed Run Home script and run desired script again If problem persists contact Affymetrix for service Valve Out of Position Run Home script and run desired script again If problem persists contact Affymetrix for service 174 GeneChip Mapping 500K Assay Manual MEANING OF ERROR MESSAGES The following lists some of the common error messages and what they mean Table 6 4 Table 6 4 Common Error Messages Error Message Meaning Invalid Command The script contains a command that can not be executed because its command code is either undefined or has a format error Improper Script The first command of the script is not the required FS450 command Temperature Timeout The Re attempt command timed out before the set point temperature was reached Sensor Timeout The Await Sensors command timed out before the anticipated sensor pattern was seen Valve not Homed The Home command did not result in the valve reaching its HOME position Valve Motion Error The Valve command did not result in the valve reaching its target valve position Valve out of Position According to the outer valve encoder the
7. PCR Purification and Elution Reagents DNA Amplification Clean Up Kit to be used with Affymetrix products Clontech P N 636974 1 plate or P N 636975 4 plates Manifold QlAvac multiwell unit QIAGEN P N 901457911 EDTA 0 5 M pH 8 0 Ambion P N 9260G e Molecular Biology Grade Biology Water BioWhittaker Molecular Applications Cambrex P N 51200 Biomek Seal and Sample Aluminum Foil Lids Beckman P N 538619 Equipment e Vacuum Regulator for use during the PCR clean up step QIAGEN Vacuum Regulator OIAGEN P N 19530 Table D 6 appendix D Reagents Instruments and Supplies Required for Low Throughput Protocol 297 Reagents Equipment and Supplies Not Supplied by Affymetrix Assay Step Fragmentation and Labeling Reagents GeneChip Fragmentation Reagent DNase 1 Affymetrix P N 900131 10X Fragmentation Buffer Affymetrix P N 900422 for 30 Rxns and P N 900695 for 100 Rxns Molecular Biology Grade Water Bio Whittaker Molecular Applications Cambrex P N 51200 4 TBE Gel BMA Reliant precast 4 NuSieve 3 1 Plus Agarose Cambrex P N 54929 All Purpose Hi Lo DNA Marker Bionexus Inc 50 10000 bp P N BN2050 Gel Loading Solution Sigma P N G2526 96 well plate Bio Rad P N MLP 9601 96 well Clear Adhesive Films Applied Biosystems P N 4306311 GeneChip DNA Labeling Reagent 30 mM Affymetrix P N 900778 for 30 Rxns and P N 900699 for 100 Rxns available in the Nsp and
8. TdNTPs from Invitrogen P N R72501 have been tested on a limited basis with similar results You should test in your own lab prior to full scale production appendix D Reagents Instruments and Supplies Required for Low Throughput Protocol 299 The PCR process is covered by patents owned by Roche Molecular Systems Inc and F Hoffmann LaRoche Ltd Roche A license to use the PCR process for certain research and development activities accompanies the purchase of certain reagents from licensed suppliers when used in conjunction with an authorized thermal cycler If you are using an MJ Research thermal cycler your thermal cycler may not be an authorized thermal cycler You should obtain authorization from Roche or ABI see PCR licensing information in the MJ Research User Manual if you are not already licensed For information about obtaining a license contact The Director of Licensing at Applied Biosystems 850 Lincoln Center Drive Foster City CA 94404 or the Licensing Department Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda CA 94501 In 2004 MJ GeneWorks Inc and its subsidiary MJ Research Inc were purchased by Bio Rad Laboratories Inc This model is no longer available Bio Rad has indicated that the DNA Engine Tetrad 2 gives similar performance with the same progams Affymetrix has not tested the newer version Clontech also supports the Millipore MultiScreen Promega Vac Man 96 and BioRad Aurum vacuum m
9. When performing the steps for Stages 2 through 8 Leave all of the tubes on ice or in a cooling chamber on ice Keep all plates in a cooling chamber on ice Consult the appropriate MSDS for reagent storage and handling requirements chapter 4 96 Well Plate Protocol 39 PREPARING THE WORK AREA FOR EACH STAGE Many of the stages in the Mapping 500K 96 well plate protocol must be performed rapidly and on ice to carefully control enzyme activity and temperature transitions Therefore we recommend that you gather and set up all of the equipment consumables and reagents except for the enzymes prior to beginning each stage Below is an illustration of the setup for Stage 7 Fragmentation Pipettes and tips are not shown Cooling chamber chilled to 4 C Cooler chilled to 20 C Reagent thawed vortexed and spun down Eppendorf tube labeled and ready for master mix preparation Two strips of tubes each row Plate of samples labeled and ready for additions from previous stage Have pipettes and pipette tips ready as well Begin each stage with full racks of pipette tips Figure 4 1 Example of Work Area Preparation 40 GeneChip Mapping 500K Assay Manual THERMAL CYCLERS PLATES AND PLATE SEALS The Mapping 500K 96 well plate protocol has been optimized using the following thermal cyclers reaction plates and adhesive film IMPORTANT Hi Use only the PCR plate adhesive film and thermal cy
10. inner diameter Cole Parmer P N H 06418 04 Tough Spots Label Dots USA Scientific P N 9185 0000 chapter 5 Washing Staining and Scanning Arrays 137 Reagent Preparation IMPORTANT Wash A Non Stringent Wash Buffer 6X SSPE 0 01 Tween 20 For 1000 mL 300 mL of 20X SSPE 1 0 mL of 10 Tween 20 699 mL of water Filter through a 0 2 pm filter Store at room temperature Wash B Stringent Wash Buffer 0 6X SSPE 0 01 Tween 20 For 1000 mL 30 mL of 20X SSPE 1 0 mL of 10 Tween 20 969 mL of water Filter through a 0 2 pm filter Store at room temperature The pH should be 8 Prepare Wash B in smaller quantities to avoid long term storage The container must be sealed tightly to avoid changes in salt concentration due to evaporation 0 5 mg mL Anti Streptavidin Antibody Resuspend 0 5 mg in 1 mL of water Store at 4 C IMPORTANT Hi 138 GeneChip Mapping 500K Assay Manual 12X MES Stock Buffer 1 25 M MES 0 89 M Na For 1 000 mL 70 4g of MES hydrate 193 3g of MES Sodium Salt 800 mL of Molecular Biology Grade Water Mix and adjust volume to 1 000 mL The pH should be between 6 5 and 6 7 Filter through a 0 2 pm filter Do not autoclave Store at 2 C to 8 C and shield from light Discard solution if yellow 1X Array Holding Buffer Final 1X concentration is 100 mM MES 1M Na 0 01 Tween 20 For 100 mL 8 3 mL of 12X MES Stock Buffer 18 5 mL of 5 M NaCl
11. 0 1 mL of 10 Tween 20 73 1 mL of water Store at 2 C to 8 C and shield from light chapter 5 Washing Staining and Scanning Arrays 139 Experiment and Fluidics Station Setup The following instructions are for GeneChip Operating Software GCOS 1 4 client 1 3 server STEP 1 REGISTERING A NEW EXPERIMENT IN GCOS 1 From the File menu click New Experiment The New Experiment window appears in the display pane The top half of the display pane refers to the sample and the bottom half refers to the experiment GeneChip Operating Software Esp 8 rie Em ew fun Tove Wede Hib E e l 4 mm n na El Pe C esl me aT Datu Source Local Samehe Tem iohe No ter glate O Nowe Vake 1 12 02 09 02 04 20 GeneChe Operating Software In iakzabion complete Figure 5 1 GCOS Sample Entry Pane 2 Enter information into the appropriate boxes TIP El 140 GeneChip Mapping 500K Assay Manual e Fields that are highlighted in bold require an entry e Drop down menus are available for Sample Project information default information can be used or new information can be entered The Experiment Name must be unique e Appropriate library files must be installed for a probe array to appear in the drop down menu 3 From the File menu click Save As or click the Save icon on the tool bar to register the experiment into the database The Sample Information f
12. 5 Create a third column called Valid Concordant SNP This column will contain a TRUE if the SNP calls match and neither is a NC A Enter the following formula AND D2 1 E2 FALSE B Auto fill down the column 6 Count the number of SNPs that had a genotype call in both experiments A Within the spreadsheet enter the following formula into a cell COUNTIF E2 65536 FALSE B Press return 7 Count the number of SNPs that have a genotype call in both experiments and are concordant A Elsewhere within the spreadsheet enter the following formula into a cell COUNTIF F2 65536 TRUE B Press return 8 The Concordance rate can be calculated by dividing the value from step 7 by the value from step 6 The concordance rate should always be greater than 99 Reasons for a decline in the concordance rate include e Selecting the wrong data set to compare to the reference DNA e Contamination at some step in the assay e Poor sample preparation 206 GeneChip Mapping 500K Assay Manual DOWNSTREAM ANALYSIS CONSIDERATIONS Data Filtering For many genotyping applications loss of accuracy can result in a significant decrease in genetic power This loss of accuracy can be caused by systematic or sporadic errors that occur due to stochastic sample or experimental factors To filter out errors and exclude these SNPs in downstream analysis a two tiered filtering process is rec
13. MES Sodium Salt Sigma P N M5057 DMSO Sigma P N D5879 e EDTA Ambion P N 9260G Denhardt s Solution Sigma P N D2532 HSDNA Herring Sperm DNA Promega P N D1815 Human Cot 1 DNA Invitrogen P N 15279 011 e Oligo Control Reagent 0100 OCR 0100 Affymetrix P N 900541 for 30 Rxns and 900701 for 100 Rxns Available in the Nsp and Sty GeneChip Mapping 250K Assay Kits Nsp 30 Rxn Kit P N 900766 Nsp 100 Rxn Kit P N 900753 Sty 30 Rxn Kit P N 900765 Sty 100 Rxn Kit P N 900754 We have noticed increased Mapping 500K performance variability in the GeneChip Hybridization Oven 640 models P N 800138 or 800189 manufactured prior to 2001 We have not seen this increased variability in later Hybridization Oven 640 models with a serial number of 11215 or higher Please check the serial number of your hybridization oven s If you have one of the older models with a number of 11214 or lower please contact Affymetrix for an upgrade 278 GeneChip Mapping 500K Assay Manual REAGENT PREPARATION 12 X MES Stock 1 25 M MES 0 89 M Na IMPORTANT Do not autoclave Store between 2 C and 8 C and shield from light Discard solution if it turns yellow For 1000 mL 70 4 g MES hydrate 193 3 g MES Sodium Salt 800 mL molecular biology grade water Mix and adjust volume to 1 000 mL The pH should be between 6 5 and 6 7 Filter through a 0 2 pm filter appendix C Low Throughput Protocol 27
14. Program the thermal cycler in advance see page 261 and switch on the thermal cycler 10 minutes before reactions are ready so that the lid is heated e Make sure the ligated DNA from the ligation step was diluted to 100 pL with water e Prepare PCR Master Mix in Pre PCR Clean room Set up PCRs in PCR Staging Area e Prepare 3 PCRs for each sample and for each restriction enzyme 3 PCRs are required for each array 1 The PCR process is covered by patents owned by Roche Molecular Systems Inc and F Hoffmann LaRoche Ltd Roche A license to use the PCR process for certain research and development activities accompanies the purchase of certain reagents from licensed suppliers when used in conjunction with an authorized thermal cy cler If you are using an MJ Research thermal cycler your thermal cycler may not be an authorized thermal cy cler You should obtain authorization from Roche or ABI see PCR licensing information in the MJ Research User Manual if you are not already licensed For information about obtaining a license contact The Director of Li censing at Applied Biosystems 850 Lincoln Center Drive Foster City CA 94404 or the Licensing Department Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda CA 94501 In 2004 MJ GeneWorks Inc and its subsidiary MJ Research Inc were purchased by Bio Rad Laboratories Inc This model is no longer available Bio Rad has indicated that the DNA Engine Tetrad 2 give
15. Table A 7 Table A 8 Table A 9 Table A 10 Affymetrix GeneChip Mapping 250K Nsp Assay Kit 100 Reactions Affymetrix GeneChip Mapping 250K Sty Assay Kit 100 Reactions New England Biolabs Reagents Required Other Reagents Required for the Mapping 500K 96 Well Plate Protocol Affymetrix Equipment and Software Required Other Equipment Required to Run the GeneChip Mapping 500K 96 Well Plate Protocol Thermal Cyclers PCR Plates and Plate Seals Optimized for Use With the Mapping 500K 96 Well Plate Protocol Arrays Required for the Mapping 500K 96 Well Plate Protocol Other Consumables Required for the Mapping 500K 96 Well Plate Protocol Supplier Contact List 226 GeneChip Mapping 500K 96 Well Plate Protocol Reagents AFFYMETRIX REAGENTS REQUIRED Table A 1 Affymetrix GeneChip Mapping 250K Nsp Assay Kit 100 Reactions Kit Contents Part Number e Adaptor Nsp 50 uM 900753 DNA Labeling Reagent 30 mM 100 reactions e Fragmentation Buffer e Fragmentation Reagent Oligo Control Reagent 0100 PCR Primer 002 100 uM e Terminal Deoxynucleotidyl Transferase e 5X Terminal Deoxynucleotidyl Transferase Buffer e Reference Genomic DNA 103 use as a positive control Table A 2 Affymetrix GeneChip Mapping 250K Sty Assay Kit 100 Reactions Kit Contents Part Number e Adaptor Sty 50 uM 900754 e DNA Labeling Reagent 30 mM 100 reactions
16. Troubleshooting 215 Problem Likely Cause Faint absent bands on PCR gel continued Solution Samples affected but Non optimal reaction conditions positive controls OK Use master mixes and include a positive control to eliminate reagents and assay problems as detailed above Insufficient starting material 250 ng genomic DNA should be used Confirm concentration using calibrated spectrophotometer Sample DNA contains enzymatic or chemical inhibitors Ensure genomic DNA is purified and diluted in Low EDTA 0 1mm TE buffer Use recommended procedure to ethanol precipitate genomic DNA to remove inhibitors Degraded sample DNA Confirm quality of genomic DNA sample Low PCR yield Gel image shows PCR Sufficient PCR product is present but Calibrate spectrophotometer Proceed product but following spectrophotometer is out of with assay purification calibration spectrophotometer PCR product is lost due to reduced temperature measurements at 260nm indicate low PCR yield All purification steps must be carried out at 25 to 35 C Pipette used for quantitation not calibrated Calibrate Pipette Proceed with assay White precipitate is seen after the PCR reaction Precipitation from assay reagents Add 0 1 M EDTA as per protocol before PCR product purification This precipitate should no longer be present after purification Problem 216 GeneC
17. 100 GeneChip Mapping 500K Assay Manual PREPARE THE REAGENTS CONSUMABLES AND OTHER COMPONENTS IMPORTANT Hi Thaw Reagents Thaw the Fragmentation Buffer 10X on ice Leave the Fragmentation Reagent at 20 C until ready to use Prepare Your Work Area To prepare the work area Figure 4 6 on page 101 1 Place a double cooling chamber and a cooler on ice 2 Place the AccuGENE Water on ice 3 Prepare the Fragmentation Buffer as follows A Vortex 3 times 1 sec each time B Pulse spin for 3 sec C Place the buffer in the cooling chamber on ice 4 Cut two strips of 12 tubes from a Bio Rad 96 well unskirted PCR plate P N MLP 9601 Strip tubes must be cut from this particular plate See Important Information About This Stage on page 99 for more information 5 Label and place the following in the cooling chamber on ice e Two strips of 12 tubes labeled Buffer and FR One 1 5 mL Eppendorf tube labeled Frag MM e Plate of purified normalized PCR product from the previous stage chapter 4 96 Well Plate Protocol 101 Figure 4 6 Work Area Set Up for Stage 7 Fragmentation Preheat the Thermal Cycler Block The block must be heated to 37 C before samples are loaded To preheat the thermal cycler 1 Power on the thermal cycler and preheat the block to 37 C 2 Allow it to heat for 10 minutes before loading samples 102 GeneChip Mapping 500K Assay Manual PREPARE THE SAMPLES
18. 2 Transfer 10 pL of each diluted ligated DNA from the 96 well plate into the corresponding three individual wells of the PCR plates using an 8 or 12 channel pipette Be sure to change tips between samples 3 Add 90 pL PCR Master mix to obtain a total volume of 100 pL Final volume for each PCR is listed in the table below It is convenient to dispense the PCR Master Mix with a repetitive dispenser such as Gilson Distriman available from Rainin or pipet the PCR Master Mix from a solution basin Labcor Products Inc Cat No 730 014 available from PGC Scientifics with an 8 channel or 12 channel pipette Table C 8 Reagent Volume PCR PCR Master Mix 90 uL Diluted ligated DNA from Ligation step 10 uL Total 100 uL Three PCR reactions are needed to produce sufficient product for hybridization to one array each reaction 100 pL 4 Seal the plate with plate cover vortex at medium speed for 2 seconds and spin at 2 000 rpm for 1 minute MAIN LAB IMPORTANT IMPORTANT Hi appendix C Low Throughput Protocol 261 Program the thermal cycler in advance Switch on the thermal cycler 10 minutes before reactions are ready so that the lid is heated PCR protocols for DNA Engine Tetrad and Applied Biosystems thermal cyclers are different as listed on the following pages 5 Run the 500K PCR program on either an MJ Research DNA Tetrad Engine or GeneAmp PCR System 9700 M
19. C y 196 19 22 09 Batch analysis completed for the Mendel_Nsp errey Jop Hig 08 19 05 13 22 15 hatch analyok started for the Mendel_Sty aray group 1675181 ons 1312705692 87006133 11904979 2758114 21727 nans 111074534 116877522 Ready Figure 7 3 Dynamic Model Mapping Algorithm Table View If the user generated chp files are not seen in the data file tree right click the Analysis Results bar and click Refresh All or make sure the Filter settings are set correctly REPORT IMPORTANT Hi 186 GeneChip Mapping 500K Assay Manual A Mapping Algorithm report is automatically generated when cell intensity data is analyzed from Mapping arrays The report is automatically displayed when you use the Batch Analysis window to analyze data The Mapping Algorithm Report has several important indicators that must be checked for each array in order to assess the quality of the data A saved Mapping Algorithm can be opened by 1 Clicking the Open button in the main toolbar or selecting File gt Open from the main menu The Open dialog box appears m_C5 _5_rep1_101304_ 52_ G_1 56_cel_summary APT N amp 12740_H_7GComplexB_HapMap_F9 rpt NA18523_NsEa_573007_N10 2_41_SC3 RPT NA18523 NsEa_573007_N10 2_410_SC2 RPT NA18523 StE a 550955 510 SC3 AP NATED StE_550955_ 10 2_A10_SC2APT X Universal_HuEx_cel_summary RPT UseCase1_EN_cel_summary RPT Data name
20. Chang Y Man T Lau C C Allelic imbalance analysis by high density single chapter 3 Genomic DNA General Requirements 31 nucleotide polymorphic allele SNP array with whole genome amplified DNA Nucleic Acids Res May 17 32 9 e69 2004 32 GeneChip Mapping 500K Assay Manual Chapter 4 96 Well Plate Protocol Chapter 4 35 96 Well Plate Protocol ABOUT THIS PROTOCOL The 96 well plate protocol described in this chapter is designed for processing one full 96 well reaction plate one enzyme at a time The protocol is presented in stages Stage 1 Genomic DNA Plate Preparation Stage 2 Restriction Enzyme Digestion Stage 3 Ligation Stage 4 PCR Stage 5 PCR Product Purification and Elution Stage 6 Quantitation and Normalization Stage 7 Fragmentation o Stage 8 Labeling o Stage 9 Target Hybridization The protocol and guidelines include key points regarding the various molecular biology steps that comprise whole genome sampling analysis WGSA Successful performance of the various molecular biology steps in this protocol requires accuracy and attention to detail Many of these stages involve specific yet distinct enzymatic reactions For example in stage 2 the genomic DNA is initially digested with the restriction enzymes Nsp I or Sty I In stage 3 it is ligated to a common adaptor with T4 DNA ligase Following ligation the template undergoes PCR stage
21. Fragmentation Buffer e Fragmentation Reagent Oligo Control Reagent 0100 PCR Primer 002 100 uM e Terminal Deoxynucleotidy Transferase e 5X Terminal Deoxynucleotidyl Transferase Buffer e Reference Genomic DNA 103 use as a positive control appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol 227 NEW ENGLAND BIOLABS REAGENTS REQUIRED Table A 3 New England Biolabs Reagents Required Reagent Description Part Number Nsp I 125 uL vial 10 000 U mL containing RO602L Bovine Serum Albumin BSA NEB P N B9001S e NE Buffer 2 NEB P N B7002S The BSA and NE Buffer can be ordered separately using these part numbers Sty 300 uL vial 10 000 U mL containing RO500S Bovine Serum Albumin BSA NEB P N B9001S e NE Buffer NEB P N B7003S The BSA and NE Buffer can be ordered separately using these part numbers T4 DNA Ligase 250 uL vial Contains M0202L T4 DNA Ligase T4 DNA Ligase Buffer NEB P N B202S 228 GeneChip Mapping 500K 96 Well Plate Protocol OTHER REAGENTS REQUIRED Table A 4 Other Reagents Required for the Mapping 500K 96 Well Plate Protocol Reagent Vendor Description Part Number TITANIUM DNA Clontech Contains 639240 Amplification Kit 50X TITANIUM Taq DNA Polymerase 300 reactions e 10X TITANIUM Taq PCR Buffer sinan a 190 e GC Melt AR dNTPs DNA Amplification Clean Clon
22. IMPORTANT E To minimize sample loss due to evaporation be sure that the plate is tightly sealed before running the 500K Label thermal cycler program PREPARE THE REAGENTS CONSUMABLES AND OTHER COMPONENTS IMPORTANT Hi Thaw Reagents Thaw the following reagents on ice gt X TdT Buffer GeneChip DNA Labeling Reagent Leave the TdT enzyme at 20 C until ready to use 110 GeneChip Mapping 500K Assay Manual Prepare Your Work Area To prepare the work area 1 Place a double cooling chamber and a cooler on ice 2 Prepare the reagents as follows A Vortex each reagent at high speed 3 times 1 sec each time B Pulse spin for 3 sec C Place in the cooling chamber 3 Label and place the following in the cooling chamber One strip of 12 tubes labeled MM One 15 mL centrifuge tube labeled MM e Plate of fragmented reactions from the previous stage Preheat the Thermal Cycler Block The block must be heated to 37 C before samples are loaded To preheat the thermal cycler block 1 Turn on the thermal cycler and preheat the block to 37 C 2 Allow it to heat for 10 minutes before loading samples PREPARE THE LABELING MASTER MIX Preparation Keep all reagents and tubes on ice while preparing the Labeling Master Mix To prepare the Labeling Master Mix 1 Add the following to the 15 mL centrifuge tube on ice using the volumes shown in Table 4 33 5X TdT Buffer GeneChip DNA Labelin
23. M J Determinants of DNA yield and quality from buccal cell samples collected with mouthwash Cancer Epidemiol Biomarkers Prev 10 9 1005 8 2001 Heath Ellen M Morken Nathaniel W Campbell Kristen A Tkach Dennis Boyd Erin A Strom Daniel A Use of Buccal Cells Collected in Mouthwash as a Source of DNA for Clinical Testing Arch Pathol Lab Med 125 127 133 2001 King I B Satia Abouta J Thornquist M D Bigler J Patterson R E Kristal A R Shattuck A L Potter J D White E Abouta J S Buccal cell DNA yield quality and collection costs comparison of methods for large scale studies Cancer Epidemiol Biomarkers Prev 11 10 Pt 1 1130 3 2002 Lench N Stanier P Williamson R Simple non invasive method to obtain DNA for gene analysis Lancet Jun 18 1 8599 1356 1358 1988 Paez J G Lin M Beroukhim R Lee J C Zhao X Richter D J Gabriel S Herman P Sasaki H Altshuler D Li C Meyerson M Sellers W R Genome coverage and sequence fidelity of phi29 polymerase based multiple strand displacement whole genome amplification Nucleic Acids Research 32 9 2004 Tzvetkov M V Becker C Kulle B Nurnberg P Brockmoller J Wojnowski L Genome wide single nucleotide polymorphism arrays demonstrate high fidelity of multiple displacement based whole genome amplification Electrophoresis Feb 26 3 710 5 2005 Wong K K Tsang Y T M Shen J Cheng R S
24. Sty GeneChip Mapping 250K Assay Kits Nsp 30 Rxn Kit P N 900766 Nsp 100 Rxn Kit P N 900753 e Sty 30 Rxn Kit P N 900765 e Sty 100 Rxn Kit P N 900754 Terminal Deoxynucleotidyl Transferase 30 U uL Affymetrix P N 900508 for 30 Rxns and P N 900703 for 100 Rxns available in the Nsp and Sty GeneChip Mapping 250K Assay Kits Nsp 30 Rxn Kit P N 900766 Nsp 100 Rxn Kit P N 900753 e Sty 30 Rxn Kit P N 900765 e Sty 100 Rxn Kit P N 900754 5X Terminal Deoxynucleotidyl Transferase Buffer Affymetrix P N 900425 for 30 Rxns and P N 900696 for 100 Rxns available in the Nsp and Sty GeneChip Mapping 250K Assay Kits Nsp 30 Rxn Kit P N 900766 Nsp 100 Rxn Kit P N 900753 e Sty 30 Rxn Kit P N 900765 e Sty 100 Rxn Kit P N 900754 Equipment PCR Thermal Cycler Ramp speeds on these models are critical assay protocols have been optimized for these two thermal cycler models only e MJ Research DNA Engine Tetrad PTC 225 96 well block or ABI GeneAmp PCR System 9700 gold plated 96 well block 298 GeneChip Mapping 500K Assay Manual Table D 6 Reagents Equipment and Supplies Not Supplied by Affymetrix Assay Step Reagents Equipment Target Hybridization 5 M TMACL Tetramethyl Ammonium Chloride e GeneChip Hybridization Sigma P N T3411 Oven 640 10 Tween 20 Pierce P N 28320 Surfact Amps diluted to 3 in molecular biology grade water MES hydrate SigmaUltra Sigma P N M5287
25. filled with ice 1 Marker fine point permanent 1 Pipette single channel P20 1 Pipette single channel P100 1 Pipette single channel P1000 1 Pipette 12 channel P20 accurate to within 5 1 Pipette 12 channel P200 As needed Pipette tips for pipettes listed above full racks 4 Plate optical For example the UV Star Transparent 96 well Use the optical plate recommended for use with your plate reader 1 Plate 96 well reaction 1 Plate centrifuge 5 Plate seal 1 Spectrophotometer plate reader 1 Solution basin 100 mL 1 Vortexer REAGENTS REQUIRED The following reagents are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information The amounts listed are sufficient to process one full 96 well reaction plate 86 GeneChip Mapping 500K Assay Manual Table 4 22 Reagents Required for Stage 6 Quantitation and Normalization Quantity Reagent As needed RB Buffer from Clontech DNA Amplification Clean Up Kit 75 mL AccuGENE water molecular biology grade IMPORTANT INFORMATION ABOUT THIS STAGE To help ensure the best results carefully read the information below before you begin this stage of the protocol IMPORTANT Hi Prepare three independent dilutions of each sample for accurate concentration measurement Average the results for each individual sample before normalizing
26. 1 PROBLEM Average Sample OD is greater than 0 7 3 5 pg pL If the average sample OD of three independent measurements is greater than 0 7 calculated concentration greater than 3 5 ug uL a problem exists with either the elution of PCR products or the OD reading The limit on PCR yield is approximately 3 5 ug L as observed in practice and as predicted by the mass of dNTPs in the reaction Possible causes include e The purified PCR product was eluted in a volume less than 45 uL e The purified PCR product was not mixed adequately before making the 1 100 dilution e The diluted PCR product was not mixed adequately before taking the OD reading e The water blank reading was not subtracted from each sample OD reading e The spectrophotometer plate reader may require calibration e Pipettes may require calibration e There may be air bubbles or dust in the OD plate e There may be defects in the plastic of the plate e The settings on the spectrophotometer plate reader or the software may be incorrect e OD calculations may be incorrect and should be checked Reliance on any single OD reading may give an outlier result You should make three independent dilutions and take three independent OD readings per dilution chapter 8 Troubleshooting 219 Table 8 2 PROBLEM Average Sample OD is Less Than 0 5 2 5 pg pL If the average sample OD of three independent measurements is less than 0 5 calculated concentration less than 2
27. 19 20 This method reproducibly amplifies a subset of the human genome through a single primer amplification reaction using restriction enzyme digested adaptor ligated human genomic DNA In contrast many alternative genotyping technologies depend on multiple 2 to 6 locus specific oligonucleotides per SNP which often precludes scaling due to cost and technical difficulty to the magnitude required for linkage and association studies This assay was first developed for simultaneous genotyping of over 10 000 SNPs on a single array GeneChip Human Mapping 10K Array Xba 142 2 0 and has been used to date for both linkage studies 21 34 and association studies 35 39 Recently the WGSA assay has been extended to allow highly accurate SNP genotyping of over 100 000 SNPs using the two array GeneChip Human Mapping 100K Set 40 With an average inter marker distance of 23 6 kb the arrays provide increasingly dense coverage for whole genome association studies 41 Recently landmark breakthroughs in age related macular degeneration and multiple sclerosis provide additional examples that this approach has now been proven to work for whole genome association studies 42 43 The same characteristics that make SNPs useful markers for genetic studies also make SNPs powerful markers for additional biological applications such as the analysis of DNA copy number changes which include but are not limited to loss of heterozygosity LOH deletions and g
28. 2720 Thermal Cycler or an MJ Tetrad PTC 225 Thermal Cycler Requires the use of an Applied Biosystems 2720 Thermal Cycler or an MJ Tetrad PTC 225 Thermal Cycler located adjacent to the hybridization ovens Samples are on a 96 well reaction plate See Method 2 Using an Applied Biosystems 2720 Thermal Cycler or an MJ Tetrad PTC 225 Thermal Cycler on page 127 Method 3 Using Heat Blocks Requires the use of two heat blocks and Eppendorf tubes one per sample See Hybridizing Samples Using Heat Blocks on page 130 First you will prepare a Hybridization Master Mix and add the mix to each sample Then based on the method you are using you will denature the samples on a thermal cycler methods 1 and 2 or ona heat block method 3 After denaturation you will load each sample onto the appropriate GeneChip Human Mapping 250K Array Nsp or Sty one sample per array The arrays are then placed into a hybridization oven that has been preheated to 49 C Samples are left to hybridize for 16 to 18 hours Two operators are required for all of the methods chapter 4 96 Well Plate Protocol 115 LOCATION AND DURATION Main Lab e Hands on time approximately 2 hours e Hybridization time 16 to 18 hours INPUT REQUIRED FROM PREVIOUS STAGE The input required from Stage 8 Labeling is Quantity Item 1 Plate of labeled DNA EQUIPMENT AND CONSUMABLES REQUIRED The following equipment and consumables are requ
29. 4 96 Well Plate Protocol 65 About Controls A PCR negative control can be included in the experiment to assess the presence of contamination Refer to Chapter 2 and Chapter 7 for more information PREPARE THE REAGENTS CONSUMABLES AND OTHER COMPONENTS IMPORTANT Thaw Reagents and Ligation Stage Plate To thaw the reagents and Ligation Stage Plate 1 Allow the following reagents to thaw on ice e TITANIUM Taq PCR Buffer e dNTPs e PCR Primer 002 Leave the TITANIUM Taq DNA Polymerase at 20 C until ready to use 2 If the Ligation Stage plate was frozen allow to thaw in a cooling chamber on ice Prepare Your Work Area Pre PCR Clean Area To prepare the work area 1 Place two double or four single cooling chambers and one cooler on ice Figure 4 1 on page 39 2 Label the following then place in a cooling chamber e Three 96 well reaction plates labeled P1 P2 P3 see Figure 4 2 on page 67 e A 50 mL Falcon tube labeled PCR MM 3 Place on ice e AccuGENE water e GC Melt e Solution basin 66 GeneChip Mapping 500K Assay Manual 4 Prepare the Ligation Stage plate as follows A Vortex the center of the plate at high speed for 3 sec B Spin down the plate at 2000 rpm for 30 sec C Label the plate Lig D Place back in the cooling chamber on ice 5 To prepare the reagents A Vortex at high speed 3 times 1 sec each time except for the enzyme B Pulse spin for 3 sec C Place in a
30. 4 Plate supports 1 Regulator QIAGEN 1 Solution basin 55 mL 1 Vortexer 76 GeneChip Mapping 500K Assay Manual IMPORTANT Use only the PCR plate adhesive film and thermal cyclers listed in Table 4 1 on page 40 REAGENTS REQUIRED The following reagents are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information The amounts listed are sufficient to process one full 96 well reaction plate Table 4 20 Reagents Required for Stage 5 PCR Product Purification and Elution Quantity Reagent 1 Clean Up Plate Clontech 3 mL EDTA diluted to 0 1M working stock is 0 5 M pH 8 0 5 mL RB Buffer 75 mL AccuGENE water molecular biology grade IMPORTANT INFORMATION ABOUT THIS STAGE To help ensure the best results carefully read the information below before you begin this stage of the protocol IMPORTANT Hi The working stock of EDTA must be diluted to 0 1 M before use e The AccuGENE water listed in Appendix A must be used for this stage Using in house ddH O is not acceptable and can negatively impact downstream stages particularly Stage 7 Fragmentation The fragmentation reaction is very sensitive to pH and metal ion contamination To avoid cross contamination and the introduction of air bubbles pipette very careful when pooling the three PCR reactions for each sample onto the Clo
31. 48 pL of Ligation Master Mix to each tube of the strip tubes on ice 2 Using a 12 channel P20 pipette aliquot 5 25 pL of Ligation Master Mix to each reaction on the Digestion Stage Plate Reagent Volume Sample Digested DNA 19 75 uL Ligation Master Mix 5 25 uL Total 25 uL Contains ATP and DTT Keep on ice Seal the plate tightly with adhesive film Vortex the center of the plate at high speed for 3 sec Spin down the plate at 2000 rpm for 30 sec Ensure that the thermal cycler lid is preheated No OT CIR W Load the plate onto the thermal cycler and run the 500K Ligate program chapter 4 96 Well Plate Protocol 59 500K Ligate Program Temperature Time 16 C 180 minutes 70 C 20 minutes 4 C Hold DILUTE THE SAMPLES To dilute the samples 8 Place the AccuGENE Water on ice 20 minutes prior to use 1 When the 500K Ligate program is finished remove the plate and spin it down at 2000 rpm for 30 sec Place the plate in a cooling chamber on ice Dilute each reaction as follows A Pour 10 mL AccuGENE water into the solution basin B Using a 12 channel P200 pipette add 75 pL of the water to each reaction The total volume in each well is 100 pL Reagent Volume Sample Ligated DNA 25 uL AccuGENE water 75 uL Total 100 pL 4 Seal the plate tightly with adhesive film 5 Vortex the center of the plate at high speed for 3 sec 6 Spin down the
32. 5 744 305 5 945 334 6 054 270 6 140 044 6 261 776 6 291 183 6 346 413 6 399 365 6 420 169 6 551 817 6 610 482 6 733 977 and EP 619 321 373 203 and other U S or foreign patents Copyright 2005 2006 Affymetrix Inc All rights reserved CHAPTER 1 CHAPTER 2 CHAPTER 3 Contents Overview 1 ABOUT THIS MANUAL 3 ABOUT WHOLE GENOME SAMPLING ANALYSIS 4 REFERENCES 8 Laboratory Setup 19 INTRODUCTION TO LABORATORY SETUP 21 PRE PCR CLEAN ROOM 22 PCR STAGING ROOM 22 MAIN LAB 23 SAFETY PRECAUTIONS 24 Genomic DNA General Requirements 25 INTRODUCTION 27 GENERAL REQUIREMENTS FOR HUMAN GENOMIC DNA 27 SOURCES OF HUMAN GENOMIC DNA 29 GENOMIC DNA EXTRACTION PURIFICATION METHODS 29 DNA CLEANUP 29 REFERENCES 30 CHAPTER 4 iv GeneChip Mapping 500K Assay Manual 96 Well Plate Protocol 33 96 WELL PLATE PROTOCOL 35 About This Protocol 35 BEFORE YOU BEGIN 38 Master Mix Preparation 38 Reagent Handling and Storage 38 Preparing the Work Area for Each Stage 39 thermal Cyclers Plates and Plate Seals 40 PRogram Your Thermal Cyclers 41 Cutting Strip Tubes From Plates 41 STAGE 1 GENOMIC DNA PLATE PREPARATION 42 About this Stage 42 Location and Duration 42 Input Required 42 Equipment and Consumables Required 43 Reagents Required 44 Preparing the Genomic DNA Plate 44 Aliquoting Prepared Genomic DNA 45 What You Can Do Next 45 STAGE 2 RESTRICTION ENZYME DIGESTION 46 About this Stage 46 Location and Duration 4
33. 5 99 11 99 94 NA18503_FinSty_vR1_579710_B4_7_SC7 864 0 679 0 1500 0 1846 5 97 88 99 79 Batch Analysis NA18959_FinSty_vR1_879712_C11_4_SC4 822 5 655 5 1612 0 1947 0 97 56 99 71 Lan NA10865_FinSty_vR1_579710_A4_7_SC1 581 0 315 5 890 5 1046 5 99 21 99 91 ya NA11831_FinSty_vR1_579710_A5_7_SC3 1134 0 525 5 1844 0 2009 5 99 00 99 87 Attributelmporter Tool Shared SNP Patterns 1 CEL Data SNP1 SNP2 SNP3 SNPS SNP5 SNP6 SNP7 SNF Probe Intensity NA12234_FinSty_vR1_679712_A12_4_8C5 AA AA BB AB AA AB M AB NA18969_FinSty_vR1_579712_C12_4_SC5 AA AB AB BB AB AB BB AB d NA18605_FinSty_vR1_579710_D5_7_8C5 AB AA AA AB AB BB BB BB Publish Tool NA18503_FinSty_vR1_579710_B4_7_SC7 AB BB AB AA BB AA AB AB NA18959_FinSty_vR1_579712_C11_4_SC4 AA AA AB AB BB AB BB AA A NA10855_FinSty_vR1_579710_A4_7_SC1 AA AB AB BB A AB MA AB Reports NA11831_FinSty_vR1_579710_A5_7_SC3 AA BB BB BB AA AA AB AB Ei 09 15 05 13 34 45 GTYPE Software initialization complete Figure 7 6 Dynamic Model Mapping Algorithm report chapter 7 Analysis Workflow 197 Genomic DNA Quality Genomic DNA should be prepared following the guidelines in Chapter 3 of this manual DNA prepared outside these guidelines e g degraded DNA nicked DNA or DNA with inhibitors may produce lower Call Rates without necessarily reducing accuracy A gel image of the DNA before restriction digestion should be used to evaluate DNA quality Direct comparison to the Reference Genomic
34. 5 ug uL a problem exists with either the genomic DNA the PCR reaction the elution of purified PCR products or the OD readings Possible problems with input genomic DNA that would lead to reduced yield include The presence of inhibitors heme EDTA etc Severely degraded genomic DNA Inaccurate concentration of genomic DNA NOTE Check the OD reading for the PCR products derived from RefDNA 103 as a control for these issues To prevent problems with the PCR reaction that would lead to reduced yield Use the recommended reagents and vendors including AccuGENE water for all PCR mix components Thoroughly mix all components before making the PCR Master Mix Pipette all reagents carefully particularly the PCR Primer when making the master mix Check all volume calculations for making the master mix Store all components and mixes on ice when working at the bench Do not allow reagents to sit at room temperature for extended periods of time Be sure to use the recommended PCR plates Plates from other vendors may not fit correctly in the thermal cycler block Differences in plastic thickness and fit with the thermal cycler may lead to variance in temperatures and ramp times Be sure to use the correct cycling mode when programming the thermal cycler maximum mode on the GeneAmp PCR System 9700 calculated mode on the MJ Tetrad PTC 225 Be sure to use silver or gold plated silver blocks on the GeneAmp PCR System 9
35. DNA 103 control in a 2 agarose gel is one way to accomplish this If an alternate genomic DNA preparation method is used it is highly recommended that a small pilot experiment be conducted to evaluate reproducibility and accuracy of genotype calls Deviation from Assay Protocol A problem in any step of the assay may lead to a decreased Call Rate The gel images produced before DNA digestion and before PCR cleanup the PCR yield after cleanup and a gel image after fragmentation can be used to identify problematic steps Consult Chapter 8 Troubleshooting for further information At a minimum a PCR negative control water instead of DNA template should be incorporated into each group of samples processed The Reference Genomic DNA 103 is included in the assay kit as a positive process control DETECTING SAMPLE CONTAMINATION Monitoring sample contamination is a critical component of sample processing in SNP genotyping While detection of mixed or contaminated samples is relatively straightforward with multi allelic markers such as microsatellite markers it can be more of a challenge for bi allelic markers The presence of contamination in a sample reduces genotyping accuracy and therefore genetic power Guidelines are described in this manual that aid in reducing contamination i e lab set up as well as detecting contamination through gel electrophoresis i e process negative controls and PCR negative controls and analysis metrics i
36. IMPORTANT 264 GeneChip Mapping 500K Assay Manual cover vortex at medium speed for 2 seconds and spin at 2 000 rpm for 1 minute 4 Consolidate three PCR reactions for each sample into one well of the Clean Up Plate For PCR samples prepared in three 96 well PCR plates an 8 or 12 channel pipette can be used to transfer each row of 12 samples in the PCR plates to the corresponding row of the Clean Up Plate With the vacuum on the three PCR reactions for each sample 300 uL can be combined into one well of the Clean Up Plate Be sure to dilute EDTA to 0 1M A higher concentration may interfere with downstream steps To avoid piercing the membrane do not pipet up and down in the Clean Up Plate Make sure the orientations of PCR plates are consistent Use a method of distinguishing between used and unused wells on the plate Be sure to maintain the vacuum at 600 mbar Three water washes must be done to remove PCR reaction contaminants e g EDTA Be sure to completely dry the membrane between each wash After the final wash every well must be completely dry before adding elution buffer This step is critical to prevent the dilution of DNA with water 5 Apply a vacuum and maintain at 600 mbar until the wells are completely dry IMPORTANT Hi appendix C Low Throughput Protocol 265 6 Wash the PCR products by adding 50 pL molecular biology grade water and d
37. LaFramboise T Lin M Beroukhim R Garraway L Beheshti J Lee J C Naoki K Richards W G Sugarbaker D Chen F Rubin M A Janne P A Girard L Minna J Christiani D Li C Sellers W R Meyerson M Homozygous deletions and chromosome amplifications in human lung carcinomas revealed by single nucleotide polymorphism array analysis Cancer Res 65 5561 70 2005 Garraway L A Widlund H R Rubin M A Getz G Berger A J Ramaswamy S Beroukhim R Milner D A Granter S R Du J Lee C Wagner S N Li C Golub T R Rimm D L 16 GeneChip Mapping 500K Assay Manual 57 58 59 60 62 63 Meyerson M L Fisher D E Sellers W R Integrative genomic analyses identify MITF as a lineage survival oncogene amplified in malignant melanoma Nature 436 117 22 2005 Sebat J Lakshmi B Troge J Alexander J Young J Lundin P Maner S Massa H Walker M Chi M Navin N Lucito R Healy J Hicks J Ye K Reiner A Gilliam T C Trask B Patterson N Zetterberg A Wigler M Large scale copy number polymorphism in the human genome Science 305 525 8 2004 Sharp A J Locke D P McGrath S D Cheng Z Bailey J A Vallente R U Pertz L M Clark R A Schwartz S Segraves R Oseroff V V Albertson D G Pinkel D Eichler E E Segmental duplications and copy number variation in the human genome Am J Hum Gene
38. Ligase New England Biolabs NEB P N M0202L containing T4 DNA Ligase Buffer New England Biolabs NEB P N BO0202S Molecular Biology Grade Water BioWhittaker Molecular Applications Cambrex P N 51200 Adaptor Nsp 50 uM Affymetrix P N 900596 for 30 Rxnx and P N 900697 for 100 Rxns if running Nsp Array available in the GeneChip Mapping 250K Nsp Assay Kit 30 Rxn Kit P N 900766 100 Rxn Kit P N 900753 Adaptor Sty 50 uM Affymetrix P N 900597 for 30 Rxns and P N 900698 for 100 Rxns if running Sty Array available in the GeneChip Mapping 250K Sty Assay Kit e 30 Rxn Kit P N 900765 100 Rxn Kit P N 900754 Equipment Thermal Cycler Table D 6 appendix D Reagents Instruments and Supplies Required for Low Throughput Protocol 295 Reagents Equipment and Supplies Not Supplied by Affymetrix Assay Step PCR Reagents Equipment e G C Melt 5 M Clontech P N 639238 PCR Thermal Cycler e H O Molecular Grade Biology Water BioWhittaker Ramp speeds on these Molecular Applications Cambrex P N 51200 models are critical assay dNTP 2 5 mM each Takara P N 4030 Fisher protocols have been Scientific P N TAK 4030 or Invitrogen P N optimized for these two R72501 FN1 thermal cycler models PCR Primer 002 100 pM Affymetrix P N only 900595 for 30 Rxns and P N 900702 for 100 e MJ Research DNA Rxns if running Nsp Array available in the Engine Tetrad GeneChip Mapping 250
39. MES Sodium Salt Sigma P N M5057 DMSO Sigma P N D5879 0 5 M EDTA Ambion P N 9260G Denhardt s Solution Sigma P N D2532 HSDNA Herring Sperm DNA Promega P N D1815 Human Cot 1 DNA Invitrogen P N 15279 011 Oligo Control Reagent 0100 OCR 0100 Affymetrix P N 900541 for 30 Rxns and 900701 for 100 Rxns available in the Nsp and Sty GeneChip Mapping 250K Assay Kits Nsp 30 Rxn Kit P N 900766 Nsp 100 Rxn Kit P N 900753 Sty 30 Rxn Kit P N 900765 Sty 100 Rxn Kit P N 900754 Wash and Staining 20X SSPE BioWhittaker Molecular Applications e GeneChip Fluidics Cambrex P N 51214 Station 450 Denhardt s Solution 50X concentrate Sigma P N D2532 10 Tween 20 Pierce P N 28320 Surfact Amps Molecular Biology Grade Water BioWhittaker Molecular Applications Cambrex P N 51200 SAPE Streptavidin R phycoerythrin conjugate Invitrogen P N S866 1 mg mL Ab Biotinylated Anti Streptividin Vector Laboratories P N BA 0500 0 5mg reconstitute according to product instructions Distilled water Invitrogen Life Technologies P N 15230147 Bleach 5 25 Sodium Hypochlorite VWR Scientific P N 21899 504 or equivalent Scanning e GeneChip Scanner 3000 7G Denotes critical reagents equipment or supplies Formulations or vendors not listed here have not been tested and verified at Affymetrix In some cases lower performance has been demonstrated by reagents from non qualified vendors
40. Module door open showing peristaltic tubing 2 Open the white clamps to release tubing on both sides See Figure 6 7 Do not attempt to replace the tubing on a module where the module has been removed from the case of the fluidics station In this case rotating the pump may damage the motor driver circuitry chapter 6 Fluidics Station Care and Maintenance 167 White Clamp Figure 6 7 Releasing peristaltic tubing 3 Pull tubing off while gently turning the peristaltic pump head Discard old tubing 4 Replace tubing with new peristaltic tubing supplied with the accessory kit as described below A Attach one end of the new tubing to the fitting on the right at the top of the pump enclosure B Insert the tubing into the clamp under the fitting without stretching the portion of the tubing between the fitting and the clamp There should be a small amount of slack in that portion of the tubing C Work the tubing into the pump head while slowly turning the pump D Insert the free end of the tubing into the other clamp and attach it to the other fitting E Close the drop down module door 5 Order more replacement tubing P N 400110 168 GeneChip Mapping 500K Assay Manual Troubleshooting and Assistance If problems arise with the fluidics station use the following tables to locate the description that matches the problem If a solution is not found call Affymetr
41. NA18523_StEa_550955_ 10 2_A1_SC3APT Cox Data of Type Reports t RPT Cancel Figure 7 4 Open dialog box 2 From the Data of Type drop down list select Reports RPT Select the Mapping Algorithm report from the displayed list 4 Click OK to open the report The report contains information that can be used to assess the performance of the sample Refer to Table 7 1 for the report components and description chapter 7 Analysis Workflow 187 Table 7 1 Dynamic Model Mapping Algorithm Report Components Report Component Description Total number of SNPs Number of SNPs on array Total number of QC Probes Number of OC SNPs on array Probe array type Affymetrix probe array model number SNP Performance A list of the analyzed samples with the following information Sample An identifier assigned to the analyzed samples Gender Gender of the sample determined by the DM algorithm SNP Call Rate Number of SNP calls Total number of SNPs on the array AA Call Rate The number of AA calls for the sample Total number of SNPs on the array AB Call Rate The number of AB calls for the sample Total number of SNPs on the array BB Call Rate The number of BB calls for the sample Total number of SNPs on the array QC Performance A list of the analyzed samples with the following information Sample An identifier assigned to the analyzed samples Median PM Median Intensity V
42. ON ICE Table C 9 Fragmentation Mix Reagent Volume Sample Purified PCR product 90 ug in RB buffer 45 uL 10X Fragmentation Buffer 5 uL Total 50 uL 3 Examine the label of the GeneChip Fragmentation Reagent tube for U pL definition and calculate dilution Y number of pL of stock Fragmentation Reagent X number of U of stock Fragmentation Reagent per pL see label on tube 0 05 U pL final concentration of diluted Fragmentation Reagent 120 pL final volume of diluted Fragmentation Reagent 0 05 U pL 120 pL X U pL Y enough for 20 reactions 270 GeneChip Mapping 500K Assay Manual IMPORTANT Hi As the concentration of stock Fragmentation Reagent U yL may vary from lot to lot it is essential to check the concentration before conducting the dilution Do calculations prior to diluting sample and Fragmentation Reagent IMPORTANT Hi To ensure uniform and reproducible fragmentation completely pipet the viscous reagent from the stock vial into the diluted enzyme mix Thorougly mix the diluted enzyme before aliquoting to the DNA samples IMPORTANT p The Fragmentation Reagent must be added to the fragmentation mix quickly and ON ICE to minimize enzyme activity prior to placing the samples on the thermal cycler 4 Dilute the stock of Fragmentation Reagent to 0 05 U pL as follows A Place the water Molecular Biology Grade Fragmentation Buffer and Fr
43. PCR and Main Lab Jitterbug 115V AC 1 Boekel Scientific 130000 Main Lab Manifold QlAvac multiwell unit 1 QIAGEN 9014579 Main Lab Microcentrifuge PicoFuge 2 Stratagene 400550 Pre PCR and maximum rotation 6000 rpm Main Lab Pipet Lite Magnetic Assist single channel 2 Rainin L 10 Main Lab P10 Pipet Lite Magnetic Assist single 2 Rainin L 20 Pre PCR and channell P20 Main Lab Pipet Lite Magnetic Assist single channel 2 Rainin L 100 Main Lab P100 Pipet Lite Magnetic Assist single channel 2 Rainin L 200 Pre PCR and P200 Main Lab Pipet Lite Magnetic Assist single channel 2 Rainin L 1000 Main Lab P1000 Pipette 12 channel P20 2 Rainin P N L12 20 Pre PCR and accurate to within 5 Main Lab appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol 231 Table A 6 Other Equipment Required to Run the GeneChip Mapping 500K 96 Well Plate Protocol Equipment Quantity Manufacturer Part Number Laboratory Distributor Location Pipette 12 channel P100 2 Rainin P N L12 100 Pre PCR and Main Lab Pipette 12 channel P200 2 Rainin P N L12 200 Pre PCR and Main Lab Plate UV Star Transparent 96 well 3 E amp K Scientific EK 25801 Main Lab Plate Centrifuge multipurpose 2 Eppendorf 5804 or 5810 Pre PCR and Main Lab Plate stand optional 1 Diversified WPST 1000 Main Lab Biotech Spectrophotometer high throughput 1 Molecular SpectraMax Main Lab microplate spectrophotomete
44. Software Required The 96 well plate protocol has been optimized using the following equipment and software AFFYMETRIX EQUIPMENT AND SOFTWARE REQUIRED Table A 5 Affymetrix Equipment and Software Required Item Part Number GeneChip Fluidics Station 450 00 0079 GeneChip Hybridization Oven 640 800139 GeneChip Scanner 3000 7G 00 0205 GeneChip Operating Software version 1 4 690031 GeneChip Genotyping Analysis Software 4 0 690051 Denotes critical reagents equipment or supplies Formulations or vendors not listed here have not been tested and verified at Affymetrix In some cases lower performance has been demonstrated by reagents from non qualified vendors 230 GeneChip Mapping 500K 96 Well Plate Protocol OTHER EQUIPMENT REQUIRED Table A 6 Other Equipment Required to Run the GeneChip Mapping 500K 96 Well Plate Protocol Equipment Quantity Manufacturer Part Number Laboratory Distributor Location StrataCooler Lite 400012 Pre PCR and Benchtop Main Lab Cooler 2 Stratagene StrataCooler II 400002 blue Benchtop 400008 red Cooling chamber single gold block 2 double Diversified CHAM 1000 1 single in and Biotech __ Pre PCR double gold block 1 single CHAM 1020 enough for 4 plates in Main Lab Heat block required only if using tubes for 2 Fisher Scientific 11 718 9 Main Lab Stage 9 Target Hybridization Ice bucket _ 2 _ _ Pre
45. Spin down the plate at 2000 rpm for 30 sec ona Pw Cut the adhesive film between each row of samples Do not remove the film N Place the plate onto the thermal cycler and close the lid Run the 500K Hyb program 500K Hyb Program Temperature 95 C 10 minutes 49 C Hold chapter 4 96 Well Plate Protocol 125 Load the Samples onto Arrays This procedure requires 2 operators working simultaneously Operator 1 loads the samples onto the arrays Operator 2 covers the septa with Tough Spots and loads the arrays into the hybridization ovens To load the samples onto arrays Operator 1 Tasks 1 10 11 When the plate reaches 49 C slide back the lid on the thermal cycler enough to expose the first row of samples only Remove the film from the first row Using a single channel P200 pipette remove 200 pL of denatured sample from the first well Immediately inject the sample into an array Pass the array to Operator 2 NOTE The tasks for Operator 2 are listed below Remove 200 pL of sample from the next well and immediately inject it into an array Pass the array to Operator 2 Repeat this process one sample at a time until the entire row is loaded Place a fresh strip of adhesive film over the completed row Slide the thermal cycler lid back to expose the next row of samples Repeat steps 3 through 10 until all of the samples have been loaded onto arrays IMPORTANT EF 126
46. Tb gt e A r Hybridization PCR Staining Adaptor ligation B Scanning Set conditions lt to amplify HES 200 1 100 bp fragments e EE an m u h y r U gt 27 gt T Ha Figure 1 2 GeneChip Mapping Assay Sty References GeneChip Mapping 500K Assay Manual Botstein D White R L Skolnick M Davis R W Construction of a genetic linkage map in man using restriction fragment length polymorphisms Am J Hum Genet 32 314 31 1980 Lander E S Linton L M Birren B Nusbaum C Zody M C Baldwin J Devon K Dewar K Doyle M FitzHugh W al e Initial sequencing and analysis of the human genome Nature 409 860 921 2001 Venter J C Adams M D Myers E W Li P W Mural R J Sutton G G Smith H O Yandell M Evans C A Holt R A al e The sequence of the human genome Science 291 1304 51 2001 Botstein D Risch N Discovering genotypes underlying human phenotypes past successes for mendelian disease future approaches for complex disease Nat Genet 33 Suppl 228 37 2003 Carlson C S Eberle M A Kruglyak L Nickerson D A Mapping complex disease loci in whole genome association studies Nature 429 446 52 2004 Wang D G Fan J B Siao C J Berno A Young P Sapolsky R Ghandour G Perkins N Winchester E Spencer J et al Large scale identification mapping and genotyping of single nucleotide polymor
47. across samples and operators all equipment should be well maintained and calibrated including e The thermal cyclers used pre PCR PCR and post PCR GeneChip Hybridization Oven 640 GeneChip Fluidics Station 450 GeneChip Scanner 3000 7G The UV spectrophotometer plate reader All multi channel pipettes Since WGSA involves a series of ordered stages it follows that the output of one stage directly impacts the performance of the subsequent stage For example the quantity and purity of the DNA after purification and normalization can affect the kinetics of the Fragmentation Reagent during the subsequent fragmentation stage Variation in either the quantity or the relative purity of the DNA can result in over or under fragmentation which can lead to variability in genotype call rates To efficiently process samples in a 96 well plate it is essential to be proficient with the use of 12 channel pipettes Attempting to use a IMPORTANT Hi chapter 4 96 Well Plate Protocol 37 single channel pipette for plate based samples requires too many pipetting steps thus creating too high of a chance for error To familiarize yourself with the use of multi channel pipettes we strongly recommend practicing several times before processing actual samples You can use water to get a feel for the aspiration and dispensing of a solution to multiple wells simultaneously The post PCR stages 5 through 8 are best performed by the
48. be followed to ensure the success of the step Store the Fragmentation Reagent stock at 20 C until ready for use Make sure the purified PCR products are in RB buffer with proper volume 45 pL e Pre heat the thermal cycler to 37 C before setting up the fragmentation reaction Prepare the Fragmentation Reagent dilution immediately prior to use Prepare diluted Fragmentation Reagent in excess to avoid errors in taking a small volume of Fragmentation Reagent Perform all the dilution addition and mixing steps ON ICE Perform all the steps AS QUICKLY AS POSSIBLE Discard remaining Diluted Fragmentation Reagent after use Tips on handling the Fragmentation Reagent Store Fragmentation Reagent stock at 20 C until ready for use e Transfer Fragmentation Reagent in a 20 C cooler and keep in the cooler until used Return to the cooler immediately after use e Work efficiently while preparing mixes for the fragementation reaction Briefly spin down Fragmentation Reagent tube Do not vortex e Avoid excess enzyme on the outside of the pipette tip while preparing mixes appendix C Low Throughput Protocol 269 FRAGMENTATION PROCEDURE IMPORTANT i Program the thermal cycler in advance Switch on the thermal cycler 10 minutes before reactions are ready so that the lid is heated 1 Pre heat thermal cycler to 37 C 2 Add 5 pL 10X Fragmentation Buffer to each sample in the fragmentation plate
49. cartridge into the cartridge holder Push the holder door shut and firmly lift the lever to engage the cartridge needles chapter 6 Fluidics Station Care and Maintenance 177 Table 6 5 Continued Other Problems Problem Possible Cause Solution Sample needles do not properly enter vial Bent sample needle User may be pressing the needle lever down too quickly or with too much force Replace sample needle Engage sample needle lever more slowly and or with less force 178 GeneChip Mapping 500K Assay Manual INSTRUMENT SPECIFICATIONS Fluidics Station Dimensions height depth width 40 2 x 41 0 x 71 1 cm or 15 13 16 x 16 1 8 x 28 inches Product Weight Approximately 80 pounds or 36 3 kg Power Input 100 to 240 V 3 A 300 watts or less Main supply voltage fluctuations not to exceed 15 of the nominal supply voltage Temperature Operating 15 to 30 C Storage non operating 10 to 60 C Humidity Operating 10 90 RH non condensing Storage non operating 10 to 95 RH Other Pollution degree 2 Installation category II Electrical Supply The electrical supply should meet the input specified on the instrument label Voltage fluctuations should not exceed 15 nominal supply voltage Altitude lt 2000 m Chapter pi Analysis Workflow Chapter 181 Introduction The purpose of this chapter is to outline the necessary steps to anal
50. choice that have emerged for whole genome linkage scans and association studies are single nucleotide polymorphisms SNPs Although there are multiple sources of genetic variation that occur among individuals SNPs are the most common type of sequence variation and are powerful markers due to their abundance stability and relative ease of scoring 6 Current estimates of the total human genetic variation suggest that there are over 7 million SNPs with a minor allele frequency of at least 5 7 The ongoing international effort to build a haplotype map will identify a standard set of common allele SNPs that are expected to provide the framework for new genome wide studies designed to identify the underlying genetic basis of complex diseases pathogen susceptibility and differential drug responses 8 9 Genome wide association studies which are based on the underlying principle of linkage disequilibrium LD in which a disease predisposing allele co segregates with a particular allele of a SNP have been hampered by the lack of whole genome genotyping methodologies 10 As new genotyping technologies develop coupled with ongoing studies into chapter 1 Overview 5 LD patterns and haplotype block structure across the genome improvements in the design and power of association studies will be feasible 11 18 We have developed an assay termed whole genome sampling analysis WGSA for highly multiplexed SNP genotyping of complex DNA
51. cooling chamber Preheat the Thermal Cycler Lids Main Lab Have someone in the Main Lab power on the thermal cyclers to be used for the PCR to preheat the lids The lids must be preheated before loading samples leave the blocks at room temperature If you are preparing the plates for PCR it is best not to go from the Pre PCR Room or Staging Area to the Main Lab and then back again ADD DNA TO THE REACTION PLATES To add DNA to the reaction plates 1 Working one row at a time and using a 12 channel P20 pipette transfer 10 pL of sample from each well of the Ligation Plate to the corresponding well of each reaction plate Example Figure 4 2 on page 67 Transfer 10 pL of sample from each well of row A on the Ligation Plate to the corresponding wells of row A on reaction plates P1 P2 and P3 2 Seal each plate with adhesive film and leave in cooling chambers on ice chapter 4 96 Well Plate Protocol 67 D gt 6 Ligation Stage Plate 2eseee e e e 6 eseee eeee es e P p2 P3 Reaction Plate P1 Reaction Plate P2 Reaction Plate P3 An equal aliquot of each sample from the Ligation Stage Plate is transferred to the corresponding well of each PCR Plate For example an equal aliquot of each sample from row A on the Ligation Stage Plate is transferred to the corresponding wells of
52. each Takara P N 4030 or Fisher Scientific P N TAK 4030 PCR Primer 002 100 pM Affymetrix P N 900595 for 30 Rxns and P N 900702 for 100 Rxns Available in the Nsp and Sty GeneChip Mapping 250K Assay Kits Nsp 30 Rxn Kit P N 900766 Nsp 100 Rxn Kit P N 900753 Sty 30 Rxn Kit P N 900765 Sty 100 Rxn Kit P N 900754 Clontech TITANIUM Taq DNA Polymerase 50X Clontech P N 639209 50X Clontech TITANIUM Taq DNA Polymerase 10X Clontech TITANIUM Taq PCR Buffer 2 TBE Gel BMA Reliant precast 2 SeaKem Gold Cambrex Bio Science P N 54939 e All Purpose Hi Lo DNA Marker Bionexus Inc P N BN20S0 or Direct Load Wide Range DNA Marker Sigma P N D7058 Gel Loading Solution Sigma P N G2526 e Tubes Individual tubes Bio Rad P N TWI 0201 8 Tube Strips thin wall 0 2 mL Bio Rad P N TBS 0201 Strip of 8 caps Bio Rad P N TCS 0801 e Plate 1 dNTPs from Invitrogen P N R72501 have been tested on a limited basis with similar results You should test in your own lab prior to full scale production 258 GeneChip Mapping 500K Assay Manual 96 well plate Bio Rad P N MLP 9601 96 well Clear Adhesive Films Applied Biosystems P N 4306311 PCR Thermal Cycler this assay has only been optimized for the following two thermal cyclers GeneAmp PCR System 9700 with gold plated block Applied Biosystems or DNA Engine Tetrad PTC 225 MJ Research IMPORTANT Hi
53. enzyme A Vortex 3 times 1 sec each time 50 GeneChip Mapping 500K Assay Manual B Pulse spin for 3 sec C Place in the cooling chamber Preheat the Thermal Cycler Lid Power on the thermal cycler to preheat the lid Leave the block at room temperature PREPARE THE DIGESTION MASTER MIX IMPORTANT Er The same team or individual operator should not process samples with both Nsp and Sty enzymes on the same day Best practice is to process samples for either Nsp or Sty on a given day Keeping all reagents and tubes on ice prepare the Digestion Master Mix as follows 1 A o onos To the 2 0 mL Eppendorf tube add the appropriate volumes of the following reagents based on Table 4 7 Nsp or Table 4 8 Sty e AccuGENE Water e NE Buffer e BSA Remove the appropriate enzyme Nsp I or Sty I from the freezer and immediately place in a cooler Pulse spin the enzyme for 3 sec Immediately add the enzyme to the master mix then place remaining enzyme back in the cooler Vortex the master mix at high speed 3 times 1 sec each time Pulse spin for 3 sec Place in the cooling chamber Return any remaining enzyme to the freezer Proceed immediately to Add Digestion Master Mix to Samples on page 51 chapter 4 96 Well Plate Protocol 51 Table 4 7 Nsp Digestion Master Mix Reagent 1 Sample 96 Samples 15 extra AccuGENE Water 11 55 uL 1275 1 uL NE B
54. hybridization mix can be stored at 20 C for future use IMPORTANT The hybridization temperature is 49 C This is different from the GeneChip expression assay and the Mapping 10K and 100K assays 282 GeneChip Mapping 500K Assay Manual on ak meee A eee ee Appendix D Reagents Instruments and Stippllas Required for Low Throughput Protocol 284 GeneChip Mapping 500K Assay Manual 286 Introduction This section describes the reagents supplies and equipment required to implement the GeneChip Mapping 500K Low Throughput Protocol The first section describes the Affymetrix GeneChip Mapping 250K Assay Kits for Nsp and Sty Nsp 30 Rxn Kit P N 900766 Nsp 100 Rxn Kit P N 900753 Sty 30 Rxn Kit P N 900765 Sty 100 Rxn Kit P N 900754 which contains critical reagents and reagent components specifically developed and or optimized for the GeneChip Mapping 500K Assay and controls that are integrated for use with the GeneChip Mapping 500K Array Set This section also indicates the Affymetrix equipment scanner fluidics station hybridization oven and GeneChip Mapping 250K arrays required for this assay The second section describes the reagents supplies and instruments that are required but not supplied directly by Affymetrix The products and vendors listed in this section have been tested at Affymetrix during the development of the product other products and vendo
55. in your experiment file use GTYPE to export the genotype calls and pedigree information toa file in either MERLIN GeneHunter or Haploview format For more information on these formats please refer to the GeneChip Genotyping Analysis Software User s Guide Before using the linkage analysis export tool the following must be done e Assign a sample template with pedigree attributes to the samples e Import sample attribute data To export data for linkage analysis 1 Click the SNP Export button in the Genotyping Views shortcut bar or select Tools gt Genotype gt SNP Export from the menu bar 2 Click the MERLIN GeneHunter or Haploview tab to select the export format Specify sample attributes containing pedigree information For information on sample attribute values for these formats please consult the GeneChip Genotyping Analysis Software User s Guide chapter 7 Analysis Workflow 191 3 Select the file set project sample experiments or analysis data in the data tree and drag them to the Samples box 4 Optional Choose any filters that need to be applied to the data The SNP filters allow you to filter out SNPs that do not meet the particular requirements of your experiment from the export You can filter by e Allele Frequency Hardy Weinberg Probability Value Mendelian error rate When filtering on Mendelian error you have the option to remove the erroneous SNPs from t
56. loading arrays chapter 4 96 Well Plate Protocol 121 IMPORTANT Hi An accurate hybridization temperature is critical for this assay Therefore we recommend that your hybridization ovens be serviced at least once per year to ensure that they are operating within manufacture specifications Thaw Reagents If the labeled samples from the previous stage were frozen Thaw the plate on the bench top Vortex the center of the plate at high speed for 3 sec Spin down the plate at 2000 rpm for 30 sec Place in a cooling chamber on ice g PF WRN If hybridizing samples using Method 1 or 2 the labeled samples must be placed in a Bio Rad unskirted 96 well plate P N MLP 9601 For Method 2 the plate will be cut into 4 strips of 24 wells each Preheat the Thermal Cycler Lid A thermal cycler is required only if you are hybridizing samples using Method 1 or 2 See Hybridizing Samples Using a Thermal Cycler on page 124 Power on the thermal cycler to preheat the lid Leave the block at room temperature PREHEAT THE HEAT BLOCKS Heat blocks are required only if you are hybridizing samples using Method 3 See Hybridizing Samples Using Heat Blocks on page 130 To prepare the heat blocks 1 Turn on both heat blocks 2 Preheat one to 99 C 3 Preheat the other to 49 C 122 GeneChip Mapping 500K Assay Manual PREPARE THE ARRAYS To prepare the arrays 1 Unwrap the arrays and place on the bench top septa
57. major band at approximately 10 20 kb on the gel assay performance may vary with DNA that is substantially more degraded Pre amplified genomic DNA has been tested with the Human Mapping 500K Assay and found to give results comparable to the standard DNA preparation methods The Repli G Kit a O29 whole genome amplification kit QIAGEN was used to amplify 10 ng genomic DNA and the amplified products were immediately used in the subsequent protocol steps This DNA gave call rates between 96 and 98 Nsp and 95 and 98 Sty and concordance greater than 99 Other pre amplification methods or pre digestion with restriction enzymes other than Nsp I or Sty I have not been tested by Affymetrix If these other methods are desired it is recommended that the user conduct experiments to evaluate these other methods with the Mapping 500K Assay chapter 3 Genomic DNA General Requirements 29 Sources of Human Genomic DNA The following sources of human genomic DNA have been successfully tested in the laboratories at Affymetrix for DNA that meets the requirements described in the section General Requirements for Human Genomic DNA on page 27 e blood e cell line Success with other types of samples such as formalin fixed paraffin embedded tissue will depend on quality degree of degradation degree of inhibitors present etc quantity of genomic DNA extracted and purity of these types of samples as described in the section General Requ
58. monitor right click your experiment and select Advance to Scan Refer to the GeneChip Operating Software User s Guide for further information 3 Click the Load Eject button and place the array in the scanner Only one scan is required for the GeneChip Scanner 3000 7G Please do not attempt to manually open or close the GeneChip Scanner 3000 7G scanner door as this may damage the scanner 4 Once the experiment has been selected click the Start button A dialog box prompts to load the array into the scanner chapter 5 Washing Staining and Scanning Arrays 151 5 Pixel resolution and wavelength for the GeneChip Scanner 3000 7G are preset and cannot be changed 6 Open the sample door of the scanner and insert the probe array into the holder The door of the GeneChip Scanner 3000 7G closes automatically IMPORTANT Hi Do not force the probe array into the holder 7 Click OK in the Start Scanner dialog box The scanner begins scanning the probe array When Scan in Progress is selected from the View menu the probe array image appears on the screen as the scan progresses 152 GeneChip Mapping 500K Assay Manual Shutting Down the Fluidics Station 1 After removing a probe array from the probe array holder the LCD window displays the message ENGAGE WASHBLOCK 2 For the FS 450 gently lift up the cartridge lever to engage or close the washblock The fluidics station automatically perfo
59. on ice e If not proceeding directly to the next step store the samples at 20 C chapter 4 96 Well Plate Protocol 53 Stage 3 Ligation ABOUT THIS STAGE During this stage the digested samples are ligated using either the Nsp or Sty Adaptor You will prepare the Ligation Master Mix then add it to the samples The samples are then placed onto a thermal cycler and the 500K Ligate program is run When the program is finished you will dilute the ligated samples with AccuGENE water LOCATION AND DURATION e Pre PCR Clean Area e Hands on time 30 minutes 500K Ligate thermal cycler program time 3 3 hours INPUT REQUIRED FROM PREVIOUS STAGE The input required from Stage 2 Restriction Enzyme Digestion is Quantity Item 1 Plate of digested samples in a cooling chamber on ice 54 GeneChip Mapping 500K Assay Manual EQUIPMENT AND CONSUMABLES REQUIRED The following equipment and consumables are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information Table 4 9 Equipment and Consumables Required for Stage 3 Ligation Quantity Item 1 Cooler chilled to 20 C 1 Cooling chamber double chilled to 4 C do not freeze 1 Ice bucket filled with ice 1 Marker fine point permanent 1 Microcentrifuge 1 Pipette single channel P100 1 Pipette sin
60. options in the Tools menu bar chapter 7 Analysis Workflow 183 File Edit View Run Tools Window Help 18 x g i 8 fl E Open Saye Prit Tree Shorts Status Analyze Image Help ER x e 23 Data Source Local Add Remove Run Analysis Stop Options Bl Experiments input Ftp Report ____ E U t_j t i E FH Cell Intensities WH 3520_10 CEL E 3521_11 CEL 1 3522 1 CEL E 3523_30 CEL 3524 2 CEL B 3525_7 CEL WH 3530_12 CEL WB 3533_5 CEL WA 3537_8 CEL WH 3538_30 CEL WH 3539_13 CEL WH 3540_4 CEL WH 3541_30 CEL ail Analysis Results t t FileSets Pedigree Check Sample Mismatch Report Batch Analysis Attributelmporter Tool J a 08 25 05 11 55 19 GTYPE Software initialization complete f Ti i Fitters applied Z Figure 7 2 GTYPE main window with the Batch Analysis window and Filters Applied message 2 Click Analyze and the files will be analyzed generating chp files containing genotype calls 3 After Batch Analysis is complete a report will be displayed summarizing data from the samples This rpt file is saved in the GCOS data directory OUTPUT NOTE 184 GeneChip Mapping 500K Assay Manual Single File Analysis 1 In the Data Source window browse to your cel file of interest Right click that cel file 2 Click Analyze and a chp file of genotyping calls will be generat
61. or antibody in vial Wash empty Air bubbles in line Leaks Loose tubing attachments inside the fluidics station Identify if chip is filled If important to recover fluid in chip then run Recovery script followed by Resume function If not important to recover fluid in chip run Resume function Call Affymetrix Technical Support for service 172 GeneChip Mapping 500K Assay Manual Table 6 3 Continued Common error messages their meanings probable causes and solutions Error Message Problem Fluidics Station X Does Not Respond Possible Cause Power not switched on at the fluidics station Incorrect fluidics station designated for communication Loose cables Solution Turn fluidics station power on and then try to connect again Designate correct fluidics station on workstation Firmly connect cables to fluidics station Sensor Timeout Sensor Timeout error message on workstation No user response to Remove Vial prompt or other prompt Start the selected script again Error While Draining Error While Filling Cartridge is not filling or draining properly Defective septa in cartridge Insufficient sample or stain volume Excessive bubbling in cartridge Buffer conductivity too low Failure of one of the fluid sensors Use a new cartridge Add more sample solution to sample vial Change the buffer reduce detergent C
62. plate at 2000 rpm for 30 sec IMPORTANT Hi It is crucial to dilute the ligated DNA with AccuGENE water prior to PCR 60 GeneChip Mapping 500K Assay Manual WHAT YOU CAN DO NEXT Do one of the following If proceeding to the next step store the plate in a cooling chamber on ice for up to 60 minutes If not proceeding directly to the next step store the plate at 20 C chapter 4 96 Well Plate Protocol 61 Stage 4 PCR ABOUT THIS STAGE During this stage you will transfer equal amounts of each ligated sample into three new 96 well plates Figure 4 2 on page 67 You will then prepare the PCR Master Mix and add it to each sample Each plate is placed onto a thermal cycler and the 500K PCR program is run When the program is finished you will check the results of this stage by running 3 pL of each PCR product on a 2 TBE gel LOCATION AND DURATION Pre PCR Clean Area PCR Master Mix preparation PCR Staging Area PCR set up Main Lab PCR Plates placed on thermal cyclers Hands on time 1 hour e 500K PCR thermal cycler program time 1 5 hours samples can be held overnight INPUT REQUIRED FROM PREVIOUS STAGE The input required from Stage 3 Ligation is Quantity Item 1 Plate of diluted ligated samples Keep in a cooling chamber on ice 62 GeneChip Mapping 500K Assay Manual EQUIPMENT AND MATERIALS REQUIRED The following equipment and materials are required to perform
63. plate is tightly sealed particularly around the wells on the edge of the plate The plate must be tightly sealed to minimize evaporation while on the thermal cycler 4 Vortex the center of the plate at high speed for 3 sec 5 Spin down the plate at 2000 rpm for 30 sec 6 Place the plate on the pre heated thermal cycler block and run the 500K Label program Samples can remain at 4 C overnight 500K Label Program Temperature 37 C 4 hours 95 C 15 minutes 4 C Hold Samples can remain at 4 C overnight 7 When the 500K Labeling program is finished A Remove the plate from the thermal cycler B Spin down the plate at 2000 rpm for 30 sec chapter 4 96 Well Plate Protocol 113 WHAT YOU CAN DO NEXT Do one of the following Proceed to the next stage If not proceeding directly to the next stage freeze the samples at 20 C 114 GeneChip Mapping 500K Assay Manual Stage 9 Target Hybridization ABOUT THIS STAGE During this stage each sample is loaded onto either a GeneChip Human Mapping 250K Sty Array or a 250K Nsp Array Three methods for performing this stage are presented Method 1 Using a GeneAmp PCR System 9700 Requires the use of aGeneAmp PCR System 9700 located adjacent to the hybridization ovens Samples are on a 96 well reaction plate See Method 1 Using a GeneAmp PCR System 9700 on page 124 Method 2 Using an Applied Biosystems
64. prevent salt crystals from forming within the fluidics system e When not using the instrument leave the sample needles in the lowered position Each needle should extend into an empty vial This will protect them from accidental damage Always use deionized water to prevent contamination of the lines Change buffers with freshly prepared buffer at each system startup The fluidics station should be positioned on a sturdy level bench away from extremes in temperature and away from moving air Before performing maintenance turn off power to the station to avoid injury in case of a pump or electrical malfunction INSTRUMENT MAINTENANCE To ensure proper functioning of the fluidics station perform periodic maintenance 156 GeneChip Mapping 500K Assay Manual Fluidics Station Bleach Protocol Affymetrix recommends a weekly cleaning protocol for the fluidics station This protocol uses commonly purchased sodium hypochlorite bleach This protocol is designed to eliminate any residual SAPE antibody complex that may be present in the fluidics station tubing and needles The protocol runs a bleach solution through the system followed by a rinse cycle with deionized DI water This protocol takes approximately one hour and forty minutes to complete Affymetrix recommends running this protocol weekly regardless of the frequency of use The current version of the protocol can be found at www affymetrix com support techni
65. row A on PCR Plates P1 P2 and P3 Figure 4 2 Transferring Equal Aliquots of Diluted Ligated Samples to Three Reaction Plates 68 GeneChip Mapping 500K Assay Manual PREPARE THE PCR MASTER MIX IMPORTANT Prepare enough PCR Master Mix to run three PCR reactions per sample Location Pre PCR Clean Room Prepare the PCR Master Mix To prepare the PCR Master Mix The PCR reaction is sensitive to the concentration of primer used It is critical that the correct amount of primer be added to the PCR Master Mix to achieve the correct distribution of fragments 200 to 1100 bp in the products Check the PCR reactions on a gel to ensure that the distribution is correct see Figure 4 3 90 ug of PCR product is needed for fragmentation 1 Keeping the 50 mL Falcon tube in the cooling chamber add the reagents in Table 4 16 in the order shown 2 Remove the TITANIUM Taq DNA Polymerase from the freezer and immediately place in a cooler Pulse spin the Taq DNA polymerase for 3 sec Immediately add the Taq DNA polymerase to the master mix then return the tube to the cooler on ice Vortex the master mix at high speed 3 times 1 sec each time Pour the mix into the solution basin keeping the basin on ice chapter 4 96 Well Plate Protocol 69 Table 4 16 PCR Master Mix Reagent For 1 Reaction For 3 PCR Plates 15 extra AccuGENE water 39 5 uL 13 082 mL TITANIUM Taq PCR Buffe
66. sample should be based on the examination of all samples and array performance metrics CALL RATE chapter 7 Analysis Workflow 195 Call Rate is displayed in the Dynamic Mapping Algorithm report Figure 7 6 in the SNP Call column It is an indicator of the overall performance of the assay Using the Reference Genomic DNA 103 sample as the standard a Call Rate in excess of 93 at a confidence score of 0 33 indicates that all steps from restriction digestion through scanning worked as expected A reduced Call Rate may result if an error in any of the assay steps occurs or if lower quality DNA samples are processed It is also common to observe lower Call Rates in circumstances where a new operator is learning the assay or the number of samples processed at one time increases In these later examples it may be prudent to budget time for additional practice for the operator in order to increase proficiency with the assay and achieve higher performance Some other factors that can lead to a reduced Call Rate include Deviation from the assay protocol e Contaminated DNA e Expired reagents e Inaccurate quantitation For a sample with a lower Call Rate it is important to take into consideration the reasons for the lower Call Rate as well as the degree to which accuracy is compromised It may be necessary to repeat target preparation for that sample depending on the degree to which the lower Call Rate and decrease in accuracy affects th
67. the 96 well plate and the low throughput protocol 500K Ligate Program Temperature Time 16 C 180 minutes 70 C 20 minutes 4 C Hold 500K PCR 240 GeneChip Mapping 500K Assay Manual Required for the 96 well plate and the low throughput protocol For the GeneAmp PCR System 9700 You must use GeneAmp PCR System 9700 thermal cyclers with silver or gold plated silver blocks Do not use GeneAmp PCR System 9700 thermal cyclers with aluminum blocks Ramp speed Max Volume 100 pL 500K PCR Program for GeneAmp PCR System 9700 Temperature Time Cycles 94 C 3 minutes 1X 94 C 30 seconds 60 C 45 seconds 30X 68 C 15 seconds 68 C 7 minutes 1X 4 C HOLD Can be held overnight For the MJ Tetrad PTC 225 Use Heated Lid and Calculated Temperature Volume 100 pL 500K PCR Program for MJ Tetrad PTC 225 Temperature Time Cycles 94 C 3 minutes 1X 94 C 30 seconds 60 C 30 seconds 30X 68 C 15 seconds 68 C 7 minutes 1X 4 C HOLD Can be held overnight appendix B Thermal Cycler Programs 241 500K FRAGMENT Required for the 96 well plate and the low throughput protocol 500K Fragment Program Temperature Time 37 C 35 minutes 95 C 15 minutes 4 C Hold 500K LABEL Required for the 96 well plate and the low throughput protocol 500K Label Program Temperature 37 C 4 hours 95 C 15 minutes 4 C Hold 500K HYB R
68. transfer to ensure that all of the product is dispensed C Examine the pipette tips and aliquots before and after each dispense to ensure that exactly 2 pL has been transferred D Transfer 2 pL of each purified PCR product from row H of the purified sample plate to the corresponding rows and wells of optical plate 4 E Again pipette up and down 2 times after each transfer and examine the pipette tips and aliquots before and after each dispense The result is a 100 fold dilution Two of the wells containing water only will serve as blanks 4 Set a 12 channel P200 pipette to 180 pL Mix each sample by pipetting up and down 5 to 10 times Be careful not to scratch the bottom of the plate or to introduce air bubbles 89 chapter 4 96 Well Plate Protocol Optical Plate 1 Optical Plate 2 Optical Plate 3 rA z A A Tr lt c N AB BB BAe 999999969 9 9999909 999 9 2 999 9 9 9909 OOOOO S 9299 Optical Plate 4 at 999 9 99 9 99 9 99 o 99 9 6 l amp 9000 OOOOOODO 00909000 WwW 9099 99 9 0 00O00O0 999 9 99 66 999 9 99 0 0 99 999 90909 0 J 9 9 999 9 9 6 6 999 9 9 9 0 0 99990990 999 9 9099 9 0 H 8 9 9 9 99 6 999 099 eee oO0C 9 99 9 9 0 99OOOOGD OS O9OOOOH OOOC 00000000 OODOHED OOODOOOGDO 00000090
69. tray 4 arrays per tray evenly spaced IMPORTANT Hi 132 GeneChip Mapping 500K Assay Manual 10 11 Place the trays in the oven 32 arrays per oven Do not allow arrays to sit on the bench top for more than 1 minute after the sample has been loaded Ensure that the oven is balanced as the trays are loaded and ensure that the trays are rotating at 60 rpm at all times Because you are loading 4 arrays per tray each hybridization oven will have a total of 32 arrays Repeat this procedure until all 16 samples are loaded onto arrays and placed in the oven Process the Remaining Samples To process the remaining samples 1 Repeat the procedures listed under e Load Samples Onto a Heat Block and e Remove Samples from Heat Block and Load Onto Arrays Allow the arrays to rotate at 49 C 60 rpm for 16 to 18 hours Store the remaining sample and any samples not yet hybridized in a tightly sealed plate at 20 C Allow the arrays to rotate for 16 to 18hours at 49 C This temperature has been optimized for this product and should be stringently followed Chapter 5 Washing Staining d Scanning Arraya Chapter 5 Introduction This chapter contains instructions for using the Fluidics Station 450 to automate the washing and staining of GeneChip Mapping 250K Arrays and instructions for scanning probe arrays using the GeneChip Scanner 3000 7G After completing the procedures
70. valve did not reach a valid position when it was last rotated Error while Filling While filling the cartridge the AwaitMotor command terminated because of the step count not the expected sensor pattern and that the same error had occurred several times consecutively Error while Draining While draining the cartridge the AwaitMotor command terminated because the step count was not the expected sensor pattern and the same error had occurred several times consecutively chapter 6 Fluidics Station Care and Maintenance 175 Table 6 4 Continued Common Error Messages Error Message Meaning Missing Fluid Error Stage C WashA Examples Sense Threshold 960 890 Stage C WashA The Pump command completed its step Sense Threshold 960 890 count before the conductivity sensor determined that the cartridge contained a solution with conductivity below the set threshold value The Missing Fluid Error MFE Display not only gives a visual notification of an error condition to the operator but gives the operator information that enables him her to determine the cause of the error It does this by displaying information about the sensor value and the fluid that caused the error It shows this internal information in a continuous loop until the machine is powered down or a script is started For example Missing Fluid Error for 4 seconds Stage A valveP
71. vial EDTA 1 mL 1 vial Herring Sperm DNA HSDNA 500 uL 1 vial Human Cot 1 DNA 80g MES Hydrate SigmaUltra 200g MES Sodium Salt 16 mL 1 tube Tetramethy l Ammonium Chloride TMACL 5M 10 mL 1 vial Tween 20 10 250 uL 1 vial Oligo Control Reagent OCR 0100 IMPORTANT INFORMATION ABOUT THIS STAGE To help ensure the best results carefully read the information below before you begin this stage of the protocol IMPORTANT Hi This procedure requires two operators working simultaneously when loading samples onto arrays and placing arrays in the hybridization ovens If using a thermal cycler it is critical that the samples remain at 49 C after denaturation and while being loaded onto arrays If you have a GeneAmp PCR System 9700 located adjacent to the hybridization ovens we recommend using method 1 Otherwise chapter 4 96 Well Plate Protocol 119 you must use method 2 or method 3 see About this Stage on page 114 e About DMSO When adding to the Hybridization Master Mix pipette DMSO into the middle of the tube Do not touch the sides of the tube as the DMSO can leach particles out of the plastic which in turn may cause high background DMSO is light sensitive and must be stored in a dark glass bottle Do not store in a plastic container Be sure to allow the arrays to equilibrate to room temperature otherwise the rubber septa may crack and the array may
72. 00K Fragment program Once the program is finished you will check the results of this stage by running 4 pL of each reaction on a 4 TBE gel LOCATION AND DURATION e Main Lab e Hands on time 30 minutes 500K Fragment thermal cycler program time 1 hour INPUT REQUIRED FROM PREVIOUS STAGE The input required from Stage 6 Quantitation and Normalization iS Quantity Item 1 Plate of quantitated normalized PCR product in a cooling chamber on ice chapter 4 96 Well Plate Protocol 97 EQUIPMENT AND CONSUMABLES REQUIRED The following equipment and consumables are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information IMPORTANT Use only the PCR plate adhesive film and thermal cyclers listed in Table 4 1 on page 40 Table 4 27 Equipment and Consumables Required for Stage 7 Fragmentation Quantity Item 1 Cooler chilled to 20 C 1 Cooling chamber double chilled to 4 C do not freeze 1 Ice bucket filled with ice 1 Marker fine point permanent 1 Microcentrifuge 1 Pipette single channel P20 1 Pipette single channel P100 1 Pipette single channel P1000 1 Pipette 12 channel P20 accurate to within 5 As needed Pipette tips for pipettes listed above full racks 1 Plate centrifuge 1 Plate seal 1 Thermal cycler 2 Tube Eppendorf
73. 0778 for 30 Rxns and P N 900699 for 100 Rxns Available in the Nsp and Sty GeneChip Mapping 250K Assay Kits Nsp 30 Rxn Kit P N 900766 Nsp 100 Rxn Kit P N 900753 Sty 30 Rxn Kit P N 900765 Sty 100 Rxn Kit P N 900754 e Terminal Deoxynucleotidyl Transferase 30 U pL Affymetrix P N 900508 for 30 Rxns and P N 900703 for 100 Rxns Available in the Nsp and Sty GeneChip Mapping 250K Assay Kits Nsp 30 Rxn Kit P N 900766 Nsp 100 Rxn Kit P N 900753 Sty 30 Rxn Kit P N 900765 Sty 100 Rxn Kit P N 900754 e 5X Terminal Deoxynucleotidyl Transferase Buffer Affymetrix P N 900425 for 30 Rxns and P N 900696 for 100 Rxns Available in the Nsp and Sty GeneChip Mapping 250K Assay Kits Nsp 30 Rxn Kit P N 900766 Nsp 100 Rxn Kit P N 900753 Sty 30 Rxn Kit P N 900765 Sty 100 Rxn Kit P N 900754 appendix C Low Throughput Protocol 275 LABELING PROCEDURE IMPORTANT i MAIN LAB Program the thermal cycler in advance Switch on the thermal cycler 10 minutes before reactions are ready so that the lid is heated 1 Prepare Labeling Mix as master mix ON ICE and vortex at medium speed for 2 seconds for multiple samples make a 5 excess Table C 12 Final Conc in Sample Reagent 5X TdT Buffer 0 857 mM GeneChip DNA Labeling Reagent 30 mM 2 uL TdT 30 U L 3 5 uL 1 5 U uL Total 19 5 uL 2 Aliquot 19 5 pL of Labeling Master Mix into the fragmentation pl
74. 1 5 mL 2 Tubes strips of 12 cut from the Bio Rad 96 well unskirted PCR plate P N MLP 9601 IMPORTANT For this stage the strip tubes must be cut from this particular plate 1 Vortexer 98 GeneChip Mapping 500K Assay Manual REAGENTS REQUIRED The following reagents are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information The amounts listed are sufficient to process one full 96 well reaction plate Table 4 28 Reagents Required for Stage 7 Fragmentation Quantity Reagent 1 vial Fragmentation Buffer 10X 1 vial Fragmentation Reagent DNase l 2mL AccuGENE water molecular biology grade GELS AND RELATED MATERIALS REQUIRED The following gels and related materials are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information The amounts listed are sufficient to process one full 96 well reaction plate Table 4 29 5 4 TBE Gel 10 DNA Markers 5 uL each As needed Gel loading solution chapter 4 96 Well Plate Protocol 99 IMPORTANT INFORMATION ABOUT THIS STAGE To help ensure the best results carefully read the information below before you begin this stage of the protocol IMPORTANT EJ Purified PCR product must be normalized to 90 pg DNA in 45 pL RB Buffer The degree
75. 1 mg mL 3 uL 330 uL Tween 20 3 1 uL 110 uL DMSO 100 13 uL 1430 uL TMACL 5 M 140 uL 1540 mL Total 190 uL 20 9 mL Using Premixed Hybridization Master Mix Hybridization Master Mix can be made ahead of time aliquoted and stored for 1 week To prepare stored Hybridization Master Mix 1 Place the stored Hybridization Master Mix on the bench top and allow to warm to room temperature 2 Vortex at high speed until the mixture is homogeneous and without precipitates up to 5 minutes 3 Pulse spin for 3 sec 124 GeneChip Mapping 500K Assay Manual HYBRIDIZING SAMPLES USING A THERMAL CYCLER Method 1 Using a GeneAmp PCR System 9700 The thermal cycler used for this method must be a GeneAmp PCR System 9700 located adjacent to the hybridization ovens This particular thermal cycler is required because of the way the lid operates You can slide it back one row at a time as samples are loaded onto arrays Keeping the remaining rows covered prevents condensation in the wells Add Hybridization Master Mix and Denature the Samples To add Hybridization Master Mix and denature the samples 1 Pour 20 9 mL Hybridization Master Mix into a solution basin Using a 12 channel P200 pipette add 190 pL of Hybridization Master Mix to each sample on the Label Plate Total volume in each well is 260 pL IMPORTANT Seal the plate tightly with adhesive film Vortex the center of the plate for 3 minutes
76. 2 13 14 15 For laboratories that also run GeneChip Expression arrays it is important to check the temperature setting on the Hybridization Oven 640 For the GeneChip Mapping 250K Nsp Array and the GeneChip Mapping 250K Sty Array ovens should be set to 49 C The temperature for hybridization on expression arrays is 45 C We also recommend that your hybridization ovens be serviced at least once per year to ensure that they are operating within manufacture specifications Buffer B is different for the expression and DNA arrays Using the MES based buffer B from the Expression protocol will result in substantially reduced call rates for the GeneChip Mapping 500K Set Also care should be taken to ensure the fluidics station is properly maintained and primed with the correct buffers prior to use Both the GeneChip Mapping 500K and Expression protocols use the same stain reagents for each staining step However after the last wash the Mapping 250K Array is filled with Array Holding Buffer The arrays in the GeneChip Mapping 500K Set are scanned once at 570 nm on the GeneChip Scanner 3000 7G 214 GeneChip Mapping 500K Assay Manual Troubleshooting Guide for the GeneChip Mapping 500K Assay Problem Likely Cause Faint absent bands on PCR gel Solution Both samples amp positive control affected Problem with master mixes or individual reagents Ensure all reagents added to master mixes
77. 4 using TITANIUM Taq DNA polymerase Once the product has been purified and normalized stage 5 it is then fragmented in stage 7 with Fragmentation Reagent DNAse J and end labeled using terminal deoxynucleotidyl transferase stage 8 The stages involving enzymatic reactions are the most critical of the assay Thus it is important to carefully monitor and control any variables such as pH salt concentrations time and temperature all of which can adversely modulate enzyme activity Successful sample processing can be achieved by incorporating the following principles 36 GeneChip Mapping 500K Assay Manual Use only fresh reagents from the recommended vendors to help eliminate changes in pH or the salt concentration of buffers Properly store all enzyme reagents Storage methods can profoundly impact activity When using reagents at the lab bench Closely follow the protocol and ensure that enzymes are kept at 20 C until needed Keep all master mixes and working solutions in chilled cooling chambers as indicated Properly chill essential equipment such as centrifuges cooling chambers and reagent coolers before use Since enzyme activity is a function of temperature ensure that all temperature transitions are rapid and or well controlled to help maintain consistency across samples Along with the enzymatic stages lab instrumentation plays an important role in WGSA To aid in maintaining consistency
78. 6 Input Required From Previous Stage 46 Equipment and Consumables Required 46 Reagents Required 48 Important Information About This Stage 48 Prepare the Reagents Equipment and Consumables 49 Prepare the Digestion Master Mix 50 Add Digestion Master Mix to Samples 51 STAGE 3 LIGATION 53 About this Stage 53 Location and Duration 53 Input Required From Previous Stage 53 contents Equipment and Consumables Required Reagents Required Important Information About This Procedure Prepare the Reagents Consumables and Other Components Prepare the Ligation Master Mix Add Ligation Master Mix to Reactions Dilute the Samples What You Can Do Next STAGE 4 PCR About this Stage Location and Duration Input Required from Previous Stage Equipment and Materials Required Reagents Required Gels and Related Materials Required Important Information About This Stage Prepare the Reagents Consumables and Other Components Add DNA to the Reaction Plates Prepare the PCR Master Mix Add PCR Master Mix to Samples Load PCR Plates Onto Thermal Cyclers Running Gels What You Can Do Next STAGE 5 PCR PRODUCT PURIFICATION AND ELUTION About this Stage Location and Duration Input Required from Previous Stage Equipment and Consumables Required Reagents Required Important Information About This Stage Prepare the Reagents Consumables and Other Components Add Diluted EDTA to the PCR Products Prepare the Clean Up Plate Pool the PCR Products P
79. 6 Well Plate Protocol 131 A Place four tubes onto a heat block at 99 C and set a timer for 10 minutes B Wait 3 to 4 minutes then place another 4 tubes onto the heat block and set another timer for 10 minutes C Repeat this procedure until there are 16 samples loaded onto the heat block Remove Samples from Heat Block and Load Onto Arrays Two operators will perform this procedure at the same time two samples per person To load samples onto arrays 16 samples at a time 1 When the first timer indicates 10 minutes has transpired A Immediately remove the first samples two per operator B Cool on crushed ice for 10 sec then remove immediately Cool for 10 sec only If left on ice longer aggregates may form These aggregates will not break apart at 49 C and will reduce your call rate Cooling on ice is required for this method only due to the loose fit of the tubes on the heat blocks This step helps to ensure that the samples cool quickly to 49 C Pulse spin for 3 sec Place the tubes back on the heat block at 49 C for 1 minute Remove tubes from the heat block and check for precipitate a N Using a single channel P200 pipette remove 200 pL of denatured sample from one tube Immediately inject the sample into an array Cover each septa with a Tough Spot Figure 4 8 on page 127 Repeat steps 5 through 7 for the next sample oon Immediately load the arrays into a hybridization oven
80. 700 other blocks are not capable of maximum mode which will affect ramp times Use the recommended plate seal Make sure the seal is tight and that no significant evaporation occurs during the PCR NOTE The Mapping 500K PCR reaction amplifies a size range of fragments that represents 15 20 of the genome The Mapping 500K arrays are designed to detect the SNPs that are amplified in this complex fragment population Subtle changes in the PCR conditions may not affect the PCR yield but may shift the amplified size range up or down very slightly This can lead to reduced amplification of SNPs that are assayed on the array set subsequently leading to lower call rates 220 GeneChip Mapping 500K Assay Manual Table 8 2 PROBLEM Average Sample OD is Less Than 0 5 2 5 pg pL Troubleshooting Possible Problems with the Elution or OD Readings possible causes include e The purified PCR product was eluted in a volume greater than 45 uL e The purified PCR product was not mixed adequately before making the 1 100 dilution e The diluted PCR product was not mixed adequately before taking the OD reading e The water blank reading was not subtracted from each sample OD reading e The spectrophotometer plate reader may require calibration e Pipettes may require calibration e There may be air bubbles or dust in the OD plate e There may be defects in the plastic of the plate e The settings on the spectrophotometer plate reader or the softw
81. 9 HYBRIDIZATION PROCEDURE WARNING A IMPORTANT Hi IMPORTANT i Gloves safety glasses and lab coats must be worn when preparing the hybridization cocktail Please consult the appropriate MSDS for reagent storage and handling requirements It is important to allow the arrays to equilibrate to room temperature completely Specifically if the rubber septa are not equilibrated to room temperature they may be prone to cracking which can lead to leaks DMSO is light sensitive and must be stored in a dark glass bottle Do not store in a plastic container 1 Prepare the Hybridization Cocktail Master Mix in the order shown in Table C 14 For multiple samples prepare 5 excess Table C 14 Hybridization Cocktail Master Mix Reagent 1X Final Conc in Sample MES 12X 1 22 M 12 uL 0 056 M DMSO 100 13 uL 5 0 Denhardt s Solution 50X 13 uL 2 50X EDTA 0 5 M 3 uL 5 77 mM HSDNA 10 mg mL 3 uL 0 115 mg mL OCR 0100 2 uL 1X Human Cot 1 DNA 1 mg mL 3 uL 11 5 pg mL Tween 20 3 TuL 0 0115 TMACL 5 M 140 uL 2 69 M Total 190 uL IMPORTANT Hi IMPORTANT Hi 280 GeneChip Mapping 500K Assay Manual 2 Mix well This Hybridization Cocktail Master Mix can be stored at 20 C before proceeding to the next step 3 Transfer each of the labeled samples from the plate to a 1 5 mL Eppendorf tube Aliquot 190 pL of the Hybridization Cocktail Master Mix into th
82. A in a double cooling chamber on ice Otherwise seal each plate with adhesive film WHAT YOU CAN DO NEXT Do one of the following e Proceed to the next stage processing one plate of samples one enzyme at a time e Store the sealed plates of diluted genomic DNA at 20 C 46 GeneChip Mapping 500K Assay Manual Stage 2 Restriction Enzyme Digestion ABOUT THIS STAGE During this stage the genomic DNA is digested by one of two restriction enzymes Nsp I or Sty I You will prepare the Digestion Master Mix then add it to the samples The samples are then placed onto a thermal cycler and the 500K Digest program is run LOCATION AND DURATION e Pre PCR Clean Area e Hands on time 30 minutes 500K Digest thermal cycler program time 2 3 hours INPUT REQUIRED FROM PREVIOUS STAGE The input required from Stage 1 Genomic DNA Plate Preparation is Quantity 1 Plate 96 well Genomic DNA prepared as instructed in the previous stage 5 uL at 50 ng uL in each well Keep in a cooling chamber on ice EQUIPMENT AND CONSUMABLES REQUIRED The following equipment and consumables are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information IMPORTANT Use only the PCR plate adhesive film and thermal cyclers listed in Table 4 1 on page 40 chapter 4 96 Well Plate Protocol 47 Table 4 5 Equipment an
83. Available in the GeneChip Mapping 250K Assay Kits Sty 30 Rxn Kit P N 900765 Sty 100 Rxn Kit P N 900754 e Thermal cycler any Pre PCR Clean Room thermocycler Avoid multiple freeze thaw cycles with Ligase Buffer according to vendor s instructions 254 GeneChip Mapping 500K Assay Manual LIGATION PROCEDURE PRE PCR CLEAN AREA IMPORTANT Program the thermal cycler in advance Switch on the thermal cycler 10 minutes before reactions are ready so that the lid is heated IMPORTANT E Ligase buffer contains ATP and should be thawed held at 4 C Mix ligase buffer thoroughly before use to ensure precipitate is re suspended Avoid multiple freeze thaw cycles according to vendor s instructions 1 Depending on the restriction enzyme used prepare the following Ligation Master Mix ON ICE for multiple samples make a 5 excess Table C 4 Nsp I Reagent in Sample 1 Sample Final Conc Sty I 1 Sample Final Conc in Sample Reagent Adaptor Nsp I 50 uM 0 75 uL 1 5 uM Adaptor Sty I 50 uM 0 75 uL 1 5 uM T4 DNA Ligase buffer 2 5 uL 1X T4 DNA Ligase buffer 2 5 uL 1X 10X 10X T4 DNA Ligase 2 uL 32 U uL T4 DNA Ligase 2 uL 32 U uL 400 U uL 400 U uL Total 5 25 uL Total 5 25 uL Contains ATP and DTT Keep on ice Contains ATP and DTT Keep on ice appendix C Low Throughput Protocol 255 PCR STAGING AREA 2 Aliquot 5 25 p
84. Care and Maintenance 171 PROBLEMS AND SOLUTIONS Table 6 3 Common error messages their meanings probable causes and solutions Error Message Problem Missing Fluid Error Cartridge not filling initial stages of hybridization wash or staining protocol completely with sample solution or buffer during Possible Cause Possible holes in the septa of the cartridge Sample or staining solution not in place properly Insufficient volume of sample or staining solution 500 uL Blocked sampling tube or line of the fluidics station Failure of one of the fluidics sensors Pump tubing stretched too tightly around the pump Solution Run Recover script and then use another cartridge Run Recover script Make sure sample or stain vial is in the sample holder Run Recover script Add more sample solution to the sample vial Run Recover script Run the Clean or Prime script with fresh deionized DI water to flush out salt blockage Call Affymetrix Technical Support for service Loosen the tubing clamps allow tubing to relax close the clamps Cartridge not filling completely with buffer during wash script Buffer bottle empty Module not primed Fill buffer bottles Prime module conditions while filling Note where in protocol error occurred Recovered less sample than initial input during Recover script System detects improper Missing or insufficient stain
85. Chapter 4 high oligonucleotides which hybridize to throughput or control regions gridding controls and Appendix C low array controls on the GeneChip throughput Mapping 250K Arrays appendix D Reagents Instruments and Supplies Required for Low Throughput Protocol 289 Adaptor Nsp 5 ATTATGAGCACGACAGACGCCTGATCTCATG 3 3 AATACTCGTGCTGTCTGCGGACTAGAp 5 PCR Primer 002 5 ATTATGAGCACGACAGACGCCTGATCT 3 290 GeneChip Mapping 500K Assay Manual Table D 3 Reagents Supplied by Affymetrix 30 reaction Kit Affymetrix GeneChip Mapping 250K Sty Assay Kit P N 900765 This kit includes sufficient reagent for 30 arrays Component Volume Concentration Description Adaptor Sty 25 uL 50 uM Two annealed oligonucleotides specific 1 for ligation to Sty restriction site PCR Primer 002 450 uL 100 uM PCR primer to amplify ligated genomic 1 DNA Reference Genomic 30 uL 50 ng uL Human genomic DNA single source 2 DNA 103 GeneChip 25 uL See label on tube DNasel enzyme formulated to fragment 3 Fragmentation Reagent purified PCR amplicons 10X Fragmentation 250 uL 10X Buffer for fragmentation reaction 3 Buffer GeneChip DNA 60 uL 30 mM Biotin labeled reagent for end labeling 3 Labeling Reagent fragmented PCR amplicons 30 mM Terminal 105 uL 30 U uL Enzyme used to end label fragmented 3 Deoxynucleotidyl PCR amplicons with the GeneChip DNA Transferase Labelin
86. ENT AND CONSUMABLES REQUIRED IMPORTANT Hi The following equipment and consumables are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information Table 4 3 Equipment and Consumables Required for Stage 1 Genomic DNA Plate Preparation Quantity Item 1 Cooling chamber double chilled to 4 C do not freeze 1 Ice bucket filled with ice 1 Plate centrifuge 1 Pipette single channel P20 1 Pipette 12 channel P200 1 Pipette single channel P200 As needed Pipette tips As needed Reaction plates 96 well As needed Plate seals 1 Spectrophotometer plate reader 1 Vortexer Use only the PCR plate adhesive film and thermal cyclers listed in Table 4 1 on page 40 44 GeneChip Mapping 500K Assay Manual REAGENTS REQUIRED The following reagents are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information Table 4 4 Reagents Required for Stage 1 Genomic DNA Plate Preparation Quantity Item As needed Reduced EDTA TE Buffer 10 mM Tris HCL 0 1 mM EDTA pH 8 0 PREPARING THE GENOMIC DNA PLATE IMPORTANT Hi This protocol has been optimized using UV absorbance to determine genomic DNA concentrations Other quantitation methods such as PicoGreen will give different readings Ther
87. FOR FRAGMENTATION Add Fragmentation Buffer to Samples IMPORTANT Hi All of the additions in this procedure must be performed on ice To prepare the samples for Fragmentation 1 Aliquot 50 pL of 10X Fragmentation Buffer to each tube of the 12 tube strip labeled Buffer 2 Using a 12 channel P20 pipette add 5 pL of Fragmentation Buffer to each sample in the 96 well reaction plate Check your pipette tips each time to ensure that all of the buffer has been dispensed The total volume in each well is now 50 pL Dilute the Fragmentation Reagent IMPORTANT Hi The concentration of stock Fragmentation Reagent U uL may vary from lot to lot Therefore read the label on the tube and record the stock concentration before diluting this reagent Use the formula provided to accurately calculate the dilution required To dilute the Fragmentation Reagent 1 Read the Fragmentation Reagent tube label and record the concentration chapter 4 96 Well Plate Protocol 103 Table 4 30 Dilution Recipes for Fragmentation Reagent Concentrations of 2 and 3 U uL Fragmentation Reagent Reagent Concentration 2 U pL 3 U pL AccuGENE water 525 uL 530 uL Fragmentation Buffer 60 uL 60 uL Fragmentation Reagent 15 uL 10 uL Total 600 uL 600 uL enough for 96 samples 2 If the concentration is 2 or 3 U pL dilute the Fragmentation Reagent using the volumes show in Table 4 30 above 3 If the concentration i
88. GeneChip Mapping 500K Assay Manual Operator 2 Tasks 1 Cover the septa on each array with a Tough Spot Figure 4 8 2 For every 4 arrays A Load the arrays into an oven tray evenly spaced B Immediately place the tray into the hybridization oven Do not allow loaded arrays to sit at room temperature for more than approximately 1 5 minute Ensure that the oven is balanced as the trays are loaded and ensure that the trays are rotating at 60 rpm at all times Because you are loading 4 arrays per tray each hybridization oven will have a total of 32 arrays Operators 1 and 2 e Load no more than 32 arrays in one hybridization oven at a time e All 96 samples should be loaded within 1 hour e Store the remaining samples and any samples not yet hybridized in a tightly sealed plate at 20 C e Allow the arrays to rotate at 49 C 60 rpm for 16 to 18 hours Allow the arrays to rotate in the hybridization ovens for 16 to 18 hours at 49 C and 60 rpm This temperature is optimized for this product and should be stringently followed chapter 4 96 Well Plate Protocol 127 Figure 4 8 Applying Tough Spots to the array cartridge Method 2 Using an Applied Biosystems 2720 Thermal Cycler or an MJ Tetrad PTC 225 Thermal Cycler For this method you can use an Applied Biosystems 2720 Thermal Cycler or an MJ Tetrad PTC 225 Thermal Cycler The thermal cycler must be located adjacent to the hybridiz
89. Genotyping Views shortcut bar or select Tools gt Sample Mismatch Report from the menu bar 2 Drag and drop files from the Data Tree into the Mismatch Report dialog box Set the Mismatch Threshold Default is 1 95 optional If you defined Sample identifiers as sample attributes you can uses these attributes to identify mismatch samples Click the Define Sample Attributes button to define the sample sample attribute You can also specify a gender attribute to detect gender misregistrations The Sample Mismatch Report Figure 7 9 is a tab delimited text file providing information on the experiment input parameters a legend of the codes used in the Sample Mismatch Report as well as a list of data compared showing assigned and called gender the Mismatch score and any problems detected in the pair wise analysis For more information on the Sample Mismatch Report and Mismatch score please consult the GeneChip Genotyping Analysis Software User s 202 GeneChip Mapping 500K Assay Manual Guide Jr Sa Se a LE RD Paw Hime EN We a Person IDs match but the IOS is below the mismatch threshold b Persons genders match but the GTYPE genders der a Person IDs difer but the IBS is greater than or equal to the mismatch threshold b Persons genders difer but the IBS is greater than or equal to the mismatch threshold ic Persons genders match but differ from the GTYPE genders GTYPE genders diffor but the IBS is
90. J Newbury Ecob R Geenhalgh L Hughes S Whiteford M Garrett C Houlston R S Genomewide linkage searches for Mendelian disease loci can be efficiently conducted using high density SNP genotyping arrays Nucleic Acids Res 32 e164 2004 John S Shephard N Liu G Zeggini E Cao M Chen W Vasavda N Mills T Barton A Hinks A Eyre S Jones K W Ollier W Silman A Gibson N Worthington J Kennedy G C Whole genome scan in a complex disease using 11 245 single nucleotide polymorphisms comparison with microsatellites Am J Hum Genet 75 54 64 2004 chapter 1 Overview 11 23 Schaid D J Guenther J C Christensen G B Hebbring S Rosenow C Hilker C A McDonnell S K Cunningham J M Slager S L Blute M L Thibodeau S N Comparison of microsatellites versus single nucleotide polymorphisms in a genome linkage screen for prostate cancer susceptibility Loci Am J Hum Genet 75 948 65 2004 24 Sellick G S Garrett C Houlston R S A novel gene for neonatal diabetes maps to chromosome 10p12 1 p13 Diabetes 52 2636 8 2003 25 Middleton F A Pato M T Gentile K L Morley C P Zhao X Eisener A F Brown A Petryshen T L Kirby A N Medeiros H Carvalho C Macedo A Dourado A Coelho I Valente J Soares M J Ferreira C P Lei M Azevedo M H Kennedy J L Daly M J Sklar P Pato C N Genomewide linkage analysis of bipo
91. J Research DNA Engine Tetrad 500K PCR Program Specify 100 pL volume and use Heated Lid and Calculated Temperature 500K PCR Program for MJ Tetrad PTC 225 Temperature Time Cycles 94 C 3 minutes 1X 94 C 30 seconds 60 C 30 seconds 30X 68 C 15 seconds 68 C 7 minutes 1X 4 C HOLD NOTE Ez 262 GeneChip Mapping 500K Assay Manual GeneAmp PCR System 9700 Program Specify 100 pL volume and maximum mode 500K PCR Program for Geneamp PCR System 9700 Temperature Time Cycles 94 C 3 minutes 1X 94 C 30 seconds 60 C 45 seconds 30X 68 C 15 seconds 68 C 7 minutes 1X 4 C HOLD 6 Run 3 pL of each PCR product mixed with 3 pL 2X Gel Loading Dye on 2 TBE gel at 120V for 1 hour PCR products can be stored at 20 C if not proceeding to the next step within 60 minutes 2000 1000 750 500 300 100 Figure C 2 Typical example of PCR products run on 2 TBE agarose gel at 120V for 1 hour with average size between 200 and 1 100 bp appendix C Low Throughput Protocol 263 STEP 5 PCR Purification and Elution with Clontech Clean Up Plate REAGENTS AND EQUIPMENT DNA Amplification Clean Up Kit to be used with Affymetrix DNA products Clontech P N 636974 1 plate or P N 636975 4 plates each kit also contains RB Buffer Manifold QIAvac multiwell unit QIAGEN P N 9014579 EDTA 0 5 M pH 8 0 Ambion P N 9260G
92. K W Shapero M H Whole genome DNA copy number changes identified by high density oligonucleotide arrays Hum Genomics 1 287 99 2004 Nannya Y Sanada M Nakazaki K Hosoya N Wang L Hangaishi A Kurokawa M Chiba S Bailey D K Kennedy G C Ogawa S A robust algorithm for copy number detection using high density oligonucleotide single nucleotide polymorphism genotyping arrays Cancer Res 65 6071 9 2005 Wong K K Tsang Y T Shen J Cheng R S Chang Y M Man T K Lau C C Allelic imbalance analysis by high density single nucleotide polymorphic allele SNP array with whole genome amplified DNA Nucleic Acids Res 32 e69 2004 Zhao X Li C Paez J G Chin K Janne P A Chen T H Girard L Minna J Christiani D Leo C Gray J W Sellers W R Meyerson M An integrated view of copy number and allelic alterations in the cancer genome using single nucleotide polymorphism arrays Cancer Res 64 3060 71 2004 Zhou X Mok S C Chen Z Li Y Wong D T Concurrent analysis of loss of heterozygosity LOH and copy number abnormality CNA for oral premalignancy progression using the Affymetrix 10K SNP mapping array Hum Genet 115 327 30 2004 Rauch A Ruschendorf F Huang J Trautmann U Becker C Thiel C Jones K W Reis A Nurnberg P Molecular karyotyping using an SNP array for genomewide genotyping J Med Genet 41 916 22 2004 chapter 1 Overview 15
93. K Nsp Assay Kits PTC 225 96 well 30 Rxn Kit P N 900766 block or 100 Rxn Kit P N 900753 ABI GeneAmp PCR PCR Primer 002 100 pM Affymetrix P N System 9700 gold 900595 for 30 Rxns and P N 900702 for 100 plated 96 well block Rxns if running Sty Array available in the gel apparatus GeneChip Mapping 250K Sty Assay Kits e Jitterbug Boekel 30 Rxn Kit P N 900765 Scientific model e 100 Rxn Kit P N 900754 130000 e Clontech TITANIUM Taq DNA Polymerase 50X Clontech P N 639209 50X Clontech TITANIUM Taq DNA Polymerase 10X Clontech TITANIUM Taq PCR Buffer e 2 TBE Gel BMA Reliant precast 2 SeaKem Gold Cambrex Bio Science P N 54939 e All Purpose Hi Lo DNA Marker Bionexus Inc P N BN2050 or Direct Load Wide Range DNA Marker Sigma P N D7058 Gel Loading Solution Sigma P N G2526 PCR Tubes must be compatible and qualified with MJ DNA Engine Tetrad or ABI GeneAmp PCR System For example e Individual tubes Bio Rad P N TWI 0201 e 8 Tube Strips thin wall 0 2 mL Bio Rad P N TBS 0201 Strip of 8 caps Bio Rad P N TCS 0801 e Plate must be compatible and qualified with MJ DNA Engine Tetrad or ABI GeneAmp PCR System 96 well plate Bio Rad P N MLP 9601 96 well PLT Clear Adhesive Films Applied Biosystems P N 4306311 Table D 6 296 GeneChip Mapping 500K Assay Manual Reagents Equipment and Supplies Not Supplied by Affymetrix Assay Step
94. L a problem exists with either the genomic DNA the PCR reaction the elution of purified PCR products or the OD readings Possible problems with input genomic DNA that would lead to reduced yield include The presence of inhibitors heme EDTA etc Severely degraded genomic DNA Inaccurate concentration of genomic DNA NOTE Check the OD reading for the PCR products derived from RefDNA 103 as a control for these issues To prevent problems with the PCR reaction that would lead to reduced yield Use the recommended reagents and vendors including AccuGENE water for all PCR mix components Thoroughly mix all components before making the PCR Master Mix Pipette all reagents carefully particularly the PCR Primer when making the master mix Check all volume calculations for making the master mix Store all components and mixes on ice when working at the bench Do not allow reagents to sit at room temperature for extended periods of time Be sure to use the recommended PCR plates Plates from other vendors may not fit correctly in the thermal cycler block Differences in plastic thickness and fit with the thermal cycler may lead to variance in temperatures and ramp times Be sure to use the correct cycling mode when programming the thermal cycler maximum mode on the GeneAmp PCR System 9700 calculated mode on the MJ Tetrad PTC 225 Be sure to use silver or gold plated silver blocks on the GeneAmp PCR System 9700 ot
95. L of the Ligation Master Mix into each digested DNA sample Table C 5 Reagent Volume Sample Digested DNA 19 75 uL Ligation mix 5 25 uL Total 25 uL Contains ATP and DTT Keep on ice TIP El To expedite the aliquoting the Ligation Master Mix can be first divided into 8 or 12 microwell strips and then dispensed into the wells of the plate with an 8 channel or 12 channel pipette Pipet up and down for several times to mix Be sure to change tips between samples 3 Cover the plate with plate cover and seal tightly vortex at medium speed for 2 seconds and spin at 2 000 rpm for 1 minute 4 Place the plate in a thermal cycler and run the 500K Ligate program 500K Ligate Program Temperature Time 16 C 180 minutes 70 C 20 minutes 4 C Hold NOTE Ez Store samples at 20 C if not proceeding to the next step within 60 minutes 256 GeneChip Mapping 500K Assay Manual 5 Dilute each DNA ligation reaction by adding 75 pL of molecular biology grade H O as described below Table C 6 Ligated DNA 25 uL HO 75 uL Total 100 uL IMPORTANT j It is crucial to dilute the ligated DNA with molecular biology grade water prior to PCR appendix C Low Throughput Protocol 257 STEP 4 PCR REAGENTS AND EQUIPMENT e G C Melt 5 M Clontech P N 639238 e H O Molecular Biology Grade Water BioWhittaker Molecular Applications Cambrex P N 51200 e dNTP 2 5 mM
96. Leave the block at room temperature The lid must be preheated before samples are loaded PREPARE THE LIGATION MASTER MIX Keeping all reagents and tubes on ice prepare the Ligation Master Mix as follows 1 To the 2 0 mL Eppendorf tube add the following reagents based on the volumes shown in Table 4 11 for Nsp or Table 4 12 for Sty e Adaptor Nsp or Sty T4 DNA Ligase Buffer 10X 2 Remove the T4 DNA Ligase from the freezer and immediately place in the cooler on ice Pulse spin the T4 DNA Ligase for 3 sec 4 Immediately add the T4 DNA Ligase to the master mix then place back in the cooler 5 Vortex the master mix at high speed 3 times 1 sec each time 6 Pulse spin for 3 sec 7 Place the master mix on ice 8 Proceed immediately to Add Ligation Master Mix to Reactions Table 4 11 Nsp Ligation Master Mix Reagent 1 Sample 96 Samples 15 extra Adaptor Nsp 50 uM 0 75 uL 82 8 uL T4 DNA Ligase Buffer 10X 2 5 uL 276 uL T4 DNA Ligase 400 U uL 2uL 220 8 uL Total 5 25 uL 579 6 uL 58 GeneChip Mapping 500K Assay Manual Table 4 12 Sty Ligation Master Mix Reagent 1 Sample 96 Samples 15 extra Adaptor Sty 50 uM 0 75 uL 82 8 uL T4 Ligase Buffer 10X 2 5 uL 276 uL T4 DNA Ligase 400U uL 2 uL 220 8 uL Total 5 25 uL 579 6 uL ADD LIGATION MASTER MIX TO REACTIONS To add Ligation Master Mix to samples 1 Using a single channel P100 pipette aliquot
97. NetAffx SNP Annotation 193 ASSESSING DATA QUALITY 194 Call Rate 195 Detecting Sample Contamination 197 Oligonucleotide Controls 200 Sample Mismatch report 200 B2 Oligo Performance 203 Concordance with Reference Genotypes on Reference Genomic DNA 103 204 Downstream Analysis Considerations 206 CHAPTER 8 APPENDIX A contents ix Troubleshooting 209 ASSAY RECOMMENDATIONS 211 TROUBLESHOOTING GUIDE FOR THE GENECHIP MAPPING 500K ASSAY 214 OD TROUBLESHOOTING GUIDELINES 218 WHEN TO CONTACT TECHNICAL SUPPORT 221 Reagents Equipment and Consumables Required for 96 Well Plate Protocol 223 REAGENTS EQUIPMENT AND CONSUMABLES REQUIRED FOR 96 WELL PLATE PROTOCOL 225 About this Appendix 225 REAGENTS 226 Affymetrix Reagents Required 226 New England Biolabs Reagents Required 227 Other Reagents Required 228 EQUIPMENT AND SOFTWARE REQUIRED 229 Affymetrix Equipment and Software Required 229 Other Equipment Required 230 Thermal Cyclers PCR Plates and Plate Seals 232 CONSUMABLES REQUIRED 233 GeneChip Arrays Required 233 Other Consumables Required 233 SUPPLIER CONTACT LIST 235 APPENDIX B APPENDIX C x GeneChip Mapping 500K Assay Manual Thermal Cycler Programs 237 THERMAL CYCLER PROGRAMS 239 About this Appendix 239 500K Digest 239 500K Ligate 239 500K PCR 240 500K Fragment 241 500K Label 241 500K Hyb 241 Low Throughput Protocol 243 INTRODUCTION 245 Assay Overview 246 Before You Begin 247 GENOMIC DNA
98. OOOD DOOOOE OSOO OOOOOO e 9 Perde DOO 66 eseeese e 6 0 TOR TOT 2 P 4 2 e e 08808 eeesesesesesesese P P2 P3 0 899898295280 Clean Up Plate E 2 Pooled PCR product from row A of plate BL bottom left CUP BL Transfer and pool each PCR product from plates P1 P2 and P3 to the corresponding well of the Clean Up Plate For example transfer and pool the PCR product from well A1 of plates P1 P2 and P3 to the corresponding row and well on the Clean Up Plate Figure 4 4 Pooling PCR Products Onto the Clean Up Plate PURIFY THE PCR PRODUCTS IMPORTANT Hi Three water washes must be performed to properly purify the PCR products Be sure to completely dry the membrane after the third wash To purify the PCR products 1 Load the Clontech Clean Up Plate with samples onto the manifold 2 Cover the plate to protect the samples from environmental contaminants For example you can use the lid from a pipette tip box Do not put a plate seal on the wells containing sample IMPORTANT F chapter 4 96 Well Plate Protocol 81 Turn on the vacuum and slowly bring it up to 600 mbar Check the vacuum by gently trying to lift the middle section of the manifold off the base Be very careful not to lose any sample You should not be able to lift the middle section off the base 5 Maintain the vacuum a
99. PREPARATION 248 Preparation of Genomic DNA 248 Reagents 248 STEP 1 REAGENT PREPARATION AND STORAGE 248 STEP 2 RESTRICTION ENZYME DIGESTION 249 Reagents and Equipment 249 Digestion Procedure 251 Pre PCR Clean Area 251 PCR Staging Area 252 STEP 3 LIGATION 253 Reagents and Equipment 253 Ligation Procedure 254 Pre PCR Clean Area 254 PCR Staging Area 255 contents xi STEP 4 PCR 257 Reagents and Equipment 257 PCR Procedure 259 Pre PCR Clean Room 259 PCR Staging Area 260 Main Lab 261 STEP 5 PCR PURIFICATION AND ELUTION WITH CLONTECH CLEAN UP PLATE 263 Reagents and Equipment 263 STEP 6 QUANTIFICATION OF PURIFIED PCR PRODUCT 266 STEP 7 FRAGMENTATION 267 Reagents and Equipment 267 Main Lab 268 Fragmentation Procedure 269 STEP 8 LABELING 274 Reagents 274 Labeling Procedure 275 Main Lab 275 STEP 9 TARGET HYBRIDIZATION 277 Reagents 277 Reagent Preparation 278 Hybridization Procedure 279 APPENDIX D Reagents Instruments and Supplies Required for Low Throughput Protocol 283 INTRODUCTION 286 REAGENTS AND INSTRUMENTS REQUIRED 287 SUPPLIER CONTACT LIST 300 xii GeneChip Mapping 500K Assay Manual Chapter 1 Overview Chapter ji About This Manual This manual is a guide for technical personnel conducting GeneChip Mapping 500K experiments in the laboratory It contains protocols for sample preparation 96 well plate sample processing and low throughput sample processing It also includes i
100. R J Lo B Quarrell O W Di Rocco M Trembath R C Mandel H Wali S Karet F E Knisely A S Houwen R H Kelly D A Maher E R Mutations in VPS33B encoding a regulator of SNARE dependent membrane fusion cause arthrogryposis renal dysfunction cholestasis ARC syndrome Nat Genet 36 400 4 2004 Uhlenberg B Schuelke M Ruschendorf F Ruf N Kaindl A M Henneke M Thiele H Stoltenburg Didinger G Aksu F Topaloglu H Nurnberg P Hubner C Weschke B Gartner J Mutations in the gene encoding gap junction protein alpha 12 connexin 46 6 cause Pelizaeus Merzbacher like disease Am J Hum Genet 75 251 60 2004 31 Janecke A R Thompson D A Utermann G Becker C 32 33 34 Hubner C A Schmid E McHenry C L Nair A R Ruschendorf F Heckenlively J Wissinger B Nurnberg P Gal A Mutations in RDH12 encoding a photoreceptor cell retinol dehydrogenase cause childhood onset severe retinal dystrophy Nat Genet 36 850 4 2004 Hao K Li C Rosenow C Hung Wong W Estimation of genotype error rate using samples with pedigree information an application on the GeneChip Mapping 10K array Genomics 84 623 30 2004 Weber S Mir S Schlingmann K P Nurnberg G Becker C Kara P E Ozkayin N Konrad M Nurnberg P Schaefer F Gene locus ambiguity in posterior urethral valves prune belly syndrome Pediatr Nephrol 20 1036 1042 2005 Mether
101. R MIX PREPARATION Carefully follow each master mix recipe Use pipettes that have been calibrated to 5 When molecular biology grade water is specified be sure to use the AccuGENE water listed in Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol Using in house ddH20 or other water can negatively affect your results The enzymatic reaction in Stage 7 Fragmentation is particularly sensitive to pH and metal ion contamination If you run out of master mix during any of these procedures a volume error has been made or the pipettes are not accurate We recommend that you stop and repeat the experiment REAGENT HANDLING AND STORAGE Follow these guidelines for reagent handling and storage e When working on the bench top keep all reagents except enzymes on ice in a cooling chamber that has been chilled to 4 C Always leave enzymes at 20 C until immediately prior to adding them to master mixes When removed from the freezer immediately place in a cooler that has been chilled to 20 C and placed on ice Store the reagents used for the restriction digestion ligation and PCR steps in the Pre PCR Clean Area Do not re enter the Pre PCR Clean Area after entering the PCR Staging Room or the Main Lab Aliquot each of the reagents in the Pre PCR Clean Area before starting the rest of the experiment e Dedicate one cooler for the Pre PCR Clean Area and one for the Main Lab post PCR
102. ROBLEM Average Sample OD is greater than 0 7 3 5 pg pL If the average sample OD of three independent measurements is greater than 0 7 calculated concentration greater than 3 5 ug uL a problem exists with either the elution of PCR products or the OD reading The limit on PCR yield is approximately 3 5 ug L as observed in practice and as predicted by the mass of dNTPs in the reaction Possible causes include The purified PCR product was eluted in a volume less than 45 uL The purified PCR product was not mixed adequately before making the 1 100 dilution The diluted PCR product was not mixed adequately before taking the OD reading The water blank reading was not subtracted from each sample OD reading The spectrophotometer plate reader may require calibration Pipettes may require calibration There may be air bubbles or dust in the OD plate There may be defects in the plastic of the plate The settings on the spectrophotometer plate reader or the software may be incorrect OD calculations may be incorrect and should be checked Reliance on any single OD reading may give an outlier result You should make three independent dilutions and take three independent OD readings per dilution 92 GeneChip Mapping 500K Assay Manual Table 4 24 PROBLEM Average Sample OD is Less Than 0 5 2 5 pg L If the average sample OD of three independent measurements is less than 0 5 calculated concentration less than 2 5 ug u
103. a workflow to minimize the risk of cross contamination during the assay procedure It is essential to adhere to workflow recommendations PCR reactions should only be carried out in the main laboratory and personnel should not re enter the Pre PCR Clean and PCR staging areas following potential exposure to PCR product without first showering and changing into clean clothes It is essential to carefully read and follow the protocol as written This assay has been validated using the reagents and suppliers listed substitution of reagents and shortcuts are not recommended as they could result in suboptimal results For example always use AccuGENE water from Cambrex and ligase and restriction enzymes from New England Biolabs Additional recommendations are listed below 1 Think ahead to ensure that reagents and equipment you require including designated pipettes are in the correct work location This will make workflow easier and prevent contamination risks 2 Check that your spectrophotometer is accurately calibrated and ensure readings are in dynamic range 0 2 to 0 8 OD This will ensure you use the correct amount of genomic DNA necessary for fragmentation reaction efficiency and identifying good PCR yields Adding the same amount of labeled target to the arrays will help obtain reproducible call rates 3 Pay particular attention to the storage and handling of reagents This is especially important for enzymes such as DNA Ligase
104. agementation Reagent on ice B Combine the reagents ON ICE in the order shown in Table C10 C Vortex at medium speed for 2 seconds Two examples of dilution are listed below for two different concentrations of Fragmentation Reagent IMPORTANT appendix C Low Throughput Protocol 271 Table C 10 Diluting the Fragmentation Reagent Combine Reagents in the Order Shown Reagent 2 units pL 3 units uL H20 Molecular Biology Grade 105 uL 106 uL 10X Fragmentation Buffer 12 uL 12 uL Fragmentation Reagent 3 uL 2 uL Total 120 uL 120 uL Add the Fragmentation Reagent last after allowing the water and buffer to cool on ice If the concentration on your tube is not shown in the table above use the formula provided in Step 3 5 Quickly and ON ICE divide the diluted Fragmentation Reagent into 8 or 12 microtube strips 6 Add 5 pL of diluted Fragmentation Reagent 0 05 U pL with an 8 or 12 channel pipette to the fragmentation plate containing Fragmentation Mix ON ICE Pipet up and down several times to mix Be sure to change tips between samples The total volume for each sample is listed below Table C 11 Reagent Volume Sample Fragmentation Mix 50 uL Diluted Fragmentation Reagent 0 05 U uL 5 uL Total 55 uL For 90 ug of purified PCR product a total of 0 25 U of Fragmentation Reagent is needed in a final reaction volume of 55 pL 7 Cover the fragmentation plate with a plat
105. agents and Digestion Stage Plate 1 Allow the following reagents to thaw on ice e Adaptor Nsp I or Sty I as appropriate T4 DNA Ligase Buffer 10X Takes approximately 20 minutes to thaw IMPORTANT F IMPORTANT r 56 GeneChip Mapping 500K Assay Manual 2 Ifthe Digestion Stage plate was frozen allow to thaw in a cooling chamber on ice Leave the T4 DNA Ligase at 20 C until ready to use Prepare Your Work Area To prepare the work area 1 Place a double cooling chamber and a cooler on ice Figure 4 1 on page 39 2 Label the following tubes then place in the cooling chamber One strip of 12 tubes labeled Lig e A 2 0 mL Eppendorf tube labeled Lig MM e Solution basin 3 Prepare the Digestion Stage plate as follows A Vortex the center of the plate at high speed for 3 sec B Spin down the plate at 2000 rpm for 30 sec C Place back in the cooling chamber on ice 4 To prepare the reagents A Vortex at high speed 3 times 1 sec each time except for the enzyme B Pulse spin for 3 sec C Place in the cooling chamber T4 DNA Ligase Buffer 10X contains ATP and should be thawed on ice Vortex the buffer as long as necessary before use to ensure precipitate is re suspended and that the buffer is clear Avoid multiple freeze thaw cycles per vendor instructions chapter 4 96 Well Plate Protocol 57 Preheat the Thermal Cycler Lid Power on the thermal cycler to preheat the lid
106. alue for perfect match cells for the OC QC Probe Set ID probe sets MCR MPAM algorithm Call Rate This is used to determine DM Mapping only whether a sample is contaminated MDR MPAM algorithm Discrimination Rate This is used to DM Mapping only determine whether a sample is contaminated Common SNP Patterns Calls for a selected set of SNPs displayed as a list of the DM Mapping only analyzed samples with the allele calls for the common SNPs 188 GeneChip Mapping 500K Assay Manual GTYPE ADDITIONAL FUNCTIONALITY Additional functionality within GTYPE includes the ability to import sample attributes create custom file sets export batch SNP or linkage data create virtual data sets assess sample mismatch and update SNP annotations from the NetAffx Analysis Center IMPORT SAMPLE ATTRIBUTES Pedigree information associated with the sample can be imported into the GCOS Process database by using the AttributeImporter Tool Attributes can be imported from multiple samples in batch from files or excel spreadsheets Attributes include information like father mother family and diseased state and must be imported before checking Mendelian Inheritance or importing into MERLIN or GeneHunter Swps 1 Browse to select a sample import file Sample Import File E 2 Select header labels from the file to import Meader Labels Amribute impon Assy the label in the import file to an atr bute na
107. an or Hardy Weinberg errors in user defined samples These genotyping errors can be filtered out upon data export Please consult the GeneChip Genotyping Analysis Software User s Guide for more information 1 Matsuzaki H Dong S Loi H Di X Liu G Hubbell E Law J Berntsen T Chadha M Hui H Yang G Kennedy G Webster T Cawley S Walsh P Jones K Fodor S Mei R Genotyping over 100 000 SNPs on a pair of oli gonucleotide arrays Nat Methods 1 109 111 2004 2 Di X Matsuzaki H Webster T A Hubbell E Liu G Dong S Bartell D Huang J Chiles R Yang G Shen M M Kulp D Kennedy G C Mei R Jones K W Cawley S Dynamic model based algorithms for screening and geno typing over 100K SNPs on oligonucleotide microarrays Bioinformatics 21 1958 63 2005 1 See SNP Selection Criteria for the GeneChip Human Mapping 10K Array Xba 131 Technical Note A similar pro cess was used for the Mapping 500K SNP selection 208 GeneChip Mapping 500K Assay Manual Chapter 8 Trou bleshooting Chapter 8 211 Assay Recommendations Genotyping applications require very high accuracy to achieve maximum power Therefore great care should be taken to avoid possible sources of cross contamination that would lead to genotyping errors As with any assay using PCR the GeneChip Mapping Assay has an inherent risk of contamination with PCR product from previous reactions In Chapter 2 we recommend
108. and GeneChip Fragmentation Reagent DNase I which are sensitive to temperatures exceeding 20 C To prevent loss of enzyme activity when the enzymes are removed from the freezer use a bench top freeze block and return to 20 C directly after use Take care when pipetting enzymes stored in glycerol which is viscous Do not store at 80 C 212 GeneChip Mapping 500K Assay Manual 4 Fragmentation Reagent DNAse I activity can decline over time after dilution on ice and so the reagent should be added to samples as quickly as possible 5 The use of master mixes prepared with an excess 15 for 96 well plate protocol 5 for low throughput protocol ensures consistency in reagent preparation by minimizing pipetting errors and reducing handling time of temperature sensitive reagents The success of this assay depends on the accurate pipetting and subsequent thorough mixing of small volumes of reagents 6 The PCR reaction for this assay has been validated using one of the specified thermal cyclers These thermal cyclers were chosen because of their ramping times We highly recommend the PCR thermal cyclers be calibrated regularly Take care programming your thermal cycler and use the thin walled reaction tubes recommended Thicker walled tubes may result in reduced PCR efficiency and lower yields 7 It is essential to run gels to monitor both the PCR reaction and the fragmentation reaction For the PCR reaction individual PCR
109. and enzymes are stored at 20 C Work quickly with enzymes and return to 20 C directly after use to prevent loss of activity Failed restriction digest Use restriction enzyme to digest a known good DNA sample Run gel to confirm restriction enzyme activity Failed adaptor ligation reaction Confirm enzyme activity Ligase buffer contains ATP and should be defrosted held at 4 C Mix ligase buffer thoroughly before use to ensure precipitate is re suspended Avoid multiple freeze thaw cycles Try a fresh tube of buffer Reduced adaptor ligation efficiency due to adaptor self ligation DNA re ligation To prevent self ligation of adaptor work rapidly and add DNA ligase last Failed PCR reaction Check PCR reagents Take care with preparation of master mixes and ensure accurate pipetting and thorough mixing Reduced PCR reaction yield non optimal PCR conditions Use a validated thermal cycler check PCR programs Use recommended thin walled reaction tubes Thoroughly mix PCR reaction Ligation mix not diluted prior to PCR reaction Ligation mixture diluted 1 4 with molecular biology grade water to remove potential inhibitors and maintain optimal pH and salt concentration Incorrect concentration of nucleotides Check dNTP stock concentration and vendor Used Nsp adaptor for Sty digest or vice versa Repeat Ligation step with correct adaptors chapter 8
110. and thermal cyclers listed in Table 4 1 on page 40 108 GeneChip Mapping 500K Assay Manual Table 4 31 Equipment and Consumables Required for Stage 8 Labeling Quantity Item 1 Cooler chilled to 20 C 1 Cooling chamber double chilled to 4 C do not freeze 1 Ice bucket filled with ice 1 Marker fine point permanent 1 Microcentrifuge 1 Pipette single channel P200 1 Pipette single channel P1000 1 Pipette 12 channel P20 accurate to within 5 As needed Pipette tips for pipettes listed above full racks 1 Plate centrifuge 1 Plate seal 1 Thermal cycler 1 Tube centrifuge 15 mL 1 Tubes strip of 12 1 Vortexer chapter 4 96 Well Plate Protocol 109 REAGENTS REQUIRED The following reagents are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information The amounts listed are sufficient to process one full 96 well reaction plate Table 4 32 Reagents Required for Stage 8 Labeling Quantity Reagent 1 vial GeneChip DNA Labeling Reagent 30 mM 1 vial Terminal Deoxynucleotidyl Transferase TdT 30 U uL 2 vials Terminal Deoxynucleotidyl Transferase Buffer TdT Buffer 5X IMPORTANT INFORMATION ABOUT THIS STAGE To help ensure the best results carefully read the information below before you begin this stage of the protocol
111. anifolds for use with the Clontech Clean Up Plates The Clontech protocol requires 600 mb vacuum If your lab does not have an internally regulated vacuum source this vacuum regulator is strongly sug gested 300 GeneChip Mapping 500K Assay Manual Supplier Contact List Table D 7 Ambion www ambion com Applied Biosystems home appliedbiosystems com Bionexus Inc www bionexus net Bio Rad www bio rad com Boekel Scientific www boekelsci com Cambrex www cambrex com Clontech www clontech com clontech Fisher Scientific www fisherscientific com Invitrogen Life Technologies www invitrogen com Molecular Probes www probes com New England Biolabss www neb com Operon Technologies www operon com PerkinElmer Life Sciences lifesciences perkinelmer com Pierce Chemical www piercenet com Promega www promega com QIAGEN www qiagen com Sigma Aldrich www sigma aldrich com TaKaRa Bio Inc www takara bio co jp english index htm TEKnova www teknova com Vector Laboratories www vectorlabs com
112. are may be incorrect e OD calculations may be incorrect and should be checked Reliance on any single OD reading may give an outlier result You should make three independent dilutions and take three independent OD readings per dilution Table 8 3 PROBLEM OD260 0D280 ratio is not between 1 8 and 2 0 Possible causes include e The PCR product may be not be sufficiently purified Be sure to perform three water washes and check to be sure the vacuum manifold is working properly e An error may have been made while taking the OD readings Table 8 4 PROBLEM The OD320 measurement is significantly larger than zero 0 0 005 Possible causes include e Precipitate may be present in the eluted samples Be sure to add diluted EDTA to PCR products before purification e There may be defects in the OD plate e Air bubbles in the OD plate or in solutions chapter 8 Troubleshooting 221 When to Contact Technical Support IMPORTANT p Under any of the following conditions unplug the instrument from the power source and contact Affymetrix Technical Support when the power cord is damaged or frayed if any liquid has penetrated the instrument if after service or calibration the instrument does not perform to the specifications stated in Instrument Specifications on page 178 If the instrument must be returned for repair call Affymetrix Technical Support Make sure you have the mod
113. ate containing 50 5 pL of fragmented DNA samples as follows Table C 13 Fragmented DNA 50 5 uL Remaining fragmented DNA from Fragmentation step is used for gel analysis Labeling Mix 19 5 uL Total 70 uL IMPORTANT Hi 276 GeneChip Mapping 500K Assay Manual To expedite the aliquoting the Labeling Master Mix can be first divided into 8 or 12 microtube strips and then dispensed into the wells of the plate with an 8 or 12 channel pipette Pipet up and down several times to mix Be sure to change tips between samples Seal the plate tightly with a plate cover Vortex the plate at medium speed for 2 seconds and spin the plate at 2 000 rpm for 1 minute 5 Run the 500K Label program 500K Label Program Temperature Time 37 C 4 hours 95 C 15 minutes 4 C Hold Make sure the plates reaction tubes are securely sealed prior to running this program in order to minimize solution loss due to evaporation at denaturation step 95 C 6 Spin the plate at 2 000 rpm for 1 minute after the labeling reaction Samples can be stored at 20 C if not proceeding to next step appendix C Low Throughput Protocol 277 STEP 9 Target Hybridization REAGENTS IMPORTANT e 5 M TMACL Tetramethyl Ammonium Chloride Sigma P N T3411 10 Tween 20 Pierce P N 28320 Surfact Amps diluted to 3 in molecular biology grade water MES hydrate SigmaUltra Sigma P N M5287
114. ation ovens Because the lids on these thermal cyclers do not slide back you will process 24 samples at a time Add Hybridization Master Mix and Denature To add Hybridization Master Mix and denature the samples 1 Pour 20 9 mL Hybridization Master Mix into a solution basin 2 Using a 12 channel P200 pipette add 190 pL of Hybridization Master Mix to each sample on the Label Plate Total volume in each well is 260 pL IMPORTANT Seal the plate tightly with adhesive film Vortex the center of the plate for 3 minutes Cut the plate into 4 strips of two rows each Put each strip of 24 samples into a plate holder 2 strips per holder No 9I FP Ww Spin down the strips at 2000 rpm for 30 sec 128 GeneChip Mapping 500K Assay Manual 8 Cut the adhesive film between each row of samples Do not remove the film 9 Place one set of 24 wells onto the thermal cycler and close the lid 10 Keep the remaining sets of wells in a cooling chamber on ice 11 Run the 500K Hyb program 500K Hyb Program Temperature 95 C 10 minutes 49 C Hold Load the Samples onto Arrays This procedure requires 2 operators working simultaneously Operator 1 loads the samples onto the arrays Operator 2 covers the septa with Tough Spots and loads the arrays into the hybridization ovens To load the samples onto arrays Operator 1 Tasks 1 When the plate reaches 49 C open the lid on the thermal cycler 2 Remove the film
115. ator should not perform Nsp 1 and Sty 1 digestion reactions on the same day About Using Controls Positive Controls Reference Genomic DNA 103 can be used as a positive control It is supplied in both the Sty and Nsp GeneChip Mapping 250K Assay Kits e Nsp 100 Rxn Kit P N 900753 Sty 100 Rxn Kit P N 900754 chapter 4 96 Well Plate Protocol 49 Negative Controls A process negative control can be included at the beginning of the assay to assess the presence of contamination Refer to Chapter 2 and Chapter 7 for more information PREPARE THE REAGENTS EQUIPMENT AND CONSUMABLES IMPORTANT Hi Thaw Reagents and Genomic DNA Plate 1 Allow the following reagents to thaw on ice NE Buffer e BSA If the plate of genomic DNA from stage 1 was frozen allow it to thaw in a cooling chamber on ice Leave the NSP I or STY I enzyme at 20 C until ready to use Prepare Your Work Area To prepare the work area 1 Place a double cooling chamber and a cooler on ice Figure 4 1 on page 39 Label the following tubes then place in the cooling chamber One strip of 12 tubes labeled Dig e A 2 0 mL Eppendorf tube labeled Dig MM Place the AccuGENE water on ice Prepare the plate of genomic DNA from Stage 1 as follows A Vortex the center of the plate at high speed for 3 sec B Spin down the plate at 2000 rpm for 30 sec C Place back in the cooling chamber on ice To prepare the reagents except for the
116. based only on the extent to which PM probes are brighter than MM probes Therefore a reduction in Call Rate MCR lt 0 94 accompanied by no decrease in MDR MDR gt 0 99 is a characteristic indicator of sample contamination Figure 7 7 and Figure 7 8 Note that this contamination metric does not apply if the MDR is lt 99 chapter 7 Analysis Workflow 199 Call Rate or Concordance 100 00 95 00 90 00 85 00 4 80 00 4 Nsp MDR Nsp MCR Nsp Concordanc 75 00 4 70 00 65 00 60 00 T T T 0 0 0 1 02 0 3 0 4 0 5 Contamination Fraction Figure 7 7 The effect of genomic DNA contamination on MPAM Detection Rate MDR Concordance Rate and MPAM Call Rate MCR Nsp Call Rate or Concordance 100 00 95 00 90 00 85 00 80 00 75 00 StyMDR Sty MCR 70 00 Sty Concordance 65 00 60 00 T 7 0 0 0 1 0 2 0 3 0 4 0 5 Contamination Fraction Figure 7 8 The effect of genomic DNA contamination on MPAM Detection Rate MDR Concordance Rate and MPAM Call Rate MCR Sty If you suspect a sample has DNA contamination you may want to consider testing it with microsatellite markers 200 GeneChip Mapping 500K Assay Manual OLIGONUCLEOTIDE CONTROLS The oligonucleotide control reagent Box GeneChip Mapping 250K Assay Kit Box 3 contains oligonucleotide B2 and 4 hybridization contr
117. cal fluidics_scripts affx THE BLEACH CYCLE To avoid carryover or cross contamination from the bleach protocol Affymetrix recommends the use of dedicated bottles for bleach and DI water Additional bottles can be obtained from Affymetrix Table 6 1 Affymetrix Recommended Bottles Part Number Description 400118 Media Bottle SQ 500 mL 400119 Media Bottle SQ 1000 mL 1 Disengage the washblock for each module by pressing down on the cartridge lever Remove any probe array cartridge Figure 6 1 chapter 6 Fluidics Station Care and Maintenance 157 Remove cartridges if any Washblocks disengaged with cartridge lever down Figure 6 1 Disengaged washblocks showing cartridge levers in the down position Remove any cartridges 2 Prepare 500 mL of 0 525 sodium hypochlorite solution using deionized water For example follow these directions to make 500 mL of bleach In a 1 liter plastic or glass graduated cylinder combine 43 75 mL of commercial bleach such as Clorox bleach which is 6 sodium hypochlorite with 456 25 mL of DI H O mix well Pour the solution into a 500 mL plastic bottle and place 158 GeneChip Mapping 500K Assay Manual the plastic bottle on fluidics station IMPORTANT Hi The shelf life of this solution is 24 hours After this period you must prepare a fresh solution NOTE Each fluidics station with four modules requires 500 mL of the 0 525 sodi
118. ceeding to the next step If necessary bring the volume of each well to 45 uL by adding RB Buffer do not add water STEP 7 Fragmentation REAGENTS AND EQUIPMENT Fragmentation Reagent DNase I Affymetrix P N 900131 10X Fragmentation Buffer Affymetrix P N 900422 for 30 Rxns and P N 900695 for 100 Rxns e Molecular Biology Grade Water Bio Whittaker Molecular Applications Cambrex P N 51200 4 TBE Gel BMA Reliant precast 4 NuSieve 3 1 Plus Agarose Cambrex P N 54929 All Purpose Hi Lo DNA Marker Bionexus Inc 50 10000bp P N BN2050 Gel Loading Solution Sigma P N G2526 e 96 well plate Bio Rad P N MLP 9601 e 96 well PLT Clear Adhesive Films Applied Biosystems P N 4306311 Thermal cycler DNA Engine Tetrad MJ Research or GeneAmp PCR System 9700 with gold plated block 1 In 2004 MJ GeneWorks Inc and its subsidiary MJ Research Inc were purchased by Bio Rad Laboratories Inc This model is no longer available Bio Rad has indicated that the DNA Engine Tetrad 2 gives similar performance with the same progams Affymetrix has not tested the newer version MAIN LAB IMPORTANT i IMPORTANT FI 268 GeneChip Mapping 500K Assay Manual Fragmentation of PCR product before hybridization onto GeneChip probe arrays has been shown to be critical in obtaining optimal assay performance Due to the sensitive nature of the Fragmentation Reagent DNase I these general rules need to
119. clers listed in Table 4 1 Using other PCR plates and film that are incompatible with these thermal cyclers can result in crushed tubes loss of sample or poor results Table 4 1 Thermal Cyclers PCR Plate and Adhesive Film Optimized for Use With the 500K 96 well Plate Protocol Area Thermal Cyclers MAT El Ct a IA BENA Plate Film 2720 Thermal Cycler or GeneAmp PCR Pre PCR System 9700 by Applied Biosystems MJ Tetrad PTC 225 by Bio Rad Multiplate 96 Well Unskirted PCR Plates Bio Rad P N MLP 9601 MicroAmp Clear Adhesive Films Applied Biosystems P N 4306311 GeneAmp PCR System 9700 by Applied Biosystems PCR and Post PCR silver block or gold plated silver block MJ Tetrad PTC 225 by Bio Rad Multiplate 96 Well Unskirted PCR Plates Bio Rad P N MLP 9601 MicroAmp Clear Adhesive Films Applied Biosystems P N 4306311 chapter 4 96 Well Plate Protocol 41 PROGRAM YOUR THERMAL CYCLERS The Mapping 500K 96 well plate protocol includes the thermal cycler programs listed below Before you begin processing samples enter and store these programs on the thermal cyclers that will be used for this protocol Thermal cycler program details are listed in Appendix B Thermal Cycler Programs Table 4 2 Thermal Cycler Programs Required for the 96 well Plate Protocol Program Name of Thermal Cyclers Laboratory Required based on 96 sample throug
120. containing NE Buffer 2 New England Biolab NEB P N B7002S to order separately BSA Bovine Serum Albumin New England Biolab NEB P N B9001S to order separately e H O Molecular Biology Grade Water BioWhittaker Molecular Applications Cambrex P N 51200 96 well plate Bio Rad P N MLP 9601 or Applied Biosystems P N 403083 e 96 well Clear Adhesive Films Applied Biosystems P N 4306311 Thermal cycler any Pre PCR Clean Room thermocycler e 8 Tube Strips thin wall 0 2 mL Bio Rad P N TBS 0201 Strip of 8 caps Bio Rad P N TCS 0801 1 This product was formerly an MJ Research product and is currently available from Bio Rad IMPORTANT Hi wanN NG jj NOTE CAUTION NOTE 250 GeneChip Mapping 500K Assay Manual Program the thermal cycler in advance Switch on the thermal cycler 10 minutes before reactions are ready so that the lid is heated See Appendix B for a list of thermal cycler programs PCR tubes must be compatible and qualified with either MJ Research DNA Engine Tetrad or ABI GeneAmp 9700 For example individual tubes Bio Rad P N TWI 0201 Using incompatible tubes with either the DNA Engine Tetrad or the GeneAmp 9700 could cause tubes to crush and lead to loss of sample Reference Genomic DNA 103 is supplied in both the Sty and Nsp GeneChip Mapping 250K Assay Kits Nsp 30 Rxn Kit P N 900766 Nsp 100 Rxn Kit P N 900753 Sty 30 Rxn Kit P N 900765 and Sty 100 R
121. d Consumables Required for Stage 2 Restriction Enzyme Digestion Quantity Item 1 Cooler chilled to 20 C 1 Cooling chamber double chilled to 4 C do not freeze 1 Ice bucket filled with ice 1 Marker fine point permanent 1 Microcentrifuge 1 Pipette single channel P100 1 Pipette single channel P200 1 Pipette single channel P1000 1 Pipette 12 channel P20 As needed Pipette tips for pipettes listed above full racks 1 Plate centrifuge 1 Plate seal 1 Thermal cycler 1 strip Tubes strip 12 per strip 1 Tube Eppendorf 2 0 mL 1 Vortexer 48 GeneChip Mapping 500K Assay Manual REAGENTS REQUIRED The following reagents are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information The amounts listed are sufficient to process one full 96 well reaction plate Table 4 6 Reagents Required for Stage 2 Restriction Enzyme Digestion Quantity Reagent 1 vial BSA 100X 10 mg mL 1 vial NE Buffer 2 or 3 10X e If Nsp use NE Buffer 2 e If Sty use NE Buffer 3 1 vial Sty or Nsp 10 U L NEB 2 0 mL AccuGENE Water molecular biology grade IMPORTANT INFORMATION ABOUT THIS STAGE To help ensure the best results carefully read the information below before you begin this stage of the protocol IMPORTANT EN The same team or individual oper
122. d Fragmentation Reagent to each tube of the 12 tube strip labeled FR 2 Using a 12 channel P20 pipette add 5 pL of diluted Fragmentation Reagent to each sample Do not pipette up and down Reagent Volume Sample Sample with Fragmentation Buffer 50 uL Diluted Fragmentation Reagent 0 05 U uL 5 uL Total 55 uL 3 Seal the plate and inspect the edges to ensure that it is tightly sealed chapter 4 96 Well Plate Protocol 105 IMPORTANT Hi To minimize solution loss due to evaporation make sure that the plate is tightly sealed prior to loading onto the thermal cycler The MJ thermal cyclers are more prone to evaporation 4 Vortex the center of the plate at high speed for 3 sec Place the plate in a chilled plastic plate holder and spin it down at 4 C at 2000 rpm for 30 sec 6 Immediately load the plate onto the pre heated block of the thermal cycler 37 C and run the 500K Fragment program 500K Fragment Program Temperature Time 37 C 35 minutes 95 C 15 minutes 4 C Hold 7 Discard any remaining diluted Fragmentation Reagent Diluted Fragmentation Reagent should never be reused WHAT YOU CAN DO NEXT Proceed directly to the next stage Concurrently check the fragmentation reaction by running gels as described below 106 GeneChip Mapping 500K Assay Manual CHECK THE FRAGMENTATION REACTION To ensure that fragmentation was successful 1 When the 500K Fragment p
123. d the formation of air bubbles Air bubbles will slow drying Working one row at a time pool the PCR products as follows 1 2 Cut the adhesive film from the first row of each reaction plate Using a 12 channel P200 pipette transfer and pool the samples from the same row and well of each PCR product plate to the corresponding row and well of the Clean Up Plate Example Figure 4 4 on page 80 transfer each sample from row A of plates P1 P2 and P3 to the corresponding wells of row A on the Clean Up Plate To avoid piercing the membrane do not pipette up and down in the Clean Up Plate Change your pipette tips Be sure to change pipette tips after each of the three corresponding rows of sample are pooled onto the Clean Up Plate Repeat these steps until all of the PCR products are pooled Examine the three PCR product plates to be sure that the full volume of each well was transferred and that the plates are empty The final volume in each well on the Clontech Clean Up Plate should be approximately 320 pL 80 GeneChip Mapping 500K Assay Manual P1 P2 and P3 PCR Product Plates 9660606089360360 p 9 0 e0O0D0D0 0 6 06 5OOOOoeSoOE eseeee s 6 e ee dj 928230000900 DOQOQDOOOOQE DOSOOOOOO OE P ee e e
124. dde R Rohde K Becker C Toliat M R Entz P Suk A Muller N Sindern E Haupts M Schimrigk S Nurnberg P Epplen J T Association of the HLA region with multiple sclerosis as confirmed by a genome screen using gt 10 000 SNPs on DNA chips J Mol Med 83 486 94 2005 Matsuzaki H Dong S Loi H Di X Liu G Hubbell E Law J Berntsen T Chadha M Hui H Yang G Kennedy G Webster T Cawley S Walsh P Jones K Fodor S Mei R Genotyping over 100 000 SNPs on a pair of oligonucleotide arrays Nat Methods 1 109 111 2004 Uimari P Kontkanen O Visscher P M Pirskanen M Fuentes R Salonen J T Genome wide linkage disequilibrium from 100 000 SNPs in the East Finland founder population Twin Res Hum Genet 8 185 97 2005 14 GeneChip Mapping 500K Assay Manual 42 43 44 45 46 47 48 49 Klein R J Zeiss C Chew E Y Tsai J Y Sackler R S Haynes C Henning A K Sangiovanni J P Mane S M Mayne S T Bracken M B Ferris F L Ott J Barnstable C Hoh J Complement factor H polymorphism in age related macular degeneration Science 308 385 9 2005 Serono Identifies 80 Genes Involved in Multiple Sclerosis Using 100 000 SNPs In Affymetrix Microarray Bulletin 2005 Issue 1 1 4 www microarraybulletin com Huang J Wei W Zhang J Liu G Bignell G R Stratton M R Futreal P A Wooster R Jones
125. described in this chapter the scanned probe array image dat file is ready for analysis 136 GeneChip Mapping 500K Assay Manual Reagents and Materials Required The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists Information and part numbers listed are based on U S catalog information Water Molecular Biology Grade BioWhittaker Molecular Applications Cambrex P N 51200 e Distilled water Invitrogen Life Technologies P N 15230147 e 20X SSPE 3 M NaCl 0 2 M NaH PO 0 02 M EDTA BioWhittaker Molecular Applications Cambrex P N 51214 Anti streptavidin antibody goat biotinylated Vector Laboratories P N BA 0500 reconstitute according to product instructions R Phycoerythrin Streptavidin Molecular Probes P N S 866 10 Surfact Amps 20 Tween 20 Pierce Chemical P N 28320 Bleach 5 25 Sodium Hypochlorite VWR Scientific P N 21899 504 or equivalent Denhardt s Solution 50X concentrate Sigma P N D2532 MES hydrate Sigma Aldrich P N M5287 MES Sodium Salt Sigma Aldrich P N M5057 e 5 M NaCl RNase free DNase free Ambion P N 9760G Miscellaneous Supplies e Sterile RNase free microcentrifuge vials 1 5 mL USA Scientific P N 1415 2600 or equivalent Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent e Sterile barrier pipette tips and non barrier pipette tips Tygon Tubing 0 04
126. e chapter 5 Washing Staining and Scanning Arrays 147 Fluidics Station dialog box at the workstation terminal and the LCD window displays the status of the washing and staining steps 7 When staining is finished remove the microcentrifuge vials containing stain and replace with three empty microcentrifuge vials as prompted 8 Remove the probe arrays from the fluidics station modules by first pressing down the cartridge lever to the eject position 9 Check the probe array window for large bubbles or air pockets If bubbles are present the probe array should be filled with Array Holding Buffer manually using a pipette Take out one half of the solution and then manually fill the probe array with Array Holding Buffer Ifthe probe array has no large bubbles it is ready to scan on the GeneChip Scanner 3000 7G Pull up on the cartridge lever to engage wash block and proceed to Probe Array Scan on page 148 IMPORTANT Hi If a bubble is present do not return the probe array to the probe array holder The probe array must be filled manually with Array Holding Buffer If the arrays cannot be scanned promptly keep the probe arrays at 4 C and in the dark until ready for scanning Scan must be preformed within 24 hours If no more samples require washing and staining shut down the fluidics station following the procedure outlined in the section Shutting Down the Fluidics Station on page 152 148 GeneChip Mappi
127. e 70 pL of labeled DNA samples as follows Table C 15 Labeled DNA 70 uL Hybridization Mix 190 uL Total 260 uL 4 Heat the 260 pL of hybridization mix and labeled DNA at 99 C in a heat block for exactly 10 minutes to denature Denaturation of the labeled DNA sample is important to maximize binding to the oligonucleotides on the array surface The sample must be heated to at least 95 C for 10 minutes prior to adding the DNA to the array If a precipitate forms during this step resuspend it before hybridization Hybridize the arrays for at least 16 hours at 49 C This temperature has been optimized for this product and should be stringently followed 5 Cool on crushed ice for 10 seconds To avoid the formation of aggregates do not leave on ice for longer than 10 seconds 6 Spin briefly at 2 000 rpm in a microfuge to collect any condensate 7 Place the tubes at 49 C for 1 minute appendix C Low Throughput Protocol 281 8 Inject 200 pL denatured hybridization cocktail into the array NOTE If there is anything that has come out of the solution pipette briefly to resuspend before adding solution to the array IMPORTANT Hi When processing multiple samples leave samples at 49 C until ready to load onto the array After injecting sample into an array immediately place the array in the hybridization oven 9 Hybridize at 49 C for 16 to 18 hours at 60 rpm NOTE The remaining
128. e annotations can be found in the NetAffx Annotations chapter in the GeneChip Genotyping Analysis Software User s Guide 194 GeneChip Mapping 500K Assay Manual Assessing Data Quality The purpose of this section is to help researchers establish guidelines for evaluating results generated from Mapping experiments The Mapping Algorithm Report in GTYPE has a number of parameters that must be checked for each array in order to assess the quality of the data and to identify outlier samples Table 7 2 It is important to check these parameters and to create a running log for each project The Reference Genomic DNA 103 included in the GeneChip Mapping 250K Assay Kits can serve as a positive control to ensure that all steps of the assay are being performed correctly Table 7 2 Dynamic Model Mapping Algorithm Report Metrics Metric Description Call Rate SNP Call Good first pass evaluation If the genomic DNA sample is of equivalent quality and purity to the Reference Genomic DNA 103 then the Call Rate should be similar when analyzed at the same algorithm settings Reference Genomic DNA Process control to show that assay steps are 103 Call rate being performed correctly MDR MCR Difference can be used to identify sample contamination Shared SNPs Evaluate possible sample mix ups Oligonucleotide controls Help evaluate hybridization fluidics and scanning steps Evaluation of a particular
129. e cover and seal tightly IMPORTANT Hi 272 GeneChip Mapping 500K Assay Manual 8 Vortex the fragmentation plate at medium speed for 2 seconds and spin briefly at 2 000 rpm at 4 C 9 Place the fragmentation plate in pre heated thermal cycler 37 C as quickly as possible Make sure the reaction tubes plates are securely sealed prior to running this program in order to minimize solution loss due to evaporation at the DNase inactivation step 95 C Seal the tubes plates to make sure all reaction tubes fit snugly into the wells of the heating block Do not use a low quality substitute of the 96 well plate or PCR tubes that do not fit with the thermal cycler 10 Run the 500K Fragment program 500K Fragment Program Temperature Time 37 C 35 minutes 95 C 15 minutes 4 C Hold 11 Spin the plate briefly after fragmentation reaction 12 Dilute 4 pL of fragmented PCR product with 4 pL gel loading dye and run on 4 TBE gel at 120V for 30 minutes to 1 hour See Figure C 3 13 Proceed immediately to Labeling step if your gel matches the example below appendix C Low Throughput Protocol 273 Figure C 3 Typical example of fragmented PCR products run on 4 TBE agarose gel at 120V for 30 minutes to 1 hour with average size lt 180 bp 274 GeneChip Mapping 500K Assay Manual STEP 8 Labeling REAGENTS GeneChip DNA Labeling Reagent 30 mM Affymetrix P N 90
130. e following reagents from the Clontech TITANIUM DNA Amplification Kit e 1 28 mL dNTPs 2 5 mM each e 1mL GC Melt 5M e 100 uL TITANIUM Taq DNA Polymerase 50X e 600 UL TITANIUM Taq PCR Buffer 10X 64 GeneChip Mapping 500K Assay Manual GELS AND RELATED MATERIALS REQUIRED The following gels and related materials are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information The amounts listed are sufficient to process one full 96 well reaction plate Table 4 15 Gels and Related Materials Required for Stage 4 PCR Quantity Reagent 50 uL DNA Marker 13 Gels 2 TBE As needed Gel loading solution 3 Plates 96 well reaction IMPORTANT INFORMATION ABOUT THIS STAGE To help ensure the best results carefully read the information below before you begin this stage of the protocol IMPORTANT Hi Make sure the ligated DNA was diluted to 100 pL with AccuGENE water Prepare PCR Master Mix immediately prior to use and prepare in Pre PCR Clean room To help ensure the correct distribution of fragments be sure to add the correct amount of primer to the master mix Mix the master mix well to ensure the even distribution of primers e Set up the PCRs in PCR Staging Area To ensure consistent results take 3 pL aliquots from each PCR to run on gels before adding EDTA chapter
131. e incorrect e OD calculations may be incorrect and should be checked Reliance on any single OD reading may give an outlier result You should make three independent dilutions and take three independent OD readings per dilution Table 4 25 PROBLEM OD260 0D280 ratio is not between 1 8 and 2 0 Possible causes include e The PCR product may be not be sufficiently purified Be sure to perform three water washes and check to be sure the vacuum manifold is working properly e An error may have been made while taking the OD readings 94 GeneChip Mapping 500K Assay Manual Table 4 26 PROBLEM The OD320 measurement is significantly larger than zero 0 0 005 Possible causes include e Precipitate may be present in the eluted samples Be sure to add diluted EDTA to PCR products before purification e There may be defects in the OD plate e Air bubbles in the OD plate or in solutions NORMALIZE THE SAMPLES To normalize the samples 1 Calculate the volume of RB Buffer required to normalize each sample Formula X uL RB Buffer 45 uL Y uL purified PCR product Where Y The volume of purified PCR product that contains 90 ug The value of Y is calculated as Y uL purified PCR product 90 ug Z ug L Z the concentration of purified PCR product in ug L 2 Using a single channel P20 pipette add the calculated volume of RB Buffer to each well of a new 96 well reaction plate the value
132. e overall experimental goals Please refer to Chapter 8 for detailed troubleshooting tips 196 GeneChip Mapping 500K Assay Manual ail Fie Edt View Run Tools Window Help u sjea 2 SE E3 Open Save Prit Tree Shorts Status Anelyze Image Help six Ba a Data Source GCOS Server copy Find Experiments Bu cell Intensities Mapping Array Report a EW Red Report File Name lSGC0803 GCLimslData NA12234_FinSty_vR1_579712_AM12_4_SC5 RPT Date 09 1 5 05 13 25 04 Total number of SNPs 238304 Total number of QC Probes 4 Probe array type Mapping250K_Sty SNP Performance CEL Data Called Gender SNP Call AA Call AB Call BB Call NA12234_FinSty_vR1_579712_A12_4_SC5 F 98 67 37 58 26 51 35 91 Peau NA18969_FinSty_vR1_579712_C12_4_8C5 F 97 20 38 76 24 30 36 95 NA18805_FinSty_vR1_5798710_D5_7_8C5 M 98 52 38 81 24 21 36 97 NA18503_FinSty_vR1_579710_84_7_SC7 M 96 61 36 95 26 99 36 05 s NA18959_FinSty_vR1_579712_C11_4_8C4 M 96 87 39 14 23 60 37 27 NA10855_FinSty_vR1_579710_A4_7_SC1 F 98 57 37 37 26 95 35 68 NA11831_FinSty_vR1_579710_A5_7_SC3 M 98 61 37 67 26 36 35 97 Pedigree Check AIT CELData AFFX 5Q 123 AFFX 5Q 456 AFFX 50 789 AFFX 5Q ABC MCR MDR NA12234_FinSty_vR1_679712_A12_4_8C5 1332 5 647 0 2402 5 2729 0 98 88 99 90 So NA18969_FinSty_vR1_579712_C12_4_SC5 1370 0 934 5 2650 0 2901 5 97 96 99 67 NA18605_FinSty_vR1_579710_D5_7_SC5 1674 5 859 0 2934 0 3156
133. ective modules in the Protocol drop down list 3 Change the intake buffer reservoir A to Non Stringent Wash Buffer and intake buffer reservoir B to Stringent Wash Buffer Click Run for each module to begin priming Follow LCD instructions All modules can be selected by selecting the All Modules button in the fluidics dialog box 142 GeneChip Mapping 500K Assay Manual Probe Array Wash and Stain The Affymetrix staining protocol for mapping arrays is a three stage process consisting of a Streptavidin Phycoerythin SAPE stain followed by an antibody amplification step and final stain with Streptavidin Phycoerythin SAPE Following staining the array is filled with Array Holding Buffer prior to scanning as outlined in Table 3 3 1 After 16 to 18 hours of hybridization remove the hybridization cocktail from the probe array and set it aside in a microcentrifuge vial Store on ice during the procedure or at 80 C for long term storage 2 Fill the probe array completely with 270 pL of Array Holding Buffer If necessary the probe array can be stored in the Array Holding Buffer at 4 C for up to 3 hours before proceeding with washing and staining Equilibrate the probe array to room temperature before washing and staining chapter 5 Washing Staining and Scanning Arrays 143 Preparing the Staining Reagents Prepare the following reagents Volumes given are sufficient for one probe array Mix
134. ed Further information on the use of chp files may be found below Right click on the generated chp file in the Data Source window Click Report to display the rpt file summarizing data from that sample This rpt file is saved in the GCOS data directory For customers interested in generating data using the new BRLMM algorithm for 500K data please refer to www Affymetrix com for detailed information and documentation on the BRLMM algorithm Following analysis chp files are generated for each sample The chp files can be opened by double clicking on the files in the GTYPE data file tree Multiple chp files can be opened simultaneously Once opened the chp files will display a Dynamic Model DM scatter plot in the upper portion of the window and a data table in the lower portion of the window as shown in Figure 7 3 In the data table a genotype call for each SNP along with a confidence score is displayed chapter 7 Analysis Workflow 185 Fle Cdk vew Expert Run Tool Window Hep _N Ea_572009 N102 08 5C3 CHP als NAIISZ N Ea_572009 N102 D9 5C3 CHP a NATE523_NtE4_573003_NIG 2E1_SC2CHP w of K4 SNP_AZ217198 19 SNP A222 18 e SNP_A 2206750 X 70095720 SNP AZEMI 4 nans ge SNP AIII 10 193439644 118983249 g SNP_ATEIBEES 18 944 9485 go SNP A194027 16 erzan oka SNP AIMS 5 ema 9 1905 12 29 50 Batch analysis started 19 05 12 29 57 Batch analy k startad for the Mandal Aip aray group
135. ed within 1 hour e Store the remaining samples and any samples not yet hybridized in a tightly sealed plate at 20 C Allow the arrays to rotate at 49 C 60 rpm for 16 to 18 hours 130 GeneChip Mapping 500K Assay Manual HYBRIDIZING SAMPLES USING HEAT BLOCKS About this Procedure The following instructions require 2 operators working simultaneously each processing two samples at a time Batches of sixteen samples at a time are denatured and loaded onto arrays Two heat blocks are required one set to 99 C the other set to 49 C Load Samples Onto a Heat Block 1 If the heat blocks are not turned on preheat them now set one to 99 C the other to 49 C 2 Add 190 pL of Hybridization Master Mix to each 1 5 mL Eppendorf Safe Lock tube 3 Transfer the labeled sample from the reaction plate to an Eppendorf tube containing Hybridization Master Mix one sample per tube The total volume is now 260 pL Reagent Volume Sample Hybridization Master Mix 190 uL Labeled DNA 70 uL Total 260 uL 4 Vortex at high speed 3 times 1 sec each time Pulse spin for 3 sec 6 Do one of the following e If denaturing and loading samples onto arrays now place the tubes on ice If not proceeding to denature and hybridization at this time store the samples at 20 C the mix will not freeze 7 Place the tubes in batches of 16 at a time onto a heat block as follows IMPORTANT chapter 4 9
136. ee fresh 96 well reaction plates P1Ge P2Gel and P3Gel Aliquot 3 pL of 2X Gel Loading Dye to each well of the three plates Using a 12 channel P20 pipette transfer 3 pL of each PCR product from plates P1 P2 and P3 to the corresponding plate row and wells of plates P1Ge P2Gel and P3Gel Example 3 pL of each PCR product from each well of row A on plate P1 is transferred to the corresponding wells of row A on plate P1Gel Seal plates P1Ge P2Gel and P3Gel Vortex the center of plates P1Ge P2Gel and P3Ge then spin down at 2000 rpm for 30 sec Load all 6 pL from each well of plates P1 Ge P2Gel and P3Gel onto 2 TBE gels Run the gels at 120V for 40 minutes to 1 hour Verify that the PCR product distribution is between 250 bp to 1100 bp see Figure 4 3 90 pg of PCR product is needed for fragmentation chapter 4 96 Well Plate Protocol 73 Figure 4 3 Example of PCR products run on 2 TBE agarose gel at 120V for 1 hour Average product distribution is between 250 to 1100 bp WHAT YOU CAN DO NEXT Do one of the following e Proceed to the next stage within 60 minutes e If not proceeding directly to the next stage seal the plates with PCR product and store at 20 C 74 GeneChip Mapping 500K Assay Manual Stage 5 PCR Product Purification and Elution ABOUT THIS STAGE During this stage you will Add diluted EDTA to each PCR product e Pool each corresponding PCR product bac
137. efore you should correlate readings from other methods to the equivalent UV absorbance reading To prepare the genomic DNA plate 1 Thoroughly mix the genomic DNA by vortexing at high speed for 3 sec 2 Determine the concentration of each genomic DNA sample Based on OD measurements dilute each sample to 50 ng pL using reduced EDTA TE buffer Apply the convention that 1 absorbance unit at 260 nm equals 50 pg mL for double stranded DNA This convention assumes a path length of 1 cm Consult your spectrophotometer handbook for more information If using a quantitation method other than UV absorbance correlate the reading to the equivalent UV absorbance reading 4 Thoroughly mix the diluted DNA by vortexing at high speed for 3 sec An elevated EDTA level may interfere with subsequent reactions chapter 4 96 Well Plate Protocol 45 ALIQUOTING PREPARED GENOMIC DNA To aliquot the prepared genomic DNA 1 Vortex the plate of genomic DNA at high speed for 10 sec then spin down at 2000 rpm for 30 sec Aliquot 5 pL of each DNA to the corresponding wells of a 96 well reaction plate 5 pL of the 50 ng pL working stock is equivalent to 250 ng genomic DNA per well For this protocol one plate is required to process Nsp samples a second plate is required to process Sty samples Do not process Nsp and Sty samples on the same day If continuing immediately to the next stage place the plate with prepared genomic DN
138. el and serial number Affymetrix Inc 3420 Central Expressway Santa Clara CA 95051 USA E mail support affymetrix com Tel 1 888 362 2447 1 888 DNA CHIP Fax 1 408 731 5441 Affymetrix UK Ltd Voyager Mercury Park Wycombe Lane Wooburn Green High Wycombe HP10 OHH United Kingdom E mail supporteurope affymetrix com UK and Others Tel 44 0 1628 552550 France Tel 0800919505 Germany Tel 01803001334 Fax 44 0 1628 552585 222 GeneChip Mapping 500K Assay Manual Affymetrix Japan K K Mita NN Bldg 16 Floor 4 1 23 Shiba Minato ku Tokyo 108 0014 Japan Tel 03 5730 8200 Fax 03 5730 8201 Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol 225 Reagents Equipment and Consumables Required for 96 Well Plate Protocol ABOUT THIS APPENDIX This appendix includes the vendor and part number information for the reagents equipment and consumables that have been validated for use with the GeneChip Mapping 500K 96 well plate protocol IMPORTANT Hi Use only the PCR plate adhesive film and thermal cyclers listed in Table A 7 Using other PCR plates and film that are incompatible with the thermal cycler can result in crushed tubes loss of sample or poor results The following lists of reagents equipment and consumables are included in this appendix Table A 1 Table A 2 Table A 3 Table A 4 Table A 5 Table A 6
139. ell L A Chapple J P Cooray S David A Becker C Ruschendorf F Naville D Begeot M Khoo B Nurnberg P Huebner A Cheetham M E Clark A J Mutations in MRAP encoding a new interacting partner of the ACTH receptor cause familial glucocorticoid deficiency type 2 Nat Genet 37 166 70 2005 chapter 1 Overview 13 35 36 37 38 39 40 41 Hu N Wang C Hu Y Yang H H Giffen C Tang Z Z Han X Y Goldstein A M Emmert Buck M R Buetow K H Taylor P R Lee M P Genome wide association study in esophageal cancer using GeneChip mapping 10K array Cancer Res 65 2542 6 2005 Mitra N Ye T Z Smith A Chuai S Kirchhoff T Peterlongo P Nafa K Phillips M S Offit K Ellis N A Localization of cancer susceptibility genes by genome wide single nucleotide polymorphism linkage disequilibrium mapping Cancer Res 64 8116 25 2004 Butcher L M Meaburn E Knight J Sham P C Schalkwyk L C Craig I W Plomin R SNPs microarrays and pooled DNA identification of four loci associated with mild mental impairment in a sample of 6000 children Hum Mol Genet 14 1315 25 2005 Kulle B Schirmer M Toliat M R Suk A Becker C Tzvetkov M V Brockmoller J Bickeboller H Hasenfuss G Nurnberg P Wojnowski L Application of genomewide SNP arrays for detection of simulated susceptibility loci Hum Mutat 25 557 65 2005 Go
140. ene amplifications 44 55 Furthermore integration of DNA copy number changes with gene expression changes provides a powerful paradigm for elucidating gene function 56 With the recent identification of large scale copy number polymorphisms in the human genome as well it is increasingly clear that a detailed understanding of the role of genomic alterations and structure will be important in the context of both the normal and disease state 57 60 and the high resolution of the genotyping arrays should prove valuable in this arena Additionally large scale SNP genotyping provides the basis for complex studies on population and admixture structure 61 62 6 GeneChip Mapping 500K Assay Manual The third generation product in the mapping portfolio the GeneChip Human Mapping 500K Array Set also uses the WGSA assay that has been the hallmark characteristic of all previous mapping arrays An outline of the assay steps is shown in Figure 1 1 and Figure 1 2 By changing the choice of the restriction enzymes used in WGSA and therefore the complexity of the resulting PCR products along with an increase in the information capacity of the high density arrays themselves genotyping of 500 000 SNPs has been enabled on two arrays This increase in the number of SNPs allows for higher density genome wide mapping sets which in turn will increase the amount of information that can be extracted for association studies the identification of DNA c
141. equired for the 96 well plate protocol only if denaturning samples on a thermal cycler 500K Hyb Program Temperature 95 C 10 minutes 49 C Hold 242 GeneChip Mapping 500K Assay Manual Low Throughput Pro Appendix C IMPORTANT Hi 245 Introduction The Affymetrix GeneChip Mapping 500K Assay in conjunction with the GeneChip Mapping 500K Set is designed to detect greater than 500 000 Single Nucleotide Polymorphisms SNPs in samples of genomic DNA The Mapping 500K Set is comprised of two arrays and two assay kits Each array and its corresponding assay kit are processed independently of the other array and assay kit The protocol starts with 250 ng of genomic DNA per array and will generate SNP genotype calls for approximately 250 000 SNPs for each array of the two array set An overview of the assay is shown in Figure C 1 The assay utilizes a strategy that reduces the complexity of human genomic DNA up to 10 fold by first digesting the genomic DNA with the Nsp Ior Sty I restriction enzyme and then ligating sequences onto the DNA fragments The complexity is further reduced by a PCR procedure optimized for fragments of a specified size range Following these steps the PCR products amplicons are fragmented end labeled and hybridized to a GeneChip array Arrays from different enzyme fractions should not be processed by the same technician on the same day 246 GeneChi
142. er fragmentation of DNA sample due to incorrect dilution of Fragmentation Reagent DNase Il stock Use correct concentration of Fragmentation Reagent DNase I Check U uL on the label and check dilution formula Dilute the Fragmentation Reagent on page 102 amount is the same for high and low throughput Work quickly and on ice transfer reaction tubes to pre heated thermal cycler 37 C Mix thoroughly Extremely low call rate Sample hybridization is absent on cel and dat images but B2 grid is bright Labeling reaction suboptimal Use a new vial of Terminal Dideoxynucleotidy Transferase Verify the labeling reagents and repeat labeling chapter 8 Troubleshooting 217 Problem Likely Cause Solution Positive control has good Genomic DNA not optimal Ensure DNA samples are of high quality call rates but samples are i e run in a 1 to 2 gel and compare to lower than expected Reference 103 DNA control Use positive control sample as a reference guide for assay procedures Prepare master mixes for samples and controls MDR high MCR low Mixed or contaminated genomic Use uncontaminated stock of DNA sample DNA sample page 197 Very low call rates Mixed up Nsp arrays and Sty sample Do Nsp and Sty work on separate days or vice versa 218 GeneChip Mapping 500K Assay Manual OD Troubleshooting Guidelines Refer to the tables below when troubleshooting OD readings Table 8
143. er on ice Label the 96 well reaction plate Fragment as this plate will also be used for the next stage and place on the cooling chamber Place the following on the bench top Optical plates e Solution basin e AccuGENE water Label each optical plate as follows OP1 OP2 OP3 OP4 5 Vortex the RB Buffer and place on the bench top Prepare the purified eluted PCR product plate as follows A If the plate was frozen allow it to thaw in a cooling chamber on ice B Vortex the center of the plate at high speed for 3 sec C Spin down the plate at 2000 rpm for 30 sec D Place the plate on the bench top 88 GeneChip Mapping 500K Assay Manual PREPARE DILUTED ALIQUOTS OF PURIFIED SAMPLE IMPORTANT Hi Two of the wells on each optical plate must be set up as blanks containing AccuGENE water only The 12 channel P20 pipette must be accurate to within 5 To prepare three diluted aliquots of the purified samples 1 Pour 75 mL of room temperature AccuGENE water into the solution basin 2 Using a 12 channel P200 pipette aliquot 198 pL of water to A Each well of optical plates 1 2 and 3 B The first four rows of optical plate 4 3 Using a 12 channel P20 pipette A Transfer 2 pL of each purified PCR product from rows A through G of the purified sample plate to the corresponding rows and wells of optical plates 1 2 and 3 see Figure 4 5 on page 89 B Pipette up and down 2 times after each
144. ermal cyclers be sure the blocks are silver or gold plated silver Do NOT use thermal cyclers with aluminum blocks It is not easy to visually distinguish between silver and aluminum blocks chapter 4 96 Well Plate Protocol 71 Table 4 17 500K PCR Thermal Cycler Program for the GeneAmp PCR System 9700 silver or gold plated silver blocks 500K PCR Program for GeneAmp PCR System 9700 Temperature Time Cycles 94 C 3 minutes 1X 94 C 30 sec 60 C 45 sec 30X 68 C 15 sec 68 C 7 minutes 1X 4 C HOLD Can be held overnight Volume 100 uL Specify Maximum mode Table 4 18 500K PCR Thermal Cycler Program for the MJ Tetrad PTC 225 500K PCR Program for MJ Tetrad PTC 225 Temperature Time Cycles 94 C 3 minutes 1X 94 C 30 sec 60 C 30 sec 30X 68 C 15 sec 68 C 7 minutes 1X 4 C HOLD Can be held overnight Volume 100 uL Use Heated Lid and Calculated Temperature RUNNING GELS WARNING El 72 GeneChip Mapping 500K Assay Manual Before Running Gels To ensure consistent results take 3 pL aliquot from each PCR before adding EDTA Wear the appropriate personal protective equipment when handling ethidium bromide Run the Gels When the 500K PCR program is finished ga PF WRN 10 11 Remove each plate from the thermal cycler Spin down plates at 2000 rpm for 30 sec Place plates in cooling chambers on ice or keep at 4 C Label thr
145. for obtaining optimal assay results including troubleshooting tips Appendix A Reagents Equipment and Supplies Required for 96 Well Plate Protocol Includes vendor and part number information for the equipment and reagents required to run the 96 Well Plate Protocol 4 GeneChip Mapping 500K Assay Manual Appendix B Thermal Cycler Programs Required for 96 Well Plate Protocol Includes a list of the thermal cycler programs required for the 96 Well Plate Protocol Appendix C Low Throughput Protocol Detailed step by step protocol for low throughput human genomic DNA sample processing Included is a description of quality control checkpoints at various stages of the protocol which enable array performance to be monitored Appendix D Reagents Instruments and Supplies Required for Low Throughput Protocol A complete list of the equipment and reagents required to run the Low Throughput Protocol About Whole Genome Sampling Analysis Long before the completion of the sequence of the human genome it was clear that sites of genetic variation could be used as markers to identify disease segregation patterns among families This approach successfully led to the identification of a number of genes involved in rare monogenic disorders 1 Now that the genome sequence has been completed and is publicly available 2 3 attention has turned to the challenge of identifying genes involved in common polygenic diseases 4 5 The markers of
146. from the first row Using a single channel P200 pipette remove 200 pL of denatured sample from the first well 4 Immediately inject the sample into an array Pass the array to Operator 2 NOTE The tasks for Operator 2 are listed below 6 Remove 200 pL of denatured sample and immediately inject it into an array Pass the array to Operator 2 Repeat this process one sample at a time until all 24 samples are loaded onto arrays chapter 4 96 Well Plate Protocol 129 9 Cover the wells with a fresh strip of adhesive film and place in the cooling chamber on ice 10 Remove the next strip of 24 wells and place it on the thermal cycler 11 Run the 500K Hyb program 12 Repeat steps 1 through 11 until all of the samples have been loaded onto arrays Operator 2 Tasks 1 Cover the septa on each array with a Tough Spot Figure 4 8 2 When 4 arrays are loaded and the septa are covered A Load the arrays into an oven tray evenly spaced B Immediately place the tray into the hybridization oven Do not allow loaded arrays to sit at room temperature for more than approximately 1 minute Ensure that the oven is balanced as the trays are loaded and ensure that the trays are rotating at 60 rpm at all times Because you are loading 4 arrays per tray each hybridization oven will have a total of 32 arrays Operators 1 and 2 Load no more than 32 arrays in one hybridization oven at a time All 96 samples should be load
147. g Reagent 2 Remove the TdT enzyme from the freezer and immediately place in the cooler chapter 4 96 Well Plate Protocol 111 3 Pulse spin the enzyme for 3 sec then immediately place back in the cooler 4 Add the TdT enzyme to the master mix 5 Vortex the master mix at high speed 3 times 1 sec each time 6 Pulse spin for 3 sec 7 Immediately proceed to the next set of steps Add the Labeling Master Mix to the Samples Table 4 33 Labeling Master Mix Reagent 1 Sample 96 Samples 15 extra TdT Buffer 5X 14 uL 1545 6 uL GeneChip DNA Labeling 2 uL 220 8 uL Reagent 30 mM TdT enzyme 30 U uL 3 5 uL 386 4 uL Total 19 5 uL 2152 8 uL ADD THE LABELING MASTER MIX TO THE SAMPLES To add the Labeling Master Mix to the samples Keep samples in the cooling chamber and all tubes on ice when making additions 1 Aliquot 178 pL of Labeling Master Mix to each tube of the strip tubes 2 Add the Labeling Master Mix as follows A Using a 12 channel P20 pipette aliquot 19 5 pL of Labeling Master Mix to each sample B Pipette up and down one time to ensure that all of the mix is added to the samples The total volume in each well is now 70 pL IMPORTANT Hi 112 GeneChip Mapping 500K Assay Manual Reagent Volume Rx Fragmented DNA 50 5 uL less the 4 uL used for gel analysis Labeling Mix 19 5 uL Total 70 pL 3 Seal the plate tightly with adhesive film Check to ensure that the
148. g Reagent 30 mM 5X Terminal 420 uL 5X Buffer for labeling reaction 3 Deoxynucleotidyl Transferase Buffer Oligo Control Reagent 60 uL See protocol Mixture of five biotin labeled 3 0100 OCR 0100 Chapter 4 high oligonucleotides which hybridize to throughput or control regions gridding controls and Appendix C low array controls on the GeneChip throughput Mapping 250K Arrays appendix D Reagents Instruments and Supplies Required for Low Throughput Protocol 291 Table D 4 Reagents Supplied by Affymetrix 100 reaction Kit Affymetrix GeneChip Mapping 250K Sty Assay Kit P N 900754 This kit includes sufficient reagent for 100 arrays Component Volume Concentration Description Adaptor Sty 75 uL 50 uM Two annealed oligonucleotides specific for ligation to Sty restriction site PCR Primer 002 2 vials 100 uM PCR primer to amplify ligated genomic 750 uL DNA each Reference Genomic 30 uL 50 ng uL Human genomic DNA single source 2 DNA 103 GeneChip 25 uL See label on tube DNasel enzyme formulated to fragment 3 Fragmentation Reagent purified PCR amplicons 10X Fragmentation 835 uL 10X Buffer for fragmentation reaction 3 Buffer GeneChip DNA 200 uL 30 mM Biotin labeled reagent for end labeling 3 Labeling Reagent 30 fragmented PCR amplicons mM Terminal 350 uL 30 U uL Enzyme used to end label fragmented 3 Deoxynucleotidy PCR amplicons with the GeneChip DNA Transferase Labelin
149. g Reagent 30 mM 5X Terminal 2 vials 5X Buffer for labeling reaction 3 Deoxynucleotidyl 700 uL Transferase Buffer each Oligo Control Reagent 200 uL See protocol Mixture of five biotin labeled 3 0100 OCR 0100 Chapter 4 high oligonucleotides which hybridize to throughput or control regions gridding controls and Appendix C low array controls on the GeneChip throughput Mapping 250K Arrays 292 GeneChip Mapping 500K Assay Manual Adaptor Sty 5 ATTATGAGCACGACAGACGCCTGATCT 3 3 AATACTCGTGCTGTCTGCGGACTAGAGWWCp 5 PCR Primer 002 5 ATTATGAGCACGACAGACGCCTGATCT 3 Table D 5 Equipment and Software Supplied by Affymetrix Item Part Number GeneChip Fluidics Station 450 00 0079 GeneChip Hybridization Oven 640 800139 GeneChip Scanner 3000 7G 00 0205 Affymetrix GeneChip Operating Software version 1 4 690031 Affymetrix GeneChip Genotyping Analysis Software 4 0 690051 GeneChip Human Mapping 250K Nsp Array 520330 GeneChip Human Mapping 250K Sty Array 520331 Denotes critical reagents equipment or supplies Formulations or vendors not listed here have not been tested and verified at Affymetrix In some cases lower performance has been demonstrated by reagents from non qualified vendors Table D 6 appendix D Reagents Instruments and Supplies Required for Low Throughput Protocol 293 Reagents Equipment and Supplies Not Supplied by Affyme
150. gle channel P1000 1 Pipette 12 channel P20 1 Pipette 12 channel P200 As needed Pipette tips for pipettes listed above full racks 1 Plate centrifuge 2 Plate seal 1 Solution basin 55 mL 1 Thermal cycler 1 strip Tubes strip 12 per strip 1 Tube Eppendorf 2 0 mL 1 Vortexer IMPORTANT Use only the PCR plate adhesive film and thermal cyclers listed in Table 4 1 on page 40 chapter 4 96 Well Plate Protocol 55 REAGENTS REQUIRED The following reagents are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information The amounts listed are sufficient to process one full 96 well reaction plate Table 4 10 Reagents Required for Stage 3 Ligation Quantity Reagent 1 vial T4 DNA Ligase 400 U uL NEB 1 vial T4 DNA Ligase Buffer 10X 1 vial Adaptor Nsp or Sty as appropriate 50 uM 10 mL AccuGENE water molecular biology grade IMPORTANT INFORMATION ABOUT THIS PROCEDURE To help ensure the best results carefully read the information below before you begin this stage of the protocol IMPORTANT Hi Aliquot the T4 DNA Ligase Buffer 10X after thawing for the first time to avoid multiple freeze thaw cycles See vendor instructions Be sure to use the correct adaptor Nsp or Sty PREPARE THE REAGENTS CONSUMABLES AND OTHER COMPONENTS Thaw the Reagents and Digestion Stage Plate To thaw the re
151. greater than or equal to the mismatch threshold ge jEJE E EE E EE E EE EJ EK ES i r 3 N SESBEHE eee 8 _Mappingt0K_Xbat31 Mappingi0K_Xbat31 MappingtOK Mbat31 _Mapp ng 0K_Xba131 E ERIN eevee Ht GEDIRNN 2 2 2 2 2 Bs 2 2 2 2Z ZZZZZZ amp ZZ Z amp amp zz CLELIA tz td t ld Figure 7 9 Sample Mismatch Report chapter 7 Analysis Workflow 203 B2 OLIGO PERFORMANCE The B2 oligo is a component of the Oligo Control Reagent 0100 OCR It is spiked into each hybridization cocktail and is highlighted on the image by the following The alternating pattern of intensities on the border e The checkerboard pattern at each corner Figure 7 10 and throughout the array The array name located in the lower left corner of the array Figure A11 Figure 7 10 Example of corner checkerboard pattern Figure 7 11 Array name image has been rotated for display B2 Oligo serves as a positive hybridization control and is used by the software to place a grid over the image Variation in B2 hybridization intensities across the array is normal and does not indicate variation in hybridization efficiency 204 GeneChip Mapping 500K Assay Manual CONCORDANCE WITH REFERENCE GENOTYPES ON REFERENCE GENOMIC DNA 103 A simple test that can be used to determine if the assay is performing to specifications is to measure the c
152. hange the buffer increase salt Call Affymetrix Technical Support for service Error While Filling conditions while filling Note where in protocol error occurred System detects improper Missing or insufficient stain or antibody in vial Wash or DI water empty Air bubbles in line Leaks Identify if chip is filled e If important to recover fluid in chip then run Recovery script followed by Resume function e If not important to recover fluid in chip run Resume function chapter 6 Fluidics Station Care and Maintenance 173 Table 6 3 Continued Common error messages their meanings probable causes and solutions Error Message Problem Communications error detected Note where in protocol error occurred Invalid Command Possible Cause Solution Identify if chip is filled If important to recover fluid in chip then run Recov ery script e Attempt to rerun script if sample loss can be toler ated If problem persists contact Affymetrix for ser vice e If sample loss cannot be tolerated do not attempt to rerun script Contact Affymetrix for service Temperature Timeout Temperature does not reach specified temperature Temperature has not reached required level in expected time if ambient temperature is within operating specifications 15 30 degrees C Call Affymetrix Technical Support for service Improper Script Script does not work
153. he export files or to set calls for erroneous SNPs to NoCalls for families with inheritance errors You may want to use the second option if exporting multiple families at once 5 Select output file names and choose the path to save the files Click Export to export your data Consult the GeneChip Genotyping Analysis Software User s Guide for directions specific to each format type To batch export genotyping calls The Tab Delimited export tool allows batch export of genotyping calls from large data sets simultaneously into tab delimited files This feature can be combined with File Sets to provide a flexible method of analyzing custom groupings of large data sets The data is exported in a tab delimited text file with the following columns Affymetrix SNP ID Genotype 1 Click the SNP Export button in the Genotyping Views shortcut bar or select Tools Genotype gt SNP Export from the menu bar 2 Choose the Tab Delimited tab 192 GeneChip Mapping 500K Assay Manual Select the file set project sample experiments or analysis data in the data tree and drag them to the Samples box Optional Choose any filters you wish to apply to the data The SNP filters allow you to filter out SNPs that do not meet particular requirements from the export You can filter by e Allele Frequency Hardy Weinberg Probability Value Mendelian error rate Select output file names and choose the path to sa
154. her blocks are not capable of maximum mode which will affect ramp times Use the recommended plate seal Make sure the seal is tight and that no significant evaporation occurs during the PCR NOTE The Mapping 500K PCR reaction amplifies a size range of fragments that represents 15 20 of the genome The Mapping 500K arrays are designed to detect the SNPs that are amplified in this complex fragment population Subtle changes in the PCR conditions may not affect the PCR yield but may shift the amplified size range up or down very slightly This can lead to reduced amplification of SNPs that are assayed on the array set subsequently leading to lower call rates chapter 4 96 Well Plate Protocol 93 Table 4 24 PROBLEM Average Sample OD is Less Than 0 5 2 5 pg pL Troubleshooting Possible Problems with the Elution or OD Readings possible causes include e The purified PCR product was eluted in a volume greater than 45 uL e The purified PCR product was not mixed adequately before making the 1 100 dilution e The diluted PCR product was not mixed adequately before taking the OD reading e The water blank reading was not subtracted from each sample OD reading e The spectrophotometer plate reader may require calibration e Pipettes may require calibration e There may be air bubbles or dust in the OD plate e There may be defects in the plastic of the plate e The settings on the spectrophotometer plate reader or the software may b
155. hick stack of clean absorbent paper to remove any remaining liquid B Dry the bottom of each well with an absorbent wipe IMPORTANT H Immediately blot the bottom of the plate and dry the bottom of each well Any remaining liquid will quickly seep back into the wells 3 Aliquot 5 mL RB Buffer to a solution basin Using a 12 channel P200 pipette add 45 pL RB buffer to each well of the plate Tightly seal the plate 6 Load the plate onto a Jitterbug plate shaker Set the Jitterbug to setting 5 and moderately shake the plate for 10 minutes at room temperature This setting approximately 1000 rpm allows as much movement as possible without losing liquid to the sides of the wells and film 8 Transfer 45 pL of each eluted sample from the Clontech Clean Up Plate to the corresponding well of a fresh 96 well plate following these guidelines e Use a 12 channel P200 pipette set to 60 pL e Tilt the Clontech Clean Up Plate at a 30 to 45 degree angle to move the liquid to one side of the well Optional use a plate support to keep the plate tilted at an angle Well Plate Stand Diversified Biotech P N WPST 1000 Pipette up and down 3 to 4 times before removing and transferring the eluate to a fresh 96 well reaction plate chapter 4 96 Well Plate Protocol 83 Go back into the well a second time and remove any remaining liquid It is OK to touch the bottom of the filter WHAT YOU CAN DO NEXT Do one of the follow
156. hip Mapping 500K Assay Manual Likely Cause Fragmented PCR product is not the correct size Solution PCR product is still visible Incomplete fragmentation due to in 200 1 100 bp size region underestimated DNA concentration Ensure spectrophotometer is properly calibrated so only 90 ug of DNA is added to the fragmentation reaction Failed or incomplete fragmentation due to reduced DNase activity Check that you have entered the correct activity of DNase into the formula for calculating amount of DNase to add to fragmentation reaction See Dilute the Fragmentation Reagent on page 102 amount is the same for high and low throughput Ensure fragmentation reagent DNase is kept at 20 C Do not reuse diluted working stock CEL file can not be generated GCOS is unable to align grid Unable to place a grid on the dat file due to the absence of B2 signal Hybridization controls including oligo B2 must be added to hybridization cocktail for grid alignment dat image is dim Insufficient signal intensity or staining failure Make fresh stain buffers Incorrect wash buffers used on fluidics station Prime the fluidics station with the correct buffers prior to running the assay Incorrect wash buffers will disrupt hybridization of the labeled fragmented DNA Low SNP call rates Gel images and spectrophotometric quantitation indicate successful PCR reaction Ov
157. his may be helpful in situations where multiple users are working on a project or where experiments are repeated Please note that File Sets may only be accessed within GTYPE and do not supersede or overwrite the GCOS file structure Each File Set is shown as a node in the data tree You can use File Sets for any process where you need to select a file for functions like Linkage Export Pedigree Check e SNP Export e Batch Tool e Sample Quality Tool To group files into a File Set 1 Right click in the Data Tree and select File Sets from the shortcut menu or from the main menu select Tools gt File Sets 2 Select files for a set in the Data Tree and drag them to the File Set Members box 3 Enter a name for the File Set and click Save For more information regarding using File Sets please consult the GeneChip Genotyping Analysis Software User s Guide 190 GeneChip Mapping 500K Assay Manual EXAMINING THE RAW PROBE DATA EXPORT Information on raw probe intensity can be obtained by selecting aSNP identifier from within the chp file and choosing the Probe Intensity option in the Run menu Probe intensity data is displayed for each probe in bar line or trace graph format SNP call data can be exported for use in third party software products as either a tab delimited file or linkage formats compatible with MERLIN GeneHunter or Haploview software new for GTYPE 4 0 If pedigree information is included
158. hput 500K Digest 1 Pre PCR Clean Area 500K Ligate 1 Pre PCR Clean Area 500K PCR 3 Main Lab 500K Fragment 1 Main Lab 500K Label 1 Main Lab 500K Hyb 1 Main Lab CUTTING STRIP TUBES FROM PLATES Strip tubes are required for many of the steps in the 96 well plate protocol The Mapping 500K 96 well plate protocol has been optimized using strips of tubes that have been cut from the Bio Rad plates recommended in Table 4 1 on page 40 and in Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol 42 GeneChip Mapping 500K Assay Manual Stage 1 Genomic DNA Plate Preparation ABOUT THIS STAGE The human genomic DNA you will process using the Mapping 500K 96 well plate protocol should meet the general requirements listed in Chapter 3 Genomic DNA General Requirements During this stage you will prepare the genomic DNA by 1 Determining the concentration of each sample Diluting each sample to 50 ng pL using reduced EDTA TE buffer 3 Aliquoting 5 pL of each sample to a 96 well plate one sample per well LOCATION AND DURATION e Pre PCR Clean Area Hands on time time will vary can be up to 4 hours INPUT REQUIRED This protocol is written for processing 96 samples of genomic DNA one enzyme at a time OTETA Item 96 Genomic DNA samples that meet the general requirements listed in Chapter 3 Genomic DNA General Requirements chapter 4 96 Well Plate Protocol 43 EQUIPM
159. i REAGENTS The concentration of the genomic DNA should be determined and the working stocks diluted to 50 ng pL using reduced EDTA TE buffer 0 1 mM EDTA 10 mM Tris HCL pH 8 0 Diluted genomic DNA can be aliquoted at this point For high throughput assays 2 or more 96 well plates make multiple replicates of each plate An elevated EDTA level is not recommended as it may interfere with subsequent reactions Reduced EDTA TE Buffer 10 mM Tris HCL 0 1 mM EDTA pH 8 0 TEKnova P N T0223 STEP 1 Reagent Preparation and Storage The reagents necessary for the restriction digestion ligation and PCR steps should be stored in the pre PCR clean room or area for the DNA template and free of PCR products to minimize cross contamination between samples To avoid re entering the pre PCR clean room after entering either the PCR Staging Room or the Main Lab Affymetrix recommends aliquoting each of the reagents in the pre PCR clean room before starting the rest of the experiment appendix C Low Throughput Protocol 249 STEP 2 Restriction Enzyme Digestion REAGENTS AND EQUIPMENT 250 ng Genomic DNA per array working stock 50 ng pL e Sty I 10 000 U mL New England Biolabs NEB P N R0500S containing NE Buffer 3 New England Biolab NEB P N B7003S to order separately BSA Bovine Serum Albumin New England Biolab NEB P N B9001S to order separately e Nsp I 10 000 U mL New England Biolab NEB P N R0602L
160. ical plate P1 P2 P3 and P4 in Figure 4 5 on page 89 OD1 sample OD water blank OD OD2 sample OD water blank OD OD3 sample OD water blank OD B Average the 3 readings for each sample to obtain an Average Sample OD Average Sample OD OD1 OD2 OD3 3 C Calculate the undiluted sample concentration for each sample using the Average Sample OD Sample concentration in ug uL Average Sample OD X 0 05 ug L X 100 Apply the convention that 1 absorbance unit at 260 nm equals 50 pg mL equivalent to 0 05 pg pL for double stranded PCR products This convention assumes a path length of 1 cm Consult your spectrophotometer handbook for further information ASSESS THE OD READINGS Follow the guidelines below for assessing and troubleshooting OD readings Average Sample OD A typical average sample OD is 0 5 to 0 7 This OD range is equivalent to a final PCR product concentration of 2 5 to 3 5 pg pL It is based on the use of a conventional UV spectrophotometer plate reader and assumes a path length of 1 cm chapter 4 96 Well Plate Protocol 91 Process Control Metrics Evaluate the process control metrics as follows The OD260 OD280 ratio should be between 1 8 and 2 0 Do not proceed if this metric falls outside of this range The OD320 measurement should be very close to zero 0 0 005 OD Troubleshooting Guidelines Refer to the tables below when troubleshooting OD readings Table 4 23 P
161. ields can be customized See the GeneChip Operating Software User s Guide for further information STEP 2 PREPARING THE FLUIDICS STATION The Fluidics Station 450 is used to wash and stain the probe arrays it is operated using GeneChip Operating Software Setting Up the Fluidics Station 1 Turn on the Fluidics Station using the toggle switch on the lower left side of the machine 2 Select Run gt Fluidics from the menu bar in GCOS The Fluidics Station dialog box appears with a drop down list for selecting the experiment name for each of the fluidics station modules A second drop down list is accessed for choosing the Protocol for each of the fluidics station modules Use the radio buttons to access each module Refer to the GeneChip Fluidics Station User s Guide for instructions on connecting and addressing multiple fluidics stations chapter 5 Washing Staining and Scanning Arrays 141 Priming the Fluidics Station Priming ensures the lines of the fluidics station are filled with the appropriate buffers and the fluidics station is ready to run fluidics station protocols Priming should be done when the fluidics station is first started when wash solutions are changed before washing if a shutdown has been performed e if the LCD window instructs the user to prime 1 To prime the fluidics station select Protocol in the Fluidics Station dialog box 2 Choose Prime_450 for the resp
162. ing Proceed immediately to the next step If not proceeding immediately to the next step A Seal the plate with the eluted samples B Store the plate at 20 C 84 GeneChip Mapping 500K Assay Manual Stage 6 Quantitation and Normalization ABOUT THIS STAGE During this stage you will prepare three independent dilutions of each PCR product in optical plates You will then quantitate the diluted PCR products and average the OD measurements from each plate Once the concentration of each reaction is determined you will normalize each reaction to 2 pg pL in RB Buffer LOCATION AND DURATION Main Lab e Hands on time Quantitation 1 hour Normalization 1 hour INPUT REQUIRED FROM PREVIOUS STAGE Input required from Stage 5 PCR Product Purification and Elution is Quantity Item 1 Plate of purified PCR product EQUIPMENT AND CONSUMABLES REQUIRED The following equipment and consumables are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information IMPORTANT Hi Use only the PCR plate adhesive film and thermal cyclers listed in Table 4 1 on page 40 chapter 4 96 Well Plate Protocol 85 Table 4 21 Equipment and Consumables Required for Stage 6 Quantitation and Normalization Quantity Item 1 Cooling chamber double chilled to 4 C do not freeze 1 Ice bucket
163. ion in three human populations Science 307 1072 9 2005 Hirschhorn J N Daly M J Genome wide association studies for common diseases and complex traits Nat Rev Genet 6 95 108 2005 Pharoah P D Dunning A M Ponder B A Easton D F Association studies for finding cancer susceptibility genetic variants Nat Rev Cancer 4 850 60 2004 Patil N Berno A J Hinds D A Barrett W A Doshi J M Hacker C R Kautzer C R Lee D H Marjoribanks C McDonough D P Nguyen B T Norris M C Sheehan J B Shen N Stern D Stokowski R P Thomas D J Trulson M O Vyas K R Frazer K A Fodor S P Cox D R Blocks of limited haplotype diversity revealed by high resolution scanning of human chromosome 21 Science 294 1719 23 2001 Crawford D C Carlson C S Rieder M J Carrington D P Yi Q Smith J D Eberle M A Kruglyak L Nickerson D A Haplotype diversity across 100 candidate genes for inflammation lipid metabolism and blood pressure regulation in two populations Am J Hum Genet 74 610 22 2004 Dawson E Abecasis G R Bumpstead S Chen Y Hunt S Beare D M Pabial J Dibling T Tinsley E Kirby S Carter D Papaspyridonos M Livingstone S Ganske R Lohmussaar E Zernant J Tonisson N Remm M Magi R Puurand T 10 GeneChip Mapping 500K Assay Manual 18 19 20 21 22 Vilo J Kurg A Rice K Deloukas P M
164. ips Rainin GP L10F Pre PCR and Main Lab As needed for pipettes listed in GP L200F Table A 6 GP L1000F RT L10F RT L200F RT L1000F GP refill RT with rack Plate seals see Table A 7 on page 232 Pre PCR and Main Lab Plates 96 well PCR see Table A 7 on page 232 Pre PCR and Main Lab Plates 96 well UV Star 370 uL well E amp K Scientific 25801 Main Lab Solution Basin 100 mL sterile Labcor 730 014 Main Lab multichannel Solution Basin 55 mL sterile Labcor 730 004 Pre PCR and Main Lab multichannel Solution Basin lid 55 mL Labcor 730 021 Pre PCR and Main Lab Diversified Biotech SPOT 1000 Tough Spots Main Lab USA Scientific 9185 1000 CLP Direct 3426 12 Tubes strip of 12 thin wall 0 2 mL Pre PCR and Main Lab ISC BioExpress T 3114 1 Tube centrifuge 15 mL VWR 20171 020 Main Lab Tube centrifuge 50 mL VWR 21008 178 Main Lab Tube Eppendorf 2 0 mL VWR 20901 540 Pre PCR Tube Eppendorf Safe Lock 1 5 mL VWR 21008 959 Main Lab required only if using tubes for Stage 9 Target Hybridization Tube Falcon 50 mL VWR 21008 940 Pre PCR appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol 235 Supplier Contact List Table A 10 Supplier Contact List Supplier Web Site Affymetrix www affymetrix com Ambion www ambion com Applied Biosystems home appliedbiosystems com Bionexus Inc www bionexus net Bio Rad www bio rad com Boekel Scientific www b
165. ired for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information IMPORTANT Hi Increased variability in Mapping 500K performance has been observed in GeneChip Hybridization Oven 640 models P N 800138 or 800189 manufactured prior to 2001 Check the serial number of your hybridization oven s If the serial numbers are 11214 or lower contact Affymetrix for an upgrade 116 GeneChip Mapping 500K Assay Manual Hybridizing Samples Using a Thermal Cycler The following table lists the equipment and consumables required if hybridizing samples using a thermal cycler Table 4 34 Equipment and Consumables Required for Stage 9 Target Hybridization Using a Thermal Cycler OTE TIL LAYA Item 1 Cooling chamber chilled to 4 C do not freeze 96 GeneChip 250K Arrays one array per sample 1 GeneChip Hybridization Oven 640 1 Ice bucket filled with ice 1 Pipette single channel P200 1 Pipette single channel P1000 As needed Pipette tips for pipettes listed above full racks 1 Plate Bio Rad 96 well P N MLP 9601 1 Plate centrifuge 2 Plate holders centrifuge 1 Plate seal 1 Solution basin 55 mL 1 Thermal cycler See About this Stage on page 114 2 per array Tough Spots 1 Tube centrifuge 50 mL 1 Vortexer IMPORTANT Use only the PCR plate adhesive film and thermal cyclers l
166. irements for Human Genomic DNA on page 27 Genomic DNA Extraction Purification Methods DNA Cleanup Genomic DNA extraction and purification methods that meet the general requirements for genomic DNA outlined above should yield successful results Methods that include boiling or strong denaturants are not acceptable because the DNA would be rendered single stranded Genomic DNA extracted using the following methods have been tested at Affymetrix 1 SDS ProK digestion phenol chloroform extraction Microcon or Centricon Millipore ultrapurification and concentration 2 QIAGEN QIAamp DNA Blood Maxi Kit If a genomic DNA preparation is suspected to contain inhibitors the following cleanup procedure can be used 1 Add 0 5 volumes of 7 5 M NH OAc 2 5 volumes of absolute ethanol stored at 20 C and 0 5 pL of glycogen 5 mg mL to 250 ng genomic DNA 2 Vortex and incubate at 20 C for 1 hour Centrifuge at 12 000 x g ina microcentrifuge at room temperature for 20 minutes References 30 GeneChip Mapping 500K Assay Manual Remove supernatant and wash pellet with 0 5 mL of 80 ethanol Centrifuge at 12 000 x g at room temperature for 5 minutes Remove the 80 ethanol and repeat the 80 ethanol wash one mote time 7 Re suspend the pellet in reduced EDTA TE buffer 10 mM Tris pH 8 0 0 1 mM EDTA pH 8 0 Feigelson H S Rodriguez C Robertson A S Jacobs E J Calle E E Reid Y A Thun
167. isted in Table 4 1 on page 40 chapter 4 96 Well Plate Protocol 117 Hybridizing Samples Using Heat Blocks The following table lists the equipment and consumables required if hybridizing samples using heat blocks Table 4 35 Equipment and Consumables Required for Stage 9 Target Hybridization Using Heat Blocks Quantity Item 1 Cooling chamber chilled to 4 C do not freeze 96 e GeneChip Human Mapping 250K Sty Array GeneChip Human Mapping 250K Nsp Array One array per sample is required 1 GeneChip Hybridization Oven 640 2 Heat block 1 Ice bucket filled with ice 1 Pipette single channel P200 1 Pipette single channel P1000 As needed Pipette tips for pipettes listed above full racks 1 Plate centrifuge 1 Plate seal 1 Solution basin 55 mL 4 Timers 1 Tube centrifuge 50 mL 96 Tube Eppendorf Safe Lock 1 5 mL one tube per sample 2 per array Tough Spots 1 Vortexer 118 GeneChip Mapping 500K Assay Manual REAGENTS REQUIRED The following reagents are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information The amounts listed are sufficient to process one full 96 well reaction plate Table 4 36 Reagents Required for Stage 9 Target Hybridization Quantity Reagent 5 mL 1 tube Denhart s Solution 1 5 mL 1 tube DMSO 0 5 mL 1
168. ix Technical Support for assistance TROUBLESHOOTING DECISION TREE The following simple flow charts Figure 6 8 and Figure 6 9 show you how to begin troubleshooting the FS450 250 for a Missing Fluid Error chapter 6 Fluidics Station Care and Maintenance 169 Workstation says Motor Replace Sealevel drivers Motion Error with current revision contact Technical Support No Cartridge full No Pump tubing worn Yes Replace tubing No Pump tubing installed too Yes Loosen tubing tight No Yes or ae Yes Correct leakage or clog A contact Technical Support Insufficient sample stain or wash buffer Remedy neuticiency To eo Record cause of MFE as unknown Figure 6 8 Troubleshooting decision tree page 1 170 GeneChip Mapping 500K Assay Manual Stain bad MFE on several modules at once sensor readings above Valve selecting a wash buffer threshold Yes Yes Module primed Re make stain sensor reading not Prime module near 1000 Yes No Wash buffer bad No MFE on several modules at R ke boe once sensor readings above threshold Correct known causes of foaming Module recently bleached Run bleach protocol Faulty wiring or PCB Correct wiring or PCB contact Technical Support Record cause of MFE as unknown Figure 6 9 Troubleshooting decision tree page 2 chapter 6 Fluidics Station
169. k to a single reaction on a Clontech Clean Up Plate Figure 4 4 on page 80 Place the Clean Up Plate onto a manifold and concentrate the PCR products e Wash the PCR products three times while still on the manifold using AccuGENE water Elute the PCR products using RB Buffer and transfer them to a new 96 well plate LOCATION AND DURATION Main Lab Hands on time 1 hour e Initial dry down 1 5 to 2 hours First two water washes 15 to 20 minutes each e Third water wash 45 to 75 minutes INPUT REQUIRED FROM PREVIOUS STAGE The input required from Stage 4 PCR is Quantity Item 3 Plates of PCR product in cooling chambers on ice chapter 4 96 Well Plate Protocol 75 EQUIPMENT AND CONSUMABLES REQUIRED The following equipment and consumables are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information Table 4 19 Equipment and Consumables Required for Stage 5 PCR Product Purification and Elution 1 Jitterbug As needed Kimwipes 1 Manifold OlAvac Multiwell 1 Marker fine point permanent 1 Pipette single channel P200 1 Pipette single channel P1000 1 Pipette 12 channel P20 1 Pipette 12 channel P200 As needed Pipette tips for pipettes listed above full racks 1 Plate 96 well PCR 1 Plate centrifuge 1 Plate Clontech Clean Up 4 Plate holders 5 Plate seal
170. lar disorder by use of a high density single nucleotide polymorphism SNP genotyping assay a comparison with microsatellite marker assays and finding of significant linkage to chromosome 6q22 Am J Hum Genet 74 886 97 2004 26 Shrimpton A E Levinsohn E M Yozawitz J M Packard D S Jr Cady R B Middleton F A Persico A M Hootnick D R A HOX gene mutation in a family with isolated congenital vertical talus and Charcot Marie Tooth disease Am J Hum Genet 75 92 6 2004 27 Puffenberger E G Hu Lince D Parod J M Craig D W Dobrin S E Conway A R Donarum E A Strauss K A Dunckley T Cardenas J F Melmed K R Wright C A Liang W Stafford P Flynn C R Morton D H Stephan D A Mapping of sudden infant death with dysgenesis of the testes syndrome SIDDT by a SNP genome scan and identification of TSPYL loss of function Proc Natl Acad Sci USA 101 11689 94 2004 28 Kaindl A M Ruschendorf F Krause S Goebel H H Koehler K Becker C Pongratz D Muller Hocker J Nurnberg P Stoltenburg Didinger G Lochmuller H Huebner A Missense mutations of ACTA1 cause dominant congenital myopathy with cores J Med Genet 41 842 8 2004 12 GeneChip Mapping 500K Assay Manual 29 30 Gissen P Johnson C A Morgan N V Stapelbroek J M Forshew T Cooper W N McKiernan P J Klomp L W Morris A A Wraith J E McClean P Lynch S A Thompson
171. leak e An accurate hybridization temperature is critical for this assay Therefore we recommend that your hybridization ovens be serviced at least once per year to ensure that they are operating within manufacture specifications Gloves safety glasses and lab coats must be worn when preparing the Hybridization Master Mix Consult the appropriate MSDS for reagent storage and handling requirements 120 GeneChip Mapping 500K Assay Manual PREPARE THE REAGENTS CONSUMABLES AND OTHER COMPONENTS IMPORTANT Hi Prepare a 12X MES Stock Solution The 12X MES stock solution can be prepared in bulk and kept for at least one month if properly stored Proper storage Protect from light using aluminum foil Keep at 4 C Do not autoclave Store between 2 C and 8 C and shield from light using aluminum foil Discard solution if it turns yellow To prepare 1000 mL of 12X MES Stock Solution 1 25 M MES 0 89 M Na 1 Combine 70 4 g MES hydrate e 193 3 g MES sodium salt 800 mL AccuGENE water 2 Mix and adjust volume to 1 000 mL 3 Test the pH The pH should be between 6 5 and 6 7 4 Filter the solution through a 0 2 pm filter Protect from light using aluminum foil and store at 4 C Preheat the Hybridization Ovens To preheat the hybridization ovens 1 Turn each oven on and set the temperature to 49 C Set the rpm to 60 3 Turn the rotation on and allow to preheat for 1 hour before
172. lver block Bio Rad P N MLP 9601 Applied Biosystems m P N 4306311 MJ Tetrad PTC 225 by Bio Rad appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol 233 Consumables Required GENECHIP ARRAYS REQUIRED The following GeneChip arrays are required Table A 8 Arrays Required for the Mapping 500K 96 Well Plate Protocol Array Part Number GeneChip Human Mapping 250K Nsp Array minimum order is 200 arrays 520330 1 array GeneChip Human Mapping 250K Nsp Array 900768 30 arrays GeneChip Human Mapping 250K Sty Array minimum order is 200 arrays 520331 1 array GeneChip Human Mapping 250K Sty Array 900770 30 arrays Denotes critical equipment Vendors not listed here have not been tested and verified at Affymetrix OTHER CONSUMABLES REQUIRED Table A 9 Other Consumables Required for the Mapping 500K 96 Well Plate Protocol Manufacturer Part Number Laboratory Location Distributor Gel Reliant Gel System precast Cambrex 54939 Main Lab agarose gel 2 SeaKem Gold TBE DNA Marker Bionexus All Purpose Hi Lo Main Lab BN2050 Gel Loading Solution Sigma Aldrich G2526 Main Lab 234 GeneChip Mapping 500K 96 Well Plate Protocol Table A 9 Other Consumables Required for the Mapping 500K 96 Well Plate Protocol Item Manufacturer Part Number Laboratory Location Distributor Pipette t
173. me in the template IMPORTANT One column must contain the Sampie name The atrioute for tie column must be set to SAMPLENAME dh NATOSZO SE 05095 102 03 9C1 CHP d l Naaa SEE A_550855 510 2 C4_SC1 CHP dib NATOSZ2_S4a_590055_S102_CS_SC1 CHP J Check the IMPORT bax for those columns to import into Goos T 3 Chock Mody ea a moa ee Bed FT Permission to Modify Busting Samples in GCOS is allowed mier este e Check Create to create n w GCOS I Permission to Create New Samples in GCOS is allowed WEDE EWA HES DIN Rests Default Parameters 5 Select the sample template that is to be Default Template z mpk associated with the sar 2i d l NATOS23_ SEa 550755 5102 06 Nana SEa S055 6102 C7 SCI CHP db NATORZ2 SE 550565 5 102_C8_5C1 CHP a asn Make sure the aty butes in Stap 2 match the attributes in the template apal 6 Select or erter project to assii to he trok SD Batch analysis started Batch analysis started for the Mendel Jisp array group atch analysis completed for the Mendel_Nsp array group Bach waliy cated Fee the Mandal Sty arrir group d Figure 7 5 GTYPE Attributelmporter Tool FILE SETS chapter 7 Analysis Workflow 189 File Sets is a new feature in GTYPE 4 0 that provides a way to custom group Mapping data files for the analysis of previously unassociated data at a single time T
174. more experienced operators in your laboratory These operators should be proficient in The use of multi channel pipettes High throughput sample processing Even if you feel comfortable with the protocol and with multichannel pipetting do not attempt to transition to 96 samples immediately We recommend a moderately paced ramp up wherein the operator first establishes proficiency with 24 samples Your field application specialist FAS will provide additional guidance on best practices for a successful lab scale up When you are ready to process full 96 well plates we recommend that the same operator should not perform too many stages in a given day Small teams of individuals dedicated to different stages of the process has proven to bea highly effective method of managing this workflow For example the full process can be sub divided into four teams in which each team is responsible for the following stages Team 1 pre PCR digestion ligation PCR set up Team 2 post PCR purification quantitation Team 3 post PCR normalization fragmentation labeling Team 4 array processing hybridization fluidics scanning Again your FAS can provide additional guidance on how best to configure the lab personnel for the 96 well plate protocol Arrays from different enzyme fractions should not be processed by the same technician on the same day 38 GeneChip Mapping 500K Assay Manual Before You Begin MASTE
175. n GIYPE GTYPE Report metrics Because of the importance of detecting mixed or contaminated samples GTYPE has an additional algorithm to supplement the Dynamic Model algorithm to help with sample contamination 198 GeneChip Mapping 500K Assay Manual detection The MPAM calling algorithm used to make genotype calls for the Mapping 10K array is employed in this analysis to make genotype calls on a subset of 8 000 SNPs chosen for each of the GeneChip Mapping 250K Nsp and 250K Sty Arrays These SNPs were chosen based upon the ability to be a suitable detector of sample contamination across large data sets Using this subset also allows the software to quickly derive contamination metrics without the additional computational burden of having to make an extra set of calls on the entire array In a pure sample the proportion of labeled DNA target for two alleles of any SNP will typically be present at one of three allelic ratios 100 0 50 50 or 0 100 The models used to make genotype calls from probe hybridization data apply this information to determine the genotype call for each SNP and assign a no call if the observed data fall too far from these predicted ratios If a mixed or contaminated DNA sample is genotyped the assumption of only three possible allelic ratios will be violated for many SNPs resulting in lower Call Rates However whether or not the sample is contaminated the MPAM Detection Rate MDR will remain high as it is
176. n Master Mix to each well of the 96 well plate containing genomic DNA Table C 3 Genomic DNA 50 ng uL 5 uL Digestion Master Mix 14 75 uL Total Volume 19 75 uL To expedite the aliquoting the master mix can be first divided into 8 or 12 microwell strips and then dispensed into the plate with an 8 channel or 12 channel pipette Pipet up and down for several times to mix the genomic DNA and digestion mix Be sure to change tips between samples 4 Cover the plate with a plate cover and seal tightly vortex at medium speed for 2 seconds and spin at 2 000 rpm for 1 minute 5 Put the plate on a thermal cycler and run the 500K Digest program 500K Digest Program Temperature Time 37 C 120 minutes 65 C 20 minutes 4 C Hold Store sample at 20 C if not proceeding to the next step appendix C Low Throughput Protocol 253 STEP 3 Ligation REAGENTS AND EQUIPMENT e T4 DNA Ligase New England Biolab NEB P N M0202L containing T4 DNA Ligase Buffer New England Biolab NEB P N B0202S e Molecular Biology Grade Water Bio Whittaker Molecular Applications Cambrex P N 51200 Adaptor Nsp 50 pM Affymetrix P N 900596 for 30 Rxns and P N 900697 for 100 Rxns Available in the Nsp and Sty GeneChip Mapping 250K Assay Kits Nsp 30 Rxn Kit P N 900766 Nsp 100 Rxn Kit P N 900753 Adaptor Sty 50 pM Affymetrix P N 900597 for 30 Rxns and P N 900698 for 100 Rxns
177. ng 500K Assay Manual Probe Array Scan The scanner is also controlled by GCOS Software 1 4 The probe array is scanned after the wash protocols are complete Make sure the laser is warmed up prior to scanning by turning the GeneChip Scanner 3000 7G laser on at least 10 minutes before use If the probe array was stored at 4 C allow to warm to room temperature before scanning Refer to the GeneChip Operating Software User s Guide P N 701439 online help and tutorials for more information on scanning The scanner uses a laser and is equipped with a safety interlock system Defeating the interlock system may result in exposure to hazardous laser light Read and be familiar with the operation of the scanner before attempting to scan a probe array Please refer to the GeneChip Scanner 3000 Quick Reference Card P N 08 0075 chapter 5 Washing Staining and Scanning Arrays 149 HANDLING THE GENECHIP PROBE ARRAY Before scanning the probe array follow directions in this section on handling the probe array If necessary clean the glass surface of the probe array with a non abrasive towel or tissue before scanning Do not use alcohol to clean the glass Before scanning the probe array cartridge Tough Spots label spots can be applied to each of the two septa on the probe array cartridge to prevent leaking of fluids from the cartridge during scanning IMPORTANT o Apply the spots just before scanning Do
178. ning and Scanning Arrays 145 Add 820 pL of Array Holding Buffer to each microcentrifuge tube One tube is needed per module used A vial containing Array Holding Buffer must be placed in sample holder 3 for each module used Table 5 5 FS 450 Fluidics Protocol Antibody Amplification for Mapping Targets 49 Format Standard Mapping 500Kv1_450 Post Hyb Wash 1 6 cycles of 5 mixes cycle with Wash Buffer A at 25 C Post Hyb Wash 2 24 cycles of 5 mixes cycle with Wash Buffer B at 45 C Stain Stain the probe array for 10 minutes in SAPE solution at 25 C Post Stain Wash 6 cycles of 5 mixes cycle with Wash Buffer A at 25 C 2nd Stain Stain the probe array for 10 minutes in Antibody Stain Solution at 25 C 3rd Stain Stain the probe array for 10 minutes in SAPE solution at 25 C Final Wash 10 cycles of 6 mixes cycle with Wash Buffer A at 30 C The final holding temperature is 25 C Filling Array Fill the array with Array Holding Buffer Wash Buffer A non stringent wash buffer Wash Buffer B stringent wash buffer 146 GeneChip Mapping 500K Assay Manual WASHING AND STAINING THE PROBE ARRAY USING FS 450 IMPORTANT Hi The wash and staining buffers are different from the GeneChip expression buffers Using the Fluidics Station 450 1 In the Fluidics Station dialog box on the workstation select the correct experiment name from the drop down Experiment list The Probe Arra
179. not use them in the washing and staining process 1 On the back of the probe array cartridge clean excess fluid from around the septa 2 Carefully apply one spot to each of the two septa Press to ensure the spots remain flat If the spots do not apply smoothly that is if bumps bubbles tears or curled edges are observed do not attempt to smooth out the spot Remove the spot and apply a new spot See Figure 5 2 Figure 5 2 Applying Tough Spots to the probe array cartridge 150 GeneChip Mapping 500K Assay Manual 3 Insert the cartridge into the scanner and test the autofocus to ensure the spots do not interfere with the focus If a focus error message is observed remove the spot and apply a new spot Ensure that the spots lie flat SCANNING THE PROBE ARRAY NOTE WARNING a Customers using the Autoloader should refer to the Autoloader User s Guide 1 Select Run Scanner from the menu bar Alternatively click the Start Scan icon in the tool bar The Scanner dialog box appears with a drop down list of all unscanned experiments 2 Select the experiment name that corresponds to the probe array being scanned A previously run experiment can also be selected by using the Include Scanned Experiments option box After selecting this option previously scanned experiments appear in the drop down list If the experiment name is not seen in the scanner dialog box open the workflow
180. nstructions for washing staining and scanning arrays and generating genotype calls as well as extensive troubleshooting information A description of each chapter follows Chapter 1 Scientific Overview A description of the overall concept behind the GeneChip Mapping assay including the biochemical process data generation potential applications and a list of references Chapter 2 Laboratory Setup An explanation of the appropriate laboratory configuration for running GeneChip Mapping 500K experiments including how to set up a workflow to minimize the possibility of carryover contamination Chapter 3 Genomic DNA Preparation The requirements for genomic DNA with recommended sources and methods for purification and quantitation Chapter 4 96 Well Plate Protocol Detailed step by step protocol for processing a full 96 well plate of human genomic DNA samples Chapter 5 Washing Staining and Scanning Basic protocols for fluidics station and scanner operation Chapter 6 Fluidics Station Maintenance Procedures Describes a weekly fluidics station bleach protocol and a monthly fluidics station decontamination protocol Chapter 7 Analysis Workflow and Guidelines for Assessing Sample and Data Quality Describes the analysis workflow in GeneChip Operating Software GCOS and GeneChip Genotyping Analysis Software GTYPE and provides information for assessing data quality Chapter 8 Troubleshooting Additional guidelines
181. ntech Clean Up Plate e Maintain the vacuum at 600 mbar chapter 4 96 Well Plate Protocol 77 The PCR reactions contain significant contaminants including EDTA These contaminants can affect subsequent steps unless removed by washing Therefore be sure to perform three water washes After the third wash the wells must be completely dry before eluting the samples with RB Buffer Any extra water carried with the RB Buffer to the next stage can result in over fragmentation e Immediately upon removal from the manifold blot the bottom of the plate and wipe the bottom of each well Any remaining liquid will quickly seep back into the wells PREPARE THE REAGENTS CONSUMABLES AND OTHER COMPONENTS Prepare the PCR Product Plates To prepare the PCR Product Plates from the previous stage 1 Place the three PCR product plates on the bench top in plate holders If frozen allow them to thaw to room temperature 2 Once at room temperature vortex the center of each plate at high speed for 3 sec 3 Spin down each plate at 2000 rpm for 30 sec Dilute the Working Solution of EDTA Dilute the working stock of EDTA to a concentration of 0 1 M A higher concentration may interfere with downstream steps Setup the Manifold To set up the manifold 1 Connect the manifold and regulator to a suitable vacuum source able to maintain 600 mbar 2 Place the waste tray inside the base of the manifold Do not turn on the vacuum a
182. oekelsci com Cambrex www cambrex com CLP Direct www clpdirect com Clontech www clontech com clontech Diversified Biotech www divbio com E amp K Scientific www eandkscientific com Eppendorf www eppendorf com Fisher Scientific www fisherscientific com Invitrogen Life Technologies www invitrogen com ISC BioExpress www bioexpress com Labcor www labcorproducts com Molecular Devices www moleculardevices com New England Biolabs www neb com Pierce Biotechnology www piercenet com Promega www promega com QIAGEN www qiagen com Rainin www rainin com Sigma Aldrich www sigma aldrich com 236 GeneChip Mapping 500K 96 Well Plate Protocol Table A 10 Supplier Contact List Stratagene www stratagene com Takara Bio Inc www takara bio com Teknova www teknova com VWR www vwrsp com a Pee 2 He da anal a a H Thermal Cycler Programs Appendix B 239 Thermal Cycler Programs ABOUT THIS APPENDIX This appendix includes the thermal cycler programs required for the GeneChip Mapping 500K protocols Before you begin processing samples enter and save the programs into the appropriate thermal cyclers 500K DIGEST Required for the 96 well plate and the low throughput protocol 500K Digest Program Temperature Time 37 C 120 minutes 65 C 20 minutes 4 C Hold 500K LIGATE Required for
183. of X 3 Using a single channel P100 pipette add the calculated volume of purified PCR product the value of Y to the corresponding well with RB Buffer The total volume of each well is now 45 pL After normalization each well should contain 90 pg of purified PCR product in a volume of 45 pL or 2 pg pL 4 Seal the plate with adhesive film Vortex the center of the plate at high speed for 3 sec chapter 4 96 Well Plate Protocol 95 6 Spin down the plate at 2000 rpm for 30 sec and place back in the cooling chamber IMPORTANT F Because the DNA concentration in each sample is different the volume transferred to each well will differ For optimal performance it is critical that the contents of each well be normalized to 2 pg of DNA pL before proceeding to the next step WHAT YOU CAN DO NEXT Do one of the following Proceed immediately to the next step If not proceeding immediately to the next step A Seal the plate with the eluted samples B Store the plate at 20 C 96 GeneChip Mapping 500K Assay Manual Stage 7 Fragmentation ABOUT THIS STAGE During this stage the purified normalized PCR products will be fragmented using Fragmentation Reagent You will first dilute the Fragmentation Reagent by adding the appropriate amount of Fragmentation Buffer and AccuGENE water You will then quickly add the diluted reagent to each reaction place the plate onto a thermal cycler and run the 5
184. of fragmentation is critical Perform this stage carefully to ensure uniform reproducible fragmentation The Fragmentation Reagent is extremely temperature sensitive It rapidly loses activity at higher temperatures To avoid loss of activity Dilute the Fragmentation Reagent immediately prior to use Keep at 20 C until ready to use Transport and hold in a 20 C cooler Return to the cooler immediately after use Perform these steps rapidly and without interruption The Fragmentation Reagent DNase I may adhere to the walls of some microfuge tubes and 96 well plates To ensure the accurate amount of DNase I in the fragmentation reaction Stage 7 Fragmentation the strip tubes used for this stage must be cut from Bio Rad 96 well unskirted PCR plates P N MLP 9601 See Cutting Strip Tubes From Plates on page 41 and Table 4 1 on page 40 for more information on these plates The Fragmentation Reagent is viscous and requires extra care when pipetting Follow these guidelines When aspirating allow enough time for the correct volume of solution to enter the pipette tip Avoid excess solution on the outside of the pipette tip Be sure to use the AccuGENE water listed in Appendix A Using in house ddH20 or other water can negatively affect your results The reaction in Stage 7 Fragmentation is particularly sensitive to pH and metal ion contamination All additions dilutions and mixing must be performed on ice
185. ol oligonucleotides Each hybridization control oligonucleotide is present in the hybridization mix at determined concentrations ranging from 0 033 pM to 1 0 pM The median signals generated from the control oligos are reported in the rpt files The relative intensities for each oligonucleotide should correlate with the respective spike concentration The exact signal value reported for each oligonucleotide is not significant but each oligo should be detected and the signals reported should be linear relative to the spike in controls If they are not detected or do not form a roughly linear response this may indicate a problem in the washing and staining procedure See Chapter 8 Troubleshooting for further information SAMPLE MISMATCH REPORT To prevent mistakes that can commonly occur when working with large genotyping data sets GTYPE incorporates a new function to prevent sample mismatch The Sample Mismatch Report identifies chp files that are potentially labeled incorrectly resulting from duplicate files sample labeling errors or other problems This function is particularly powerful as a method to analyze large data sets in batch and may be used in conjunction with File Sets for additional flexibility The Sample Mismatch Report utilizes a set of 50 SNP probe sets that are shared across the Mapping 250K Nsp and Sty arrays The Sample Mismatch Report also allows for cross checking previous generations of Mapping arrays The Sample Misma
186. om In addition the following areas should be used when performing this assay pre PCR Clean Room PCR Staging Room and Main Lab A summary of the areas is shown in Figure 2 1 Once you enter the Main Lab do not return to the Pre PCR Room or the PCR Staging Room until you have showered and changed into freshly laundered clothing Room The Pre PCR Clean Room or dedicated area such as a biosafety hood should be free of DNA template and PCR amplicons The master stocks of PCR primer and adaptor should be stored here with aliquots taken for use in the PCR Staging Room or area Reagent preparation tasks such as preparing master mixes should be done in this room The use of gowns booties and gloves is strongly recommended to prevent PCR carryover and to minimize the risk of trace levels of contaminants being brought into the Pre PCR Clean Area This room should contain dedicated pipets tips vortex etc Refer to Appendix A or Appendix D as appropriate for more details PCR Staging Room IMPORTANT The PCR Staging Room or Area is a low copy template lab which should be free from any PCR product amplicons It is the area where non amplified template genomic DNA should be handled The digestion and ligation reactions should be conducted in this area The PCR reactions should be prepared in this area The use of gowns booties and gloves is recommended to prevent PCR carryover Each room should contain dedicated e
187. ommended In the first filter samples are included only if the call rate is greater than 93 at a 0 33 confidence score when using high quality DNA see Chapter 3 Those filtered samples are then evaluated in a secondary SNP filter where any SNP with less than an 85 call rate across samples is eliminated from the analysis These two filters together should result in a high quality set of samples and SNPs for use in downstream analysis Studies on multiple 500K data sets have shown that SNPs with a lower per SNP call rate tend to have a higher error rate and disproportionately contribute to the overall error rate in the experiment Consider taking additional steps to identify and eliminate sporadic genotype errors Steps may include eliminating SNPs out of Hardy Weinberg equilibrium in control samples from the population or eliminating genotypes showing Mendel inconsistency or unlikely genotypes GTYPE has functionality to identify SNPs showing Mendelian or Hardy Weinberg errors in user defined samples These genotyping errors can be filtered out upon data export Please consult the GeneChip Genotyping Analysis Software User s Guide for more information Adjust the Default Value to Increase or Decrease Accuracy and Call Rate GTYPE 4 0 software provides flexible options to enable a trade off between Call Rate and genotyping accuracy The Dynamic Model Mapping Algorithm uses the Wilcoxon Signed Rank Test to assign a confidence score meas
188. oncordance between two samples The Reference Genomic DNA 103 included in the GeneChip Mapping 250K Assay Kits can be used for this purpose The calls generated from the reference DNA should be gt 99 concordant with the reference calls The following method allows users to quickly assess the concordance of their data with the reference calls Microsoft Excel is limited to a maximum of 65 536 rows Because your data will exceed this number Microsoft Excel will give you a warning when you paste in your data 1 Open the reference and experimental Genotype calls in GTYPE A Sort the calls in ascending order on the SNP ID B Check that the SNP IDs match 2 Copy and paste the calls from GTYPE and paste into Microsoft Excel Create a header row Table 7 3 Columns used to calculate concordance Excel Column Header A Reference DNA SNP ID B Reference DNA call C Test DNA call D Concordance check E No call F Valid concordant SNP chapter 7 Analysis Workflow 205 3 Create column called concordance check This column will contain a 1 if the two genotype calls match and a 0 if they do not A Enter the following formula IF B2 C2 1 0 B Auto fill down the column 4 Create a second Column Called No Call This column will contain TRUE if either call column contains a NC A Enter the following formula OR B2 NoCall C2 NC B Auto fill down the column
189. opy number alterations and population sub structure Estimates for the number of SNPs that need to be genotyped for whole genome association studies using large population based samples range from 100 000 to 1 000 000 depending on the disease population or number of samples being studied 63 66 In order to leverage the power of SNPs in genetic studies we have developed a DNA target preparation method that when combined with allelic discrimination via hybridization and with an automated genotype calling algorithm 67 allows rapid and accurate genotypic information at a fraction of the cost of current approaches The Mapping 500K Set thus provides a powerful flexible cost effective approach for scoring SNP genotypes in large numbers of samples and will provide a new technological paradigm for the design of whole genome association studies chapter 1 Overview NspI NspI Nsp I Y Y Y Genomic DNA RE digestion oOo Denaturation and Fra maa End labeling b po All Sizes b b b sl Se Hybridization PCR Staining Adaptor ligation Scanning Set conditions S to amplify ma 200 1 100 bp _ fragments ie EE an EEE San _ Gaz hrnwshb bjj hjjLj jh h kxa Figure 1 1 GeneChip Mapping Assay Nsp Sty I Sty I Sty I CEEE Y v Se Ei Genomic DNA RE digestion Denaturation and Fragmentation End labeling b All Sizes Tel
190. os WashA for 4 seconds Sense Threshold 820 600 for 4 seconds 176 GeneChip Mapping 500K Assay Manual OTHER PROBLEMS AND SOLUTIONS Table 6 5 lists other problems causes and solutions that may be encountered Table 6 5 Other Problems Problem Air bubbles left in cartridge at the end of a hybridization wash script Buffer leaking inside the fluidics station Possible Cause Air bubble in wash line Loose tubing attachments inside the fluidics station Washblock requires replacement Salt buildup in the lines of the fluidics station Solution Consult Chapter 5 for information specific to array type Call Affymetrix Technical Support for service Call Affymetrix Technical Support for service Run the Clean or Prime script with fresh DI water to flush out salt blockage Cartridge needles of the fluidics station not engaging with the cartridge Possible defective septa on the cartridge Extra flashing on the cartridge Salt buildup on the cartridge needles Cartridge holder aligned and attached to the fluidics station improperly Cartridge holder not properly engaged to the fluidics station Use another cartridge Use another cartridge or call Affymetrix Technical Support for service Run the Clean script with fresh DI water to flush out salt blockage Clean cartridge needles with a wet cotton swab Call Affymetrix Technical Support for service Place the
191. ott R Metspalu A Bentley D R Cardon L R Dunham I A first generation linkage disequilibrium map of human chromosome 22 Nature 418 544 8 2002 Phillips M S Lawrence R Sachidanandam R Morris A P Balding D J Donaldson M A Studebaker J F Ankener W M Alfisi S V Kuo F S Camisa A L Pazorov V Scott K E Carey B J Faith J Katari G Bhatti H A Cyr J M Derohannessian V Elosua C Forman A M Grecco N M Hock C R Kuebler J M Lathrop J A Mockler M A Nachtman E P Restine S L Varde S A Hozza M J Gelfand C A Broxholme J Abecasis G R Boyce Jacino M T Cardon L R Chromosome wide distribution of haplotype blocks and the role of recombination hot spots Nat Genet 33 382 7 2003 Kennedy G C Matsuzaki H Dong S Liu W M Huang J Liu G Su X Cao M Chen W Zhang J Liu W Yang G Di X Ryder T He Z Surti U Phillips M S Boyce Jacino M T Fodor S P Jones K W Large scale genotyping of complex DNA Nat Biotechnol 21 1233 7 2003 Matsuzaki H Loi H Dong S Tsai Y Y Fang J Law J Di X Liu W M Yang G Liu G Huang J Kennedy G C Ryder T B Marcus G Walsh P S Shriver M D Puck J M Jones K W Mei R Parallel genotyping of over 10 000 SNPs using a one primer assay on a high density oligonucleotide array Genome Res 14 414 25 2004 Sellick G S Longman C Tolmie
192. p Mapping 500K Assay Manual ASSAY OVERVIEW y Scanning Nsp Sty Genomic DNA Genomic DNA y y Nsp I Digestion 2 5 hrs Sty I Digestion Y Y Ligation 3 5 hrs Ligation y bi i Y pitution Pre PCR Clean Area PCR Staging Area Dilution y Main Lab y PCR PCR EEE r PCR PCR PCR 2 5 hrs PCR PCR PCR Purify 3 hrs Purify Fragmentation 0 75 hr Fragmentation Labeling 4 25 hrs Labeling i ore re BEN Hybridization 16 hrs Hybridization Y Washing amp Staining 2 hrs Washing amp Staining y Scanning Figure C 1 GeneChip Mapping 500K Assay Overview appendix C Low Throughput Protocol 247 BEFORE YOU BEGIN The Mapping 500K low throughput protocol includes the thermal cycler programs listed below Before you begin processing samples enter and store these programs on the thermal cyclers that will be used for this protocol Thermal cycler program details are listed in Appendix B Thermal Cycler Programs Table C 1 Thermal Cycler Programs Required for the Low Throughput Protocol Program Name of Thermal Cyclers Laboratory Required based on 96 sample throughput 500K Digest 1 Pre PCR Clean Area 500K Ligate 1 Pre PCR Clean Area 500K PCR 3 Main Lab 500K Fragment 1 Main Lab 500K Label 1 Main Lab 248 GeneChip Mapping 500K Assay Manual Genomic DNA Preparation PREPARATION OF GENOMIC DNA IMPORTANT H
193. per R Ward R Lander E S Daly M J Altshuler D The structure of haplotype blocks in the human genome Science 296 2225 9 2002 Carlson C S Eberle M A Rieder M J Yi Q Kruglyak L Nickerson D A Selecting a maximally informative set of single nucleotide polymorphisms for association analyses using linkage disequilibrium Am J Hum Genet 74 106 20 2004 Mueller J C Lohmussaar E Magi R Remm M Bettecken T Lichtner P Biskup S Illig T Pfeufer A Luedemann J Schreiber S Pramstaller P Pichler I Romeo G Gaddi A Testa A Wichmann H E Metspalu A Meitinger T Linkage disequilibrium patterns and tagSNP transferability among European populations Am J Hum Genet 76 387 98 2005 Di X Matsuzaki H Webster T A Hubbell E Liu G Dong S Bartell D Huang J Chiles R Yang G Shen M M Kulp D Kennedy G C Mei R Jones K W Cawley S Dynamic model based algorithms for screening and genotyping over 100K SNPs on oligonucleotide microarrays Bioinformatics 21 1958 63 2005 18 GeneChip Mapping 500K Assay Manual Chapter 2 Labora ory Setup Chapter 2 IMPORTANT IMPORTANT Hi IMPORTANT Hi 21 Introduction to Laboratory Setup Please read this chapter before planning any experiments The GeneChip Human Mapping 500K Array Set has been optimized to reliably and accurately detect greater than 500 000 SNP
194. phisms in the human genome Science 280 1077 82 1998 Kruglyak L Nickerson D A Variation is the spice of life Nat Genet 27 234 6 2001 Gibbs R A Belmont J W Hardenbol P Willis T D Yu F Yang H Ch ang L Y Huang W Liu B Shen Y al e The International HapMap Project Nature 426 789 96 2003 Sachidanandam R Weissman D Schmidt S C Kakol J M Stein L D Marth G Sherry S Mullikin J C Mortimore B J Willey D L Hunt S E Cole C G Coggill P C Rice C M Ning Z Rogers J Bentley D R Kwok P Y Mardis E R Yeh R T Schultz B Cook L Davenport R Dante M Fulton L Hillier L Waterston R H McPherson J D chapter 1 Overview 9 10 11 12 13 14 15 16 17 Gilman B Schaffner S Van Etten W J Reich D Higgins J Daly M J Blumenstiel B Baldwin J Stange Thomann N Zody M C Linton L Lander E S Altshuler D A map of human genome sequence variation containing 1 42 million single nucleotide polymorphisms Nature 409 928 33 2001 Syvanen A C Toward genome wide SNP genotyping Nat Genet 37 Suppl S5 10 2005 Ardlie K G Kruglyak L Seielstad M Patterns of linkage disequilibrium in the human genome Nat Rev Genet 3 299 309 2002 Hinds D A Stuve L L Nilsen G B Halperin E Eskin E Ballinger D G Frazer K A Cox D R Whole genome patterns of common DNA variat
195. products are run on a 2 agarose gel product bands should be visible in the 200 to 1 100 bp size range See Figure 4 3 on page 73 Following fragmentation run samples on a 4 agarose gel Successful fragmentation is confirmed by the presence of a smear of less than 200 bp in size shown in Figure 4 7 on page 106 8 Run controls in parallel with each group of samples Substitute water for DNA at the PCR step as a negative control The absence of bands on your PCR gel for this control confirms no previously amplified PCR product has contaminated your samples The Reference Genomic DNA 103 is supplied as a positive control in the assay kits This is an effective troubleshooting tool confirming all individual steps have been successful completed 9 Oligonucleotide controls are included in the assay kit these are added to the target samples prior to hybridization and act to confirm successful hybridization washing staining and sensitivity of the array The oligonucleotide control reagents contain oligo B2 which is used for grid alignment chapter 8 Troubleshooting 213 10 11 For the 96 well plate protocol we highly recommend all mutlichannel pipettes be calibrated regularly For the 96 well plate protocol we recommend using a team approach to sample processing for greater efficiency This approach is described on page 37 Important Differences Between GeneChip Mapping Arrays and GeneChip Expression Arrays 1
196. quipment such as thermocyclers microfuges pipets tips etc chapter 2 Laboratory Setup 23 Main Lab The Main Lab has airborne contamination with PCR product and template After entering the main lab it is inadvisable to re enter the Pre PCR Clean Area or the PCR Staging Area without first showering and changing into freshly laundered clothes Template Genomic DNA PCR Product Pre PCR Clean Room Assay Steps Step 1 Reagent Preparation PCR Staging Room Assay Steps Step 2 Enzyme Digestion Step 3 Ligation Step 4 PCR set up only Main Lab Assay Steps Step 4 PCR Thermal Cycling Step 5 PCR Clean up Step 6 Fragmentation Step 7 Labeling Step 8 Hybridization Step 9 Wash and Stain Figure 2 1 A summary of rooms required to perform the GeneChip Mapping 500K Assay 24 GeneChip Mapping 500K Assay Manual Safety Precautions WARNING A The GeneChip Mapping 250K Assay Kits as well as the GeneChip 250K Nsp Array and the GeneChip 250K Sty Array are for research use only All blood and other potentially infectious materials should be handled as if capable of transmitting infection and disposed of with proper precautions in accordance with federal state and local regulations Some components required for this assay may pose significant health risks Follow prudent laboratory practices when handling and disposing of carcinogens and toxins Refer to the manufact
197. r 10X 10 uL 3 312 mL GC Melt 5M 20 uL 6 624 mL dNTP 2 5 mM each 14 uL 4 637 mL PCR Primer 002 100 uM 4 5 uL 1 490 mL TITANIUM Taq DNA Polymerase 50X 2 uL 0 663 mL Total 90 pL 29 808 mL ADD PCR MASTER MIX TO SAMPLES Location PCR Staging Area Procedure To add PCR Master Mix to samples 1 Using a 12 channel P200 pipette add 90 pL PCR Master Mix to each sample The total volume in each well is 100 pL Seal each reaction plate tightly with adhesive film Vortex the center of each reaction plate at high speed for 3 sec Spin down the plates at 2000 rpm for 30 sec a F wD Keep the reaction plates in cooling chambers on ice until loaded onto the thermal cyclers 70 GeneChip Mapping 500K Assay Manual LOAD PCR PLATES ONTO THERMAL CYCLERS IMPORTANT Hi PCR protocols for the MJ Tetrad PTC 225 and Applied Biosystems thermal cyclers are different See Table 4 17 and Table 4 18 below Location Main Lab Procedure To load the plates and run the 500K PCR program 1 Transfer the reaction plates to the Main Lab 2 Ensure that the thermal cycler lids are preheated The block should be at room temperature Load each reaction plate onto a thermal cycler Run the 500K PCR program The program varies depending upon the thermal cyclers you are using See Table 4 17 for Applied Biosystems thermal cyclers and Table 4 18 for Bio Rad thermal cyclers IMPORTANT Hi If using GeneAmp PCR System 9700 th
198. r Devices Plus 84 Thermal Cyclers see Table A 7 on page 232 Timers required only if using tubes for 4 _ _ Main Lab Stage 9 Target Hybridization Vacuum regulator 1 QIAGEN 19530 Main Lab Protocol requires 600 mb vacuum If your lab does not have an internally regulated vacuum source this regulator is strongly recommended Vortexer for plates and tubes 2 VWR 58816 12 Pre PCR and Main Lab 232 GeneChip Mapping 500K 96 Well Plate Protocol THERMAL CYCLERS PCR PLATES AND PLATE SEALS The 96 well plate protocol has been optimized using the following thermal cyclers PCR plate and adhesive film IMPORTANT Hi Use only the PCR plate adhesive film and thermal cyclers listed in Table A 7 Using other PCR plates and film that are incompatible with the thermal cycler can result in crushed tubes loss of sample or poor results Table A 7 Thermal Cyclers PCR Plates and Plate Seals Optimized for Use With the Mapping 500K 96 Well Plate Protocol Area Thermal Cyclers Plate Cover MAT TEL CIBE 2720 Thermal Cycler or GeneAmp PCR Pre PCR System 9700 by Multiplate 96 Well Unskirted MicroAmp Clear Adhesive Applied Biosystems PCR Plates Films Bio Rad P N MLP 9601 Applied Biosystems MJ Tetrad PTC 225 P N 4306311 by Bio Rad GeneAmp PCR System 9700 by Applied Biosystems Multiplate 96 Well Unskirted MicroAmp Clear Adhesive PCR and Post PCR silver block or gold PCR Plates Films plated si
199. rms a Cleanout procedure The LCD window indicates the progress of the Cleanout procedure 3 When the fluidics station LCD window indicates REMOVE VIALS the Cleanout procedure is complete 4 Remove the sample microcentrifuge vial s from the sample holder s 5 If no other processing is to be performed place wash lines into a bottle filled with deionized water 6 Choose Shutdown_450 for all modules from the drop down Protocol list in the Fluidics Station dialog box Click the Run button for all modules The Shutdown protocol is critical to instrument reliability Refer to the appropriate Fluidics Station User s Guide for more information 7 After Shutdown protocol is complete flip the ON OFF switch of the fluidics station to the OFF position 8 Place buffer lines in a different bottle of deionized water than the one used for the shutdown protocol IMPORTANT Hi To maintain the cleanliness of the fluidics station and obtain the highest quality image and data possible a weekly bleach protocol is highly recommended Chapter 6 Flui Chapter 6 155 Introduction This chapter provides instructions on caring for and maintaining the instrument and on troubleshooting if problems arise INSTRUMENT CARE IMPORTANT FT Use a surge protector on the power line to the fluidics station Always run a Shutdown protocol when the instrument will be off or unused overnight or longer This will
200. rogram is finished A Remove the plate from the thermal cycler B Spin down the plate at 2000 rpm for 30 sec and place in a cooling chamber on ice 2 Dilute 4 pL of each fragmented PCR product with 4 pL gel loading dye 3 Run on 4 TBE gel with the BioNexus All Purpose Hi Lo ladder at 120V for 30 minutes to 1 hour 4 Inspect the gel and compare it against the example shown in Figure 4 7 below Figure 4 7 Typical example of fragmented PCR products run on 4 TBE agarose gel at 120V for 30 minutes to 1 hour Average fragment size is lt 180 bp chapter 4 96 Well Plate Protocol 107 Stage 8 Labeling ABOUT THIS STAGE During this stage the fragmented samples will be labeled using the GeneChip DNA Labeling Reagent You will prepare the Labeling Master Mix add the mix to each sample place the samples onto a thermal cycler and run the 500K Label program LOCATION AND DURATION e Main Lab e Hands on time 30 minutes 500K Label thermal cycler program time 4 25 hours INPUT REQUIRED FROM PREVIOUS STAGE The input required from Stage 7 Fragmentation is Quantity Item 1 Plate of fragmented DNA EQUIPMENT AND CONSUMABLES REQUIRED The following equipment and consumables are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information IMPORTANT Hi Use only the PCR plate adhesive film
201. rs have not been verified at Affymetrix In some cases we have seen lower performance when using non recommended vendors appendix D Reagents Instruments and Supplies Required for Low Throughput Protocol 287 Reagents and Instruments Required The following reagents and equipment are required to process the GeneChip Mapping 500K Array Set Table D 1 Reagents Supplied by Affymetrix 30 Reaction Kit Affymetrix GeneChip Mapping 250K Nsp Assay Kit P N 900766 This kit includes sufficient reagent for 30 arrays Component Volume Concentration Description Adaptor Nsp 25 uL 50 uM Two annealed oligonucleotides 1 specific for ligation to Nsp restriction site PCR Primer 002 450 uL 100 uM PCR primer to amplify ligated genomic 1 DNA Reference Genomic DNA 30 uL 50 ng uL Human genomic DNA single source 2 103 GeneChip 25 uL See label on tube DNase enzyme formulated to 3 Fragmentation Reagent fragment purified PCR amplicons 10X Fragmentation Buffer 250 uL 10X Buffer for fragmentation reaction 3 GeneChip DNA Labeling 60 jL 30 mM Biotin labeled reagent for end labeling 3 Reagent 30 mM fragmented PCR amplicons Terminal 105 uL 30 U uL Enzyme used to end label fragmented 3 Deoxynucleotidy PCR amplicons with the GeneChip Transferase DNA Labeling Reagent 30 mM 5X Terminal 420 uL 5X Buffer for labeling reactio 3 Deoxynucleotidyl Transferase Buffer Oligo Control Reagent 60 uL See protocol Mixture of fi
202. ry the wells completely approximately 20 minutes Repeat this step 2 additional times for a total of 3 water washes Switch off vacuum source and release the vacuum Carefully remove the Clean Up Plate from the vacuum manifold and immediately A Blot the plate ona stack of clean absorbent paper to remove any liquid that might remain on the bottom of the plate B Dry the bottom of each well with an absorbent wipe To remove all remaining liquid blot and wipe the bottom of the Clean up Plate immediately after taking it off the vacuum manifold Any water retained underneath the plate may be absorbed back into the wells 10 Add 45 pL RB buffer to each well Cover the plate with PCR plate cover film and seal tightly Moderately shake the Clean Up Plate on a plate shaker e g Jitterbug Boekel Scientific model 130000 for 10 minutes at room temperature Recover the purified PCR product to a fresh 96 well plate by pipetting the eluate out of each well and transferring it to the corresponding well in the fresh 96 well plate For easier recovery of the eluates the plate can be held at a slight angle 266 GeneChip Mapping 500K Assay Manual STEP 6 Quantification of Purified PCR Product IMPORTANT Hi IMPORTANT Hi TIP El The spectrophotometer should be calibrated regularly to ensure correct readings Due to the high PCR yield the accuracy of the O D measurement is critical Carefully follow the step
203. s Required 118 Important Information About This Stage 118 Prepare the Reagents Consumables and Other Components 120 Preheat the Heat Blocks 121 Prepare the Arrays 122 Prepare the Hybridization Master Mix 122 Hybridizing Samples Using a Thermal Cycler 124 Hybridizing Samples Using Heat Blocks 130 Washing Staining and Scanning Arrays 133 INTRODUCTION 135 REAGENTS AND MATERIALS REQUIRED 136 REAGENT PREPARATION 137 EXPERIMENT AND FLUIDICS STATION SETUP 139 Step 1 Registering a New Experiment in GCOS 139 Step 2 Preparing the Fluidics Station 140 PROBE ARRAY WASH AND STAIN 142 Washing and Staining the Probe Array Using FS 450 146 PROBE ARRAY SCAN 148 Handling the GeneChip Probe Array 149 Scanning the Probe Array 150 SHUTTING DOWN THE FLUIDICS STATION 152 Fluidics Station Care and Maintenance 153 INTRODUCTION 155 Instrument Care 155 Instrument Maintenance 155 FLUIDICS STATION BLEACH PROTOCOL 156 The Bleach Cycle 156 The Rinse Cycle 162 CHAPTER 7 viii GeneChip Mapping 500K Assay Manual TROUBLESHOOTING AND ASSISTANCE 168 Troubleshooting Decision Tree 168 Problems and Solutions 171 Meaning of Error Messages 174 Other Problems and Solutions 176 Instrument Specifications 178 Analysis Workflow 179 INTRODUCTION 181 SOFTWARE REQUIREMENTS 181 ANALYSIS WORKFLOW 181 ANALYSIS 182 Output 184 Report 186 GTYPE Additional Functionality 188 Import Sample Attributes 188 File Sets 189 Examining the Raw Probe Data 190 Export 190
204. s below and be sure the O D measurement is within the linear range of the instrument Prepare at least three independent dilutions of each sample for accurate concentration measurement Average the results before proceeding 1 Use spectrophotometric analysis to determine the purified PCR product yield If available a plate reader is preferred for efficient DNA concentration determination 2 Add 2 pL of the purified PCR product to 198 pL molecular biology grade water 100 fold dilution and MIX WELL 3 Read the absorbance at 260 nm Ensure that the reading is in the quantitative range of the instrument generally 0 2 to 0 8 OD 4 Apply the convention that 1 absorbance unit at 260 nm equals 50 pg mL for double stranded PCR product This convention assumes a path length of 1 cm Consult your spectrophotometer handbook for further information 5 For fragmentation A Transfer 90 pg of each of the purified DNA samples to the corresponding wells of a new plate B Bring the total volume of each well up to 45 pL by adding the appropriate volume of RB Buffer C Cover the plate with PCR plate cover film and seal tightly D Vortex at medium speed for 2 seconds and spin down at 2000 rpm for 1 minute appendix C Low Throughput Protocol 267 imPORTANT E The amount of DNA in each well will differ For optimal performance it is critical that the contents of each well be normalized to 2 ug of DNA uL before pro
205. s in each sample The assay reduces the complexity of the genome by preferentially amplifying approximately 200 1100 base pair bp Nsp I fragments and approximately 200 1100 bp Sty I fragments using a single PCR primer from only 250 ng DNA per restriction enzyme As with all genotyping applications care should be taken to minimize possible sources of contamination that would reduce genotyping accuracy call rate and consequently genetic power To reduce the possibility of cross contamination Affymetrix recommends maintaining a single direction workflow The GeneChip Human Mapping 250K Nsp assay and the GeneChip Human Mapping 250K Sty assay should be performed separately to avoid sample mix up The most likely potential source of contamination for the GeneChip Mapping 500K Assay is previously amplified PCR product Maintain an ambient laboratory environment throughout the procedure Steps should be taken to minimize the possibility of contaminating pre PCR steps with amplified PCR product Suggested precautions include e Store reagents in proper room according to the box label and manual instructions Restrict movements through labs containing amplified DNA Use proper gowning procedures IMPORTANT Hi Pre PCR Clean 22 GeneChip Mapping 500K Assay Manual e Use dedicated equipment e g pipets tips thermocyclers etc for pte PCR stages Print separate copies of the protocol for each ro
206. s not 2 or 3 U pL use the formula below to calculate the dilution required to bring the reagent to a final concentration of 0 05 U pL Formula Where Y X 0 05 U uL 600 uL Y 0 05 U uL 600 uL X U uL number of uL of stock Fragmentation Reagent number of U of stock Fragmentation Reagent per uL per label on tube final concentration of Fragmentation Reagent final volume of diluted Fragmentation Reagent enough for 96 reactions 4 Dilute the Fragmentation Reagent to 0 05 U pL as follows using the recipes in Table 4 30 or the dilution formula calculation A To the 1 5 mL Eppendorf tube on ice 1 Add the AccuGENE water and Fragmentation Buffer 104 GeneChip Mapping 500K Assay Manual 2 Allow to cool on ice B Remove the Fragmentation Reagent from the freezer and 1 Immediately pulse spin for 3 sec Spinning is required because the Fragmentation Reagent tends to cling to the top of the tube making it warm quicker 2 Immediately place in a cooler C Add the Fragmentation Reagent to the 1 5 mL Eppendorf tube D Vortex the diluted Fragmentation Reagent at high speed 3 times 1 sec each time E Pulse spin for 3 sec and immediately place on ice 5 Proceed immediately to the next set of steps Add Diluted Fragmentation Reagent to the Samples Add Diluted Fragmentation Reagent to the Samples To add diluted Fragmentation Reagent to the samples 1 Quickly and on ice aliquot 50 pL of dilute
207. s similar performance with the same progams Affymetrix has not tested the newer version N appendix C Low Throughput Protocol 259 PCR PROCEDURE IMPORTANT ma The PCR reaction is sensitive to the concentration of primer used It is critical that the correct amount of primer is added to the PCR reaction to achieve the correct distribution of fragments 200 to 1100 base pairs in the products Check the PCR reactions on a gel to ensure that the distribution is correct see Figure C 2 PRE PCR CLEAN ROOM 1 Prepare the following PCR Master Mix ON ICE 3 PCR reactions per sample for Nsp I or Sty I ligation reactions and vortex at medium speed for 2 seconds for multiple samples make a 5 excess Table C 7 Stock Reagent 1PCR 3 PCR Final Conc in Sample HO 39 5 uL 118 5 uL Clontech TITANIUM Taq 10 uL 30 uL 1X PCR Buffer 10X G C Melt 5 M 20 uL 60 uL 1M dNTP 2 5 mM each 14 uL 42 uL 350 uM each PCR Primer 002 100 uM 4 5 uL 13 5 uL 4 5 uM Clontech TITANIUM Taq 2 uL 6 uL 1X DNA Polymerase 50X Total 90 uL 270 uL NOTE 90 ug of PCR product is needed for fragmentation NOTE IMPORTANT Hi 260 GeneChip Mapping 500K Assay Manual A PCR negative control can be included in the experiment to assess the presence of contamination Refer to Chapter 2 and Chapter 7 for more information Prepare fresh PCR Master Mix just prior to use PCR STAGING AREA
208. side up 2 Mark each array with a meaningful designation e g a number to ensure that you know which sample is loaded onto each array 3 Allow the arrays to warm to room temperature by leaving on the bench top 10 to 15 minutes 4 Insert a 200 pL pipette tip into the upper right septum of each array WARNING a To ensure that the data collected during scanning is associated with the correct sample number the arrays in a meaningful way It is critical that you know which sample is loaded onto each array PREPARE THE HYBRIDIZATION MASTER MIX As an option you can prepare a larger volume of Hybridization Master Mix than required The extra mix can be aliquoted and stored at 20 C for up to one week Preparing Fresh Hybridization Master Mix To prepare the Hybridization Master Mix 1 To the 50 mL centrifuge tube add the reagents in the order shown in Table 4 37 DMSO addition pipette directly into the solution of other reagents Avoid pipetting along the side of the tube 2 Mix well 3 If making a larger volume aliquot out 20 9 mL and store the remainder at 20 C for up to one week chapter 4 96 Well Plate Protocol 123 Table 4 37 Hybridization Master Mix 96 Arrays 15 extra Reagent MES 12X 1 25 M 1320 uL Denhardt s Solution 50X 13 uL 1430 uL EDTA 0 5 M 3 uL 330 uL HSDNA 10 mg mL 3 uL 330 uL OCR 0100 2 uL 220 uL Human Cot 1 DNA
209. t 600 mbar until all of the wells are dry approximately 1 5 to 2 hours The vacuum regulator may sound like it is leaking This sound is the pressure release working to limit the vacuum to 600 mbar 6 Wash the PCR products three times as follows keeping the vacuum on the entire time A Add 75 mL AccuGENE Water to a solution basin B Using a 12 channel P200 pipette add 50 pL water to each well C Dry the wells for 15 to 20 minutes The top and bottom rows may take longer to filter and dry D Repeat steps B and C two additional times for a total of 3 water washes 7 After the third wash tap the manifold firmly on the bench to force any drops on the sides of the wells to move to the bottom and be pulled through the plate 8 Allow the samples to dry completely Drying after the third wash may take 45 to 75 minutes 9 Tilt and inspect the plate to confirm that the top and bottom rows are completely dry Do not allow the plate to sit on the manifold or the bench top for more than 90 minutes after the wells are completely dried To prevent the dilution of DNA with water ensure that every well is completely dry before adding RB Buffer 82 GeneChip Mapping 500K Assay Manual ELUTE THE PCR PRODUCTS To elute the PCR products 1 When the wells are completely dry after the third wash turn off the vacuum 2 Carefully remove the plate from the manifold and immediately A Blot the bottom of the plate on a t
210. t 77 78 88 2005 Tuzun E Sharp A J Bailey J A Kaul R Morrison V A Pertz L M Haugen E Hayden H Albertson D Pinkel D Olson M V Eichler E E Fine scale structural variation of the human genome 37 727 732 2005 Iafrate A J Feuk L Rivera M N Listewnik M L Donahoe P K Qi Y Scherer S W Lee C Detection of large scale variation in the human genome Nat Genet 36 949 51 2004 Shriver M D Kennedy G C Parra E J Lawson H A Sonpar V Huang J Akey J M Jones K W The genomic distribution of population substructure in four populations using 8 525 autosomal SNPs Hum Genomics 1 274 86 2004 Shriver M D Mei R Parra E J Sonpar V Halder I Tishkoff S A Schurr T G Zhadanov S I Osipova L P Brutsaert T D Friedlaender J Jorde L B Watkins W S Bamshad M J Gutierrez G Loi H Matsuzaki H Kittles R A Argyropoulos G Fernandez J R Akey J M Jones K W Large scale SNP analysis reveals clustered and continuous patterns of human genetic variation Hum Genomics 2 81 89 2005 Cardon L R Abecasis G R Using haplotype blocks to map human complex trait loci Trends Genet 19 135 40 2003 chapter 1 Overview 17 64 65 66 67 Gabriel S B Schaffner S F Nguyen H Moore J M Roy J Blumenstiel B Higgins J DeFelice M Lochner A Faggart M Liu Cordero S N Rotimi C Adeyemo A Coo
211. t this time 78 GeneChip Mapping 500K Assay Manual ADD DILUTED EDTA TO THE PCR PRODUCTS To add diluted EDTA to the PCR products 1 Add 3 mL of diluted EDTA 0 1M to a solution basin 2 Using a 12 channel P20 pipette aliquot 8 pL of diluted EDTA to each well with PCR product on each PCR product plate Tightly seal each plate Vortex the center of each plate at high speed for 3 sec Spin down each plate at 2000 rpm for 30 sec on Pw Place each plate back in a plate holder PREPARE THE CLEAN UP PLATE Follow the steps as described below Consult the Clontech Clean Up Plate Handbook for the general procedure To prepare the Clean Up Plate 1 Label the plate to indicate its orientation CUP BL Clean Up Plate bottom left 2 If not processing a full plate of samples cover the wells that will not be used with adhesive film as follows A Apply pressure around the edges of the plate to make the film stick B Cut the film between the used and unused wells C Remove the portion that covers the wells you want to use chapter 4 96 Well Plate Protocol 79 POOL THE PCR PRODUCTS CAUTION To avoid piercing the Clean Up Plate membrane do not pipette up and down in the plate and do not touch the bottom of the plate Be very careful when pooling the third set of PCR products as the wells are very full Avoid cross contaminating neighboring wells with small droplets Also pipette very carefully to avoi
212. tch Report Identifies chp files with the same SNP and gender calls Identifies chp files with Sample IDs which agree or disagree with the experimental information There are two types of errors chp files with the same sample IDs but a different common SNP pattern or gender call chp files with different sample IDs but identical shared SNP patterns The Sample Mismatch Report performs a pair wise comparison of the chapter 7 Analysis Workflow 201 SNPs and gender calls for each chp file with every other chp file in the analysis group The report shows every chp file pair with significant SNP overlap It also shows pairs with the same sample IDs but with significantly different genotyping calls The Sample Mismatch Report calculates the Mismatch metric for every pair of chp files The Mismatch metric is the averaged IBS Identity by State a measure of the number of alleles shared by two individuals This value increases with the degree of relatedness Matched samples replicates or Identical twins should have Mismatch values 1 95 2 Sib pairs and parent offspring should have Mismatch values ranging from 1 3 1 8 e Unrelated pairs should have Mismatch values between 0 9 1 3 For more information about the calculation of the IBS metric please consult the GeneChip Genotyping Analysis Software User s Guide To generate a Sample Mismatch Report 1 Click the Mismatch Report button in the
213. tech Each kit includes RB Buffer 1 Plate 636974 Up Kit 4 Plates 636975 TITANIUM Taq DNA Clontech Conains P N 639209 Polymerase 50X and 50X Clontech TITANIUM Taq DNA TITANIUM Taq PCR Polymerase Buffer e 10X Clontech TITANIUM Taq PCR Buffer GC Melt Clontech 5M 639238 dNTPs Takara mixture of dATP dCTP dGTP dTTP at 4030 2 5 mM each Fisher TAK 4030 Scientific Denhart s Solution Sigma Aldrich D2532 DMSO Sigma Aldrich D5879 EDTA Ambion 0 5 M pH 8 0 dilute to 0 1 M before use 9260G Herring Sperm DNA Promega D1815 HSDNA Human Cot 1 DNA Invitrogen 15279 011 MES Hydrate SigmaUltra Sigma Aldrich M5287 MES Sodium Salt Sigma Aldrich M5057 Reduced EDTA TE Buffer TEKnova 10 mM Tris HCL 0 1 mM EDTA pH 8 0 T0223 RB Buffer Tetramethyl Ammonium Chloride TMACL 5M Contained in the DNA Amplification Clean Up Kit listed above Sigma Aldrich 5M T3411 appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol 229 Table A 4 Other Reagents Required for the Mapping 500K 96 Well Plate Protocol Reagent Description Part Number Tween 20 10 10 diluted to 3 in molecular biology 28320 Surfact grade water AmpsQ Water AccuGENE Cambrex AccuGENE Molecular Biology Grade 51200 Water 1 L dNTPs from Invitrogen P N R72501 have been tested on a limited basis with similar results You should test in your own lab prior to full scale production Equipment and
214. tes to the restriction enzyme digestion step in the protocol 2 DNA must be free of PCR inhibitors Examples of inhibitors include high concentrations of heme from blood and high concentrations of chelating agents i e EDTA The genomic DNA extraction purification method should render DNA that is generally salt free because high concentrations of certain salts can also inhibit PCR and other enzyme reactions DNA should be prepared as described in Chapter 4 96 Well Plate Protocol or Appendix C Low Throughput Protocol as appropriate 3 DNA must not be contaminated with other human genomic DNA sources or with genomic DNA from other organisms PCR amplification of the ligated genomic DNA is not human specific so sufficient quantities of non human DNA may also be amplified 28 GeneChip Mapping 500K Assay Manual and could potentially result in compromised genotype calls Contaminated or mixed DNA may manifest as high detection rates and low call rates DNA must not be highly degraded For any particular SNP the genomic DNA fragment containing the SNP must have Nsp I or Sty I restriction sites intact so that ligation can occur on both ends of the fragment and PCR can be successful The approximate average size of genomic DNA may be assessed on a 1 or 2 agarose gel using an appropriate size standard control Reference Genomic DNA 103 can be run on the same gel for side by side comparison High quality genomic DNA will run as a
215. the DI water bottle Figure 6 5 At this step there is no need to be concerned about the bleach remaining in the lines chapter 6 Fluidics Station Care and Maintenance 163 Figure 6 5 Immerse the three wash and water lines in the DI water bottle 3 Press down on the needle levers to begin the rinse cycle The fluidics station will empty the lines and rinse the needles When the rinse is completed after approximately one hour the fluidics station will bring the temperature back to 25 C and drain the lines with air The LCD display will read CLEANING DONE Discard the vials employed for the bleach protocol 6 After completing the bleach protocol follow suggestions in Table 6 2 for storage of the Fluidics Station 450 164 GeneChip Mapping 500K Assay Manual Table 6 2 Quick Reference Guide to Using the FS 450 If Then do this Planning to use the system After running the bleach protocol immediately remove the DI water supply used in the rinse phase and install the appropriate reagents for use in the next staining and washing protocol including fresh DI water e Perform a prime protocol without load ing your probe arrays Failure to run a prime protocol will result in irreparable damage to the loaded hybridized probe arrays Not planning to use the system Since the system is already well purged immediately with water there is no need to run an additional shutdown protocol Remo
216. the current bleach protocol as of the writing of this manual it is BLEACHv2_450 for each of the respective modules in the Protocol drop down list Select all four modules 1 to 4 and click Run The fluidics station will not start the bleach protocol until the needle lever is pressed down Figure 6 4 Temperature will ramp up to 50 C 7 Follow the prompts on each LCD Load empty 1 5 mL vials onto each module if not already done so 8 Press down on each of the needle levers to start the bleach protocol Figure 6 4 chapter 6 Fluidics Station Care and Maintenance 161 Figure 6 4 Press down on the needle levers to start the bleach protocol 9 The fluidics station will begin the protocol emptying the lines and performing the cleaning cycles using bleach solution 10 After approximately 30 minutes the LCD will prompt you when the bleach cycle is over and the rinse cycle is about to begin THE RINSE CYCLE 162 GeneChip Mapping 500K Assay Manual Once the bleach cycle has finished the second part of the protocol is a rinse step This step is essential to remove all traces of bleach from the system Failure to complete this step can result in damaged arrays 1 Follow the prompts on the LCD for each module Lift up on the needle levers and remove the bleach vials Load clean empty vials onto each module 2 Remove the three wash and water lines from the bleach bottle and transfer them to
217. this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information Table 4 13 Equipment and Consumables Required for Stage 4 PCR Quantity Item 1 Cooler chilled to 20 C 2 double or Cooling chambers chilled to 4 C do not freeze 4 single 1 Ice bucket filled with ice 1 Marker fine point permanent 1 Microcentrifuge 1 Pipette single channel P20 1 Pipette single channel P100 1 Pipette single channel P200 1 Pipette single channel P1000 1 Pipette 12 channel P20 1 Pipette 12 channel P200 As needed Pipette tips for pipettes listed above full racks 6 Plates 96 well reaction 1 Plate centrifuge 7 Plate seal 1 Solution basin 55 mL 3 Thermal cycler 1 Tube Falcon 50 mL 1 Vortexer chapter 4 96 Well Plate Protocol 63 IMPORTANT Use only the PCR plate adhesive film and thermal cyclers listed in Table 4 1 on page 40 REAGENTS REQUIRED The following reagents are required for this stage Refer to Appendix A Reagents Equipment and Consumables Required for 96 Well Plate Protocol for vendor and part number information The amounts listed are sufficient to process one full 96 well reaction plate Table 4 14 Reagents Required for Stage 4 PCR Quantity Reagent e 15mL AccuGENE water molecular biology grade 875 uL 2 vials PCR Primer 002 100 uM Th
218. tion about Auto Archive of dat files Analysis 182 GeneChip Mapping 500K Assay Manual GCOS User must check Filters References GCOS User s Guide Mapping 500K Assay Manual Experiment registration Wash and stain arrays Scan arrays Automatic generation of CEL files GTYPE User must import Y Sample Attributes Batch analyze data References GTYPE User s Guide Mapping 500K Assay Manual Generate report Literature references Examine data Download annotations from the NetAffx Analysis Center Probe displays Virtual arrays Export data to third party tools Figure 7 1 Data Analysis workflow for GeneChip Human Mapping 250K Arrays using GCOS and GTYPE The following is an overview of the steps necessary to analyze data using GTYPE 4 0 or higher GCOS 1 4 or higher must be installed on the same workstation in order to use GTYPE Detailed instructions may be found in the GeneChip Genotyping Analysis Software User s Guide Batch Analysis 1 Open the Batch Analysis window Then select the appropriate cel files and drag the files into the Batch Analysis window If no files can be seen in the file tree check to see if any filters are applied this is shown by the Filter Applied message in the bottom right of the window Figure 7 2 The filter settings can be adjusted by selecting the filter
219. trix Assay Step Genomic DNA Preparation Reagents Reduced EDTA TE Buffer 10 mM Tris HCL 0 1 mM EDTA pH 8 0 TEKnova P N T0223 Reference Genomic DNA 103 50 ng pL Affymetrix P N 900421 available in Box 2 of the GeneChip Mapping 250K Assay Kits Nsp 30 Rxn Kit P N 900766 Nsp 100 Rxn Kit P N 900753 e Sty 30 Rxn Kit P N 900765 e Sty 100 Rxn Kit P N 900754 Equipment Restriction Enzyme Digestion 250 ng Genomic DNA 50 ng uL working stock array Sty I 10 000 U mL New England Biolabs NEB P N RO500S if running Sty Array containing NE Buffer 3 New England Biolabs NEB P N B7003S to order separately BSA Bovine Serum Albumin New England Biolabs NEB P N B9001S to order separately Nsp I 10 000 U mL New England Biolabs NEB P N RO602L if running Nsp Array containing NE Buffer 2 New England Biolabs NEB P N B7002S to order separately H O Molecular Biology Grade Water BioWhittaker Molecular Applications Cambrex P N 51200 96 well plate Bio Rad P N MLP 9601 or Applied Biosystems P N 403083 96 well Plate Clear Adhesive Films Applied Biosystems P N 4306311 8 Tube Strips thin wall 0 2 mL Bio Rad P N TBS 0201 Strip of 8 caps Bio Rad P N TCS 0801 Thermal Cycler Table D 6 294 GeneChip Mapping 500K Assay Manual Reagents Equipment and Supplies Not Supplied by Affymetrix Assay Step Ligation Reagents T4 DNA
220. uffer 2 10X 2 uL 220 8 uL BSA 100X 10 mg mL 0 2 uL 22 1 uL Nsp I 10 U uL 1 uL 110 4 uL Total 14 75 pL 1628 4 uL Table 4 8 Sty I Digestion Master Mix Reagent 1 Sample 96 Samples 15 extra AccuGENE Water 11 55 uL 1275 1 uL NE Buffer 3 10X 2 uL 220 8 uL BSA 100X 10 mg mL 0 2 uL 22 1 uL Sty I 10 U uL 1 uL 110 4 uL Total 14 75 uL 1628 4 uL ADD DIGESTION MASTER MIX TO SAMPLES To add Digestion Master Mix to samples 1 Using a single channel P200 pipette aliquot 135 pL of Digestion Master Mix to each tube of the strip tubes labeled Dig 2 Using a 12 channel P20 pipette add 14 75 pL of Digestion Master Mix to each DNA sample in the cooling chamber on ice The total volume in each well is now 19 75 pL 52 GeneChip Mapping 500K Assay Manual Genomic DNA 50 ng uL 5 uL Digestion Master Mix 14 75 uL Total Volume 19 75 uL 3 Seal the plate tightly with adhesive film 4 Vortex the center of the plate at high speed for 3 sec 5 Spin down the plate at 2000 rpm for 30 sec 6 Ensure that the lid of thermal cycler is preheated 7 Load the plate onto the thermal cycler and run the 500K Digest program 500K Digest Program Temperature Time 37 C 120 minutes 65 C 20 minutes 4 C Hold 8 When the program is finished remove the plate and spin it down at 2000 rpm for 30 sec 9 Do one of the following If proceeding directly to the next step place the plate in a cooling chamber
221. um hypochlorite solution 3 Place on the fluidics station an empty one liter waste bottle a 500 mL bottle of bleach and a one liter bottle of DI water as shown in Figure 6 2 Insert the waste line into the waste bottle Figure 6 2 4 Immerse all three wash and water lines of the fluidics station into the 500 mL of bleach solution Figure 6 2 DO NOT IMMERSE THE WASTE LINE INTO THE BLEACH NOTE f The BLEACH protocol requires approximately one liter of DI water chapter 6 Fluidics Station Care and Maintenance 159 Figure 6 2 The bleach cycle Immerse the tubes into the 0 525 sodium hypochlorite solution The waste line remains in the waste bottle 160 GeneChip Mapping 500K Assay Manual 5 Open GeneChip Operating Software GCOS Microarray Suite or the current version of the Affymetrix control software Click Run gt Fluidics from the menu Alternatively click the down arrow on the Protocol list on the toolbar The protocol window appears Figure 6 3 Fluidics Station 3 BBE Module 1 Module 2 Module 3 Module 4 Experiment Probe Array Type Protocol Fluidics Protocol BLEACHv2_450 Version 2 0 Thoroughly clean FS450 by running bleach then DI Water thru all lines and all needles ET 1hr 35min Current Stage Time Cycle Temp Time Remaining Close Figure 6 3 The Fluidics Station protocol window select all modules 6 Choose
222. urer s Material Safety Data Sheet for additional information Wear appropriate personal protective equipment when performing this assay At a minimum safety glasses and chemical resistant gloves should be worn Lu E fol ee ee eee a Some a au om EE ln ol Chapter 3 Genomic DNA General Requirement Chapter 4 27 Introduction This chapter describes the general requirements for genomic DNA sources and extraction methods The success of this assay requires the amplification of PCR fragments between 200 and 1100 bp in size throughout the genome To achieve this the genomic DNA must be of high quality and must be free of contaminants that would affect the enzymatic reactions carried out A genomic DNA control Reference Genomic DNA 103 is provided in both of the GeneChip Mapping 250K Assay Kits Nsp and Sty This control DNA meets the requirements outlined below The size of the starting genomic DNA can be compared with Ref103 DNA to assess the quality The control DNA should also be used as a routine experimental positive control and for troubleshooting Assay performance may vary for genomic DNA samples that do not meet the general requirements outlined below However the reliability of any given result should be assessed in the context of overall experimental design and goals General Requirements for Human Genomic DNA 1 DNA must be double stranded not single stranded This requirement rela
223. urify the PCR Products Elute The PCR Products What You Can Do Next STAGE 6 QUANTITATION AND NORMALIZATION About this Stage Location and Duration vi GeneChip Mapping 500K Assay Manual Input Required from Previous Stage Equipment and Consumables Required Reagents Required Important Information About This Stage Prepare the Reagents Equipment and Consumables Prepare Diluted Aliquots of Purified Sample Quantitate the Diluted PCR Product Assess the OD Readings Normalize the Samples What You Can Do Next STAGE 7 FRAGMENTATION About this Stage Location and Duration Input Required from Previous Stage Equipment and Consumables Required Reagents Required Gels and Related Materials Required Important Information About This Stage Prepare the Reagents Consumables and Other Components Prepare the Samples for Fragmentation What You Can Do Next Check the Fragmentation Reaction STAGE 8 LABELING About this Stage Location and Duration Input Required from Previous Stage Equipment and Consumables Required Reagents Required Important Information About This Stage Prepare the Reagents Consumables and Other Components Prepare the Labeling Master Mix Add the Labeling Master Mix to the Samples What You Can Do Next STAGE 9 TARGET HYBRIDIZATION About this Stage Location and Duration Input Required from Previous Stage Equipment and Consumables Required 114 115 CHAPTER 5 CHAPTER 6 contents vii Reagent
224. uring the reliability of a genotype call see Appendix D in the GeneChip Genotyping Analysis Software User s Guide chapter 7 Analysis Workflow 207 We have chosen a confidence score value of 0 33 as the default because it gives a good compromise between accuracy and Call Rate especially when the 85 per sample filter is applied In cases where you see a lower Call Rate you may wish to consider reanalyzing the data at the more stringent confidence score e g 0 26 which will decrease the Call Rate for the sample but may increase the accuracy of the genotypes Data Clean Up For many genotyping applications loss of accuracy can result in a significant decrease in genetic power Genotyping errors can be caused by SNPs that give systematic errors or by sporadic errors that occur due to stochastic sample or experimental factors SNPs that systematically give errors e g out of Hardy Weinberg equilibrium have been removed through a SNP selection process Overall the accuracy has been shown to be approximately 99 5 on the Mapping 500K Array Set based upon internal data Prior to downstream analysis the user should consider taking steps to identify and eliminate sporadic genotype errors Steps may include eliminating SNPs out of Hardy Weinberg equilibrium in control samples from the population or eliminating genotypes showing Mendel inconsistency or unlikely genotypes GTYPE has functionality to identify SNPs showing Mendeli
225. ve biotin labeled 3 0100 OCR 0100 Chapter 4 high oligonucleotides which hybridize to throughput or control regions gridding controls and Appendix C low array controls on the GeneChip throughput Mapping 250K Arrays 288 GeneChip Mapping 500K Assay Manual Table D 2 Reagents Supplied by Affymetrix 100 Reaction Kit Affymetrix GeneChip Mapping 250K Nsp Assay Kit P N 900753 This kit includes sufficient reagent for 100 arrays Component Volume Concentration Description Adaptor Nsp 75 uL 50 uM Two annealed oligonucleotides 1 specific for ligation to Nsp restriction site PCR Primer 002 2 vials 100 uM PCR primer to amplify ligated genomic 1 750 uL DNA each Reference Genomic DNA 30 uL 50 ng uL Human genomic DNA single source 2 103 GeneChip 25 uL See label on tube DNase enzyme formulated to 3 Fragmentation Reagent fragment purified PCR amplicons 10X Fragmentation Buffer 835 uL 10X Buffer for fragmentation reaction 3 GeneChip DNA Labeling 200 uL 30 mM Biotin labeled reagent for end labeling 3 Reagent 30 mM fragmented PCR amplicons Terminal 350 uL 30 U uL Enzyme used to end label fragmented 3 Deoxynucleotidyl PCR amplicons with the GeneChip Transferase DNA Labeling Reagent 30 mM 5X Terminal 2 vials 5X Buffer for labeling reaction 3 Deoxynucleotidyl 700 uL Transferase Buffer each Oligo Control Reagent 200 uL See protocol Mixture of five biotin labeled 3 0100 OCR 0100
226. ve the files Click Export to export your data During export the SNP Statistics Report is also generated Consult the GeneChip Genotyping Analysis Software User s Guide for further directions chapter 7 Analysis Workflow 193 NETAFFX SNP ANNOTATION The NetAffx Analysis Center provides regularly updated information about the SNPs on the Mapping arrays You can download the annotation data from the NetAffx Analysis Center and display it in the SNP table of the Dynamic Model Mapping Analysis window To use the NetAffx annotation option for the first time 1 Download the NetAffx annotations you wish to display 2 Select the NetAffx annotations to display The first time you open a new array type you will be prompted to download current annotations from the NetAffx Analysis Center Click Yes if you want to see these annotations You should download updates frequently from the NetAffx Analysis Center to ensure that you have the most up to date information The NetAffx annotation download functionality has been enhanced in GTYPE Please note that due to the increased speed of download a dialogue box representing download progress is no longer shown You may need to initialize NetAffx Analysis Center access to obtain certain types of annotations to download annotations in the future Detailed information for initializing the default settings and downloading and selecting th
227. ve the old DI water bottle and replace it with a fresh bottle Not planning to use the system Remove the DI water and perform a for an extended period of time dry protocol shutdown This will longer than one week remove most of the water from the system and prevent unwanted microbial growth in the supply lines Also remove the pump tubing from the peristaltic pump rollers NOTE After completing the bleach protocol discard the vials IMPORTANT chapter 6 Fluidics Station Care and Maintenance 165 Peristaltic Tubing Replacement Periodically the peristaltic tubing requires replacement because of wear contamination or in order to avoid salt buildup Inspect the tubing and if there is evidence of these conditions follow the procedure outlined below For systems in routine use Affymetrix recommends monthly replacement of the tubing To ensure proper performance use only tubing available from Affymetrix This tubing is manufactured to the required specifications to ensure proper fluid delivery and array performance Additional tubing can be obtained by ordering from Affymetrix Part Number Description Quantity 400110 Tubing Silicone 1 Peristaltic 8 5 Wear gloves when changing tubing Do not allow fluid from old tubing to spill onto surfaces 1 Open the module door Figure 6 6 166 GeneChip Mapping 500K Assay Manual Peristaltic Tubing Figure 6 6
228. well Table 5 1 Stain Buffer Components 1X Final Concentration H20 800 04 uL SSPE 20X 360 uL 6X Tween 20 3 3 96 uL 0 01 Denhardt s 50X 24 uL 1X Subtotal 1188 uL Subtotal 2 594 uL SAPE Stain Solution Streptavidin Phycoerythrin SAPE should be stored in the dark at 49C either foil wrapped or in an amber tube Remove SAPE from refrigerator and tap the tube to mix well before preparing stain solution Always prepare the SAPE stain solution immediately before use Do not freeze either concentrated SAPE or diluted SAPE stain solution Table 5 2 SAPE Solution Mix Components Volume Final Concentration Stain Buffer 594 uL 1X 1 mg mL Streptavidin Phycoerythrin SAPE 6 0 uL 10 ug mL Total 600 uL Mix well 144 GeneChip Mapping 500K Assay Manual A vial containing SAPE Stain Solution must be placed in sample holder 1 for each module used Antibody Stain Solution Table 5 3 Antibody Solution Mix Components Volume Final Concentration Stain Buffer 594 uL 1X 0 5 mg mL biotinylated antibody 6 uL 5 ug mL Total 600 jL Mix well A vial containing Antibody Stain Solution must be placed in sample holder 2 for each module used Array Holding Buffer Table 5 4 Array Holding Buffer Components Volume MES Stock Buffer 12X 8 3 mL 5 M NaCl 18 5 mL Tween 20 10 0 1 mL Water 73 1 mL Total 100 mL chapter 5 Washing Stai
229. xn Kit P N 900754 This DNA can be used as a positive control Reference Genomic DNA 103 tubes should be kept with the original kit to avoid contamination A process negative control can be included at the beginning of the assay to assess the presence of contamination Refer to Chapter 2 and Chapter 7 for more information appendix C Low Throughput Protocol 251 DIGESTION PROCEDURE PRE PCR CLEAN AREA 1 Depending on the restriction enzyme used prepare the following Digestion Master Mix ON ICE for multiple samples make a 5 excess Table C 2 Nsp Sty I Reagent Stock 1 Sample Final Conc Reagent Stock 1 Sample Final Conc in Sample in Sample H20 9 75 uL H20 9 75 uL NE buffer 2 10X 2 uL 1X NE buffer 3 10X 2 uL 1X BSA 10X 1 mg mL 2 uL 1X BSA 10X 1 mg mL 2 uL 1X Nsp I 10 U uL 1 uL 0 5 U uL Sty I 10 U uL 1 uL 0 5 U uL Total 14 75 uL Total 14 75 uL TIP El Avoid processing samples with both Nsp and Sty enzymes on the same day Best practice is to process samples for either Nsp or Sty on a given day NOTE Ez The BSA is supplied as 100X 10 mg mL and needs to be diluted 1 10 with molecular biology grade water before use 252 GeneChip Mapping 500K Assay Manual PCR STAGING AREA 2 Add 5 pL genomic DNA 50 ng pL to each well of 96 well plate Total amount of genomic DNA is 250 ng for each Restriction Enzyme 3 Aliquot 14 75 pL of the Digestio
230. y Type appears automatically 2 In the Protocol drop down list select Mapping500Kv1_450 to control the washing and staining of the probe array 3 Choose Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions in the LCD window on the fluidics station If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the appropriate Fluidics Station User s Guide or Quick Reference Card P N 08 0093 for the FS 450 fluidics station 4 Insert the appropriate probe array into the designated module of the fluidics station while the cartridge lever is in the Down or Eject position When finished verify that the cartridge lever is returned to the Up or Engaged position 5 Remove any microcentrifuge vials remaining in the sample holders of the fluidics station module s being used 6 When prompted to Load Vials 1 2 3 place the three vials into the sample holders 1 2 and 3 on the fluidics station Place one vial containing 600 pL Streptavidin Phycoerythrin SAPE stain solution mix in sample holder 1 e Place one vial containing 600 pL anti streptavidin biotinylated antibody stain solution in sample holder 2 e Place one vial containing 820 pL Array Holding Buffer in sample holder 3 e Press down on the needle lever to snap needles into position and to start the run Once these steps are complete the fluidics protocols begin Th
231. yze data following the scanning of GeneChip Human Mapping 500K Array Set and to present some guidelines to assess the quality of the data This chapter is designed as a supplement to the information sources listed below and does not replace them GeneChip Operating Software User s Guide GCOS P N 701439 GeneChip Genotyping Analysis Software User s Guide GTYPE P N 702083 Software Requirements GeneChip Operating Software GCOS 1 4 client GCOS 1 3 server or higher GeneChip Genotyping Analysis Software GTYPE 4 0 or higher GeneChip Human Mapping 500K Set library files Mapping 250K_Nsp or Mapping 250K_Sty Analysis Workflow This section describes the workflow for generating genotyping calls using GeneChip Genotyping Analysis Software GTYPE This process is outlined in Figure 7 1 Please note that acquisition of raw data using GeneChip Operating Software GCOS precedes analysis in GTYPE Refer to the GeneChip Operating Software User s Guide for instructions on dat and cel file generation Significant improvements have been made to GCOS and the Data Transfer Tool DTT to support large dat and cel files associated with the 500K Array Set For more details on these improvements please consult Data Transfer Tool User s Guide for more information about improved performance and enhanced data management flexibility GeneChip Operating Software User s Guide for more informa

Affy 500k Assay Manual

Contents

Download Pdf Manuals

Related Search

Related Contents