Home

Nikol Simecek MSc by Research

1. ceeesesscsseeeesseeseesecseeseesaeeecsaecaeesecseesecsaeeeesaecateaesneeseenaeeees 72 a CONCLUSIONS ennnen nisen bea sanaeteasednaneesdccamasenda meanest aE Ea a e a ERSS 74 References cssssssssssssessssscsessessesessasscsessassesssassssessassesessassssessassesaseasseseseassesessassesessassesessassssassassesesees 75 APPeNICES sscerssssrserssssrsersesersessessnsensessnsessessnsessessnsessessnsessesensonsessnsesscssnsessesensensesensesscsensessesenseseeses 77 Appendix A cccscscscsevssscsscscassssccecs sdessccsssavcess sobasdsebsesssesebasscsebsscsaccobsacsssaeasseeseasandsessossbasadscbsscsaasescsesevencseesss 77 Flow chart for upload_gene pl ssessesscessceseesecesecnsecnsecssecsasonsseasesssesseessesseeesecssesaesnaesnasenasenaeensens 77 Flow chart for upload _ASSAY pI cscccscccsseesseesceeseeeecesecesecenecanecacecscesseeeseecenceeeenaeeeaeeeaeeeaeeeaeeeeeneeeseees 80 Appendix 2D aissccaacscesscscssecs aisesinscadesocaescoceasieeesaceadesseassecsdscenssecaasasssosevaassecesasesssasiasssndeansedacesdeasacetesedsusseasso 82 Contents of the accompanying CD ROM 0 scccescceessesessceescecesceeeaeecaeceencecsaeeeeaeeceaeceeaeecsaeeeeneeceaeeeenes 82 eNO LE Ta ED 3 EAE E E T E T E T E E O 83 User guide for installing the database and web based user interface locally on Windows XP 83 Cran UNIVERSITY Nikol Simecek MSc by Research FIGURES Figure 1 TaqMan Chemistry scscsssscsssscsssss
2. e If MySQL server is not on your machine select Standard Configuration option and then click on Next MySQL Server Instance Configuration Wizard MySQL Server Instance Configuration Configure the MySQL Server 5 0 server instance Please set the Windows options V Install As Windows Service This is the recommended way to run the MySQL server on Windows Service Name MySQL v V Launch the MySQL Server automatically V Include Bin Directory in Windows PATH Check this option to include the directory containing the server dient executables in the Windows PATH variable so they can be called from the command line 87 Cranfield UNIVERSITY Nikol Simecek MSc by Research Ensure that Include Bin Directory in Windows PATH is selected and then click on Next MySQL Server Instance Configuration Wizard MySQL Server Instance Configuration Configure the MySQL Server 5 0 server instance Please set the security options Modify Security Settings New root password Enter the root password Confirm Retype the password C Enable root access from remote machines _ Create An Anonymous Account This option will create an anonymous account on this server Please note that this can lead to an insecure system Enter and confirm password of choice and then click on Next 88 Cranfield UNIVERSITY Nikol Simecek MSc by Research MySQL Server Instance Configur
3. Nikol Simecek MSc by Research Retrieve Gene name sequence Accession gene description and display to Web Browser Retrieve assay data from the DB and display to Web Browser Upload my Assay files via the Web Browser Figure 12 Summary of user requirements 3 5 Installation and configuration of Apache For this project Apache was selected as the Web Server It is open source free and is one of the most popular servers available Guelich et al 2000 Apache 2 0 59 was downloaded from http httpd apache org download cgi and installed locally so that the interface could be developed without an internet connection Before CGI 43 Cranfield UNIVERSITY Nikol Simecek MSc by Research programs could be executed on the server it was necessary to modify certain parameters in the Apache configuration files This was because Apache needs to know where the CGI programs are located and to enable the execution of CGI programs 3 6 User Interface Development It seemed logical to break down the development of the CGI programs into 3 distinct phases based on the user requirements outlined in section 3 4 retrieving a TaqMan assay loading assay data and retrieving gene data A welcome page was designed with links to the different functionalities of the application The diagram in Figure 13 shows the CGI programs that were developed All CGI programs can be found on the accompanying CD ROM A description of the progr
4. Probe 1272 26 68 54 TCTGTCTCTCCATGCTGTGGTITGCC Length Re 1321 21 60 57 CAGCCCGTAGTAGGCAAAGCT Li x Export Data Gene Name Slc22a6 Synonym s Oat1 Paht Roat1 Orctl1 MGC124962 Description solute carrier family 22 member 6 Se Data for assay 4005 has been exported to c Documents and sabes Settings simecn00 My Documents My Website Exported_data Species Norway rat Rattus norvegicus Accession NM_017224 Figure 19 HTML page for display_data cgi and export_assay cgi 59 Cranfield UNIVERSITY Nikol Simecek MSc by Research 4 3 UploadTaqMan Assay Figure 20 shows how the user can upload assay files into the database by clicking on the Upload Assay link on the welcome page TAQBase Links Single File Search e Home C My Files NM_013033 _Browse _ e Find Ta 7 End lotta Assa Sub Click on sybmit to copy your Primer Express Assay file into the upload directory External Links Multiple Fil amp s e Entrez e BSTAR For quick upload copy your Primer Express assay files into this directory C Documents al e GATE Documents My Wedsite Assay Files Upload Files Click Here NM_013033 Rattus norvegic Primers TXT already exists in the upload directory Upload was successful Figure 20 HTML for Select_Files cgi and upload_assay cgi 4 4 Search Gene This section illustrates how the user can query the database to retrieve gene data and export gene sequences by clickin
5. 91 Cranfield UNIVERSITY Nikol Simecek MSc by Research i ActivePerl 5 6 1 Build 638 Setup Ready to Install The Setup Wizard is ready to begin the Custom installation Click Install to begin the installation If you want to review or change any of your installation settings click Back Click Cancel to exit the wizard e Click on Install and then click on Finish when installation is complete e Perl should now be installed and ready to use 4 Install Perl Modules The following Perl modules should be installed Time Piece MySQL DBI DBD MySQL Bio Perl HTML Template 1O String e These modules can be downloaded from 92 Cranfield UNIVERSITY Nikol Simecek MSc by Research http ppm activestate com PPMPackages zips by clicking on this link ActivePerl 6xx e g ActivePerl 5 6 1 623 Locate the following zip files and click on the link to download the zip file to a temporary directory on you PC DBD mysql 2 9004 zip DBI zip Time Piece MySQL 0 03 zip 1O String zip HTML Template zip Alternatively these zip files can be found in Perl Modules for installing folder in the Taqbase folder that has already been unzipped Extract each of the zip files into a temporary directory To install each of the Perl modules go to the command prompt and change the directory to where the ppd file is located within your unzipped file for example type cd C Your file path CGI 3
6. Before constructing the final E R diagram the entities and attributes were refined by the process of normalisation This involved applying a set of rules to the attributes and entities in order to minimise data redundancy increase flexibility of the database and to allow for data integrity to be easily maintained Stephens and Plew 2001 The final E R model as shown in Figure 6 meets the objectives of the 1 2 and 3 normal form e 1 Normal Form The data is divided into logical groups and there is no repeating information in the model Each entity has a unique attribute i e a primary key to ensure that each row in the table is unique This means that the 24 Cran UNIVERSITY Nikol Simecek MSc by Research first normal form has been met e 2 Normal Form There are no attributes within a table that are not directly related to the primary key e 3 Normal Form No attributes depend on other non key attributes i e each attribute cannot be broken down further Although there are additional normal forms these are mainly theoretical and scarcely used Ensuring that the database met the objectives of the third normal form was sufficient for the purposes of this project 25 Cran UNIVERSITY Nikol Simecek MSc by Research GENE SYNONYM Synonym ID lt Gene ID Synonym PRIMER PROBE GENE Gene ID Gene Symbol Melting Temperature Gene Name GC content Primer Probe sequence Type FP RP or PRB ZA
7. Cranfield UNIVERSITY Nikol Simecek MSc by Research additional data would certainly be of value For example it would be useful to include an entity which consists of user data i e user ID first name and last name The client may wish to retrieve assays from the database that only he or she has designed With the current database schema this query could not be executed The user entity would be related to the TaqMan file entity as shown in Figure 24 TAQMAN FILE File ID Gene Sequence ID User ID File Name Date Time created USER First Name Last Name Figure 24 Relationship between user and TaqMan file table From the client s perspective it would be useful to add additional attributes to the TaqMan assay table so that the following data could be recorded e has a specific TaqMan assay been used in an experiment e was the assay successful in the experiment e who has used a particular assay As outlined in section 2 3 1 the assay design process involves the creation of a text file containing a list of 200 candidate assays for a specific gene sequence This data is then uploaded into the database by the programs that have been designed for this project When a TaqMan experiment is performed only one assay selected by the user 69 Cran UNIVERSITY Nikol Simecek MSc by Research is used For future experiments where the same gene is to be investigated knowing which assay has been successful in prev
8. Entrez retrieval system www ncbi nlm nih gov PubMed This provides access to citations from biomedical literature and is also available via the NCBI Entrez retrieval system EMBL nucleotide sequence database This is Europe s primary sequence resource and can be accessed via www ebi ac uk embl Gene Ontology Database This can be searched using AmiGO www godatabase org cgi bin amigo go cgi This interface provides access to genes proteins and gene ontologies which are a description of how gene products behave in a cellular context The database resides on a server and is accessed by the client through a network using a familiar web browser such as Microsoft Internet Explorer or Mozilla Firefox The Common Gateway Interface CGI is commonly used for Web servers to interact dynamically with users It allows for external programs written using languages such as Perl PHP and Java to run on a Web server and when a request is made the server executes the CGI program The request is transmitted to the database and the results 13 Cran fiel d UNIVERSITY Nikol Simecek MSc by Research are returned and displayed to the client as HTML output Guelich et al 2000 This is illustrated in Figure 3 Server Application on server 44 amp Web Browser on Client 1 Sp r EN o om Results HTTP reques Call CGI a 5 A o HTTP response CGI Program s response Abbreviations
9. GENE SEQUENCE TAQMAN FILE File ID lt Gene Sequence ID File Name Date Time created Gene Sequence ID Gene ID Species ID Accession Gene Sequence TAQMAN ASSAY Assay ID File ID SPECIES Record Species ID Amplicon Length Common Name Penalty Scientific Name PK Primary Key FK Foreign Key Figure 6 Final Entity Relationship Diagram 2 5 Database implementation With the database design in place the next step was to implement the database using an appropriate relational database management system RDBMS 2 5 1 RDBMS installation MySQL distributed by MySQL AB at http www mysql com was chosen as the 26 Cranfield UNIVERSITY Nikol Simecek MSc by Research RDBMS for this project because its use is widespread particularly for web applications it is open source and it is able to interface with many programming languages Meloni 2002 This was important for the next phase of the project where software was developed to automatically upload data into the database Software development will be discussed in Chapter 3 MySQL version 4 0 26 was installed on a local PC 2 5 2 Determining the attribute data types The entity relationship diagram shown in Figure 6 provided the framework for implementing the physical database So that the tables could be created within MySQL an applicable data type needed to be assigned to each of the columns This was so that data integrity could be
10. Nikol Simecek MSc by Research there was a requirement to assign each file a unique file name The current date and time localtime was saved in a variable and used as a suffix for output file This ensured that each filename was unique 3 7 4 Displaying limited assay data The view_assay cgi program displays an HTML page which enables the user to select up to 7 primer design criteria in any combination The selected values parameters are submitted to the view_assay cgi script and SQL queries are issued to retrieve assay data that meet the selected criteria This data is then displayed to the browser as an HTML page To achieve this it was necessary to address how the database would be queried since a specific SQL query must be issued for each selected criteria for example e Retrieve assay ids where the probe GC content is between 30 and 80 SELECT taqman_assay assay_id FROM primer_probe taqman_file taqman_assay WHERE pr_type PRB and pr_gc between 30 and 80 AND taqman_file file_id taqman_assay file_id AND taqman_assay assay_id primer_probe assay_id AND file_name file name e Retrieve assay ids where the amplicon length is between 50 and 150 SELECT taqman_assay assay_id FROM taqman_file taqman_assay WHERE amplicon_length between 49 and 151 AND taqman_file file_id taqman_assay file_id AND file_name file name If both criteria were selected an SQL query could be submitted consisting of both criteria as fol
11. TEXT NTEGER NTEGER TINYINT TINYINT TINYINT TINYTEXT ENUM FP RP PRB INTEGER INTEGER TEXT TEXT Nullable Auto inc Constraint Flags UNSIGNED UNSIGNED UNSIGNED UNSIGNED UNSIGNED UNSIGNED UNSIGNED UNSIGNE UNSIGNED ASSAY_ID NTEGER UNSIGNED FILE_ID NTEGER UNSIGNED TAQMAN_ASSAY RECORD NTEGER UNSIGNED AMPLICON_LENGTH NTEGER UNSIGNED PENALTY NTEGER UNSIGNED FILE_ID NTEGER NOT NULL Y PK UNSIGNED FILE_NAME TINYTEXT NOT NULL TAQMAN_FILE DATE_TIME_CREATED DATETIME NOT NULL DATE_TIME_TRANSFERRED TIMESTAMP NOT NULL GENE_SEQ_ID NTEGER NOT NULL FK UNSIGNED Key PK Primary Key FK Foreign Key 28 UNIVERSITY Cranfield Nikol Simecek MSc by Research 2 5 3 Controlled vocabularies A controlled vocabulary is a defined list of terms for a category of information Using controlled vocabularies in a database should simplify queries issued to it An example of where a controlled vocabulary was implemented for this database was for the primer type entity in the primer probe table The enumeration data type was used to constrain this column so that an oligonucleotide i e a primer or probe could only be described by one of three pre defined terms FP RP or PRB If a control vocabulary was not implemented then a forward primer for example could be described by a multitude of terms such as Forward Primer F Primer FP and Fwd Primer Retrieving forward primer data from
12. amp no Gene symbol into the DB Are there 1 or more Synonyms yes Retrieve max gene_id For each synonym insert Gene_id and synonym Sub check species Argument passed into the Sub species scientific name Query database for species Exists in DB yes Do Nothing no Insert Species common name amp Scientific name into DB 79 Cranfield UNIVERSITY Nikol Simecek MSc by Research Flow chart for upload_assay pl Change the dir to where assay files are located 3 F Terminate program and A Does dir exist no inian Vear Open each txt file in turn amp test whether first line matches the header row of a Primer Express file Save file name to an array ee ne Called not_assay _file yes Save file name to an array called assay _file Does assay_file contain values yes Dir contains txt files yes no yes Terminate program and inform user no Terminate Program and inform user Pass assay_file into check DB subroutine which returns files that do not exist in DB Saved in an array not_in_DB Does not_in_DB contain values n Terminate Program and inform user yes Open file and save data to an array record Last element Retrieve gene_id by passing record into gene_id subroutine Go to next file in not_in_DB Is there and exact gene match yes 4 Load data into taqman fil
13. of the oligonucleotides are in double stranded conformation and 50 are single stranded GC is the proportion of G s and C s within the primer probe or amplicon Ta is the annealing temperature of a DNA fragment Penalty is a number calculated by the Primer Express software to reflect the number of criteria a TaqMan assay meets The lower the number the more criteria are met which indicates that the assay is more likely to succeed A full 19 Cran UNIVERSITY Nikol Simecek MSc by Research description of how the penalty score is calculated can be found in section B of the Primer Express V2 0 user manual This section has been saved to the attached CD ROM for reference purposes and is entitled Calculating Penalty Scores pdf Once the assays have been exported the user then selects an assay that is able to meet a number of recommended design criteria outlined by Applied Biosystems The sequences of the primers and probes belonging to the selected assay are submitted to a vendor so that they may be synthesised A flow diagram of the assay design process is shown in Figure 5 along with the data collected at each stage of the process where applicable 20 Cranfield UNIVERSITY Nikol Simecek MSc by Research Gene Name Gene Description Synonyms Species select gene amp species of interest Sequence Accession Number retrieve gene sequence for species of interest
14. 10 x than using the INSERT command 3 4 User Interface Objectives With the database upload programs in place the final phase of this project was to develop a web based application so that the database could be populated with data and queried by members of the MPT group This would be achieved by installing an appropriate Web Server and using the Perl module CGI pm which provides an interface for common CGI tasks for example parsing input parameters and HTML code output Guelich et al 2000 The first step in designing the user interface was to consider the interface requirements from the user s perspective These requirements could be broken down 41 Cran UNIVERSITY Nikol Simecek MSc by Research into three main areas e Querying the database to see if the assay already exists and displaying the results to the Web Browser Export assay data so assays can be ordered from various vendors e Retrieving a gene sequence and its associated data and displaying the results to the Browser Export the gene sequence so a TaqMan assay can be designed using the Primer Express software e Uploading Primer Express assay files into the database In addition the interface should allow for multi user access to the database so that data can be shared within the MPT group The interface should also be user friendly to encourage users to adopt this system Figure 12 provides a summary of user requirements 42 Cranfield UNIVERSITY
15. Apache open the configuration file entitled httpd txt This file is located here Your File path Apache Group Apache2 conf e Search for this in the file lt Directory C Documents and Settings My Documents My Website gt AllowOverride FileInfo AuthConfig Limit 94 Cranfield UNIVERSITY Nikol Simecek MSc by Research Options MultiViews Indexes SymLinksIfOwnerMatch IncludesNoExec lt Limit GET POST OPTIONS PROPFIND gt Order allow deny Allow from all lt Limit gt lt LimitExcept GET POST OPTIONS PROPFIND gt Order deny allow Deny from all lt LimitExcept gt lt Directory gt Remove from each line and replace the file path in lt Directory C Documents and Settings My Documents My Website gt with Your filepath Apache Group Apache2cgi bin If the software has been installed and configured correctly you should see the following webpage at this url http localhost if installed locally replace localhost with hostname if installed elsewhere 95 Cranfield UNIVERSITY Nikol Simecek MSc by Research If you can see this it means that the installation of the Apache web server software on this system was successful You may now add content to this directory and replace this page Seeing this instead of the website you expected This page is here because the site administrator has changed the configuration of this web server Please contact the person respons
16. G on 5 end Prb more C s than G s RPrimer Tm 58 60 Prb Tm 68 70 Amp Len 50 150bp Click here for more information about limits Primer and Probe Design Recommended Guidelines Description of Limits Amp Len 50 150 bp Primers should be designed to amply short segments of DNA within the target sequence These short segments are called amplicons The shortest amplicons work the best Consistent results are obtained for ampSicon size ranges from 50 150 base pairs Prb GC 30 30 Probe G C content should be kept within the 30 0 range Prb No G on S end Do not put G s on the end of the probe Prb Tm 68 70 The Tm of the probe should be 68 70 degrees C Prb more G s than C s The probe should have more C s than G s Primer Tm 58 60 The Tm of the primers should be between 58 60 degrees Figure 17 HTML pages for View assay cgi and limits cgi Figure 18 shows how the amplicon data is displayed to the user and Figure 19 displays the HTML page that is generated when the user clicks on the assay ID hyperlink 58 Cranfield UNIVERSITY Nikol Simecek MSc by Research 200 Results for Click on Assay ID to view Assay Data NM_017224 Rattus norvegic Primers TXT Click on Checkbox to export Data Assay Penalty Amplicon Export 5 FwdPRIMER PROBE RevPRIMER 3 4001 105 lccacect TCGACACCTCTTCCTCTGTCTCTCCATGCTGTGGTTT GCCACTACAGCCCGTAGTAGGCAAAG
17. a particular toxicity Use as a screen for assessing particular types of toxicity e Confirmation of microarray derived gene expression data 1 1 Polymerase Chain Reaction The Polymerase Chain Reaction PCR is considered to be one of the most important techniques in molecular biology and is used to amplify a specific target sequence of DNA within a sample DNA is denatured into two separate strands by heating to 95 C The temperature is lowered and two oligonucleotides often referred to as forward and reverse primers complementary to each end of the target sequence of interest bind to the template DNA Creighton 2005 A new DNA strand complementary to the template is synthesised by the enzyme DNA polymerase Dale Cranfield UNIVERSITY Nikol Simecek MSc by Research 2003 The process of denaturation annealing and extension is then repeated using the newly formed DNA target as a template each time During each round of PCR the DNA target doubles in quantity resulting in an exponential increase of the target DNA sequence Creighton 2005 The PCR reaction can be split into 3 phases exponential linear and plateau During the exponential phase the reaction is 100 efficient and there is exact doubling of product Towards the end of the reaction during the linear phase reagents are being consumed and the reaction begins to slow Finally during the plateau phase the reaction eventually ceases In addition to DNA it is also
18. be derived from 2 main sources a nucleotide sequence database GenBank and text files exported from the Primer Express software This is illustrated in Figure 7 which shows the database tables colour coded according to data source The two data sources are related via the gene sequence table and TaqMan file table where the gene sequence ID is present in both tables PK gene_seq_id FK TAQMAN SEQUENCE GENE TAQMAN ASSAY Primer Express Text File GenBank Record PRIMER SYNONYM PROBE SPECIES Figure 7 Summary of the data source for the tables in the database 3 3 1 Upload_Gene pl The objectives of upload_gene pl are to populate the gene sequence gene gene synonym and species tables with data retrieved from a GenBank record Figure 8 shows the relevant sections of a GenBank record that are used to populate the 34 Cranfield UNIVERSITY Nikol Simecek MSc by Research database Locus NM_053487 2259 bp mR DEFINITION _ Ra vegicus peroxisomal biogene ACCESSION VERSION KEYWORDS SOURCE gene ORIGIN cccacccacc cagcagactaa 61 agacccacga gggagcgggce 121 ccgagtcgcc aaccaaagcc 181 catgttgctt agatatttot GENE SYNONYM Figure 8 GenBank Record A description of how the program performs this task is described below Before the program is executed a text file containing a list of accession numbers should be placed in the designated directory Wh
19. file that will be used It then creates an HTML Template object assigns a parameter and outputs the results as an HTML page The following template files were developed to display HTML pages and can be found on the CD ROM all_genes tmpl display_amplicons tmpl select_files tmpl upload_assay tmpl and view_assay tmpl The file prefix corresponds to the CGI programs that use these template files e g all_genes cgi uses the template all_genes tmpl 3 7 2 Displaying colour coded amplicons The display_amplicons cgi program displays an HTML page with a list of colour coded amplicons This is an important feature since the user is able to quickly compare a list of amplicons and visualise the distance between the primers and probes In order to achieve this there were two main problems to overcome 1 No amplicon sequence in the database as this was not in the original Primer Express file 2 Colour coding the amplicon in HTML so that the primer and probe sequences could be easily visualised Retrieving the primer and probe sequences alone were not enough to display the amplicon sequence due to the residual bases labelled A and B in between the primers and probes as illustrated in Figure 14 50 UNIVERSITY Cranfield Nikol Simecek MSc by Research Forward Primer A Probe B Reverse Primer m ama aAa CCCTCTCCATTGGTTTCTCTGTCCTGGGCCACCTCCTTGGGATCTA Figure 14 Amplicon The approach used in this program was to query the database and
20. from which gene expression levels can be inferred is collected by the Applied Biosystems sequence detection software SDS Data from each plate is contained within one SDS file and can be exported to Excel for further analysis Copy numbers for each gene are calculated using a standard curve and statistical analysis of this data is performed using TaqMan Toolkit TaqMan Toolkit is an add on for Excel developed in house for analysing data from genomic TaqMan experiments Analysis methods available in this toolkit are Analysis of Variance Analysis of CoVariance and Principal Components Analysis PCA Once statistically significant data has been generated it is often compared to other parameters such as clinical pathology data Literature is reviewed and a number of pathway mapping tools are used to assist with interpreting the gene changes identified 1 4 The Application of Bioinformatics Databases There is a wealth of data generated in any one TaqMan experiment and currently within the MPT group at GlaxoSmithKline this data is stored on users PCs or in laboratory notebooks It would benefit the group if data associated with the design of TaqMan assays was organised efficiently and stored in one central repository Time would be saved since users would not have to search for assay availability Also duplication of effort could be minimized since the user could quickly assess whether Cranfield UNIVERSITY Nikol Simecek MSc by Resear
21. in the programs that allowed large amounts of inaccurate data to be uploaded The version of MySQL used for this project does not support the cascading deletion of foreign keys for example when a record is deleted records related to it are not automatically deleted Therefore additional SQL statements must be executed to delete all related data in order to maintain database integrity or a simple Perl program can be written to perform this task 5 2 Software Development Software development for this project occurred in two phases and involved the development of programs to upload data into the database and a front end CGI application for users to query the database These will be discussed in the following sections along with a description of limitations 5 2 1 Upload_Assay pl The aim of upload_assay pl was to automate the upload of assay data from the Primer 64 Cran UNIVERSITY Nikol Simecek MSc by Research Express text file into the database Ideally the program should not output any errors during its execution all data should be correctly loaded into the database so that referential integrity is enforced and it should prevent duplication of data in the database Most of these goals were achieved by e Incorporating error checks in the code e Submitting queries to the database to check for the existence of records before inserting the record thus preventing duplication e Checking that the correct data had been uploaded in
22. installation settings dick Back Click Cancel to exit the wizard Current Settings Setup Type Typical Destination Folder C Program Files MySQL MySQL Server 5 0 85 Cranfield UNIVERSITY Nikol Simecek MSc by Research e Click on Install e When installation is complete a sign up window appears to create a MySQL com account If required sign up to MySQL com otherwise click on the skip option and then click on Next ie MySQL Server 5 0 Setup Wizard Wizard Completed Setup has finished installing MySQL Server 5 0 Click Finish to exit the wizard Configure the MySQL Server now Use this option to generate an optimized MySQL config file setup a Windows service running on a dedicated port and to set the password for the root account e Ensure that Configure the MySQL Server now is selected and click on Finish e Then click on Next to configure MySQL 86 Cranfield UNIVERSITY Nikol Simecek MSc by Research MySQL Server Instance Configuration Wizard MySQL Server Instance Configuration Configure the MySQL Server 5 0 server instance Please select a configuration type Detailed Configuration RZ choose this configuration type to create the optimal server setup for F this machine Standard Configuration Use this only on machines that do not already have a MySQL server installation This will use a general purpose configuration for the server that can be tuned manually
23. retrieve a substring of the gene sequence that was used to design the assay The forward primer start position and amplicon length were used in the SQL query to access the part of the gene sequence that represented the amplicon The SQL substring function allows for part of a string to be accessed as follows SUBSTRING column name position length where column name would be the gene sequence position would be the forward primer start position and length would be the amplicon length The retrieved amplicon would then be saved in a variable So that the amplicon could be colour coded the amplicon needed to be broken down into its individual components i e primer sequence probe sequence outlined in Figure 14 The sequences for forward primer reverse primer and probe were retrieved from the database and saved as individual variables The sequences represented by A and B in the above figure were retrieved by comparing the amplicon sequence and primer probe sequences All matching bases and bases before or after the probe were removed leaving the sequences represented by A and B These were saved as variables passed to the template file along with the probe and primer sequences and colour coded accordingly 3 7 3 Unique file names on export Two of the cgi scripts export_data cgi and export_assay cgi enabled the user to export selected data to a designated directory To prevent files from being overwritten 51 Cran UNIVERSITY
24. selected by the user in browse_assay cgi to the assay upload directory An HTML page with a message is displayed in the browser depending on whether a file was selected or whether the selected file is already in the directory or not e Select_files cgi This program checks the designated assay folder to see whether it contains any files and whether these files are recognised assay files An HTML page is generated to display a list of genuine assay files and another list of non assay files if appropriate Alongside the list of genuine assay files is a checkbox for the user to select files to upload into the database e Upload_assay cgi This program uploads assay data from files selected in select_files cgi into the database It is based on the upload_assay pl program described in section 3 3 2 A message is displayed on an HTML page informing the user whether the files have been uploaded successfully 3 6 3 Search Gene This section describes the programs that were developed to retrieve gene data e Search_gene cgi This script generates an HTML page which consists of a 48 Cranfield UNIVERSITY Nikol Simecek MSc by Research text field so the user can enter a search term and submit a query to GenBank The user can limit the search by accession gene symbol gene ontology and species e Genbank_results cgi This program queries GenBank and displays an HTML page consisting of the accession and the gene description Alongside each descr
25. the database would therefore be over complicated Controlled vocabularies were also implemented in the user interface and will be discussed in Chapter 3 2 5 4 Creating the database and its tables Creation of the database was done via the command line interface as follows 1 Change the directory to mysql bin prompt gt cd c mysql bin 2 Issue a command to create a database entitled taqbase prompt gt mysqladmin u user p password create taqbase There are two common methods for creating tables in MySQL The first involves directly issuing commands using the MySQL monitor for example prompt gt mysql u user p password mysql gt USE taqbase mysql gt CREATE TABLE species 29 Cran UNIVERSITY Nikol Simecek MSc by Research gt species_id INT UNSIGNED PRIMARY KEY NOT NULL DEFAULT gt 0 AUTO_ INCREMENT gt common_name text gt scientific_name text NOT NULL gt TYPE nnoDB The second method which was used for this project involves saving all table creation statements to a text file on the server This file entitled table_create sql can be found on the accompanying CD ROM to this project The following command was used to create all the tables using this file prompt gt mysql u user p password lt path to table_ create sql 2 5 5 Database security When MySQL is installed a database called mysql is automatically created It stores data such as user privileges for
26. 00 Then at the command prompt type ppm install modulename ppd replacing modulename with the name of the ppd file To download and install Bioperl go to here http bioperl open bio org wiki Getting BioPerl Scroll down to Bioper 1 4 0 Stable Release heading Click on zip next to core modules and download zipped file into temporary directory on your PC Extract the files to a temporary location and then transfer the Bio folder to 93 Cranfield UNIVERSITY Nikol Simecek MSc by Research the Perl site lib directory The Bio folder is also supplied in the Perl Modules for installing folder in the Taqbase folder you have already unzipped 5 Download and Install Apache Server e Go to this website http httpd apache org download cgi and scroll down to here Apache HTTP Server 2 0 59 is also available e Click on this link Win32 Binary MSI Installer apache _2 0 59 win32 x86 no_ssl msi e Save the Windows installer package to a temporary directory e Double click on the installer package and follow the instructions in the installation wizard e Keep clicking on Next until the server information window is reached e For local installation of Apache type locahost for both network domain and the server name e Keep clicking on Next keeping all default options until the install window is reached and then click on Install e Click on Finish when the software installation is complete e To configure
27. 1998 In a one to one relationship a key value appears only once in the related table whereas in a one to many relationship a key value can appear many times in the related table In many to many relationships a key value can appear many times in the related table and vice versa As many to many relationships can cause problems when a database is implemented they are usually broken down into a series of one to many relationships 1 4 4 Database design Planning the database carefully will ensure that the final product is efficient flexible and easy to manage and maintain Meloni 2002 In terms of this project flexibility is an important consideration Although the database designed for this project will house data associated with TaqMan assay design it should allow for expansion For example storing data generated from other areas of the TaqMan process such as sample preparation and gene expression measurement section 1 3 would be UNIVERSITY Cranfield Nikol Simecek MSc by Research invaluable This would allow users to perform powerful biological queries in support of high priority projects Also within a research environment processes are constantly changing so a flexible database design is of great importance There are three phases of the design process requirements analysis data modeling and normalisation Requirements analysis is the process of establishing database requirements This is done by interviewing the end u
28. 36 7M Download Pick a mirror MD5 b909cl acSbde755aa20486b981 23a1 Signature e Click on the Download link and when the file download window pops up click on Save e Save the zipped file to a temporary location such as your Desktop e Close the dialog box when the download is complete e To install MySQL unzip the downloaded file to a temporary location e Double click on the Setup icon and then click on run to launch the Setup wizard g MySQL Server 5 0 Setup Wizard Welcome to the Setup Wizard for MySQL Server 5 0 The Setup Wizard will install MySQL Server 5 0 release 5 0 37 on your computer To continue dick Next WARNING This program is protected by copyright law e Click on Next 84 Cranfield UNIVERSITY Nikol Simecek MSc by Research ie MySQL Server 5 0 Setup Wizard Setup Type Choose the setup type that best suits your needs Please select a setup type Typical Common program features will be installed Recommended for a gt general use Complete M All program features will be installed Requires the most disk 9 space Custom V Choose which program features you want installed and where they TY will be installed Recommended for advanced users e Click on Next again ie MySQL Server 5 0 Setup Wizard Ready to Install the Program The wizard is ready to begin installation If you want to review or change any of your
29. C o 4002 105 ccacceT TCGACACCTCTTCCTCTGTCTCTCCATGCTGTGGTTT GCCACTACAGCCCGTAGTAGGCAAAGC o 4003 105 CCACCCTTCGACACCTCTTCCTCTGTCTCTCCATGCTGTGGTTT GCCACTACAGCOCCGTAGTAGGCAAAGC F 4004 106 CCACCCTTCGACACCTCTTCCTCTGTCTCTCCATGCTGTGGTTTGCCACTCAGCCCGTAGTAGGCAAAGCT F 4005 i 41 06 lcCACCCTTCGACACCTCTTCCTCTGTCTCTCCATGCTGTGGT TTGCCACTCAGCCCGTAGTAGGCAAAGCT J oO 6 106 lccaccct TCGACACCTCTTCCTCTGTCTCTCCATGCTGTGGTTT GCCACTCAGCOCCGTAGTAGGCAAAGCT Fl 4196 173 TGTACCTTATCCAGGTGATTTTCGGTGCCGTGGACCT GCCT GCCAAGTTTGTATGCTTCCTAGTCATGCGCCCCATGGAGTTG o 4197 173 TGTACCTTATCCAGGTGATTTTCGGTGCCGTGGACCTGCCTGCCAAGTTTGTATGCTTCCTAGTCATGCGCCCCATGGAGTTG o 4198 173 TGTACCTTATCCAGGTGATTTTCGGTGCCGTGGACCTGCCTGCCAAGTTTGTATGCTTCCTAGTCATGCGCCCCATGGAGTTG oO 4199 173 TGTACCTTATCCAGGTGATTTTCGGTGCCGTGGACCTGCCTGCCAAGTTTGTATGCTTCCTAGTCATGCGCCCCATGGAGTTG 4200 173 TGTACCTTATCCAGGTGATTTTCGGTGCCGTGGACCT GCCT GCCAAGTTTGTATGCTTCCTAGTCATGCGCCCCATGGAGTTG Can Rea peo Your file is called Slc22a6 _ TueJan91534252007 txt Nothing was selected Data for selected assays have been exported to c Documents and Settings simecn00 My Documents My Website Exported_data Figure 18 HTML page for display_amplicons and export_data cgi Data for assay 4005 Choose Data to Export Penalty 106 Amplicon Length 71 i Assay ID a Start Length TM GC Sequence Penalty a Fp 1251 20 68 60 CCACCCTTCGACACCTCTTC Length
30. Cranfield UNIVERSITY Nikol Simecek MSc by Research CRANFIELD UNIVERSITY CRANFIELD HEALTH MSc by Research Academic Year 2005 2007 Nikol Simecek DEVELOPMENT OF A DATABASE WITH WEB BASED USER INTERFACE FOR TAQMAN ASSAY DESIGN Supervisor Dr Conrad Bessant Date of Presentation 26 January 2007 Cranfield University 2007 All rights reserved No part of this publication may be reproduced without the written permission of the copyright holder UNIVERSITY Cranfield Nikol Simecek MSc by Research ABSTRACT TaqMan RT PCR reverse transcription polymerase chain reaction is a technique used to measure the relative gene expression in a biological sample and is one of the core technologies used by the Molecular Pathology and Toxicology MPT Group at GlaxoSmithKline Conducting TaqMan experiments is a complex process which involves the design of a TaqMan assay specific to a gene of interest A wealth of data has been generated during assay design but systems are not currently available to readily share this data within the MPT group There is a need for a central data storage repository so that data associated with assay design can be organised efficiently and rapidly accessed Experiments are conducted within limited timeframes and resource is often limited so this would be of great benefit to the MPT group This thesis describes the development of a database to house data associated with TaqMan assay design so
31. D PK User Id FK X User ID FK Study Type Study Number Study Title Study Location Filename K Plate Format Either or Last Name TAQMAN FILE File ID Gene Sequence ID User ID File Name Date Time created Date Time transferred A A RNA SAMPLE RNA ID PK Tissue Sample ID FK CDNA Cell ID j Fk lt CDNA ID PK Well ID PK Purity RNA ID FK Plate ID FK cDNA ID FK Concentration Assay ID EK Well position PRIMER PROBE PRID PK Assay ID FK TAQMAN ASSAY Start Assay ID PK Length P gt Fie D FK Melting Temperature Record GC content Amplicon Length Primer Probe sequence Penalty Type FP RP or PRB Figure 25 Example of Expanded Schema If the database was expanded there would be a need to address how the database would be populated with this additional data Manual data entry would not be practical and would possibly lead to inaccuracies One way of approaching this would be to perhaps implement a bar coding system for users to track and upload experimental data In fact there is already an initiative within GSK to use such a system within other departments so this could be a feasible option Another consideration is as the data expands procedures should be put in place so the 71 Cranfield UNIVERSITY Nikol Simecek MSc by Research database is backed regularly to prevent loss of data This can be performed us
32. GI pm module can be used in conjunction with Perl DBI to dynamically create web pages that display database query results As described in the objectives of this project there was a requirement to develop a simple interface to query the database and return the results to the user Perl is regarded as a relatively simple programming language and is considered to be an ideal choice for a biologist with limited or no prior computer programming experience This was an important factor to consider due to the limited timeframes for the development of this software and the lack of programming knowledge within the MPT group Perl is well suited to processing long strings such as DNA sequences Gibas amp Jambeck 2001 3 2 Interfacing with MySQL So that Perl could interface with MySQL the Perl modules DBI Database Independence and DBD Database Driver were downloaded from CPAN Comprehensive Perl Archive Network at http www perl com CPAN To test that these modules had installed correctly a short Perl program was written to connect to the database It simply calls the connect method from the DBI module to connect to the database If the connection fails an error message is displayed to the user This program was entitled test_database_connect pl and is located on the attached CD ROM 33 Cranfield UNIVERSITY Nikol Simecek MSc by Research 3 3 Program design and Implementation Data to populate the database could
33. HTTP Hypertext Transfer Protocol CGI Common Gateway Interface PERL Practical Extraction and Report Language Adapted from Guelich et al 2000 Figure 3 How a CGI application is executed 1 5 Project Aims The aims of this project are e The development and implementation of a well designed database to house the data collected during the design of TaqMan assays This will be achieved by o Establishing the goals and objectives of the database 14 Cran UNIVERSITY Nikol Simecek MSc by Research o Analysing the assay design process so that data types may be identified o Generating an Entity Relationship schema o Implementing the schema using an appropriate Relational Database Management System e The development of software to automate the upload of data into the database and an easy to use application for non SQL specialists to query the database This will be achieved by o Identifying and carefully planning the program requirements o Installing the appropriate software o Regular testing of the programs during development 15 Cranfield UNIVERSITY Nikol Simecek MSc by Research Chapter 2 Database Design and Implementation The first few sections of this chapter focus on the design phase of the database which consisted of defining database goals and objectives requirements analysis and entity relationship modeling The remainder of the chapter outlines database implementation from installing the re
34. Import gene sequence into Primer Express software Design TaqMan assay using Primer Express software Select another sequence no Was the software able to design assays yes GC content of Primer Probe Amplicon Melting Temperature of Primer Probe Amplicon Primer Probe sequence Primer Probe start position Primer Probe end position Length of Primer Probe Amplicon Penalty Export assay list to a txt file Select an assay that meets the design criteria no Could a selection be made yes Key l D ll ED ata colecien Save assay in a txt file and Name of assay selected File name Date ordered submit order to vendor Red Text Numeric Data type Blue Text Alphanumeric Data type Green Text Date Time Data type Figure 5 Flow Diagram of the Assay Design Process 2 4 Entity Relationship Modelling Once all the data had been captured during the requirements analysis the next step was to develop an Entity Relationship E R model The aim of the E R model was to 21 Cran UNIVERSITY Nikol Simecek MSc by Research visually represent this data and the relationships that exist between it in preparation for database implementation 2 4 1 Defining the entities attributes and relationships The first step in developing the E R model was to categorise the data attributes captured in the requirements analysis into logical groups entities The data wa
35. TA B 2004 Teach Yourself SQL in 10 Minutes SAMS GIBAS C amp JAMBECK P 2001 Developing Bioinformatics Computer Skills O Reilly GUELICH S GUNDAVARAM S BIRZNIEKS G 2000 CGI Programming with Perl O Reilly HAWRAMI K amp BRUER J 1999 Development of a flurogenic polymerase chain reaction assay TaqMan for the detection and quantitation of varicella zoster virus Journal of Virological Methods 79 33 40 KING K 2002 SQL tips and Techniques Premier Press KOCHANOWSKI B amp REISCHL U 1999 Quantitative PCR Protocols Methods 75 Cranfield UNIVERSITY Nikol Simecek MSc by Research in Molecular Medicine Vol 26 Humana Press MARSHALL OJ 2004 PerlPrimer cross platform graphical primer design for standard bisulphite and real time PCR Bioinformatics 20 15 2471 2472 MELONI J C 2002 Teach Yourself MySQL in 24 Hours SAMS PATWARDHAN N SIEVER E SPAINHOUR S Perl in a Nutshell O Reilly PEITZSCH R M 2003 Modeling Biology Using Relational Databases Current Protocols in Bioinformatics 9 3 1 9 3 28 PETERSEN J V 2002 Absolute Beginner s Guide to Databases Que Corporation RICCARDI G 2003 Database Management with Web Site Development Addison Wesley ROLLAND F D 1998 The Essence of Databases Pearson Prentice Hall STEIN L 2003 Creating Databases for Biological Information An Introduction Current protocols in bioinformatics 9 1 1 9 1 9 S
36. TEPHENS R K amp PLEW R R 2001 Database Design SAMS TISDALL J D 2001 Beginning Perl for Bioinformatics O Reilly 76 Cranfield UNIVERSITY Nikol Simecek MSc by Research Appendices Appendix 1 Flow chart for upload_gene pl Are there any txt files in the designated directory 46 Inform user and terminate Program yes Open File and save contents to an Array Go to next element no Last element Does element Contain one accession no Inform user and yes terminate Program Does the accession already exist In Taqbase Refer to flow chart for UPLOAD GENE SEQUENCE TABLE 77 Cran UNIVERSITY Nikol Simecek MSc by Research Flow Chart for Upload Gene Sequence Table Return a seq obj from GenBank By Accession Use BioPerl methods to retrieve the following from the seq obj SeqFeatures Species Sequence common name Retrieve tags and values for Gene synonym and product check gene subroutine check species subroutine Retrieve Gene id Retrieve Species id from TaqBase from TaqBase INSERT Gene_id Species_id Sequence Accession into Gene_ Sequence table 78 Cran UNIVERSITY Nikol Simecek MSc by Research SUBROUTINES Sub check gene Arguments passed into the subroutine gene synonym and gene_name Query database for gene and synonym Exists in the DB yes Do Nothing no Insert Gene name
37. UNIVERSITY Nikol Simecek MSc by Research Primer Express v 2 1 which automatically generates a list of 200 candidate assays The list of assays can be exported by the user as a text file to any specified directory The text file always consists of a header row and 200 records an example of which can be found on the accompanying CD ROM The format of the exported file always remains consistent as there are no options within the software to modify the data export parameters A description of the data contained within the text file is outlined below along with an example of the first 5 lines of a text file shown in Figure 4 Forward primer Probe Reverse primer Amplicon Start Length Tm GC Primer Start Length Tm GC Probe Start Length Tm GC Primer Length Tm GC Ta Penalty 1573 25 58 40 GTGCT 1599 26 68 54 CTCCC 1650 25 58 48 GTCCC 78 79 47 58 150 1572 26 59 38 AGTGC 1599 26 68 54 CTCCC 1650 25 58 48 GTCCC 79 79 47 58 156 3263 18 59 56 CGAGG 3282 19 69 74 CGCGI 3343 23 58 52 GATGC 81 83 58 61 160 1571 27 59 37 TAGTG 1599 26 68 54 CTCCC 1650 25 58 48 GTCCC 80 78 46 57 162 Figure 4 Example of the first 5 records in a text file exported from Primer Express Start refers to the starting position of the primer or probe relative to the entire gene sequence used for assay design Length refers to the length in bases of the primer probe or amplicon Tm is the melting temperature of the primer or probe This is the temperature at which 50
38. a Clicking on TAQbase Links the Find TaqMan Assay link will navigate you to a search page Here you can search for T TaN and export TaqMan Assay data a wre M You can also search for and download gene sequences by clicking on the Search Gene link A The exported sequences will be in the correct format for Primer Express primer design oeei Clicking on the Load TaqMan Assay link will navigate you to a page where you can upload Primer Express text files into the database External Links e Entrez e BSTAR e GATE Figure 15 Welcome cgi 4 2 Find TaqMan Assay This section illustrates how the user can query the database to retrieve assay data by clicking on the Find TaqMan Assay link on the welcome page Initially the user is navigated to a search page as shown in Figure 16 This page provides a link where the 56 Cranfield UNIVERSITY Nikol Simecek MSc by Research user can view all the assays that exist in the database TAQBase Links Enter Search Term e Home e Load TaqMan Assay To add a wildcard to your search Gene Symbol ray st RGA add after your search term Accession Assay file name All Eukaryotes External Links e Entrez e BSTAR Click here to view all genes with TaqMan Assays e GATE Genes will be listed in alphabetical order pes Pere 80072532 Reva DRA Mel mac enzyme 1 NM012600 NOM_912900 Rats aorvegc Prkwak4 putative protein kinase WNK4 AY187039 ag Daan Scanlb sodium channel noa
39. a total of 19 CGI programs o Templates Folder This contains 5 HTML template files o Perl Modules Folder This contains the Perl modules that are required for TaqBase to be fully functional o A mysqldump file called taqbase sql e Perl Programs Folder This contains all 3 Perl programs written for this project e There are two text files an example of a GenBank record and a Primer Express file e One pdf file containing an explanation of how penalty scores are calculated e One SQL file containing CREATE table statements for this database 82 Cranfield UNIVERSITY Nikol Simecek MSc by Research Appendix 3 User guide for installing the database and web based user interface locally on Windows XP 1 Download and Install MySQL e Click on the downloads link on the MySQL homepage http www mysql com Download MySQL community server by clicking on download as shown below MySQL Downloads am comfortable upgrading and configuring MySQL can resolve technical issues myself have DBA skills am familiar with database security best practices understand how to design and set up MySQL replication know how to improve MySQL performance I am fluent in open source take me straight to the packages MySQL Community Server Download 83 Cranfield UNIVERSITY Nikol Simecek MSc by Research e Scroll down the Web page until the following is reached Windows x86 ZIP Setup EXE 5 0 37
40. ams that were developed is outlined in the next three sections 44 Cran UNIVERSITY Nikol Simecek MSc by Research Welcome cgi Upload Assay Search Gene Find Assay Upload Assay Browse_asSay cgi File_copy cgi Select_files cgi Upload_Assay cgi Search Gene Search_Gene cgi GenBank_ Results cgi Files_downloaded cgi Find Assay Find_assay cgi all_genes cgi View_Assay cgi amplicons cgi Display_data cgi Export_assay cgi 4 Export_data cgi Figure 13 Summary of the CGI programs that were developed 45 UNIVERSITY Cranfield Nikol Simecek MSc by Research 3 6 1 Find TaqMan assay This section describes the CGI programs that were developed to retrieve and display data associated with TaqMan assays e find_assay cgi This script generates an HTML page which consists of a text field so the user can enter a search term to query the database and retrieve a list of assays The search term can be limited according to species drop down menu gene symbol accession and assay file name radio buttons Using a drop down menu for species is an example of the utilisation of controlled vocabularies see section 2 5 3 for definition This enables the database to be easily queried since the user is requested to select a species from a pre defined list This avoids typographic errors or the use of ambiguous search terms which may return no results to the user The pa
41. art Length Tm GC Probe Start Length Tm GC Primer Length Tm GC Ta _ Penalty 1573 25 58 40 GTGCT 1599 26 68 54 CTCCC 1650 25 58 48 GTCCC 78 79 47 58 150 1572 26 59 38 AGTGC 1599 26 68 54 CTCCC 1650 25 58 48 GTCCC 79 79 47 58 156 3263 18 59 56 CGAGG 3282 19 69 74 CGCGI 3343 23 58 52 GATGC 81 83 58 6l 160 1571 27059 37 TAGTG 1599 26 68 54 CTCCC 1650 25 58 48 GTCCC 80 78 46 57 162 PRIMER PROBE TAQMAN ASSAY Figure 11 Data source for the Primer Probe and TaqMan assay tables There were several important factors to consider whilst planning the program e Assigning the correct gene id to the file Since text files exported from Primer Express do not contain any reference to the sequence they were derived from assigning the correct gene sequence id was particularly challenging There is the option for the user to name their file with the accession number however this is prone to errors e g typographical or the assignment of an incorrect accession and cannot be relied upon e Preventing duplication of data in the database so that database redundancy could be minimised e Ensuring that records in the TaqMan file TaqMan assay and primer probe tables were related to each other with the correct keys Solutions to these issues are outlined in the brief description of the program below A more comprehensive flow chart of the program can be found in Appendix 1 Before the program could be executed it was necessary to p
42. at data can be quickly accessed navigation around the database is relatively easy and groups of data can be related to each other King 2002 Stephens and Plew 2001 Network databases are an improved version of the hierarchical database model as they allow for each child table to have many parent tables Child tables can be easily Cranfield UNIVERSITY Nikol Simecek MSc by Research accessed without the need to access the parent table first This ensures that the data is retrieved in a more efficient manner Stephens and Plew 2001 The main disadvantage with network databases is that modifications to their structure such as adding new tables or fields is difficult King 2002 Relational databases originally proposed by Dr E F Codd in the 1970s are more flexible and provide a powerful way of organising and accessing data A relational database consists of a group of related tables with the tables categorised in a logical manner The tables consist of a number of rows and columns Each row record contains a collection of data items fields with each item described by the column attribute The tables are related to each other through common column values called keys Buchanan 2002 Stephens and Plew 2001 Advantages of the relational database model include reduced data redundancy which allows for more economical data storage and ease of database modification and easy retrieval of data As a result the relational database mode
43. ated to the primary key These should be placed in a new table e Third Normal Form o The rules of the first and second normal form must be met o No attributes depend on other non key attributes i e there should be no fields in the table that can be broken down further There are additional normal forms however these are currently mainly theoretical and scarcely used In addition to reducing data redundancy the normalisation process aims to minimise null values Null values are difficult to interpret since they can have one of a number of definitions for example null can either mean the information does not exist has not been entered or is not applicable Normalisation also aims to prevent loss of information known as deletion anomaly Rolland 1998 since it is possible to lose data unintentionally when a row in a table is deleted 11 Cranfield UNIVERSITY Nikol Simecek MSc by Research 1 4 6 Relational Database Management Systems Database Management Systems DBMS are software packages that allow for the access and storage of data Examples of commercial Relational Database Management Systems RDBMS include Oracle Microsoft Access Microsoft SQL server and examples of open source products include PostgreSQL and MySQL Stein 2003 DBMSs allow multiple users to access the data simultaneously using a query language Stephens and Plew 2001 Security can be enforced by limiting who can access and or update the database and t
44. ation Wizard MySQL Server Instance Configuration Configure the MySQL Server 5 0 server instance Ready to execute C Prepare configuration C Write configuration file Start service C Apply security settings Please press Execute to start the configuration e Click on Execute and when complete click on Finish to close the Wizard 2 Create TaqBase e Unzip the TaqBase folder on the supplied CD ROM to a temporary directory e Transfer TaqBase sql located within the TaqBase folder to the following directory your file path MySQL MySQL Server 5 0 bin e Go to the command prompt and change the directory by typing cd c your file path path mysql mysqI server 5 0 bin for example c Shorcut to c command Microsoft Windows XP Version 5 1 2666 lt C gt Copyright 1985 2661 Microsoft Corp C WINDOWS system32 gt cd c mysql MySQl1 Server 5 bin The system cannot find the path specified C WINDOWS system32 gt cd c Program Files mysql mysql server 5 bin C Program Files MySQL MySQL Server 5 bin gt 89 Cran UNIVERSITY Nikol Simecek MSc by Research e At the prompt type Mysqladmin uroot ppassword create taqbase replacing password with the password that was entered during the configuration of MySQL e At the command prompt change the directory as follows cd c your file path mysql mysql server 5 0 data e Then type mysql hlocalhost uroot ppassword taqbase lt taqbase sq again rep
45. bly enhanced by the development of a fully integrated system This would involve the incorporation of an algorithm for designing TaqMan assays within the system There are a number of web based resources that could be used to achieve this goal For example there are a number of BioPerl modules such as Bio PrimerDesigner which could be adapted to design TaqMan 73 Cranfield UNIVERSITY Nikol Simecek MSc by Research primers and probes Alternatively an open source primer design application called PerlPrimer Marshall 2004 written in Perl is available for download at perlprimer sourceforge net Assay data could then be immediately uploaded into the database thus eliminating the need to separately launch the primer design software Also the difficulties associated with assigning the correct gene sequence ids to TaqMan assay files could be easily resolved 5 5 Conclusions A database to house the data associated with TaqMan assays has been successfully designed and implemented Programs to automate the upload of data have been written and integrated into the final CGI application which has been developed so that the database can be easily queried and uploaded by users without any knowledge of SQL Additional error checking however needs to be incorporated into the programs and further testing needs to be performed to ensure reliability and accuracy of the data within the database Before the system can be used routinely within the g
46. ch an assay had already been designed As a result the productivity of the group would increase which is particularly important in a business environment Databases provide an ideal solution as data is organised easily accessed and updated 1 4 1 Database types There are several types of database model available for the storage of data These include flat file hierarchical network relational and object orientated database models Stephens and Plew 2001 A flat file database is the most basic type of database and is simply a collection of files stored in an orderly manner The file usually in text format consists of data with a delimiter to separate one field from another Buchanan 2002 There are many disadvantages with this model for example the user is required to know the physical location of the data It is also impractical to perform manual searches and so programs are required to access the data With larger data sets using a flat file system becomes inefficient Gibas amp Jambeck 2001 Stephens and Plew 2001 Hierarchical databases consist of tables populated with data arranged in hierarchies similar in structure to family trees or organisational diagrams The parent or root table at the top of the tree has child tables with related data below it Stephens and Plew 2001 A parent table can have many child tables but each child record must have only one parent record King 2002 The main advantage of these databases is th
47. controlled using column constraints which safeguard against incorrect or inappropriate data being added to the database The data that would populate the database could be described by the following data types e Unsigned Integer This is a normal sized integer within the range of 0 to 4294967295 e Text This is a field that can hold string data with a maximum length of 65535 characters e TinyText This is a field that can hold a maximum of 255 characters e Datetime This is a date and time combination in the following format YYYY MM DD HH MM SS e Enum This is an enumeration i e list A value must be selected from a list of values that has been created 27 Cranfield UNIVERSITY Nikol Simecek MSc by Research e Timestamp This is date time in the following format YYYYMMDDHHMMSS Each of the primary keys would be generated automatically by MySQL using the auto increment function which adds the next highest integer in a field Table 3 summarises the data types of each of the attributes Table 3 Description of the attributes for each entity Columns GENE_ID GENE_SYMBOL GENE_NAME GENE_SEQ_ID GENE_SEQ GENE_SEQUENCE GENBANK_ID GENE_ID SPECIES_ID SYNONYM ID GENE_SYNONYM GENE_ID SYNONYM PR_ID PR_START PR_LENGTH PR_TM PR_GC PR_SEQ PR_TYPE ASSAY_ID PRIMER_PROBE SPECIES_ID SPECIES COMMON_NAME SCIENTIFIC_NAME Data Type NTEGER TINY TEXT TEXT NTEGER TEXT TINYTEXT NTEGER NTEGER NTEGER NTEGER
48. d a sequence must belong to one gene SPECIES GENE A species may have many One to Many SEQUENCE gene sequences and a gene sequence must belong to one species GENE TAQMAN FILE A gene sequence may have One to Many SEQUENCE many TaqMan files derived from it A TaqMan file can only be derived from one sequence TAQMAN FILE TAQMAN A TagMan file may consist of O7 Many ASSAY many TaqMan assays A TaqMan assay can only belong to one TaqMan file 23 fra Cranfield UNIVERSITY Nikol Simecek MSc by Research TAQMAN PRIMER PROBE A TaqMan assay consists of t Many ASSAY more than one primer probe A primer probe can only belong to one TaqMan assay As previously described many to many relationships should be resolved as they can cause confusion and are difficult to maintain Initially there were instances where the relationship between entities was many to many For example the gene name attribute in the gene table originally included records for the official gene name in addition to alternative gene names synonyms This meant that there was a many to many relationship between the gene entity and the gene sequence entity since a gene sequence could have more than one gene name and a gene name could be represented with more that one sequence The process of normalisation eliminated such relationships and is outlined in the next section 2 4 2 Normalisation
49. d from the first record in the Primer Express file The SQL statement retrieves the gene id where the substring of a gene sequence determined by the probe start position and length is an exact match of the probe sequence If a gene sequence id is retrieved then the TaqMan file table and subsequent tables Regular expressions allow for pattern matching within strings 40 Cranfield UNIVERSITY Nikol Simecek MSc by Research are populated with data So that the assay table could be related to the TaqMan file table the correct file id is required The database is queried to retrieve the most recently inserted auto increment value This corresponds to the required file id since the file table is the most recently updated table Each record along with the file id is then inserted into the TaqMan assay table After each record is inserted the most recently inserted auto increment value i e assay id is retrieved so that the assay table could be related to the primer probe table Rather than using the INSERT command to insert records one by one in the primer probe table 600 records for 1 assay file data for the primer probe table including the assay_id is saved to 3 text files Each text file contains data for forward primer reverse primer and probe respectively Data from the text file is directly uploaded into the database using the LOAD DATA INFILE command This loads data in the database far more quickly approximately
50. d with gene name free text and gene 67 Cranfield UNIVERSITY Nikol Simecek MSc by Research ontology in addition to the accession number 5 2 3 Transaction Processing Transaction commands were used in the upload assay programs to limit the presence of non related data in the database They maintain database integrity by ensuring that groups of SQL queries are executed completely or not at all so no operations are aborted mid processing For example a system failure may lead to the interruption of data upload so that a table is only partially populated with data or a series of related tables would not be populated This would result in database integrity being compromised Forta 2004 5 3 User Interface The final phase of this project was to develop a user interface so that the database could be easily queried and results displayed to the user A CGI application was developed to achieve this task It consisted of a welcome page with links to HTML pages for uploading TaqMan assay data searching for gene data and searching for assay data 5 4 Future work This section discusses future work that could be carried out to expand the database schema improve the programs and increase the functionality of the user application 5 4 1 Database expansion Although the database designed and implemented for this project will be a valuable resource to the MPT group in its own right expanding the database to incorporate 68
51. e sequence database and uploaded into in the local database Potentially this could be achieved by submitting the primer and probe sequences into a BLAST Altschul et al 1990 program A list of similar 72 Cranfield UNIVERSITY Nikol Simecek MSc by Research sequences would be returned The program could then loop through this list until the primer and probe sequence matched at the specified position on the retrieved sequence Sequence data could then be uploaded into the database and the correct gene sequence id retrieved This approach would need to be investigated further to confirm that it is feasible As with many applications there are many features which could be included to enhance the interface Examples include e Enabling batch searches For example it would be useful if the search gene HTML page included a batch search option where the user could submit a list of genes to query the database e Browsing for multiple assay files Including an option where the user can browse and upload multiple assay files from the interface e Enabling the user to submit BLAST queries on the amplicons that are shown on the display_amplicons cgi page This would provide additional data relating to the specificity of an assay which is a consideration when using a TaqMan assay in an experiment e Allowing flexibility for uploading TaqMan assay data from sources other than Primer Express text files The CGI application could be considera
52. e table by passing record into load file subroutine Retrieve last insert id i e file_id and no save as insert_id 4 Load data into assay and primer probe table by passing insert_id record into load assay subroutine 80 Cran UNIVERSITY Nikol Simecek MSc by Research SUBROUTINES Sub check_ DB Arguments passed into the subroutine assay_file names l Foreach file perform an SQL query to retrieve file_name from Taqman file subroutine File in DB yes Go to next file in the array l no Save to an array not_in_DB Return not_in_DB values to main program Sub gene_id Arguments passed into the subroutine record Save probe seq start position and length into variables l Query the database to retrieve gene_id WHERE SUBSTR gene_seq probe_start probe_length probe_seq Is there one match Return Gene_id to main program 81 Cranfield UNIVERSITY Nikol Simecek MSc by Research Appendix 2 Contents of the accompanying CD ROM Below is a list of files that are included on the accompanying CD ROM They have been cross referenced throughout this thesis e Zipped folder entitled Taqbase This contains all the necessary components to install TaqBase on a blank system The following items are located within this folder o CGI Programs Folder This contains all the CGI programs that were written for user interface implementation There are
53. e users attempting to alter the same data Data integrity is implemented by having column or table constraints rules so that inappropriate values are not entered into the database Stein 2003 In addition default values can be used in order to minimise manual input of data Referential integrity is enforced by the use of keys so that tables can be related to each other A primary key is a column with unique entries so that records can be differentiated from each other Stein 2003 In addition to its primary keys a table may have fields that correspond to keys in other tables These are referred to as foreign keys Primary and foreign keys can comprise of more than one column in some cases It is important to maintain referential integrity by ensuring that the relationships between tables remain consistent For example a table s foreign key value must match the value of the primary key in the table of which it is related to UNIVERSITY Cranfield Nikol Simecek MSc by Research 1 4 3 Relationships As mentioned in the previous section tables in a relational database are related to each other by primary and foreign keys An example is illustrated in Figure 2 SPECIES Species ID Common Name Scientific Name GENE SEQEUNCE Sequence ID Seqeunce Length Species ID Figure 2 Example of two tables related by keys Relationships can be classified as one to one one to many or many to many Rolland
54. ecosgsenestsassonssassonsassaosdedessssncoseoescecbansese 56 4 1 Welcome PARE ies viet scekeiebet puss h tee G iG slates adh iowa bet ALG sa E E E ioe 56 4 2 Find TaqMan ASSAY sscsessesseescuseeseeseescesecasesccucescsaeeceesecacesecaeeeeesaeeseaeessesesaeeseeneseeeeasenes 56 4 3 Upload TAGMGN ASSAY piaren pe a e ea ai E E E s 60 4 4 Searc GENE iiaeaa e E E E a a ee seeeeat ata 60 Chapter 5 Discussion and Conclusions sscccssscssssscssssseescssssssecsscssesssssesssssnessessessessessesenses 63 Cranfield UNIVERSITY Nikol Simecek MSc by Research 5 1 Database design and implementAation scccccccscceceescesesssesecseesecuseeecuseeseesecaeeeceeeecnseeeeeasenes 63 3 2 Software Development sisien iai soii eon E E Ti E E aea Eiaa 64 92 1 Upload Assay Ph ensreicesiecnnn entana a E a a 64 5 22 Uplo d Gen Plerin cesses sises ancby lines nene aE nE a ENA EEOSE EREE EE TEENE Eei 67 5 2 3 Transaction PrOCESSING oss csc cesscossaisscsstes ccdycnsecssauwsonss ysessosacouse aai i r S EE EEEa EEE 68 5 3 User ANG CTF ACE escent ecestewusen itsesstnedieestebietessesdaevanesSbsvenesSuebceeststuewenducteaysdusvestedvexsvpdaveeeanentes 68 5 4 F t re Wok eee eee rer rere ree er ere ae eerreeee ep errr eetp rer AEE r err er per E S 68 S41 Database expansion iii cocci Leelee A ee esi de a 68 DAD RDBMS Upstade cc 3 isi ses ccveguscacesives sacsseed sense csssuuseussgenss nea i E E i E E aKa iaia 72 5 4 3 Software iMprovements
55. ema sscsscssssssssscsscsscsscssssssssssesccsnsssessssssesesenessessssosseseees 71 vi Cranfield UNIVERSITY Nikol Simecek MSc by Research TABLES Table 1 Entities and their attributes ccssssscsssscssssssscsscsssessssssesssssescesssssessssssesesenessessessosssseees 22 Table 2 Description of the relationships between entities ssceccsssccsssscescssssesssensssesssscsesseees 23 Table 3 Description of the attributes for each entity ccsccscsssssssessscssssessscssssesssesessssssssssesesees 28 vil Cranfield UNIVERSITY Nikol Simecek MSc by Research Chapter 1 Introduction and Literature Review The role of Safety Assessment at GlaxoSmithKline is to support the selection of targets and molecules with the lowest probability of toxicity thus enabling safe clinical trials and successful compound registration The Molecular Pathology and Toxicology MPT group within Safety Assessment use a number of Molecular Biology techniques to investigate toxic mechanisms of compounds in development One of the principal technologies used within the MPT group is TaqMan RT PCR reverse transcription polymerase chain reaction It is a targeted approach used to assess the expression of specific genes within a sample and it is one of the most sensitive techniques for mRNA messenger RNA detection and quantification Its main applications within MPT are Elucidating mechanisms of action of
56. en the program is executed it initially checks for the existence of a text file containing accession numbers in the designated directory The database is then queried with the accession number to see if it already exists in the gene sequence table This is to prevent duplication of data within the database thus ensuring database efficiency If the accession exists in the database the program proceeds onto the next accession number in the list If the accession does not exist then a query is submitted to GenBank Gene sequence gene name gene synonym gene description and species are then extracted from the GenBank record So that data in the gene sequence table can be related to the species 35 Cran UNIVERSITY Nikol Simecek MSc by Research and gene tables gene_id and species_id are required to populate the gene sequence table along with the gene sequence In order to retrieve the correct ids from these tables the species and gene data retrieved from GenBank is used to query the species and gene tables respectively If the species and or gene do not exist in the database the program first inserts the gene and or species record and then retrieves the appropriate id This program was used to populate the database with gene data where assays had been designed by the MPT group Accession numbers were collated representing a comprehensive list of all assays that have been designed within the group These were placed in a text
57. ere captured in the database design A description of the process is outlined in the next section 2 3 1 TaqMan assay design The initial step in designing a TaqMan assay is to select a gene sequence for the gene and species of interest There are 3 main repositories for known genetic sequences These are the U S National Center for Biotechnology Information Genetic Sequence Data Bank GenBank European Molecular Biology Laboratory EMBL and the DNA databank of Japan Each contains almost identical information due to international cooperative agreements A gene sequence representing the gene of interest is retrieved as a text file from one of these nucleotide sequence databases along with its accession number Additional data is also retrieved from this source including the official gene name gene description a list of gene synonyms and the scientific and common name for species The gene sequence is imported into the Applied Biosystems primer design software m Accession numbers are unique identifiers of sequences within publicly available sequence databases Often there are many names used to describe a single gene within the public domain however a gene has an official name which is determined by recognised committees such as Human Gene Nomenclature Committee HGNC International Committee on Standardized Genetic Nomenclature for Mice and Rat Genome and Nomenclature Committee 18 Cranfield
58. ere developed ssccsssscssssssecsssensssesesesesesseees 45 Figure 14 Amplicom ccscsscsscssssscssessssssssccsssssessesssessssncssesesssosssssnesssssessesscssessnsssesesenessessessossseoss 51 Figure 15 Welcome cgi sscssssssssssssssssssssscessssssssssssesssssessesssssosssssssssssnessesnsesosssssnsssssnessessessosesssoss 56 Figure 16 HTML pages for find_assay cgi and all_genes CQi scccssscssessssscssssesscenessesssssesesesees 57 Figure 17 HTML pages for View assay cgi and limits cgi ssscssscsssccsssssescsessesssesessesssecsesesees 58 Figure 18 HTML page for display_amplicons and export_ata c i ccsssscssssssssesssssssseceseseeees 59 Figure 19 HTML page for display_data cgi and export_assay CQl sccccsrsscssesssssessscssssscessseseee 59 Figure 20 HTML for Select_Files cgi and upload _assay cgi cscssscssssscscscscscssccsscscscessssesscesseees 60 Figure 21 Search _gene cgi sssccscssesssssscsscssesssescsssnessssnossessessescsssnsesssnesccsnessesenssnesessnessessessosssssoes 61 Figure 22 Genbank_results cgi and files_downloaded cGi s scsssssssscssssscescssssesssenessessessesesseese 62 Figure 23 Section of the Primer Express text file ssccscssssssssesssssesssccsssssessssssesssenessessessoseseoss 66 Figure 24 Relationship between user and TaqMan file table scsssccssssssssssssssensssesssecesesseess 69 Figure 25 Example of Expanded Sch
59. ess involves using software to design primer and probes specific to a genomic sequence On receipt of the primer and probe sequence the oligonucleotides are synthesised by vendors such as Proligo www proligo com They are then ready to use in a TaqMan experiment Before gene expression can be measured in a tissue or cell sample a number of processes need to be carried out The first step is the isolation of RNA Once RNA has been isolated the quantity and purity of RNA is determined using a spectrophotometer The integrity of each RNA sample is checked by running each sample on a gel Since RNA is unstable and prone to degradation an aliquot of RNA is reverse transcribed or copied into cDNA by following a standard protocol Once the reaction is complete levels of gene expression can be assessed in the cDNA sample The expression levels of the selected genes are measured in the samples of interest by applying an aliquot of each assay forward primer reverse primer and probe to an aliquot of sample cDNA derived from an animal or cell culture Cranfield UNIVERSITY Nikol Simecek MSc by Research experiment in one well of a 96 or 384 well plate The position of each sample and assay in the plate is recorded either in a laboratory notebook or by manually entering the details in an Excel spreadsheet The plate is then placed inside a sequence detector which measures fluorescence emission in each well during each PCR cycle This data
60. file and the Upload_Gene pl program was executed The flow chart in Figure 9 summarises the program flow A more detailed flow diagram can be found in Appendix 1 The Perl code for upload_gene pl is on the accompanying CD ROM 36 Cranfield UNIVERSITY Nikol Simecek MSc by Research Next Sequence Accessions y gt yes no Subm itQ uery t G enbank Retreve gene nam e description Synonym species sequence from GB record no no Insert data into SPECIES Insert data into GENE SEQ Insert data into GENE Insert data into SYNONYM Figure 9 Flow diagram for Upload_Gene pl 3 3 2 Upload_Assay pl Once the database had been populated with gene data the next phase was to develop 37 Cran UNIVERSITY Nikol Simecek MSc by Research a program to upload data from Primer Express text files into the database Initially a spider diagram was created outlining the objectives of the program This is shown in Figure 10 pload_Assay p Figure 10 Spider Diagram outlining the objectives of upload assay pl Figure 11 shows the header row and the first 4 records of an exported Primer Express text file and which table the data would be uploaded into A full description of the data is described in section 2 3 1 38 Nikol Simecek MSc by Research Cranfield UNIVERSITY Forward primer Probe Reverse primer Amplicon Start Length Tm GC Primer St
61. ftware to populate the database with minimal user interaction and a web based CGI application for members of the MPT group to query and submit data to the database Finally the output from testing the software is provided and discussed Cranfield UNIVERSITY Nikol Simecek MSc by Research ACKNOWLEDGEMENTS GlaxoSmithKline I would like to thank the Investigative Preclinical Toxicology group at GlaxoSmithKline for sponsoring this project In particular I would like to thank Stephanie Gresham and Dr Jon Lyon for their support throughout this project Cranfield University I would like to thank Dr Conrad Bessant for supervising this project providing invaluable advice where needed and for reading this thesis I would also like to thank the members of the Bioinformatics group for providing support when required Cranfield UNIVERSITY Nikol Simecek MSc by Research Chapter 1 1 1 1 2 1 3 1 4 1 4 1 1 4 2 1 4 3 1 4 4 1 4 5 1 4 6 1 4 7 1 4 8 1 5 Chapter 2 2 1 2 2 2 3 2 3 1 2 4 2 4 1 2 4 2 2 5 2 5 1 2 5 2 2 5 3 TABLE OF CONTENTS Introduction and Literature Review sssscssssssecsessesessessesessessssessessesessassesssessesess 1 Polymerase Chain ReQction ccccccccceecceesseescesecesecesecesecsecaeeeseeeseeseeeeeeseecsaesusecaecsaecnaeeaeeeneees I TagMan RT POUR cieie onone TNE couees ee ENEE IEEE ON AERE 2 TaqMan RT PCR Experimental Protocol 0 1ccccccesceessees
62. g on the Search Gene link on the welcome page After clicking on this link the user is navigated to a search page as shown in Figure 21 60 Cranfield INIVERSITY Nikol Simecek MSc by Research TAQBase Links Enter Search Term e Home a e Load TaqMan Assay Free Text Mouse Human Gene Symbol Dog External Links Accession All Eukaryotes Gene Ontology e Entrez e BSTAR e GATE Figure 21 Search_gene cgi Once the user has submitted a search query the results are displayed in a table as illustrated in Figure 22 and the user can click on the GenBank accession to view the original record or download a GenBank file containing the gene sequence of interest 61 Cranfield UNIVERSITY Nikol Simecek MSc by Research Results for enos Genbank Accession Description NM 012611 NM 175761 NM 021838 NM 053683 NM 052799 NM 019155 NM 133651 NM 031556 NM 030851 NM 024356 NM 017090 NM 013012 Rattus norvegicus nitric oxide synthase 2 inducible Nos2 mRNA Rattus norvegicus heat shock protein 1 alpha Hspca mRNA Rattus norvegicus nitric oxide synthase 3 endothelial cell Nos3 mRNA Rattus norvegicus NADPH oxidase 1 Nox1 mRNA Rattus norvegicus nitric oxide synthase 1 neuronal Nos1 mRNA Rattus norvegicus caveolin 3 Cav3 mRNA Rattus norvegicus caveolin Cav transcript variant 2 mRNA Rattus norvegicus caveolin Cav transcript variant 1 mRNA Rattus nor
63. g the template the probe is cleaved between the reporter and quencher dye by the 5 nuclease activity of the polymerase The reporter dye emits fluorescence as it is no longer suppressed by the quencher dye Hawrami amp Bruer 1998 This is summarised in Figure 1 Cleavage will only occur if the probe is hybridised to its specific target Reporter fluorescence increases during each PCR cycle and is proportional to the amount of PCR product Fluorescence levels are measured at each PCR cycle by a detector and the starting amount of template can be calculated Hawrami amp Bruer 1998 Fluorogenic probe Quencher _ IP se 1 Polymerization 5 3 az primers Forward 2 Strand per 2 z displacement 5 _L Z_ZZZ Revene pna z_ 3 5 3 Cleavage 5 T 240 S mMm Reverse T 9 Forward 4 Ploymerization completed 5 IIIN Figure 1 TaqMan Chemistry UNIVERSITY Cranfield Nikol Simecek MSc by Research 1 3 TaqMan RT PCR Experimental Protocol The goal of a TaqMan experiment is to measure the expression levels of one or more genes in samples taken from an animal or cell culture experiment There are three components that comprise a TaqMan experiment e Assay Design e Sample Preparation e Gene Expression Measurement If an assay is not already available for the desired gene and species a new assay consisting of a forward primer probe and reverse primer should be designed This proc
64. ge also contains a hyperlink to all_genes cgi e all _genes cgi This displays an HTML page consisting of a list of all assay files and their respective genes gene description accession and species that are present in the database e view_assay cgi This script queries the database using the search parameters received from the find_assay cgi script A list of assay files along with their associated gene name and accession are retrieved from the database The results are displayed on an HTML page along with a checkbox against each result At the bottom of the page there is a scrolling box which contains primer probe design criteria and a link which navigates the user to limits cgi e limits cgi This is a static HTML page which displays a full description of the 46 Cranfield UNIVERSITY Nikol Simecek MSc by Research primer design criteria e display_amplicons cgi This script queries the database for assay_id penalty score and primer probe sequences using the file name and limits received from the view_assay cgi script A list of amplicons with their associated assay ids and penalty scores are displayed on an HTML page along with a checkbox for each amplicon The amplicons are colour coded with the primer and probe sequences coloured red and green respectively The remaining bases are coloured black Each assay id provides a link to display_data cgi e export_data cgi This program exports data associated with the selected amplico
65. he data upload as possible The initial sections of this chapter describe the development of software to automate data upload into the database in order to minimise user interaction The remainder of the chapter focuses on the development of a CGI application so that the database can be queried by members of the MPT group 3 1 Perl Perl Practical Extraction Reporting Language was chosen as the programming language for this project The rationale for choosing Perl is outlined below e Modules can be downloaded for free from websites such as http www cpan org and http www bioperl org Tisdall 2001 This is helpful when time and programming expertise are restricted since existing code can be used or modified by the developer BioPerl modules for example contain extremely useful bioinformatics functions such as sequence manipulation and access to various biological databases This was particularly relevant for this project where data would be sourced from NCBI and uploaded directly into the database CPAN Comprehensive Perl Archive Network provides access to Perl modules that can be used to manipulate relational databases which was another key component of this project 32 Cranfield UNIVERSITY Nikol Simecek MSc by Research Perl is considered to be an ideal language for CGI Common Gateway Interface scripting CGI programs run on a Web server to process a form or perform a search and return the results to the client The C
66. hey also provide support for backup and recovery Stein 2003 1 4 7 Structured Query Language Structured Query Language SQL is a standardised query language used to communicate with relational databases Buchanan 2002 It is a declarative language i e it does not describe how data should be accessed but only what data to access SQL allows data to be modified deleted and retrieved Peterson 2002 and consists of three sub languages Stephens and Plew 2001 e Data Definition Language DDL used to define database structure e Data Manipulation Language DML used to modify data e Data Query Language DQL which allows for retrieval of data 1 4 8 Database User Interface As with most laboratory based groups knowledge of SQL within the MPT group is virtually non existent It is therefore necessary to produce a well designed application whereby the users can easily query and load data into the database 12 Cran UNIVERSITY Nikol Simecek MSc by Research A popular approach is the design of networked database applications Many biological databases are accessible via a Web interface so that data can be easily accessed and shared throughout the scientific community The following examples are routinely used within the MPT group Genetic Sequence Data Bank GenBank This database contains all publicly released genetic sequence data and can be accessed via the National Center for Biotechnology Information NCBI
67. ible for maintaining this server with questions The Apache Software Foundation which wrote the web server software this site administrator is using has nothing to do with maintaining this site and cannot help resolve configuration issues The Apache documentation has been included with this distribution You are free to use the image below on an Apache powered web server Thanks for using Apache ee eac H E Install CGI files and template files e Locate the CGI programs folder which also contain the TaqLibrary pm perl module within the Taqbase folder you have already unzipped e Transfer all programs within the folder to this location Your file path Apache Group Apache2 cgi bin e Open the Taqlibrary pm in a text editor such as notepad and make the changes requested in the module and then save e If you access websites via a proxy server open genbank_results cgi in a text editor and remove the from the following configureProxy query_ obj 96 Cranfield UNIVERSITY Nikol Simecek MSc by Research configureProxy dbh e Re save the file e Locate the Templates folder within the Taqbase folder e Transfer the folder and its contents to Your file path C Program Files Apache Group Apache2 htdocs 6 Launch TaqBase If all the previous steps have been followed correctly TaqBase should be ready to use as follows e Launch your Browser e At the browser type http 127 0 0 1 cgi bin welco
68. ing the mysqldump application The output file created by this command contains the commands to create and populate the tables Meloni 2002 5 4 2 RDBMS upgrade MySQL software is continually under development with additional features added for each subsequent version As of writing this thesis the most current version of MySQL is version 5 0 There are later versions of MySQL available 5 1 and 5 2 but these are pre production releases It is recommended to save the database tables and its contents using mysqldump then install the latest version of MySQL and reload the tables and their contents Alternatively the database could be implemented in a commercial RDBMS where support is available within GlaxoSmithKline for example Microsoft SQL server or Oracle Oracle is reliable highly scaleable and has many tools to manage databases Microsoft SQL is also a powerful DBMS with many advanced features such as data mining Buchanan 2002 If the database developed for this project is expanded then these RDBMS s should be considered 5 4 3 Software improvements As described in section 5 2 1 the upload of assay data into the database was not a fully automated process If an assays corresponding gene sequence did not exist in the database the user would be prompted to upload the gene sequence data before re loading the assay data Ideally code should be written so that the gene sequence is automatically retrieved from an external nucleotid
69. ious experiments would be invaluable The next natural step in expanding the database would be to include experimental data and TaqMan results as described in section 1 3 Since the current database has been carefully designed additional entities could easily be included An example of an expanded schema which includes entities and attributes for experimental data and TaqMan results is shown in figure Figure 25 This schema has been normalised to the 3 Normal Form using the methods described in section 2 4 2 70 SPECIES Species ID Common Name Scientific Name Cranfield UNIVERSITY Nikol Simecek MSc by Research Composite key ANIMAL TREATMENT Animal ID PK Treatment ID FK Sequence ANIMAL Animal ID Sex Time of Cull TISSUE SAMPLE Tissue sample ID Animal ID Tissue Type Storage Species ID lt Study Number Animal Number GENE SYNONYM Synonym ID Gene ID Synonym PK FK GENE SEQUENCE GENE Gene Sequence ID Gene ID Gene ID Gene Symbol Species ID Gene Name Accession Gene Sequence PK Composite key CELL TREATMENT TREATMENT Treatment ID PK Name Concentration Time of Admin Treatment ID FK Sequence CELL CULTURE Cell ID PK Study Number FK Treatment ID FK lt I Species ID FK Culture vessel Time of Collection Cell Line Media STUDY Study Number PK APlateI
70. iption is a checkbox so the user can select a record for download The accession provides a hyperlink to the original GenBank record for the user to view e Files_downloaded cgi This program uploads gene data into the database and is based on the program Upload_Gene pl outlined in section 3 3 1 Sequence data is downloaded as a text file to the designated directory specified in the Taqlibrary pm and an HTML page is displayed to the user indicating that the sequence files have been downloaded to the designated directory 3 7 Program design challenges and solutions 3 7 1 HTML Template During the early stages of writing the CGI programs HTML was embedded within the logic of the Perl code As development progressed and the programs increased in size they became difficult to follow and the identification of errors and altering the programs became more challenging A decision was made to separate the HTML code from the Perl code within the CGI program Whilst this was appropriate for many of the CGI programs this approach could not be applied if the Perl code contained loops and the output needed to be displayed as an HTML page The Perl module 49 Cranfield UNIVERSITY Nikol Simecek MSc by Research HTML Template provided a solution to this problem This module extends HTML with a few extra tags and enables the programmer to pass loop data from a CGI script into a template file containing HTML The CGI program points to the template
71. jeCtives cscesccsssesssseencesecssesecceeneseecsusecacesecacescesasenesaecaeesesaeessenaeenssasease 41 3J Installation and configuration of Apache ccscscceseescesesssesecssesecuseeecuseeseeseeaeesecaeeeecnaeeeeeaeeaes 43 3 6 User Interface Development sisccsseccnesscebicessscanevaswstasvonssvtessev5iseueoenesuteawsabuveswesterestbsseveanense 44 3 6 1 Find TaqMan assay c ccsssscesccecsseceeececsseceseeecaecesneecsaeceseeeceaeeeeeeecsaeeseneecaeceeeeessaeeeeenees 46 3 6 2 Load VaqMan ASsay sesiscvseccsuccssessiecsacsviicsncbsdenvaes van erin eE sets tbcuandeusbassansoeiondsceyuecvad bens 48 3 6 3 Search Genes esiiiticcdescisitiicdvgeriict aces a e E a e ER aTa 48 3 7 Program design challenges and SOLUtiONS c sccecesccsseeseesecsseeecuseeseuseesceseeasesesacescnseeeenaeenes 49 3 7 1 HTML Templates icici ecisicceccsciniseac hee naa a aa e EEEa SEA 49 3 7 2 Displaying colour coded amplicons ccessseescsseeeceseeeeesecseesecseeeeesaeeeeeaecatesesseserenaees 50 3 7 3 Unique file names On CXport ee eceeecsseeseesecseeeeceeeeeceaeceeesecseesecneeeecsaeeeeesecaeeseeeseeeeaees 31 3 7 4 Displaying limited assay data ce eeeseeseesecseeeecneeeecaeceeesecaeesecseeeeesaeeeeaecaeesesneeerenaees 52 3 8 Testing the SOftWATEC ccccccccceescesscesecesecesecesecasecaeeeseeeseesseesseeseeeeeceseceaecsaecaecsaesaaeeaaeeaaeeasens 53 Chapter 4 RESUS ssi ssscsseccsescocssssossecsenssececsciooncceeassseseausevesscsecs
72. l Simecek MSc by Research content was checked for accuracy Upload_Gene p and Upload_Assay pl contained code to prevent the duplication of data in the database Once the data had been uploaded this was confirmed by querying each table in the database for duplicate data by issuing the following SQL queries e Check the gene table for duplicates SELECT gene_symbol count AS number FROM gene group BY gene_symbol HAVING count gt 1 e Check TaqMan file table for repeating files SELECT file_name count AS number FROM TaqMan_file GROUP BY file_ name HAVING count gt 1 e Check Species table for repeated records SELECT scientific name count AS number FROM species GROUP BY scientific_name HAVING count gt 1 e Check Gene Sequence table for repeated records SELECT genbank_id count AS number FROM gene_sequence GROUP by genbank_id HAVING count gt 1 Similar queries were issued for the remaining tables in the database Each SQL query is designed to retrieve records where there is more than one identical record for a specified field and to return the total of number of identical records When the SQL queries were submitted no data was retrieved indicating that the programs did not allow any duplicate data to be uploaded into the database To confirm this the programs were further tested by running the programs to load data already known to be in the database The SQL statements we
73. l is the most common type of database in use today Buchanan 2002 Object orientated databases are databases that are defined stored and accessed using an object orientated programming language such as Java Their development is still in its infancy and standards for this model have not been completely refined Stephens and Plew 2001 The features of a relational database model described in this section make it an ideal choice for solving the data storage issues faced by the MPT group For example flexibility is important in an environment where procedures and processes are constantly evolving The relational database model is well established and has many Cranfield UNIVERSITY Nikol Simecek MSc by Research advantages over the other models including reliability wealth of vendors ease of data manipulation and definition and extensive programming support These features are important in the context of this project for example the automation of data upload which will require the development of programs to interface with the database The following sections will focus on tools and methods associated with relational databases 1 4 2 Database Integrity It is extremely important to ensure that the integrity of a database is maintained so that the information produced is accurate and of the highest quality Errors can arise as a result of incorrect data entry incomplete data modification unintentional data alteration and multipl
74. lace the Primer Express files for upload in the designated directory The program was then executed from the 39 Cran UNIVERSITY Nikol Simecek MSc by Research command line prompt For subsequent upload of Primer Express assay data a web based user interface was developed for submission of data This is described in section 3 6 Initially the program checks for the existence of the designated directory and then the existence of Primer Express assay files using regular expressions If these conditions are met the program loops through each file and queries the TaqMan file table in the database to see if it has already been uploaded If data relating to the specified file does not exist in the database then the program proceeds with populating the database with assay file data The TaqMan file table is the first table to be populated with data To ensure that this table is correctly related to the gene sequence table the corresponding gene sequence id is required Retrieving the correct id is performed by querying the gene sequence table with the following SQL command SELECT gene_seq_id FROM taqman_test_3 gene_sequence where SUBSTRING gene_seq probe_start probe_ length probe seq The variables probe_start and probe_length refer to the position of the probe in the sequence it was derived from and the probe length The variable probe_seq contains the exact sequence of the probe Data for these variables are obtaine
75. lacing password with the password that was entered during the configuration of MySQL e Creation and population of the TaqBase should now be complete 3 Install Perl e The Perl application can be found at http www activestate com downloads e Scroll down to the bottom of the webpage until ActivePerl 5 8 8 820 ActivePerl 5 6 1 638 is reached e Click on get current release and then click on the Download button e Enter contact details optional and then click on the Continue button e Under the ActivePerl 5 6 1 638 heading as shown below click on the MSI link under the Windows heading and then click on save 90 Cranfield UNIVERSITY Nikol Simecek MSc by Research Linux AS package DEB RPM Solaris AS package pkgadd Windows AS package MSI ActivePerl 5 6 1 638 Verify system requirements 7l View archive of older releases ActivePerl 5 6 1 638 addresses an identified security issue related to win32_stat Although exposure is rare ActiveState is providing a patch here and to core Perl because the issue could result in data loss 9 4MB 12 1MB 12 1MB 9 5MB 9 5MB 8 3MB 8 5MB e Download the file to a temporary directory and close the message box when download is complete e Go to the folder where you have downloaded ActivePerl 5 6 1 638 MS Win32 x86 Windows Installer package and double click on it to launch the Wizard e Once in the Wizard click on Next until the following is reached
76. lational database management system to creating the tables 2 1 Rationale for developing a database As outlined in section 1 4 there is currently no central storage facility within the MPT group for the data generated during a TaqMan RT PCR experiment On certain occasions this has resulted in duplication of effort or loss of data At present scientists manually search for data which is extremely time consuming and can also result in biologically relevant data being overlooked It is evident that there is a need to develop a database system to house the data generated since it will efficiently organise all the data and enable the end user to quickly search and access data of interest The time saved and the increased accuracy would greatly benefit the MPT group particularly as time and resources are limited For the purposes of this project a database was developed to house data derived from the TaqMan assay design process Although there is a wealth of data generated during sample preparation and gene expression measurement limiting the database to encompass only TaqMan assay data ensured that development and testing of the database and the accompanying software was a manageable task 16 Cranfield UNIVERSITY Nikol Simecek MSc by Research 2 2 Database Goals and Objectives The goals and objectives of the database are listed below e To consolidate all TaqMan assay data that exists within the MPT group into the database and to ho
77. lows 52 Cranfield UNIVERSITY Nikol Simecek MSc by Research SELECT taqman_assay assay id FROM _ taqman_file taqman_assay primer_probe taqman_assay WHERE amplicon_length between 49 and 151 AND pr_type PRB and pr_gc between 30 and 80 AND taqman_file file_id taqman_assay file_id AND taqman_assay assay_id primer_probe assay_id AND file_name file name Since there are 7 criteria that could be selected in any combination there are potentially 127 SQL statements that could be issued with one statement specific to one combination of criteria This figure was calculated by applying the equation below to the numbers 1 to 7 and then totalling the results Number of a C ossible selections i y C y C Number of criteria to select from y Number of criteria selected It was not a viable option to create 127 SQL statements Therefore to account for any possible combination of selections therefore an alternative approach was employed SQL queries are submitted to the database for each selected individual criteria and the returned assay ids are saved in an array variable Assay ids that are common to all arrays i e the intersect are those that meet all selected criteria The results are then displayed to the user along with the amplicon data 3 8 Testing the software To ensure the programs developed for uploading the database were robust database 53 Cran UNIVERSITY Niko
78. me cgi to launch TaqBase This will only work for locally installed software Replace 127 0 0 1 with alternative IP address if installed elsewhere 7 Uploading data into the database All Perl programs for uploading data can be found on the attached CD ROM in the Perl Programs directory Only text files that have been exported from Primer Express software can be uploaded into the database An example file is located on the attached CD ROM To run the upload_gene program a text file containing a list of accession numbers is required with one accession on each row The accession numbers should correspond to the assays that have been designed e Save the Perl programs and taqlibrary pm to your working directory e At the command prompt change your directory to where your Perl files are 97 Cran UNIVERSITY Nikol Simecek MSc by Research located using the cd command e First run the Upload_Gene pl program at the command prompt as follows gt upload_gene pl e Then run the Upload_assay pl program at the command prompt as follows gt upload_assay pl e Your database should now be populated with data 98 Cran UNIVERSITY Nikol Simecek MSc by Research 99
79. nce table in order to retrieve the correct gene sequence id Loading assay file data into the database was therefore dependent on the existence of the sequence data in the gene sequence table If the gene sequence was not in the database the user would be informed and prompted to upload the appropriate gene sequence using the upload_gene program This is not ideal because user interaction is required The program therefore cannot be described as a fully automated system for uploading assay data into the database A description of how this program could be improved will be discussed in section 5 4 5 2 2 Upload_Gene pl The aim of this program was to query an external nucleotide database GenBank with a list of accession numbers and retrieve the appropriate data for upload into the gene sequence gene gene synonym and species tables All data for a specific accession is retrieved from one GenBank record by calling methods from the BioPerl module and complementing these with regular expressions This program generally ensured referential integrity and data accuracy The program could be improved however to increase its flexibility with regard to input data A query could not be issued to the nucleotide database if the user could not provide the accession number This was resolved through the development of the CGI program genbank_results cgi This program incorporated the code for upload_gene pl and additional code so that GenBank could be querie
80. ns as a text file to the directory specified in the Perl module TaqLibrary pm Once the data has been exported the file name and location of the file is displayed on an HTML page An example of an exported text file entitled amplicon_data txt can be found on the attached CD ROM e display_data cgi This script queries the database for additional assay data e g primer probe length tm and GC associated with the assay_id received from display_amplicons cgi and the results are displayed on an HTML page in a new pop up window In addition there is a scrolling box so that the user can select data for export e export_assay cgi This script queries the database with the parameters received from display_data cgi and exports the data to a text file in the designated directory specified in Taqlibrary pm A message is displayed on an HTML page informing the user of the file name and its location 47 Cranfield UNIVERSITY Nikol Simecek MSc by Research 3 6 2 Load TaqMan Assay This section describes the cgi programs that were developed to upload Primer Express text files containing assay data into the database e Browse Assay cgi This script generates an HTML page consisting of a browse button so the user can search for a required assay file In addition it gives the user instructions describing how to upload multiple files At the bottom of the page there is a link to select_files cgi e File_copy cgi This program copies the file that was
81. nship Modelling ccccccsscessssecssesscuseesceseeseeseeaeesecuceeecaeeseeaeeaeesesaeeecneeeneeaeenes 21 Defining the entities attributes and relationships sssssssesssreesssreeessessrsrrsrrsensreeesse 22 Normalisation esde e Ae a a E ea hee 24 Database implementation ccsccscseceseescesecssesecneeseeeseeccesecacesececeeeeaeeceaeeneesecaeeeesaeeeseaseaes 26 RDBMS installation vivcscccshioscesteisscaeeSeasesususcl bas hopacs slevbset vel evacsiaeveds baalvbavesbecboebecbunsessesredss 26 Determining the attribute data types eececesceeneecsseceeececeaeceeeeeceaeeeeaeeceaeeeeeeecneeeentees 27 Controlled Vocabularies 5 2 0 issih aunetiseiceierth desreted anne EEEE E oE EE eia 29 Cranfield UNIVERSITY Nikol Simecek MSc by Research 2 54 Creating the database and its tables 00 eeeeeeeeeeeeecesececesecscesecneeeeesaecaeaecaeeseesaeeees 29 DID Database SCCurity sonnii enina a i iE E E R E Ei 30 Chapter 3 Software Development essesseseosoesesoossesoesseseosoesesosssesoessesessossesosssesoessescesoesesssssessesse 32 3 1 POPU TE ETE AT P EE EE EE EEE E T 32 3 2 Interjacme with MYSOL sisri sri a e E E E E A EE vobeubarees 33 3 3 Program design and Implementation cccsccecescceseecsseessesecseesecseeeenseescesecaeesesaceescneeeneeasenes 34 33l WM plo dd Gene Plescoi ae e E E E 34 3 3 2 Upload Assay splicaces cisccusecsssivasesesasncnssSevncbsdsevens ea eE EEE EEEE E EE ae E Eea 37 3 4 User Interface OD
82. possible to amplify mRNA using PCR Reverse transcriptase is used to convert the mRNA sequence into either single stranded DNA or a double stranded DNA RNA hybrid Creighton 2005 This forms the basis of many technologies used for monitoring gene expression levels in a sample 1 2 TaqMan RT PCR In traditional PCR methods amplification is only detected in the final phase of the PCR reaction plateau phase usually by agarose gel electrophoresis Quantification of starting material is therefore limited due to the poor sensitivity and resolution of this technique Real time PCR RT PCR measures the accumulation of products during the PCR reaction During the exponential phase of PCR there is a quantitative relationship between starting material and PCR product This feature of the PCR reaction enables the accurate quantification of starting material using real time PCR The 5 nuclease assay is one of a number of real time PCR methods A TaqMan probe Cranfield UNIVERSITY Nikol Simecek MSc by Research is included in the PCR reagent mix in addition to the primers used in a traditional PCR reaction The probe labelled with a fluorescent reporter at the 5 end and quencher dye at 3 end anneals to the target between the forward and reverse primers Fluorescence of the reporter is suppressed by the quencher by fluorescence resonance energy transfer FRET due to the close proximity of these dyes As the DNA polymerase moves alon
83. re then resubmitted Since no results were retrieved for each of the queries the programs are considered to 54 Cran UNIVERSITY Nikol Simecek MSc by Research be robust in terms of preventing duplication of data in the database Further checks were carried out to ensure the relationships between the tables were correct This was done by comparing the original assay text files and GenBank records with data retrieved from the database If any inconsistencies arose then the error in the program was identified and amended The user interface was tested by checking that all the links navigated to the correct cgi program To ensure that the correct SQL results were displayed to the browser the results were compared to results retrieved when the same SQL query was executed at the MySQL monitor The interface was also tested by several members of the MPT group to see if their requirements were met and to assess how easy it was to navigate through the system 55 Cranfield UNIVERSITY Nikol Simecek MSc by Research Chapter 4 Results This chapter shows the HTML output of the CGI programs that were developed for this project 4 1 Welcome Page The welcome page provides a brief summary of the application along with links for uploading an assay searching for an assay and searching for a gene The welcome page is shown below in Figure 15 TAQbase provides an interface to a database consisting of TaqMan assay dat
84. roup it is essential that the client trials the application and provides feedback so this can be incorporated into software revisions This will be carried out within the MPT group to ensure the application meets their requirements Development of software is an iterative process and user feedback is important for the development of a useful system In addition internet security measures should be implemented which will be done in collaboration with IT specialists at GSK This project has taken the initial step in addressing data storage issues faced by the MPT group at GSK and has provided a means of rapidly accessing TaqMan assay data of interest 74 Cranfield UNIVERSITY Nikol Simecek MSc by Research References ALTSCHUL S F GISH W MILLER W MYERS E W LIPMAN D J 1990 Basic local alignment search tool J Mol Biol 215 3 403 10 BUCHANAN W 2002 Mastering Computing Palgrave Macmillan BROWN M C 2001 Perl The Complete Reference Osbourne CREIGHTON T E 2005 Encyclopaedia of Molecular Biology John Wiley amp Sons CHRISTIANSEN T amp TORKINGTON N 1998 Perl Cookbook Tips and Tricks for Perl Programmers O Reilly DALE J W amp SCHANTZ M 2003 From Genes to Genomes Concepts and Applications of DNA Technology John Wiley amp Sons DAWSON R 2002 Relational Databases Design and Use Group D Publications DESCARTES A amp BUNCE T 2000 Programming the Perl DBI O Reilly FOR
85. s categorised into groups shown in Table 1 Each entity was given an additional attribute in the form of a unique identifier to ensure that each record was unique Table 1 Entities and their attributes Entity Attributes Gene ID Gene Symbol Gene Name GENE SYNONYM Synonym ID Gene Sequence ID GENE SEQUENCE Accession Gene Sequence PRIMER PROBE Melting Temperature GC content Primer Probe sequence Type FP RP or PRB File Name Date Time created Once this had been carried out the next step was to establish the relationships between the entities There are three types of relationships that can exist between entities one to one one to many and many to many For an explanation of these relationships refer to section 1 4 3 in the introduction Each entity is related to another 22 Cranfield UNIVERSITY Nikol Simecek MSc by Research entity by their keys The primary key is a column value within an entity that makes the row of data unique and the foreign key is a key that references the primary key in another entity The cardinality of each relationship is described below in Table 2 Table 2 Description of the relationships between entities DESCRIPTION OF ENTITY ENTITY RELATIONSHIP CARDINALITY GENE GENE One gene may have many One to Many SYNONYM synonyms however one gene synonym can be described by one official gene name GENE GENE Gene may have one or more One to Many SEQUENCE sequences an
86. se it helps to ensure the database is efficient flexible and easy to manage and maintain For this project the traditional method which includes requirements analysis data modelling and normalisation was used Stephens and Plew 2001 Requirements analysis involved reviewing the TaqMan assay design process and identifying data to be included in the database This was followed by data modelling An entity relationship E R diagram was created which was ultimately used as a framework to implement the physical tables in the Relational Database Management System MySQL During the creation of the E R diagram normalisation was carried 63 Cranfield UNIVERSITY Nikol Simecek MSc by Research out by following a set of rules to eliminate redundant data These rules are outlined in section 1 4 5 The final implemented database was normalised to the 3 Normal Form which means that the first 3 sets of rules have been followed This is considered to be adequate for removing redundancy and to allow for flexibility and expansion Meloni 2002 MySQL was the relational database management system selected for this project Although there are many advantages in using this RDBMS see section 2 5 1 it does have limitations however and these are described below During the development and testing of programs to populate the database there were many occasions where data needed to be deleted from the database This was due to the presence of errors
87. sers and analysing current processes to capture the types of data generated The next phase is database modelling whereby the data is visually represented for example in the form of an entity relationship diagram The final phase of the design process is normalisation which is carried out in order to reduce data redundancy Stephens and Plew 2001 This is described in more detail in section 1 4 5 A well designed database should e be functional e accurately represent the business s data e be easy to use maintain e be secure e have reduced data redundancy e be easily backed up 1 4 5 Normalisation Fundamental to the modelling and design of a relational database is the process of normalisation which aims to minimise data redundancy Data redundancy which refers to the duplication of data should be kept to a minimum since it can result in unnecessary space being used ambiguity inconsistency and wasted effort Stephens 10 UNIVERSITY Cranfield Nikol Simecek MSc by Research and Plew 2001 Normalisation consists of a set of rules that should be followed to reduce redundancy with each rule improving on the previous rule Peitzsch 2003 The rules are as follows e First Normal Form o The data must be divided up into logical groups i e entities o The entities should not contain repeating data e Second Normal Form o The rules of the first normal form must be met o There should be no fields in a table that are not rel
88. sescssssesssssssesssscoscsssnssssenesscssessesssssessssenesssssessossessosees 3 Figure 2 Example of two tables related Dy keyS scssscccssscsssssessssnessesscssescssseesssenessessessessssesees 9 Figure 3 How a CGI application is executed sssssssssccsssssescssesesssensscesssssescssssssssenessessessesesssoss 14 Figure 4 Example of the first 5 records in a text file exported from Primer Express 000 19 Figure 5 Flow Diagram of the Assay Design Process sssscscsssssssssssscssssssescssssesssssessessesssssesess 21 Figure 6 Final Entity Relationship Diagram esssseseseesccesosoesesecescesosoeseseeoeoesoeoesececoeeosoeseseceeoesosoesese 26 Figure 7 Summary of the data source for the tables in the database sssssssssesssssessecsseseeeee 34 Figure 8 GenBank Record sssscsssssesssssssssccssssssscssssssssssssccsssssesssssnesssssessesssesessssssessssnessesnessosesssoes 35 Figure 9 Flow diagram for Upload_Gene pl sssssssssscssssscsscssensssssnsccsssssescssssesessnessessessosssssess 37 Figure 10 Spider Diagram outlining the objectives of upload assay pl scsccssssessssssssecssesseees 38 Figure 11 Data source for the Primer Probe and TaqMan assay tables sssssssssssssssecssesseeee 39 Figure 12 Summary of user requirementts sccscccssssssscsscsscsscssescsscsssscesssssessssseesessnessessessesseseoss 43 Figure 13 Summary of the CGI programs that w
89. sesscesecesecusecusecsecaeecaeesasensseseeeeeensess 4 The Application of Bioinformatics DatabAses ccccccccceecceecese cute cnecusecneeeaeeeseeeseeseeeeeeeaes 5 Database type Senenin ctiain a ea AE REE AE E EREE AEE SETE 6 Database nite Srey oes ciisei sis ses vee siting ao Sedu benabhboaas ee dees EEA E EEEE A Sa 8 Relationships eminere runian ae aa sents use NONE EAEE 9 Database esi gtcisisccscicescescssisesscneuetsaeveahead Ee aen rne EEEa E SEEE EEEE Et EEEE RETE 9 Norm lisation sninen a E ENEE ET EENET aE 10 Relational Database Management Systems sesessseseeseeesesrsrrtrrererrstsrsrrrrerersrsrerrerereeee 12 Structured Query Language sesscsssesssescssssesssesecvsesscessessensesessssessesseessessoerseesesesses 12 Database User Interface s sccsesc5si iaes Sicesiiboeseeebasceach ds aoe heaven Saas ees peated Keeani 12 Project AIMS sosest tea decenst E e teases catsuseuasssdvnesa sate satan soveessdessicietscuenavegeectescecscateseeees 14 Database Design and Implementation sssccssssssscssssscesscscscssscescsescsssssesscesseees 16 Rationale for developing a database scscesccessscsssesseseseesecieesecseeeenseesceseeaeeseeaeeeeenaeeeeeasenes 16 Database Goals and Objectives cccccccescescsvscssesccnseesceseessssecaceseceeeeeaeesesaeeasesesaeeescneeeeeeaeenes 17 Requirements ANALYSIS sinsoorte inaen san a iieiea 18 TaqMan assay deSioti sissies iciaee ia rie E a nE n E EEEE S EE a i aea 18 Entity Relatio
90. specific fields and tables command privileges for the specific user and hosts that can connect to the database Adding users and defining their privileges is important for maintaining a secure database since there are risks associated with allowing all users full access Important data for example may be inadvertently deleted or corrupted Adding new users and defining their privileges was performed by connecting to MySQL as the root user and issuing the GRANT command The command shown below would allow a specific user SELECT and INSERT privileges to all tables in taqbase database prompt gt mysql u root p password mysql gt GRANT SELECT INSERT gt ON taqbase gt TO user hostname 30 Cran UNIVERSITY Nikol Simecek MSc by Research gt IDENTIFIED BY password For this project the database was implemented locally for development purposes however additional security measures should be implemented if MySQL is installed on an external network Data can be intercepted over a network and it is recommended a secure connection is used 31 Cranfield UNIVERSITY Nikol Simecek MSc by Research Chapter 3 Software Development Although data could be added to the database by issuing INSERT commands at the MySQL command line interface this method would be extremely time consuming and prone to human error To overcome this the next phase of the project was to write programs to automate as much of t
91. to the database and revising the program design where necessary Although the program managed to achieve most of these goals it was found that on certain rare occasions incorrect data was loaded into the primer probe table When the program was written it was based on the assumption that all Primer Express assay data was exported in the same format i e each field within a record was separated by whitespace in the original Primer Express text file The inconsistencies in the primer probe table were due to the fact that occasionally the forward primer sequence in the original text file contained whitespace The sequence would then have been treated as two separate records rather than one which resulted in the errors This is illustrated in Figure 23 below 65 Cran UNIVERSITY Nikol Simecek MSc by Research 3 22 58 50 ATGCTAGCCCCTCGAAATACAG 46 22 3 22 58 50 ATGCTAGCCCCTCGAAATACAG 46 23 3 22 58 50 ATGCTAGCCCCTCGAAATACAG 56 19 3 22 58 50 ATGCTAGCCCCTCGAAATACAG 53 20 985 20 59 50 TCCTTTGCCAAGAGCG TCAT 1010 21 985 20 59 50 TCCTTTGCCAAGAGCG TCAT 1009 21 985 20 59 50 TCCTTTGCCAAGAGCG TCAT 1011 22 985 20 59 50 TCCTTTGCCAAGAGCG TCAT 1011 21 986 20 59 50 CCTTTGCCAAGAGCG TCATT 1011 22 986 20 59 50 CCTTTGCCAAGAGCG TCATT 1010 21 Whitespace separating the sequence Figure 23 Section of the Primer Express text file The program was amended to account for this anomaly by adding an additional error checking step The program checks each ro
92. use any subsequent data generated during the design of TaqMan assays e The database should be flexible to allow for future expansion For example it will be of great value to the end user if data associated with sample preparation and gene expression measurement is included in future e The relational database model will be used As outlined in section 1 4 1 relational databases have many advantages over other database models The structure of relational databases can be easily modified data can be accessed quickly and data integrity can be implemented The database will therefore be implemented using an appropriate Relational Database Management System RDBMS e The database should have integrity i e the data should be accurate data integrity and data should be consistent between related tables referential integrity e Data redundancy will be minimised through the process of normalisation e Where possible data gathering and population of the database will be automated to ensure that user input is minimised thus reducing the potential for error 17 Cranfield UNIVERSITY Nikol Simecek MSc by Research 2 3 Requirements analysis The first stage of designing the database was to thoroughly analyse the processes involved in designing a TaqMan assay This was done with a view to identify the data generated or required during this process Scientists who would ultimately be the end users were interviewed to ensure their needs w
93. vegicus bradykinin receptor B1 Bdkrb1 mRNA Rattus norvegicus GTP cyclohydrolase 1 Gch mRNA Rattus norvegicus guanylate cyclase 1 soluble alpha 3 Gucyla3 mRNA Rattus norvegicus protein kinase cGMP dependent type II Prkg2 mRNA Genbank files have been downloaded to the shared area Figure 22 Genbank_results cgi and files_downloaded cgi 62 l l O E o F l dl o dl dl al Cranfield UNIVERSITY Nikol Simecek MSc by Research Chapter 5 Discussion and Conclusions The objectives of this project were to develop a database to house TaqMan assay data create programs to automate the population of the database and to develop a simple CGI application so the database could be queried Each of these objectives will be discussed in the following sections 5 1 Database design and implementation The first objective of implementing a database to house TaqMan assay design data was met Before commencing this project the MPT group did not have any organised way of storing TaqMan assay data so this was a considerable improvement The implementation of a database will increase efficiency within the group since accurate assay data can now be quickly and easily accessed This is far preferable to searching through various directories or users laboratory notebooks where data may be overlooked or incorrect Various methodologies can be used when designing a relational database The design phase is important becau
94. vokage gated 1 beta INM 012648 RO D12648 Panes soevegie Sic22a6 solute carrier family 22 member 6 NM017224 BM mome gt NM 013030 Rattus norvege Sle34al sobte carrier family 34 sodium phosphate member 1 pae mano D Ske4a2 solute carrier famy 4 member 2 NEA 017048 NMA O1 TOAS Rates sorvegic sokite carrier family 5 sodium glucose cotransporter NM 013033 Ramis norvegic SkSal ber 1 NM_013033 p TXT solute carrier family 7 cationic amino acid transporter NM_013111 Ramus norvegic sera S i NMO rimas TXT VT TT ie i Figure 16 HTML pages for find_assay cgi and all_genes cgi On submitting a search term data is retrieved from the database and is displayed as shown in Figure 17 The user has the option to select assay files in order to view amplicon data This search can be limited by selecting limits in the scrolling box 57 Cranfield UNIVERSITY Nikol Simecek MSc by Research TAQBase Links External Links e Entrez e BSTAR e GATE Results for Total number of result Gene Accession Slc34al NM_013030 s 5 File Name Select NM_013030 Rattus norvegic Primers TXT Fi Sic7al NM_013111 NM_013111 Rattus norvegic Primers TXT 1 Slc4a2 NM_017048 Slc22a6 NM_017224 Sic5al NM_013033 NM_017048 Rattus norvegic Primers TXT 0 NM_017224 Rattus norvegic Primers TXT Oo NM_013033 Rattus norvegic Primers TXT o Select Limits FPrimer Tm 58 60 a Prb No
95. w in the Primer Express text file to see if each row of data contains the expected 20 fields If the row contains 21 fields then the whitespace within the forward primer sequence is removed before the data is uploaded into the database Although no other irregularities were found in the text files it should not be assumed that they will never occur Additional error checking should be incorporated in the program to prevent incorrect upload of data During the initial stages of program development and testing these errors were not identified since all the data from the text files had uploaded correctly They were only discovered when data from a large number of assay files had been uploaded This could have been avoided if more assay files were used to test the database and if the program contained error checking to ensure that every record was in the correct format before it was manipulated and uploaded There were a number of challenges associated with designing this program The biggest challenge was ensuring that the correct gene sequence id was entered into the 66 UNIVERSITY Cranfield Nikol Simecek MSc by Research TaqMan file table so that referential integrity could be maintained As described in section 3 3 2 each assay file contained no reference to the sequence it was derived from other than the primer and probe sequences themselves and their relative position on the original sequence This data was used to query the gene seque

Nikol Simecek MSc by Research

Contents

Download Pdf Manuals

Related Search

Related Contents