Home

User manual chapter 1: Assembly - Techdev Home

1. 2 o 9 o iol o lel HO 5 e Or oj e 5 o iS 9 gt 0 O 0 e 9 oj oj SI S 19 CO e oj 9 e o D D D o o o 19 5 6 5 ah Ne No ol No DEBURR AND BREAK ALL SHARP EDGES ALL DIMENSIONS IN INCHES ANGULAR 1 ALL BENDS AT AINMESBEHSHERWISE STATED FOLD TO FOLD AND FOLD TO HOLE XXXX 020 EDGE TO HOLE AND HOLE TO HOLE XXX XXXX AS B EDGE TO EDGE XX UNLLESS OTHERWISE STATED ENGINEERING PURCHASING PRODUCTION SALES MARKETING SIZE DATE T A 02 25 04 FINAL APPROVAL SILK SCREEN FILE NAME SLIDE CHUCK dt SHEET 10F 7 SCALE1 2 22 IT m IT TT 1 AL Institute for Systems Biology 1441 34tl Seattle WA 98103 206 732 1200 LE SLIDE CHUCK REV B MATERIAL Teflon 12 X12 X 2 90 0 0 0 0 0 0 0 0 0 iC AO 4 9 gy se oy vo OE SOR ONO D D o D 0 oO 9 5 8 O86 96080406 0 4680 9 0 0 0 0 D o 0 9 9
2. 33 AT PAY COVE EE EE REE ERE 33 A2 Print Head Mounting Brackets eie teer et tantae eai e Yee Ma ean eee ee 36 X3 oS des MO de aS 38 A4 Machine Visio ie dc ette ge awh Gawd owed 42 APPENDIX Ir BEBCTRICAL aio tete Ee 43 B1 Electronics OVERVIEW i ec tenente Dni nis 43 IB astra Sentus as d esee uot ee 45 eth E t as told tee n aede D EIUS 45 Top ev reka 45 BY BT NR 46 46 Top view Of circuit board 46 BS Board 1909 tac nb ds Cb 47 E ee EE E TEE 47 Top view of circuit DOSE uei erede iain oa e IE 47 B6 Templates for cutting circuit board enclosures 1 4 scale 48 B7 More circuit information for boards 1804 and 1902 48 B7 Configuration file for Gemini 4 50 APPENDIX C LISTS OF COMPONUBPNTS debet 51 CL RODOtIGS oe eee EE E ete eo eee te eie ete eee tea 51 C2 Optical Mechanical eio ged Ye ge can QU A EU Hae eed UNE 51 CB I SOS S CETTE 52 53 ICS 5 ee an
3. fu Um 54 CO Other ce Mere coser tore DH 55 JELATA AEE EE E E E EE TE E eeh 56 Inkjet Microarrayer Manual version 1 4 INTRODUCTION We all know that despite their inherent problems microarrays have become an important tool in any lab that wants to do cutting edge molecular biology If you didn t think that the technology was important you wouldn t be reading this so we ll will try to keep the rhetoric to a minimum and just tell you what you need to know to build and run the instrument we call POSaM the Piezoelectric Oligonucleotide Synthesizer and Microarrayer We will try to give you a bit of the history of how the instrument came to be and how it turned out the way it is at this time Hopefully those descriptions can be helpful and maybe even amusing We also hope that those of you who actually build one of these will take part in the development of a better instrument and new methods to take advantage of its speed and flexibility In this respect we are following in the steps of Brown DeRisi and their co workers at Stanford who made their pin spotting device available to the scientific public back in the 90s We feel that the early release of these plans helped speed the development the instruments and methods that are now used and that de novo synthesized array development has suffered by not having an open source model
4. Point What Coordinates A Screw point for XZ axis support bracket 19 7 B Screw point for XZ axis support bracket 19 13 Screw point for XZ axis support bracket 38 7 D Screw point for XZ axis support bracket 38 13 E Screw point for Y axis 27 12 F Screw point for Y axis 27 17 G Screw point for Y axis 27 22 H Screw point for Y axis 27 27 I Screw point for Y axis 32 12 J Screw point for Y axis 32 17 K Screw point for Y axis 32 22 K Screw point for Y axis 32 27 M Soleonid tower 17 5 N Photodiode post 35 27 Laser post 35 12 Table 1 Coordinates of mounting screws on the optical table given in 1 units 10 Inkjet Microarrayer Manual version 1 4 3 Place servo controller and digital servo amplifiers Mount the 6K4 servo controller and its 24VDC power supply inside the electronics rack and connect the power supply wires according to the manufacturer s instructions We cut 18 inches of aluminum DIN mounting rail and fastened it near the inside top of the rack with self tapping screws The controller and the power supply both clip onto the rail We placed an inline fuse holder between the power supply and the controller Place a rack mount shelf one foot below the rail to hold the supervisory PC Mount and wire the three GV servo amplifiers according to the manufacturer s instructions Mount them to a large 19 rack panel that can accommodate the amplifiers an emergency s
5. 3 23 Ser Drying jet pressurization Printhead Printhead Solenoids Motor Motor Motor 43 Inkjet Microarrayer Manual version 1 4 B2 PCI Card Interfaces Two National Instruments interface cards are installed in the PCI slots of the PC The high speed digital card DIO32 HS controls the inkjet print head and eight 24VDC solenoids Six Angar solenoids are actually used It also receives a digital trigger signal from the 6K4 motion controller This signal is used to trigger a piezo jet event Thirteen digital lines remain available for future use The multipurpose card MIO 16E connects to the nitrogen solenoids the 120VAC solid state relays the droplet detector and the X axis precision linear encoder It monitors analog voltage levels from the hygrometer and the droplet detector power supply Four digital lines and six analog inputs remain available for future use We intend to use the additional analog inputs to monitor pressure levels at the source dewar the reagent bottles and the vacuum Argon jet 0 Phos pressure 11 Gag solengids Port A Digital VO 120V ss Relays ARON Reset dd 6 gt Read dd 7 4 Droplet Detector e O Solenoid Driver Board MIO 16E Port B Reagent Solenoids Counters Device 2 Cou
6. ee E 2 188 sce SC 0600000 89980068 66058609 3 D EE MTM 5 res 5 Hei oe mere 29889 m Le7 99908860 660666 86666660 26696666 eefsus Dice ie ERI 5 ge n5 S 101 Bene Bess Hooooooo Ho00090 Heessneen 9119919 R R8 eo CEU S e 517916 PO 0000 6 6 6 R Top LE i 420 s mere C pin Anpi 2 174341 5 1 18 e 13 0000000000005 a 8 8 66000088 es 70 455005660660 E e g g a g 46 Inkjet Microarrayer Manual version 1 4 B5 Board 1902 Circuit schematic 1e pin Sarev Terminal Maroeten deis 12345642891811
7. WP Kuo TK Jenssen AJ Butte L Ohno Machado IS Kohane Analysis of matched mRNA measurements from two different microarray technologies Bioinformatics 2002 18 3 405 12 HP Le Progress and trends in ink jet printing technology In Book Recent Progress in Ink Jet Technologies Editor Handson City Springfield VA 1999 J Li M Pankratz JA Johnson Differential gene expression patterns revealed by oligonucleotide versus long cDNA arrays Toxicol Sci 2002 69 2 383 90 A Relogio C Schwager A Richter W Ansorge J Valcarcel Optimization of oligonucleotide based DNA microarrays Nucleic Acids Res 2002 30 11 51 Roda M Guardigli C Russo P Pasini M Baraldini Protein microdeposition using a conventional ink jet printer Biotechniques 2000 28 492 6 AT Rogojina WE Orr BK Song EE Geisert Jr Comparing the use of Affymetrix to spotted oligonucleotide microarrays using two retinal pigment epithelium cell lines Mol Vis 2003 9 482 96 DI Stimpson PW Cooley SM Knepper DB Wallace Parallel production of oligonucleotide arrays using membranes and reagent jet printing Biotechniques 1998 25 886 90 56
8. al J Coax cable to Photodiode As 3 A ne E Up a E Jen iililiiliilie P mos Tea m Pu cds inii3 875824321 Uer gt We P E pin Screw Terminal Gerti Mj 8 CE TERTII DER E 1 a En D ali e vy za The Institute for Sustems Biologu ve y a Printed Circuit Board 1902 hm Pr Page 1 of 1 470k Chris Lausted 22822085 Top view of circuit board xd Ree o 60000 o a 8 8 5 AH e a 82882 88 i E E 7 8 B o pep d Proto r 1 Proto B oy que m voto Area rota Area R16 booe peooooococooooosooocoOoOOcOoO oooooocoooocooooooscooDOS SE vas BOGE peoeoooogoooooooooooOoOOOOOD poooooeobooouDODODOSOODOSGOO R15 E ooo jBeoooooococooooooOoOOOOOCOOO DODOODODOODDODODODOOODDODOGO SEP ER eooocoooocO000000000000000 ODOODOOODDODOODOODODOOOO K LI 000000000000000000000000 Jo0o000000000000000009000 ee SVG 0000 nooooooooooooooooooooooo0 0000000000000000000000000 op 0000 poooooooooooooo0000000000 000000000000000000000
9. 20 Install cover The custom plexiglas acrylic glass cover is delivered in four pieces the main body the front panel door the left panel with glove holes and the right panel Installation of the cover involves making a seal to match the main body base placing the main body making panel seals attaching the panels and attaching gloves The main body has a footprint 41 inches wide and 35 inches deep compared with the optical table dimensions of 47 inches wide and 35 inches deep The cover and the table are aligned on their right edges leaving 6 inches of table width exposed on the left side Prepare the seal between the table and the cover Attach two continuous strips of 5 16 thick weatherstrip foam MCO6 to the table top to match the flanged base of the cover main body On the right rear corner of the table where the cables are routed use polymer clay instead of weatherstrip to form the seal On the left rear corner of the table or where ever gas tubing or other wires are routed also use polymer clay Carefully set the main body on the weatherstrip surface Holes in the flanged base match the 1 inch grid pattern of the optical table Gently fasten down the main body using 74 20 screws and 1 inch fender washers 04 Only tighten the screws finger tight to avoid damaging the flange Next attach the panels Apply two strips of D profile weatherstrip MCO7 around the perimeter of the three holes in the main body Attach the le
10. Wash 1 default default Dry default Wash 3 default default moveto 5 Wait 30 Dry default PumpWaste 2 true Extra wash Wash 1 default default Dry default PumpWaste 1 true End of cycle A OR k KKK k k KKK K K K KKK K k KKK 4 K Inkjet Microarrayer Manual version 1 4 FE BREAK RK AK ARAB RK a Basic Posam POST synthesis script basic pp3 13 OCT 2004 ISB Shut of N2 and move printhead out of the way BoxFlush OFF MoveTo 5 End of POST synthesis script 2K OK OK OK K K K SK K K K K K K K K K K OK CE K CE K K K K K K K SE PK OK OK CE OK K K K OK SE K K K CE K SE K K K K K CE K K K K K E 2K K K E K K OK Sample Lineups Lineup files may be simply comma separated variables where the commas separate microarray columns and the lines correspond to the rows Each letter specifies a single phosphoramidite droplet to be printed The sequences are given in 3 to 5 order Comments and other non sequence data is not permitted The first oligonucleotide sequence in the file is printed at the top left corner of the microarray TTTTTCTGGAGGGCCTGTGCGTGAA TTTTTCTGGAGGGCCTGTGCGTGGA TTTTTCTGGAGGGCCTGGGCGTGGA TTTTTCTGGAGGGAATGTGCGTGGA The Lombardi lineup format is also supported but only the first slide specified is used Multiple lineup files must be loaded when printing multiple arrays The BANK SLIDE and DPI keywords are ignored In
11. oue an 2 866600 C Top Photodiode VE p00000060000000000 vi e eo Encoder Hygrometer HIO 16E ym es lt q 9990095065558 asese 15 6600000606000 6568 30 0 2 2 2 om Laser nr 1 29 mees nam 26 47 Inkjet Microarrayer Manual version 1 4 B6 Templates for cutting circuit board enclosures 1 4 scale The following two figures may be used to cut connector holes in the rear of 19 rackmount aluminum enclosures Copy the figures using 40096 enlargement The large square holes on the left accommodate 120VAC receptacles The holes on the right match the printed circuit boards Mount the circuit boards on 1 stand offs Use punches a nibbler a Dremel tool or a combination of these three tools 180452 19022 1 B hu L B7 More circuit information for boards 1804 and 1902 The print head drive circuit resides on board 1804 It uses two 8 bit ports of the DIO 32HS interface board The lower eight bits connect to a high speed D A converter DAC0802 settling time of 100ns which provides the piezoelectric pulsing voltage 0 30V Current is boosted by a 150mA power buffer LT1010 The higher bits provide the clock latch and signal inputs to
12. r Solenoids Dispense time s 4 Solenoid 1 Solenoid 2 Solenoid 4 Solenoid 5 Waste Dispense where Here 4 Purge All Solenoid 3 Inkjet Drops Print Dryer On Periodic Jet Figure 19 The reagent control panel 5 Change Error Log Directory item This is used to specify the Pogo error log When Pogo starts a log with the current date is created in the current directory If the file name already exists new data is appended to it 6 Open Error Log The current error log is opend in Notepad the text editor 7 MIO Test Panel This panel should be used with caution Instruments digital interface board 8 DIO Test Panel This panel should be used with caution Instruments multifunction board 9 Test Mode It provides low level access to the Nationa It provides low level access to the Nationa This menu item should be used with caution When it is checked Pogo runs in a test or simulation mode No National Instruments or Compumotor hardware is required 3 The Help menu 1 The About item This lone item displays credits and web links Help for the playbook scripting language is provided in the playbook dialog Using Pogo the first time Pogo needs some configuration before it is ready to start making arrays Slideholder printhead droplet detector and camera coordinates must be checked and adjusted Reagent names locations and defau
13. to the 3 psi pressure outlet using flexible 3 16 OD tubing and nylon hose barb fittings and connectors The check valves prevent reagent fumes from reaching other bottles or reaching the regulator Place four 500mL bottles MR02 and one 2L bottle MRO3 in the front left corner of the POSaM We place them inside a polypropylene tray to prevent any spillage from falling into the screw holes of the breadboard Fit the bottles with 3 port GL45 caps 01 Use 1 8 OD teflon tubes to deliver pressure to the bottles Connect the bottles to teflon solenoids MR09 numbers 1 to 5 using 1 16 OD teflon tubing Be sure that the tubing reaches to the bottoms of the bottles Run approximately 2 meters of 1 16 OD tubing from the five solenoids to the print head assembly Use a 1 meter length of flexible 172 flexible tubing as conduit to hold the cabling to the print head assembly as well as the bundle of reagent tubes Label all five tubes where they emerge from the conduit Insert the tubes into sleeves of 1 16 ID 1 8 OD flexible tubing Press the sleeves into the left five grooves of the print head assembly Hold the sleeved tubing in place with 44 40 screws and washers The solenoids may now be connected to board 1804 Solder a 10 conductor cable approximately 3m in length to pins 1 9 of a DB15 connector PLUG06 Pins 2 through 6 will connect to reagent solenoids 1 5 Pin 7 will connecto to waste solenoid 5 Pins 1 and 8 are currently unused Pin 9 i
14. 0000 68 0000 26 2500 4 0000 10 8500 3 7500 250 0000 2 0000 2 0000 1 0000 19 5000 98 1200 317 4300 147 0000 10 0000 10 0000 40 0000 10 0000 325 0000 100 0000 0 0000 0 0000 0 0000 57 5700 47 0000 87 0000 85 0900 10 0000 2 5000 12 0000 1 7350 1 2950 321 0000 0 1800 9 9100 79 1000 55 157 60 52 80 8 36 20 32 2 30 8 91 549 50 82 80 540 99 6 50 11 72 995 00 845 00 95 00 125 00 39 60 39 95 0 00 5 20 6 95 20 00 20 00 100 50 33 65 150 00 800 00 10 00 100 00 98 50 0 00 24 00 0 00 120 00 120 00 68 00 26 25 4 00 21 70 3 75 250 00 2 00 2 00 1 00 117 00 98 12 317 43 147 00 30 00 30 00 120 00 30 00 1 950 00 100 00 0 00 0 00 0 00 57 57 94 00 87 00 425 45 10 00 2 50 12 00 27 76 10 36 321 00 18 00 9 91 79 10 Inkjet Microarrayer Manual version 1 4 References AP Blanchard R J Kaiser and L E Hood High density oligonucleotide arrays Biosensors amp Bioelectronics 1996 11 687 690 J DeRisi V lyer PO Brown The MGuide A complete guide to building your own microarrayer http cmgm stanford edu pbrown mguide TC Islam J Lindvall A Wennborg LJ Branden Rabbani CI Smith Expression profiling in transformed human B cells influence of Btk mutations and comparison to B cell lymphomas using filter and oligonucleotide arrays Eur J Immunol 2002 32 4 982 93
15. 1 4 and 1 8 NPT brass fittings T connectors adapters hose barb connecters compression fittings and quick disconnect couplings from our local Mom and Pop hardware store It s useful to have extra supplies We took 100 feet of 3 8 O D polyethylene tubing rated with a working pressure of 87 psi We also got our 1 5 I D flexible tubing there for use as an exhaust hose and as cable conduit 15a Install pressure regulator and rotameter The POSaM requires a high purity inert gas source capable of providing 30 psi of pressure at flow rates of at least 40 Ipm We recommend installing a pair of liquid nitrogen dewars connected by an automatically switched manifold in a separate room This allows the gas provider to replace an empty dewar without interrupting DNA synthesis The output of the manifold is regulated at 60 psi Copper pipe carries to gas to a wall mounted valved outlet in our array room Mount a regulator MG06 to the breadboard stand PR13 and connect its input port to the nitrogen supply Set the regulator to 30 psi Alternatively a single dewar can be placed next to the and regulated to 30 psi Connect a T to the regulator output Mount the 120VAC solenoid MG07 on the breadboard stand We also attached a heatsink to the solenoid with thermoconducting grease Mount the rotameter to the breadboard stand and connect its input to an output from the T via the solenoid Run a length of 3 8 O D tubing from the ro
16. DMONBV 0 Analog Monitor B Variable DMONBS 100 Analog Monitor B Scaling of full scale ouput Servo Tuning DIBW 1000 Current Loop Bandwidth Hz DVBW 100 Velocity Loop Bandwidth Hz DPBW 25 00 Position Loop Bandwidth Hz SGPSIG 1 000 Velocity Position Bandwidth Ratio SGIRAT 1 000 Current Damping Ratio SGVRAT 1 000 Velocity Damping Ratio SGPRAT 1 000 Position Damping Ratio DNOTAF 0 Notch Filter A Frequency Hz DNOTAQ 1 0 Notch Filter A Quality Factor DNOTAD 0 0000 Notch Filter A Depth DNOTBF 0 Notch Filter B Frequency Hz DNOTBO 1 0 Notch Filter B Quality Factor DNOTBD 0 0000 Notch Filter B Depth DNOTLG 0 Notch Lag Filter Break Frequency Hz DNOTLD 0 Notch Lead Filter Break Frequency Hz SGINTE Integrator Enable 50 Inkjet Microarrayer Manual version 1 4 APPENDIX C LISTS OF COMPONENTS C1 Robotics Components necessary for POSAM robotics PRO1 Motion controller 4 axis PROZ Servo drive digital Servo motor NEMA 1 stack PRO4 Cables drive to motor PRO5 Cables controller to drive PRO6 Power supply 24VDC 2 5A PRO7 Motion table 24 inch PRO8 Motion table 20 inch PRO9 Motion table 4 inch PR10 Brackets vertical mounting PR11 Personal computer Pentium III PR12 Optical Breadboard 35x47x2 inch PR13 Breadboard stand C2 Optical Mechanical Opto mechanical parts Compumotor 6K Compumotor GV SM23 Yellow Black 24V Daedal 506 Daedal 506 Daedal 105 Anodized aluminum 256
17. NNNNNANAGZANNNNNNNN gt ad 12 88 6500 0 4850 0 8000 0 8000 0 3500 0 1520 0 3700 2 8700 3 6400 4 8400 4 7600 2 8900 1 9100 20 1900 4 3600 0 1360 1 7300 4 4300 1 5800 0 4400 2 9800 4 3800 21 5000 0 6000 0 4500 7 7000 0 3500 0 8000 0 2750 0 8000 54 8100 37 0300 3 2200 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 0 6000 0 6000 0 6000 0 8700 0 5700 0 9900 53 177 30 13 10 8 00 8 00 2 80 3 04 1 48 5 74 7 28 9 68 9 52 5 78 3 82 40 38 8 72 2 18 27 68 17 72 3 16 1 76 5 96 8 76 43 00 1 20 0 90 123 20 4 20 9 60 1 40 1 40 1 40 1 40 1 40 1 40 1 20 1 20 2 40 12 18 2 28 5 94 Inkjet Microarrayer Manual version 1 4 C5 PCB 1902 Components for printed circuit board 1902 C1 C2 3 5 CN1 CN2 CN3 PLUGO1 CN4 5 CN6 PLUGO2 CN7 9 PLUGO3 F1 2 H1 5 JP1 2 LED1 3 LED4 5 Pot1 R1 4 5 R12 R13 14 25 27 R15 20 R2 R21 24 R3 R6 R7 R8 R9 11 RLY1 2 801 2 1 2 HU1 Circuit board 1902 Aluminum stand off LED Nice panel mount 3mm green LED Nice panel mount 3mm red LED LED Ceramic Disc Capacitor 0 25in Radial Leaded Capacitor 0 2in Electrolytic Capacitor 0 3in Amp 68 pin connector male BNC connector D SUB 25 pin connector receptacle female D SUB 25 pin connector receptacle male 12 pin Screw Terminal D SUB 9 pin connector plug male D SUB 9 pin connector plug fe
18. PCB 1804 Components for printed circuit board 1804 Total 703 03 Express PCB File 1804 pcb C13 C16 C1 C8 C10 C12 C9 C11 CN1 PLUGOA CN2 05 CN3 PLUGO6 Cn4 Cn5 D1 D8 F1 F4 H1 H2 IC1 IC15 1C16 IC2 IC3 IC4 IC5 IC6 IC7 IC14 L17 L19 L21 L23 L25 L27 L18 L20 L22 L24 L26 L28 L1 L8 L9 L16 PS1 PS2 R1 R10 R13 R14 R25 R2 R3 R4 R5 R6 R9 RA1 RA3 RA4 1 54 S6 17 20 2 55 515 516 Circuit board 1804 Aluminum stand off LED Nice panel mount 3mm green LED Nice panel mount 3mm red plastic film capacitor aluminum electrolytic capacitor plastic film capacitor D SUB 25 pin connector receptacle female D SUB 25 pin connector male D SUB 25 pin connector plug male D SUB 25 pin connector female D SUB 15 pin connector receptacle female D SUB 15 pin connector male Amp 68 pin connector male 12 pin Screw Terminal diode Fuse Breakaway header mounts Digital to analog converter NOT gate hex Op amp Follower Optoisolation quad darlington AND gate quad Decoder Solenoid driver LED LED LED LED 5V Power Supply 30V Power Supply potentiometer resistor resistor resistor resistor resistor resistor resistor array resistor array resistor array Socket Socket Socket File 1804 pcb 24 40 1 long threaded Threaded Threaded 1 5 nF 0 1 uF 8 2nF Pzt Head Matches CN1 6k4 Trigger Matches CN2 S
19. arrayer are directly controlled by the PC except the basic motion control functions that are handled by the 6K4 The Epson F057020 print head available from Agson Electronics Cherry Hill NJ print head is uniquely suited to inkjet microarraying It contains six fluid channels that can hold the four standard monomers the catalyst and still accept a modified monomer monomer mixture or preformed linker It contains 192 total nozzles The droplet size quoted by the manufacturer is a mere 6 pL Droplet size varies with viscosity and surface tension and consequently temperature but based on solvent consumption for the work described here our droplet sizes are closer to 10 pL The newer Epson print heads actually have more nozzles that squirt smaller volumes 4 pL More nozzles can result in faster synthesis These tiny droplet volumes 4 10 pL enable high spot densities and make consumption of reagents hard to measure but that keeps the costs down Most importantly the F057020 is a piezoelectric print head so it can dispense a fairly wide range of solvents A charge applied across a lead zirconia titanate PZT crystal deforms the crystal and bends a zirconia diaphragm near the nozzle orifice Le 1999 The action of the diaphragm ejects a droplet from the nozzle Solvents of almost any boiling point can be ejected Oligo synthesis requires a solvent of very low volatility so that the coupling step can complete before significant evaporation o
20. default Dry default PumpWaste 1 true TestNozzles Print default default default ErrGoto 5 2 Print X default default ErrGoto 7 2 Wait 60 End of PRE script KK K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K 29 Inkjet Microarrayer Manual version 1 4 a ok ok ok ok ok ok ok ok ok ok ok ok ok ok ok ok ok ok ok ok ok ok Basic Posam STEPWISE synthesis script basic pp2 Set acetonitrile to 3 25 oxidizer to 3 2s acid to 2 45 SetDrops 5 SetSol 1 3 2 SetSol 2 3 2 SetSol 3 2 4 Print first time Wash 1 default default Dry default PumpWaste 1 true Purgenozzles 5 TestNozzles Print default default default ErrGoto 7 2 Image 0 lbases default Print X default default ErrGoto 10 2 Image 0 lbases tetrazole default Wait 50 Print second time Wash 1 default default Dry default PumpWaste 1 true Purgenozzles 5 TestNozzles Print default default default ErrGoto 7 2 Image 0 2bases default Print X default default ErrGoto 10 2 Image 0 2bases tetrazole default Wait 50 Oxidize Wash 1 default default Dry default Wash 2 default default moveto 5 Wait 30 Dry default PumpWaste 2 true Detritylate
21. post 1 long PO31 Ring nuts 1 PO32 SM1 ext thd SM1 ext thd adapter 33 Barrel SM1 style PO34 Barrel SM1 style PO35 C Mount ext SM1 int thd adapter PO36 Mounting ring clamp SM1 style PO37 Barrel SM1 style 2 long PO38 Camera IEEE 1394 interface 9 Fireboard IEEE 1394 card PO40 IEEE 1394 cable 41 Large red LED 626nm Sunbrite PO42 Power plug 2 5mm PP 002B PO43 Fender washer 1 dia 1 dia Red 6 long 2 long 1 dia 1 dia 1 dia 18mm dia 1 dia 100mm F L 50 R 50 T 4 20 thd 5mm long 36mm F L 2 long 1 long 1 dia 72 long 1 long 1 dia 1 dia 2 long 1024x768 CCD PCI board 4 5m 8 candela 2 5mm dia 1 dia Edmond Ind Edmond Ind Thor Labs Thor Labs Thor Labs Thor Labs Thor Labs Digi Key Edmond Ind Edmond Ind Edmond Ind Edmond Ind Thor Labs Thor Labs Thor Labs Thor Labs Thor Labs Thor Labs Thor Labs Thor Labs Thor Labs Optics Optics Edmond Ind Edmond Ind Edmond Ind Optics Optics Optics Optics Edmond Ind Edmond Ind Optics Optics Optics Optics Edmond Ind Edmond Ind Optics Optics Optics NT45 070 NT32 478 NT38 922 NT53 264 NT53 373 TR6 PH2 ST SM1RR SMR1 SM1L20 290 1024 ND NT54 395 K32 755 NT45 892 NT54 824 03 644 NT54 628 NT32 709 NT54 392 TR2 PH1 ST SM1RR SM1T2 SM1L05 SM1L10 SM1A9 SMR1 SM1L20 Unibrain San Ramon M1024 Unibrain San Ramon 1203 U
22. rapidly remove fumes from inside the cover open the inlet port and close the leak hole POGO SOFTWARE Pogo is the POSaM control software It replaces Lombardi and Arrayer software described in previous versions of this manual It has most of the features of both and reads the same microarray lineup files Lombardi LNP and Arrayer CSV A lineup file describes the DNA sequences to be printed on the slide A playbook file is used to describe the procedure used to synthesize the DNA Pogo was developed in Visual Basic 6 0 on Windows NT4 0 and 2000 It requires that Compumotor s Motion Planner and National Instruments NIDAQ Nidaq32 dll specifically be installed It also supports a firewire CCD camera A Pentium 500 MHz with 256MB RAM is sufficient 9 Pogo v0 6 0 E 0 B Servo Panel le trio 15 Commanded Actual Go To D VSBYDeviUnderCVSYpogo vblpogo 050510 Iog Test Mode 0 BUNT No camera connected Sol Purging Bloves Test Go To Coordinates ort 1 3 d 6 7 9 Nozzles User Def amp XAxsHome gt DAE Slide Holder Working Nozzles Reset D 5 i s de w E Photodiode lt YAxisHome gt User Def 8 lt Z Axis Home gt Center d a 2 a s 27 Drops 1000 1 2 3 4 5 6 Pugean Reagents Contro Solencids Synthesis Playbook Playbook Down fStartup og fi EE 5 0 4 001 No script loa
23. replaced by the smaller Humirel HM1520 and oxygen was measured using an Oxy Plus electrochemical device Brandt Instruments Slidell LA Slide holder The slide holder was custom machined from solid 30 x 30 x 5 cm block of PTFE Slides are arranged in three rows of nine with a center to center spacing of 31 75 mm 1 25 The slides are secured by vacuum Two 9 52 mm 0 375 0 rings form a gas tight contact the bottom surface at the ends of the slides Three inclined channels underneath the slides collect the reagent wash waste While this design works for us it could be improved We rarely synthesize more than eight microarrays at a time A redesign of the slide holder is planned for the near future Vision system The optical system uses collimated light to obtain a high contrast image of the colorless droplets sitting on clear glass The lensing effect of the droplets results in images of dark circles on a bright background Ambient light is mostly rejected by a 630 nm longpass glass filter that passes nearly 100 of the red LED light The system includes a plate beamsplitter and a 1024x768 pixel IEE 1394 firewire interface We use the open source GPL camera libraries developed by Iwan Ulrich and others at Carnegie Mellon University s Robotics Institute http www 2 cs cmu edu iwan 1394 The optical system is mounted to the print head GETTING STARTED BEFORE BEGINNING ASSEMBLY CONSIDER THE LOCATION OF THE ARRAY MACHINE ALTHOU
24. table from this point on the X axis and adjust the leveling screws Place the level along the short direction of the table the Y axis and again adjust Place the electronics rack next to the table preferably to its right We previously had a short electronics rack that fit underneath the arrayer The PC sat on a table nearby Figure 1 We recommend placing the electronics rack to the right of the table This allows the operator to access the front door and the gloves on the left 2 Place servo positioners Place the servo positioners on the table using the coordinates given in Figure 2 First mount the two vertical brackets using four screws in positions A D Fasten the Y axis positioner the 24 inch stage to the brackets with four screws Attach the Z axis positioner to the moving face of the Y axis positioner with four screws This will require turning the Z axis lead screw by hand a few times each direction to expose the mounting holes The motor mount of the Z axis positioner points upward Place the X axis positioner the 20 inch stage on the table underneath the YZ axis assembly Elevate the positioner one inch above the table surface using eight one inch aluminum spacer bushings Fasten the positioner down with eight screws Attach the SM23 servo motors to the positioners according to the manufacturer s instructions Inkjet Microarrayer Manual version 1 4 1 1
25. that you any good molecular biology lab with some organic chemistry experience and a little engineering help can build and run this instrument You can make arrays and test methods And you can do it fast and inexpensively We generally make 4 to 6 10K feature arrays of 40mer oligos overnight deprotect them the next morning hyb wash and scan them during the day and have some results within 24 hours of putting the slides on the machine We figure the cost is less than 80 dollars per slide including labor costs That s quick and cheap and quickness and cheapness are good when you are designing something new You can test lots of different reporters and protocols and not bust your budget or have to wait weeks or months to do it You need to keep in mind that the printing element used in the POSaM was developed for the low cost commercial color printing market where 100 reliability is not expected therefore the matter of quality control is very important This is the technical and operational manual for the POSaM inkjet oligonucleotide synthesizer is open source and licensed under GNU type licenses The idea is for the community to help make a better machine and better methods by working together using a design funded by the NIH and therefore the public and we believe that instruments developed with public funds should be available to the public If you have questions or problems call us at 206 732 1276 or email us at posam systemsbiol
26. the print head ents DIO 32HS National Instrum 48 Inkjet Microarrayer Manual version 1 4 The drive circuit for the teflon reagent solenoids resides also resides on board 1804 It uses three digital output lines to activate the seven solenoid valves which deliver washes reagents and vacuum to the arrayer work area The driver IC DRV101 provides a strong initial 100 ms pulse to open the solenoid valve followed by a 24 kHz square wave with a 2096 duty cycle The droplet detection circuit resides on board 1902 Droplet verification uses the high frequency flash of forward scattered laser light to indicate the presence of an ejected droplet The output signal if the photodiode is amplified high pass filtered and converted to a digital signal by threshold comparison The state of the droplet detection is held in a D type flip flop The circuit is reset just prior to droplet ejection and the state is read immediately after ejection 5v 30v la a lt D i 740 T In peyor Dutg X Salenoidl gt Y s x 2 LEDO 5 t C selenciot B uda 2 l when how 1 R up 29 feo Yoks 270k 28 Sp e 3 solen
27. this format a lines e g 1a indicate oligonucleotide feature sequence and b lines e g 1b provide a feature description This is an example Lombardi lineup file BANK1 Unused BANK2 XTetrazole BANK3 Adenine BANK4 Cytosine BANK5 Guanine BANK6 Thymine SLIDE12 DPI 90 la TTTTTCTGGAGGGCCTGTGCGTGAA TTTTTCTGGAGGGCCTGTGCGTGGA 1b Gene001 Gene002 2a TTTTTCTGGAGGGCCTGGGCGTGGA TTTTTCTGGAGGGAATGTGCGTGGA 2b Gene003 Gene004 End of file 31 Inkjet Microarrayer Manual version 1 4 WHAT S NEXT The software for the machine vision system is still changing We wish to be able to detect missed droplets on our new masked substrates The masked substrates contain hydrophobic wells which define the diameter of the liquid bead regardless of whether it contains one droplet or two droplets By carefully focusing our vision system we are able to see a difference in the lensing effect of one and two droplet beads A new slideholder prototype is also available While it won t accommodate 27 slides we usually only want to make 4 or 8 at a time The new holder has an uncovered position that is used during printing and an uncovered position that is used during washing and drying 32 Inkjet Microarrayer Manual version 1 4 APPENDIX A MECHANICAL DRAWINGS A1 Array Cover Not shown Front door exhaust port top left 1 5 dia inlet port bottom rear 1 5 dia removable glove panels left and right
28. two threaded mounting points on the optical assembly one on the 2 SM1 barrel and the one in the back face of the beamsplitter cube Later two posts PO28 will be attached to these points Mount the 35mm lens in the Helicoid barrel PO28 Mount it in the middle of the moving tube with two ring nuts PO21 Attach the barrel to the 2 SM1 barrel using two different adapters PO32 and 5 Add a 5mm C mount barrel PO26 to the CCD camera PO38 and attach it to the Helicoid barrel Set screws on the camera allow the camera to be rotated and locked into place once aligned Precise alignment is done later once the system is powered on and focused Insert two 74 20 studs into the top left and left center holes of the print head bracket Screw the two post holders PO30 Insert the optical assembly into these two posts The illumination disk requires some cutting and gluing Cut the plastic lens of the LED off getting as close as possible to the light emitting portion as possible Use a hack saw first followed by a file Sand and polish the face of the LED smooth Ream out the fender washer until the LED fits through its center hole Glue the LED in place with epoxy Solder a small two conductor cable 8 long to the LED leads Solder a connector any type small is good on to the the leads Make a 7 long two conductor cable to connect the LED to the 5V power supply Use the power plug PO42 for the other end Insert the illuminat
29. 0000 LER looo pooooooooooDOODODDODODDODQg oo mim ooo 0000000000000000000000000 0000000000000000000000000 99 p 0000 0009900000000000000009 0000000000000000000000000 0000000000000000000000000 0000000000000000000000000 99 S co 600000000000000000000090 2000000000000000000000000 6 SED 0000000000000000000000000 0000000000000000000000000 9 DES lb600000000000000000000000 0000000000000000000000000 8 66 6666600 66065056006 oo0999009090000000000 eo 5 0006080060000069 ee 5 RLYL RLY2 eo Bessesen BG0000000000060008 eo 4 66 66 EI Pott 0000000000000006000000000000008 4003 0000000000000000000000600000000 6 gt b0000000000000000000000000000 55 D p 000060006000000000000000000060000 Se of pm ee 55 s 2 2 ao Ee Rae eeessos o 90965966 49 0088 85860608000 alee 2 06 wae Bou ue all D P3 oo SCH 55505558 6 meee Gooooco CAJ eite 55 doc e Proto area 3 ER elieeile site B6666666656858858638 3 560 dioc oeooocoooococoooos af Boa us pocoobobo5OoOOoOOOGo eo och eu ETL EXT EI oo KSE 0000007 21 Pom e e
30. 12 a NOTE Separate power supply 5494 for droplet detector circuit en L 1 7 LE ke 1 i3 7 Ge 1 CTR GM o3 p T IESESES 5u Fa ER ESA H Version Ed b SB Da EH a 5 E wf ipee KEE 1 de Solenoid queue a R21 Sik 8 i lt cReset Droplet Detector 4415 nos d P Stk sten 3 a g Bol mco lt Sly 220225 3 Zei on I Lee ot E 28 i 20 x Pose ped FA I av 2 ed i sn P Dos 8 ai ad i Re 36l Se 4 A Ie 5 Encoder Signal Conditioning pose pa B ot 7 227748 x 2 us B ver RE PE 9 af vm 8 BE m Ts ot ML Sal mer 5 2 1 n ow uoa essem ot m S welt A fos pa pr D box 8 lagi cil eng RY 953 904 som o S E que omms ES Lg I Send M Loss pen P Droplet bet eted gt Sei ei AK ep ped Ak prp D 8961 8 79 Re Droplet Detection Circuit jc Nate aur Eo he pi R Uin urap pin 40 ta pin 3 D Ia te Ws bech e FL o A r iov al la 14 fel Vel g p
31. 20VAC Gas pressure MG08 Rotameter valve 0 100 liters per minute Gas pressure MG09 Aluminum tubing 1 8 OD 12 long Gas pressure MG10 Manifold Gas pressure MG11 Tube clamp valve for flexible tubing 10 pk Gas pressure MG12 Air amplifier Blower Gas circulation MG13 joint ABS plastic 172 size Gas circulation MG14 Adapter ABS plastic 4 to 172 size Gas circulation MG15 End cap ABS plastic 11 2 size Gas circulation MRO1 GL 45 ported caps Reagent handling MRO2 Bottle GL45 cap 500mL case Reagent handling MRO3 Bottle GL45 cap 2L case Reagent handling MR04 1 8 OD Teflon tubing 50ft and fittings Reagent handling MR05 Teflon fitting nuts 10 pack Reagent handling MRO6 Ferrules 10 pack Reagent handling MRO7 1 16 OD Teflon tubing 20ft Reagent handling MR08 Tefzel fitting nuts 10 pack Reagent handling MRO9 Solenoid valve Teflon 14VDC Reagent handling MP01 Epson Stylus Photo 700 printer Print head MP01a Cable 15 cond flexible flat Print head MP01b Print head amp ink holder black Print head 016 Print head slide silver Print head MP02 Vial 1mL clear conical bottom 12 pk Print head Septa Pierce Tuf bond 72 pack Print head MP04 Needles non coring 20 x 4 inches Print head MP05 Piezoelectric print head Print head MMO1 Flexible conduit 172 I D 25ft length Conduit MM02 Aluminum tubing square 1 wide 12 long Solenoid tower MM03 Threaded 74 20 14 inches long Solenoid tower MM04 Bushing I
32. 824 C MOUNT SM1 ADAPTER m WE 1 SM1 BARREL SMIL10 1 DIA LENS 100mm F L 8 45 892 42 Inkjet Microarrayer Manual version 1 4 APPENDIX B ELECTRICAL B1 Electronics Overview The diagram below provides an overview of the various POSaM electrical interfaces The supervisory computer controls the piezoelectric printhead the solenoid valves and the droplet detection system via two PCI bus interface cards DIO 32HS and MIO 16E The computer commands the three axis positioning system via Ethernet connection to the servo controller 6K4 Trigger positions are programmed in to the 6K4 and piezoelectric pulsing is triggered by digital signaling from the 6 4 to the DIO 32HS The solenoid labeled phosphoramidite presssurization is currently unused PCI bus Desktop PC Ethernet PCI bus Multifunction IO High speed 6K4 Servo Board Digital lO Board Dig Controller MIO16E DIO 32HS L Dig Dig Dig Dig Y 30 VDC bs Solenoid Y axis Z axis Solenoid Solenoid Power gt oral 109 Driver Servo Servo Servo detector Suppl Power Amplifier board Amp Amp Amp pp y Digital buffer Anlg Bl We Anlg Anlg Mech Mech Mech Argon Phosphoramidite Primary Extra
33. Assembly manual for the POSaM THE ISB Piezoelelctric Oligonucleotide Synthesizer and Microarrayer Version 1 4 10 May 2005 The Institute for Systems Biology O 2005 1441 North 34 Street Seattle WA 98103 8904 The Hood Laboratory Group Inkjet Microarrayer Manual version 1 4 Table of Contents EEE A CD C ap 1 Inkjet Microarrayer Manual version 1 4 enne enne 2 Introduce lo SS 4 ENDENE 5 Overview of 5 em 6 Microarrayer electtOnlUs eese 6 Phosphoramidite delivery va hag ees E ERTER 7 ReasentUsolvent storage t re rn AER ENSE Sk e Ede Fe A EUR UOS 7 Nitrogen supply and system 1 eene enne eene 7 sU 8 VO SEN 8 T 8 Assembling fe Aae 9 1 Assembl e 9 9 3 Place servo controller and digital servo amplifiers 11 4 Connect PC and configure servo 11 5 Assemble printed circuit board 1509 ried aon t qe ebe 11 6 Assemble printed circuit board 1804 12 7 Assemble electronics box 1 13 8 Assemble printed circuit board 19002 14 9 Assemble electronics b
34. D 1 long Spacer MM05 Bushing ID v2 long Spacer MM06 Teflon block 12x12x2 raw material for machineSlide holder MMO07 O rings 3 8 OD 1 4 ID Slide holder MMO08 Machine shop fabrication slide holder Labor MM09 Machine shop fabrication print head holder Labor MM10 Punch arch 3 8 inch Tool MM11 Filter Whatman P N 6704 1500 a Carbon CapFume filter Mouser Manfield TX 63 CH 14404 Mouser Manfield TX 563 C 14432 Mouser Manfield TX 161 0717 187 Mouser Manfield TX 642 631H2 Digi Key Thief River FaF952 Mouser Manfield TX 651 5602100 Mouser Manfield TX 563 POS 1295 S Mouser Manfield TX 563 SA1278 BT Mouser Manfield TX 546 PBPA19014BK2 Digi Key Thief River Fe1125M ND Digi Key Thief River Fe970 25MP ND National Instruments 4777314 01 National Instruments 4777383 01 National Instruments 4184749 01 National Instruments 4183432 01 Small Parts Miami LakB LD 1 Digi Key Thief River Fa1607 KIT ND Small Parts Miami LakB WXF 1 4 Small Parts Miami LakB WXF 3 8 Hardware store 63669 M D Building Products Hardware store M D Building Products or equi VWR 56223 154 Small Parts Miami LakB HTT 190532 Instrumentation IndustriBE 131 or similar Clear Cut Plastics SeeContact Dave Ryan Hardware store Hardware store Hardware store Hardware store Small Parts Miami LakB TCNY K5 Various Ashcroft or equivalent Airtronics of Bellevue VET 2 6 L Various 8067 or equivalent Omnifit 11340 Various Con
35. Electronics rack 05 Fuse 5x20mm 5A 250V Electronics rack 06 DIN rail Electronics rack 07 Power strip and surge protector rack mount Electronics rack MEO08 Shelf 19 Electronics rack 09 19 Electronics rack ME10 Connecter DB 25M Electronics rack ME11 Hood DB 25 connector Electronics rack ME12 Digital board PCI 6533 a k a DIO 32HS Electronics rack ME13 Multi board PCI 6040E a k a MIO 16E Electronics rack ME14 Cable 68 pin for PCI MIO 16E Electronics rack ME15 Cable 68 pin for PCI DIO 32HS Electronics rack MCO1 Draw Latch Type 304 SS Cover MC02 Hardware stainless steel Cover MC03 Hinges Cover MC04 Fender washers 1 dia 7 4 hole 25 pk Cover MCO05 Fender washers 172 dia 25 pk Cover MC06 Weather seal 5 16 thick 19 32 wide Cover MCO07 Weather seal 5 16 thick D profile Cover MCO08 Box gloves and fastening clamps Cover MCO09 Polyethylene tape 18m roll 2 wide Cover MC10 Valve low resistance air 22 30mm diameter Cover MC11 Shop to fabricate cover Cover Tubing 3 8 OD Polyethylene or copper Gas pressure Misc brass fittings connectors and adapteGas pressure MG01 Nylon fittings Gas pressure MG02 Vacuum gauge 0 30inHg range Gas pressure MG03 Solenoid ET 2 6Volt Gas pressure MG04 Pressure regulator 0 10psi range Gas pressure MG05 Check valves 0 1psi cracking pressure Gas pressure MG06 Regulator 0 200psi Gas pressure 7 Solenoid valve large 1
36. GH WE HAVE ATTEMPTED TO KEEP THE PHYSICAL DIMENSIONS OF THE MACHINE REASONABLE IT REQUIRES A FAIR BIT OF OPEN FLOOR SPACE TO BE ACCESIBLE FROM ALL SIDES PROVIDE AN AREA AT LEAST 7 FEET BY 9 FEET THE MAIN TABLE IS AN OPTICAL BREADBOARD 4 FEET WIDE BY 3 FEET DEEP WE PACKAGED THE ELECTRONICS AND THE SUPERVISORY PC IN A 19 INCH FREE STANDING RACK ABOUT 2 FEET WIDE AND 2 FEET DEEP Consult with your facility manager about providing electricity high purity nitrogen vacuum and fume ventilation The electrical needs are easily met with a 120 volt 15 amp connection A nitrogen dewar may be placed adjacent to the POSaM but that requires additional floor space We recommend placing two or more nitrogen dewars in a separate room and plumbing the inert gas into the arraying room The dewars can be connected by a manifold which will automatically switch between tanks minimizing waste Our facility wide vacuum system provides a reliable 15 20 inches of water negative pressure If this is unavailable to you consider a dedicated vacuum system It is also useful to locate the POSaM near a fume hood but the POSaM requires its own ventilation plumbing Provide a 1 5 inch exhaust ventilation pipe and set the flow rate above 80 liters per minute Numerous small tools and fittings are required by this project While we have tried to be detailed in our parts listings it is likely that some small items are not listed but are commonly available around the laborator
37. ISTOPHER LAUST INSTITUTE FOR SYSTEMS BIOLOGY INSTITUTE FOR SYSTEMS BIOLOGY 35 Inkjet Microarrayer Manual version 1 4 A2 Print Head Mounting Brackets Ink Jet Microarrayer PRINT HEAD LEFT BRACKET Christopher Lausted 8 000 12 October 1999 2 250 0 250 Aluminum 03 2 500 1 500 375 5 020 438 00 250 D 6 000 6 SZ i 3 000 4 40 THD 2 T 3 000 0 750 1 625 lt Y Y 0 500 0 500 3 125 0 875 Lg 0 500 0 125 36 Inkjet Microarrayer Manual version 1 4 0 500 PRINT HEAD RIGHT BRACKET 2 500 Ink Jet Microarrayer ool A 0 25 2 250 Christopher Lausted FM 11 October 1999 0 250 9125 ra 00 250 i Aluminum pex ee 0 125 x 0 125 Groove i PS 0 438 2 500 1 500 6 000 4 40 THD 90 375 R0 250 2 500 0 750 0 500 1 625 H T z Y A 4 4 1 000 150 120 T 0 5 in 0 500 1 250 135 CS 1 000 3 120 5 000 Inkjet Microarrayer Manual version 1 4 A3 Slide Holder ES O
38. MB RAM 4 PCI slots various Lightweight Leveling adjustment 0000000000 Coherent Coherent lympic contrc6K4 lympic contrcGV L3E lympic contrcSM231 AE NGSN lympic contrc23GS CABLE 10 lympic contrc71 016987 10 lympic contrcPS60W lympic contrc506024S T ES D2L2C5M2E3 lympic contrc506020S T ES D2L2C5M2E3 lympic contrc106004BT ES D2L2C5M1E1 lympic contrc4990 08 various 61 9312 54 0930 Total 2595 0000 845 0000 732 0000 313 0000 150 0000 250 0000 4533 0000 4372 0000 1724 0000 250 0000 1000 0000 1089 0000 1023 0000 Total 23 206 00 2 595 00 2 535 00 2 196 00 939 00 450 00 250 00 4 533 00 4 372 00 1 724 00 500 00 1 000 00 1 089 00 1 023 00 2 786 75 Droplet detector 1 Filter red glass RG665 1 dia 02 Convex lens 50 mm F L 1 dia 03 Laser LED 670 nm 3 mW PO04 Laser diode mount 5 Photodiode 1cm x 1cm square area PO6 Post 6 long 7 dia 07 Post holder 2 long gt dia PO08 Ring nuts 1 PO09 Mounting ring clamp SM1 style PO10 Barrel SM1 style PO11 BNC cable Vision system PO21 Ring nuts 18mm PO22 Filter red glass RG630 1 dia PO23 Lens 100mm F L 1 dia PO24 Plate beamsplitter PO25 Set screw 77 to 1 long 74 20 thd PO26 Barrel C Mount PO27 Lens 36mm F L DCX 15mm 18mm dia PO28 Helicoid barrel PO28 Post gt dia 2 long 8 32 stud amp 7 20 thd PO30 Post holder gt dia
39. N8 a Institute for Systems Biology Board 1503 Steghen Mordue Rev 1 1 Chris Lausted 6238 2003 Page Wl Top view of circuit board Q CN9 b CN9 a Des 5 s G 1855 fay ls og a Feo 69 D J dr L lps t Oe 69 340 ao 5 OL iip cde 7 cr 9 Ge He 8 5 oj 14 1 45 Inkjet Microarrayer Manual version 1 4 B4 Board 1804 Circuit schematic The Institute for Systems Biology Printed Circuit Board 1884 Page bart a D e 5 6 a o o eB institute for Systens Biology ERICUGUR COE ssesssssssoses O 5 a 9150 Stephen Mordue Chris Lausted e 5 eo e 60000060000009 RER Board 1804 2004 6606060000006600999 o o e 20060000600000000060 680000000000000000 ae g i inte ocotoooo b000600000000006060 eee Sy By poocoocoooscocooaacooobooo acer 19 m 8 56060660660000666060000000660065 e e 8660 i 000850006000000000000000000 M e gu
40. Op fo 0 10 1 505 1 505 1749 5 000 6 748 3 344 11 688 ALL DIMENSIONS IN INCHES ANGULAR 1 ALL BENDS AT 9INDIESSEERHERWISE STATED FOLD TO FOLD AND FOLD TO HOLE XXXX 020 EDGE TO HOLE AND HOLE TO HOLE AN XXX XXXX AS B EDGE TO EDGE XX XXX UNILESS OTHERWISE STATED Seattl EDGE TO ED PURGES aanere SIZE DATE T 02 25 04 FINAL APPROVAL SILK SCREEN FILE 1001 22 BACK PANEL cdr SLIDE CHUCK dft SHEET 3 OF 7 SCALE1 2 22 REFERENCE HOLE le WA 98103 206 732 1200 LE SLIDE CHUCK Institute for Systems Biology 1441 340 REV B 38 Inkjet Microarrayer Manual version 1 4 o 9 Ls bg o 3 0 o 9 20 0 o 9 cO o 9 e 0 o o 9 o 9 o 9 0 o 9 d i 9 oO 9 9 ei 9 FT 1 23877 F 1 239 j 2 2 398 090 4 mee 600 pe ee 100 2 090 2 590 2 840 3 100 3 344 4 339 4 599 4 849 5 349 6 339 pe 6 839 7 089 7 349 8 344 8 587 8 847 9 097 9 597 10 587 11 087
41. ccurs The thermal print head used in bubble jet printers is more popular in the home office printer however it is only suitable for fairly volatile solvents It uses a small heating element in the capillary to vaporize solvent and create a bubble The rapid expansion of the bubble ejects a droplet Although they are unsuitable for de novo array synthesis thermal or bubble jets have been used successfully to deliver aqueous solutions of oligonucleotide and of protein for microarraying Stimpson et al 1998 Roda et al 2000 Servo control The three axis positioning system utilizes Parker Daedal 506 series ball screw linear actuators driven by NEMA SM23 servo motors The motors in turn powered by GV digital servo amplifiers on command from a 6K4 multi axis motion controller The controller interfaces to the PC by Ethernet triggers the actual jetting through one of its eight digital output lines This system can move the print head over a wide 50x60 cm range with 5 micron repeatability Microarrayer electronics Circuit schematics for the print head solenoid and droplet detection interfaces appear in Figure 3 Two PCI interface boards the DIO 32HS and the MIO 16E are used National Instruments Austin TX The F057020 print head requires three data one clock one latch and one piezoelectric drive signals Each of the three data lines programs two banks of 32 nozzles Data is sent serially in 64 bit words to the nozzle selecti
42. croarray synthesis The playbook contains commands for printing washing and imaging the slides Command language help is available in a collection of tabs on the right hand side of the dialog box Syntax is checked when the file is opened One command appears on each line It may take one or more parameters separated by a whitespace comma or parenthesis For example the lines WASH 1 default default and WASH 1 default default are interpreted identically Lines starting with or REM are remarks and are ignored by Pogo Some commands like WASH may take a variable number of parameters in reference to slide numbers For example default may be used to indicated that all slides loaded in the machine are to be washed Alternatively 17 16 15 14 may be used to indicated that slides in those four positions are to be washed 23 Inkjet Microarrayer Manual version 1 4 Help Section Init Program Stepwise Program Finishing Program Shell Rem Image EnGoTo PurgeNozzles AlLog Movedbs MoveTo BosFlush Pumpwaste FipLog SetSal SetDrops Message Home MoveRel Print Wash Dy wait TestNozzles No script loaded Syntax PRINT lineup drops slide 1 slide 2 Parameters lt lineup gt text X Print whole array with one reagent Default The lineup currently loaded drops integer 1 100 Number of drops Default Use
43. ded Test Function Sero Panel Solenoid 3 Development Solenoid 4 Status Idle Configuration Reagent Panel Exit 10560 EOS Periodic Jet Waste Dispense where Here Figure 14 Screenshot of the Pogo with visible Main Servo and Reagent Panels Dispense time 5 14 Solenoid 1 Solenoid 2 Pogo Menus 1 The File menu 22 Inkjet Microarrayer Manual version 1 4 Array Slide Spot HX horiz Spot vert Description Figure 15 The lineup file dialog 1 The Open Lineup item This opens the dialog box that selects the microarray lineup or the sequences to be printed The user is asked which slide the lineup is to be printed on Alternatively the user can click on the slide button in the Slide Holder area of the main panel The lineup file can be simply comma separated variables CSV or a Lombardi lineup file LNP The files can contain up to 140 rows and 70 columns of sequences warning message will appear if unrecognized characters are encountered Usually A C G and are used Other characters can be used X usually denotes 1H tetrazole catalyst Underscore _ and dash produce no error and are used when nothing is to be printed in that spot by Pogo The lineups can not be edited here A spreadsheet can be used 2 The Open Playbook item This opens the dialog box that selects the playbook file for mi
44. dix When finished with the servo amplifiers connect the 6K to the PC using both crossover RS232 and crossover ethernet cables Optionally install Visual Basic or Visual Studio version 6 Tortoise CVS http www tortoisecvs org and WinMerge http winmerge sourceforge net To connect to the CVS repository use the secure shell ext protocol the bioinformatics org server the cvsroot pogo repository and the pogo vb and pogo vision modules Yes this open source project requires some proprietary elements This decision was made early in the project to take advantage of the drivers and setup tools from National Instruments and Compumotor There probably wouldn t be any serious problems converting to all open source elements The OS could be Linux and the interface cards could now use the Comedi drivers The servo controller has standard ethernet and RS 232 interfaces Pogo could be ported to or Java with a Java Native Interface Of course this might take some time 5 Assemble printed circuit board 1503 The smallest circuit board 1503 is an adapter to connect a DB25 cable to the flexible flat cables of the Epson print head This circuit board is mounted on the back of the X axis positioner and the flexible cable stretches to the print head Perhaps it would be better to mount it right next to the print head Download ExpressPCB software from http www expresspcb com and the latest circuit board files 1503 pcb 1503 sc
45. e synthesis and postsynthesis playbook files Inspect the code for errors The dialog box contains a help section If there are any errors use a text editor to fix the files Reload the corrected files if necessary Close the dialog box 7 Start synthesis If the presynthesis program does not contain 45 minutes of wait time wait 45 minutes for the to dry down Set the Down number to Startup script using the arrow buttons Set the line number by clicking on the line or by using the arrow buttons Start the synthesis by clicking the Run button Script execution can be paused with the Stop button It may be restarted again with the Run button 28 Inkjet Microarrayer Manual version 1 4 Sample Playbooks ok ok ok ok ok ook ok ok ok ok ok ok ok ook ok ok ok ok ok ok Basic Posam PRE synthesis script basic ppl 13 OCT 2004 ISB Set acetonitrile to 3 25 oxidizer to 3 25 acid to 2 45 SetDrops 5 SetSol 1 3 2 SetSol 2 3 2 SetSol 3 2 4 Two initial washes BoxFlush ON Wash 1 default default Dry default Wash 1 default default Dry default PumpWaste 2 true Wait 45min 5 9min exercise the inkjet Wait 300 Wait 300 Wait 300 Wait 300 Purgenozzles 5 Wait 300 Wait 300 Wait 300 Wait 300 Purgenozzles 5 Wait 300 Do an extra printing of the first down Wash 1 default
46. e 11 397 11 597 11 688 NOTE THIS PAGE FINTENDED ROR USE OF NC PROGRAMMING AND INSPECTION REFERENCE ALL DIMENSIONS IN INCHES ANGULAR 1 ALL BENDS AT 90NUESSEBEHERWISE STATED A Institute for Systems Biology 1441 341 Eo TO code iise rb Seattle WA 98103 206 732 1200 PURCHASING d d A SIZE ATE TITLE SLIDE CHUCK REV FINAL APPROVAL SILK SCREEN FILE NAME SLIDE_CHUCK dft SHEET 4 OF 7 SCALE1 2 39 Inkjet Microarrayer Manual version 1 4 0 0 479 250 750 1 729 287 2979 3 344 3 537 4 229 4 787 5 479 6 037 6 729 7 287 7 979 8 344 8 537 9 229 9 787 10 442 X DIM FOR RADIUS 10 479 10 938 ALL DIMENSIONS IN I FOLD TO FOLD At ENGINEERING FINAL APPROVAL INCHES ANGULAR 1 ALL BI ND FOLD TO HOLE XXX XXXX EDGE TO EDGE OUNLESS OTHERWISE STATED PURCHASING SILK SCREEN 11 037 NOTE THIS PAGE FINTENDED ROR USE OF NC PROGRAMMING AND INSPECTION REFERENCE ENDS AT 90 DEGRBIEESS OTHERWISE STATED 1 020 EDGE TO HOLE PRODUCTION AND HOLE TO HOLE XX XXX XXXX 010 IS B SALESIMARKETING SIZE DATE A 02 25 04 FILE NAME Insti
47. e e 5800856000600000000600085006006080 WG e o 9 600000006006000000000000000090 es x e G0000000000000000000000000 BYS e000000000000000000000000008 81 8 S mI ka pep e6606000600660060000600000006 5 a B ge WP Go0000000000000000000009000 5 e 6 6o00000000000000000600000060065 amp E ei Je as 66000000000000600000000000 38 600660000000000060060000000 090000000000000600000000000006 a e eoconoococoOoDDOOGOGOO0000000000 8 a e m5 8 o eo00000000000DOO0000000005000 19 ph Be e ert e6006000660066000000060000000 968 e ER 06806000000006000000000060 b se Bess KE 6 e6606060066665666606060000006000 e e 945 666606000000060050000000069 9 t 5 2 52 600000006006000000060000 D D Cas 6 00000000000006006600090080 D P 55 00000000000000000000000 oo ld e kk o o000666066000000600000009 oe xe aa 0000000000000000000000000000 e le 5 5 2E 5 68 Sie e s0600000600000000060060060000000 SEH Bo 09996000090000088006005600 e Be 66856606060005600050060000800 p 000000000000000009000000 y 6 60000000000000000000000000085 SC EE Som PE Eg A PH e Rege e fa e
48. ers between the mounting screw holes This will hold the connectors up off the board Do not solder ICs resistor arrays or fuses directly to the board Use sockets instead After testing the board for printing errors and short circuits with a multimeter insert these components into the sockets Note that the polarity of capacitors and LEDs is indicated by the shape of the solder pads The side is indicated by a square pad and the side is indicated by an ordinary round pad Insert the longer lead of each LED into the square pad Figure 6 Top view of the 1804 board after assembly 7 Assemble electronics box 1 Package board 1804 into an aluminum rack mount enclosure First drill or punch holes in the front panel for the 120V power switch and three power indicator LEDs Optionally punch two holes for BNC outputs eight holes for solenoid indicator LEDS and three holes for signal indicator 13 Inkjet Microarrayer Manual version 1 4 LEDs Next punch holes for the three style connectors of the circuit board Cut square holes for the 68 pin connector of the circuit board and the 120V combination receptacle fuse holder Drill mounting holes for the circuit board for the 5 0 power supply and for the 30VDC power supply Mount the circuit board power supplies DPDT power switch LEDs and BNCs The photo below shows the circuit board alone mounted in place Also shown are the cables connecting the board to the 1503 and
49. es if necessary See Appendix A4 for an exploded view of the System The beamsplitter cube is at the center of the optical system The cube contains a splitter glass mounted at a 45 angle It has four round C mount threaded holes Three holes are used the fourth is capped Referring to the Appendix check that the splitter glass is oriented correctly In that schematic you are looking at the face of the cube that does not have 74 20 mounting hole in it The LED light will enter the left hole and be reflected down out the bottom hole to the slide Some LED light will continue straight through the splitter glass and strike the cap This cap needs to be made less glossy to reduce unwanted reflection We found that adhesive backed velcro was a quick and easy solution Take a piece of loop side not hook side velcro and cut a 1 diameter disk from the material Attach the disk to the cap and replace the cap Mount the 100mm lens PO23 into the 1 SM1 barrel PO34 with two ring nuts PO31 The lens sits at the bottom end of the barrel with the convex bulge up There will be an unwanted glare if the lens is mounted upside down Attach the barrel to the splitter cube bottom hole with an adapter PO35 Mount the red filter PO22 in the 2 SM1 barrel PO37 with two ring nuts The exact position does not matter Attach the barrel to the splitter cube top hole with an adapter PO35 Clamp the mounting ring PO36 over the barrel There are now
50. ey Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key usdigital com Digi Key Digi Key 8405K ND 67 1148 ND 67 1147 ND 67 1148 ND 67 1149 ND P10461 ND 399 2143 ND P10967 ND A29093 ND ARF1065NW ND 182 825F ND 1125M ND 277 1257 ND 182 809M ND 2209F ND CP 202B ND CP 004B ND 283 2111 ND WM6880 ND 9001 ND P461 ND HLMP3750ACM ND 3386H 103 ND 10kEBK ND 100kEBK ND 2 2kEBK ND 470kEBK ND 1 0kEBK ND 820kEBK ND 5 6kEBK ND 8 2kEBK ND 1 0kEBK ND 100 ND A9414 ND A9408 ND 296 1391 5 ND 296 2101 5 ND 157183 296 1606 5 ND HM1520 ND 2 NJSASANNNNNNN Total 89 2000 0 4850 0 8000 0 8000 0 8000 0 8000 0 3000 0 1210 0 3600 20 1900 7 5800 2 8700 3 4500 4 3600 1 8300 1 6200 0 3800 0 65 1 7300 4 4300 0 1160 0 2750 0 3500 1 2900 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 1 5900 0 7920 0 5700 0 4900 0 5000 3 0500 0 5600 49 5000 54 484 28 178 40 13 10 8 00 8 00 8 00 8 00 3 00 1 21 3 60 Inkjet Microarrayer Manual version 1 4 C6 Other Parts Miscellaneous POSaM components Total 8 663 05 MEO1 Rack mountable case 19 Electronics rack ME02 Chassis cover 19 Electronics rack AC power inlet with fuse holder Electronics rack ME04 Power switch SPST
51. f electrical tape 6mm thick and 50mm long Place the strip on the end of the lens barrel as shown below Place the barrel in the ring clamp and tighten the clamp The lens faces the rear of the POSaM Connect the photodiode to the 1902 board connector CN2 with a BNC cable 11 LASER PHOTODIODE POINT O POINT N Figure 12 Droplet detection laser and photodiode assemblies In the same manner mount the laser diode POO4 at the rear of the POSaM at Position of Figure 2 coordinates 35 12 Attach the laser to a 5VDC power supply such as the one provided on the 1902 board Aim the laser at the center of the blocking strip Focus the laser by minimizing the diameter of the red spot on the blocking strip The sensitivity of the detector can be adjusted 19 Inkjet Microarrayer Manual version 1 4 by moving the lens in its barrel The default position is centered one half inch from the barrel front one half inch from the barrel rear 19 Assemble optical system This system is recommended but not required The optical system illuminates the clear droplets on the microarray with collimated LED light The lensing effect of the droplets provide a high contrast image for the CCD detector Most components are provided by Edmund Industrial Optics and Thor Labs To keep the optics clean work in a dust free room and wear gloves Use canned air or a stream of oil free nitrogen glass to blow dust off of glass surfac
52. ft glove hole and right no glove holes panels with 24 long 6 screws Seal the screw holes by covering them inside the main body with polyethylene tape 09 The front panel door attaches with three hinges on the top and has five latches around the sides and bottom Attach the hinges and latches 01 with more 6 screws from 02 and seal the screw holes with polyethylene tape Last attach gloves and the exhause valve Attach the gloves 08 to the left panel with large worm screw clamps large versions of those used for automotive radiator hose clamps A very low resistance valve MC10 is needed for the exhaust port at the upper left corner of the cover We extracted ours from a dust mask sold by the local hardware store It is 30mm in diameter and fits tightly inside the cover exhaust port tube The mask comes with three such valves We replace them every three months 21 Inkjet Microarrayer Manual version 1 4 21 Connect fume exhause hose Connect the exhaust port at the upper left corner of the cover to your fume exhaust system using flexible conduit MMO1 Overlap the exhaust tube with about 30 mm of conduit and fasten with a worm screw hose clamp Cut a hole 20mm in diameter in the conduit immediately next to the exhaust port tube This leak prevents your building s exhaust system from creating a vacuum inside the POSaM cover Place a cork in the inlet port at the lower left rear corner of the cover To
53. gnificant heat During oligo synthesis only one solenoid need be open at any given time The two solenoid valves Model ET 2 6 H Airtronics Bellevue WA controlling nitrogen flow are normally closed and require 3V to open Two output lines of the MIO 16E digital port are used to activate the two TTL compatible relays that power the solenoids Proper function of each of the 192 piezoelectric nozzles is verified by the laser droplet detection subsystem A red laser diode is mounted orthogonally to the direction of print head motion such that the droplet stream of each bank of nozzles can intersect the beam The print head is positioned 10 mm above the beam Nozzles are fired in series through the beam and the forward scattering of each droplet is detected by the photodiode A red bandpass filter is used with the photodiode The output signal is amplified highpass filtered and converted to a digital signal by threshold comparison Nozzles fail due to bubbles or plugging and are taken offline during synthesis The 10 mm distance is chosen so that partial nozzle occlusion which deflects droplet trajectory also registers as a nozzle failure Phosphoramidite delivery The six fluid channels of the inkjet print head each contain a needle inlet a filter an ink cavity and a nozzle plate The needle inlet normally punctures a protective membrane beneath the ink cartridges The volume between the inlet and the nozzle is approximately 25 pL In the desig
54. h 1804 pcb 1804 sch 1902 pcb and 1902 sch from the ISB website http techdev systemsbiology net posam index php Order two replicates of each board online with ExpressPCB Order the necessary components for all three boards from a vendor such as DigiKey 11 Inkjet Microarrayer Manual version 1 4 2 i nt DESS TEATRO Pr 2 1 BOPP Roe Po ee gt Mim D Ze e av d 2 le MN 5 nm cem Ri Ie uc HS 9 Figure 3 Top view of the 1503 board as it arrives in the mail Assemble the circuit board using the layout information in the 1503 schematic sch and circuit board pcb files First screw four stand offs into the corners of the board Second insert the components and check that everything fits properly Third solder the components in place Use a solder iron of smaller wattage with a fine tip Note that there are 16 holes for the small white 15 pin flexible cable connectors While there are probably lots of errors and omissions yet in the manual this isn t one of them At one time only 16 pin connnectors were available in the U S and that is what we used We simply inserted a 15 conductor cable into the first 15 positions of the 16 conductor connector You may solder the 15 pin connector into the 16 hole position Also note that there are four such connectors when only two are needed The second pair of connectors are reserved for the fu
55. h the flash of red scattered light from the laser A straight red line with no gaps indicate proper operation Click Test Nozzles Pogo reports the number of failing nozzles how many have gone offline and how many have come online since the previous test 4 Freshen the wash lines Open the Reagent Panel Use the Dispense where pull down menu to choose Purging area Enter 6 below the menu to indicate that each solenoid will dispense for six seconds Click Purge This is also a good time to check the Dryer to start filling the enclosure with inert gas and Periodic Jet boxes 5 Load slide lineups Select the slide positions where microarrays are to be printed It is best to select adjacent slides To make four microarrays for example choose slides 13 14 15 and 16 Click the button for each slide number With each slide selection dialog box click Load and navigate to the desired CSV or LNP file Inspect the lineup displayed Note that the reagent symbol letters are colored The dot colors in the display area correspond to the reagents Advance through all of the downs It is possible to view the feature sequences and descriptions but it is not possible to edit the lineup files here Check that the reagent symbols are correct that they match the reagents loaded in the print head 6 Load the playbooks Click the Playbook button in the Synthesis Playbook area Load the presynthesis stepwis
56. has a single access door providing a 40 x 70 cm opening A glove panel also allows the operator to work inside the enclosure without opening the access door The high pressure inert gas is controlled by a 0 100 valve rotameter Mini Master type Dwyer Michigan City IN This gas supply serves dual roles it displaces the air inside the enclosure and it powers the air amplifier 1 5 Conveyvac ARTX Cincinnati OH our internal circulation apparatus The apparatus circulates the internal atmosphere through a series of activated charcoal and desiccant filters The system is flushed with nitrogen at a 40 Ipm flow rate for 40 minutes prior to oligo synthesis Assuming good mixing of inert gas with air the time constant T for the flushing process would be approximate 7 9 minutes The observed is slightly shorter 25 6 minutes for oxygen depletion because much of the internal volume of the enclosure is occupied by hardware The air amplifier circulates gas in a horizontal loop The nitrogen fills the enclosure from bottom to top Drying takes a little more time than oxygen depletion 6 8 minutes While the use of desiccant accelerates the process much water is adsorbed to the surface of the hardware if the enclosure door has been open for a significant period of time Relative humidity was measured using a capacitance hygrometer Model 4187 Control Company Friendswood TX this has since Inkjet Microarrayer Manual version 1 4 been
57. hout them Of course That s one of the reasons that Afffymetrix started making in situ synthesized oligonucleotide arrays They could store all their sequences in a computer file and we all know that computer storage has come down in cost faster than the processors have gone up in speed It costs essentially nothing to store and recall a virtual library of sequences from the RW memory of a computer Of course this has some problems as well particularly in designing the appropriate reporter to unambiguously identify each of the genes you want to measure but we ll get to those Affymetrix has now had more than 10 years to develop their product and they haven t been sitting still on their technology There have been lots of reviews and comparisons of Affy arrays and others Islam et al 2002 Kuo et al 2002 Li et al 2002 Relogio et al 2002 Rogina et al 2003 and you should read some of them But one of the problems in our eyes anyway is that the chemistry used by Affy photocleavage of the protecting groups on the dNTP monomers is not all that efficient so the oligos that can be synthesized are relatively short 20 to 25 bases at the maximum It turns out that it takes several to many 25 mers to unambiguously identify any specific gene which means that instead of 30K 40K reporters to cover the genome it takes 10 to 20 times more reporters or 300 to 600 thousand different reporters to identify all the genes expressed in a genome Until recent
58. hutoff switch two panel mount fuse holders and an optional neon power indicator lamp Place the panel near the bottom of the rack Connect the servo amplifiers to the servo controller It is convenient to place a rack mount 120V outlet power strip and surge protector just below this panel 4 Connect PC and configure servo system Prepare the supervisory PC If your PC does not have a rack mount case it is convenient to place a shelf for it inside the electronics rack Install Windows 2000 if necessary Install the IEEE 1394 card and the CMU driver version 6 2 http Awww 2 cs cmu edu iwan 1394 download html Install the National Instruments PCI DIO 32HS and the PCI MIO 16E cards and the supporting Ni daq software according to the manufacturer s instructions We configure the PCI DIO 32HS as device number 1 and the PCI MIO 16E as device number 2 but Pogo automatically detects the board numbers Install and configure two ethernet interfaces One ethernet card can be used to connect to a LAN The other card interfaces with the 6K Configure this card with TCP IP address 192 168 10 31 and subnet mask 255 255 255 0 Configure the three servo amplifiers according to the manufacturer s instructions Install Compumotor Motion Plannner Software on the PC One at a time connect the PC to the servo amplifiers using a crossover RS 232 cable Download the configuration script using Motion Planner An suitable configuration script can be found in the appen
59. ion disk in the gt SM1 barrel PO33 and secure with a ring nut Attach it to a 1 SM1 barrel 4 Attach it to the left side hole of the beamsplitter cube with an adapter PO35 The exact position of the disk inside the SM1 barrel may require some adjustment to get nicely collimated light on the slide The light path from the LED to the 100mm lens should be 100mm The camera can be focused and the light source collimated once all software is installed including Pogo and a firewire camera real time viewer Start the firewire viewer e g 20 Inkjet Microarrayer Manual version 1 4 1394CameraDemo exe from Place an opaque slide e g A slide with a printed black on white label or barcode stuck to the surface in the slide holder and illuminate it with a bright diffuse light Jog the print head into a position above the slide The bottom of the optic system the barrel containing the objective lens should be 45 mm above the slide This will be about 20 000 encoder counts above the printing elevation Start the firewire viewer Use the helicoid barrel to focus the image After the opaque image is focused the LED light can be collimated Turn off the diffuse light and turn on the LED Replace the opaque slide with a clear clear glass slide Inkjet an array of droplets on the slide Position the optical system over the slide again Adjust the position of the illumination disk it its barrel until the array image appears focused
60. log 2 Choose the Slides tab Specify the coordinates of the 27 slides in the slide holder The slides are arranged in nine columns and three rows The nine columns are separated by about 25000 encoder counts or 1 25 inches 1 count 1 27 microns The three rows are separated by about 100000 values The Z axis will be at roughly 65000 Exact coordinates have to be determined by test printing trial and error 3 Choose the Landmarks tab Seven of these coordinates are provided for convenience but one is necessary for proper operation Enter the new droplet detector coordinates here Optionally define the other seven 4 Choose the Printhead tab The default coordinates should be acceptable The inkjet print head contains six rows of banks separated by 1778 or 6222 counts The bulk reagents are in dispense tubes separated by 10000 counts The position of wash line 1 relative to the print head is 25116000 28000 Z 8000 5 Choose the Limits tab The default coordinates should be acceptable The X limits are 176000 the Y limits are 128000 and the Z ranges from the printing elevation to 90000 6 Choose the Reagents tab The reagent name given in the Inkjetting area is very important The first initial is used in interpreting the lineup file Use X tetrazole Adenosine Cytidine Guanosine and Thymidine Or simply use X A G and T Do not use the same initial twice The
61. lt solenoid run times must be chosen Most of these values will not change from day to day The robotic home positions will not change every day but will change 26 Inkjet Microarrayer Manual version 1 4 after the 6K controller power is cycled This may affect the X position of the droplet detector which is quite sensitive 1 Launch pogo exe 2 Homing the axes The three axes must be homed absolute coordinates must be defined whenever the 6K controller is powered up Pogo checks if the 6K has been homed If not the user is given the opportunity to home the axes This must be done to avoid damaging the machine 3 Open Servo Panel and check for motion It a good idea to open the Servo Panel and test the motion of all three axis The panel can be left open 4 Determine droplet detector coordinates The coordinates of the droplet detector must be determined Use the Servo Panel to move the print head until the bottom left side near the nozzles of Bank 1 just breaks the red laser beam Jog the print head about 2mm left and up about 10mm In the Working Nozzles area of the Main Panel is a center button Click center and record the X coordinate Pogo moves the print head slowly to the right while firing droplets and watching for flashes of light Jog the print head left 2mm and repeat a few times Note the average X value Also record the Y and Z coordinates 5 Edit the main configuration file 1 Open the Configuration dia
62. lter cartridge MM10 We monitor vacuum visually with dial gauge MG02 A voltage output pressure transducer is planned for the future 17 Install hygrometer Connect the Humirel hygrometer HU1 to a DB9 connector PLUGO2 via a 2m length of shielded cable Connect wire 1 white to pin 2 ground wire 2 blue to pin 3 voltage source and wire 3 yellow to pin 1 humidity signal Mount the hygrometer on the XZ axis vertical bracket PR10 near the slide holder Plug the sensor in to board 1902 18 Install droplet detection laser and photodiode The droplet detection laser sends a beam from behind the print head to the photodiode detector in front of the print head The beam is aligned so that all droplets fired downward from the 32 nozzles in any one bank will intersect the beam Light from the beam is normally blocked from reaching the photodiode by a black tape blocking strip Light refracted by the droplets passes around the strip and reaches the detector Place a post mount POO7 to support the photodiode at Position of Figure 2 coordinates 35 27 Insert a 6 post POO6 and attach a ring clamp 09 to the end of the post Insert the photodiode 05 into the bottom of the 1 SM1 barrel PO10 followed by the red filter POO1 and secure them with ring nut POO8 Use pair of ring nuts to secure the lens P002 in the middle of the second barrel PO10 Screw the second barrel on to the first Cut a srip o
63. lus Photo 700 printer Also extract the stainless steel slider rod from the printer Insert the holder between the mounting holes of the right printhead bracket piece Insert the slider rod through all four 16 Inkjet Microarrayer Manual version 1 4 mounting holes of the left and right printhead brackets passing through the holder Secure the rod with two set screws Cut six 1 lengths of flexible 3 16 OD Pharmed tubing Attach them to the inkjet inlet spikes Cut six 7 lengths of 1 16 ODthick wall teflon tubing Insert them in the Pharmed tubing Cut the luer ends off six 20 gauge non coring 4 needles leaving the needle 3 in length Deburr the needles and wash in an ultrasonic bath Insert the cut end of the needles into the teflon tubing Carefully insert the needles into the phosphoramidite vials In the illustration below we have made a reagent rack from a sheet of aluminum The vials may also be placed in the ink holder d Figure 11 Phosphoramidite is fed from the vials through 20 gauge needles and teflon tubing to the inkjet Pharmed tubing is used to attach the teflon tubing to the inkjet 15 Assemble pressurized gas and liquid plumbing Gather together the components needed to complete the POSaM fluid system diagrammed below Most of the components are listed in Appendix C6 but part numbers for metal and plastic tubing fittings connectors and adapters will vary between hardware stores We purchased an assortment of
64. ly even the photolitographic technology used by Affy could not put that many features on a single slide Their new masking technologies may be able to put a whole genome on a slide now however since you have to make 4 new masks for every position in an oligonucleotide it gets very expensive to change an array and it also takes time to design and manufacture these new masks That really takes this technology out of the reach of most academic labs Xeotron and Nimblegen are now using dynamic micromirror displays for maskless photolithographic oligoarray synthesis but these are also unavailable to most labs Back in the 1990 s Blanchard and Hood demonstrated at the University of Washington that off the shelf inkjet parts might be used to deliver standard phosphoramadite chemistries to the Inkjet Microarrayer Manual version 1 4 modified surface of a slide in order to synthesize new oligoarrays very rapidly and inexpensively Blanchard and Hood actually put together a prototype inkjet arrayer that was used as an asset during the formation of Rosetta Inpharmatics Rosetta and then Agilent went forward and developed an elegant inkjet array synthesizer based on these original plans but because this is a commercial instrument it isn t simple enough to be constructed or maintained by a regular molecular biology lab In addition it has taken more than 5 years of development to get a catalog of inkjet arrrays to the end user This we feel has held u
65. male Connector power jack 2 5mm Power plug 2 5mm Fuse 0 2in Breakaway square header 80pin Closed end shorting jumper LED LED Potentiometer Carbon Film 1 8W Carbon Film 1 8W Carbon Film 1 8W Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in 0 25in Carbon Film 1 8W 0 25in 0 25in 0 25in Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Relay Socket 14 pin Socket 8 pin Op amp quad D flip flop quad Encoder signal conditioner AND gate 7408 type Humidity Sensor File 1902 pcb 44 40 1 long threaded Threaded Threaded Express PCB File 1902r2 pcb Digi Key Digi Key Digi Key LED FLUSH GREEIDigi Key LED 3MM FLUSH YELLCDigi Key 1nF 100nF 0 1 50V Amp 2 174225 5 Amphenol 31 5431 2010 DB25 PCB mount DB25 solder Screw Terminal DB9 PC mount DB9 solder CUI part PJ 202B CUI part PP 002B 500mA 250V 0 tinch 0 tinch Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key LED GREEN HI BRITE T Digi Key LED RED T1 3 4 W STD Digi Key 3386H series 10k 10kOhm 100kOhm 2 2kOhm 33kOhm 470kOhm 1kOhm 33kOhm 820kOhm 5 6kOhm 8 2kOhm 1kOhm 0 3inch 0 3inch LM324N 74HCT175 7183 74 8 HM1520 Digi Key Digi Key Digi Key Digi Key Digi K
66. n presented here two multi well ink cartridges are replaced by six glass vials The vials are 1 mL clear conical Reacti vials and capped with silicone Teflon septa Thick wall Teflon tubing 15 cm in length conducts the phosphoramidite or tetrazole solutions from the vials to the needle inlets The tubing connects to the needle inlets with 1 6 mm 1 0 PharMed tubing and to the vials with 20 gauge non coring stainless steel needles 5 cm in length The vials are at neutral pressure during printing Reagent solvent storage Reagents and solvents are stored in 500 mL glass bottles with GL45 screw top caps except for the 2 L acetonitrile and waste bottles All tubing and bottle cap surfaces exposed to chemical vapors or liquid are Teflon Pressurizing nitrogen enters the reagent and solvent bottles through PTFE check valves Vari bore type Omnifit Rockville Centre NY that have a 5 torr 0 1 psi cracking pressure The waste bottle is negatively pressurized with 380 650 torr 15 25 inHg vacuum Nitrogen supply and system enclosure Inert gas and pressurization is supplied to the system by a liquid nitrogen dewar Regulators are set to 50 psi for the inert atmosphere supply to 30 psi for the slide drying jet and to 3 psi for the reagent solvent reservoirs The microarray area is enclosed with a custom acrylic cover with a 89 x 104 cm footprint and an internal volume of approximately 510 liters The cover is transparent and airtight It
67. nibrain San Ramon 1601 Digi Key Digi Key Hardware store 441 1005 ND CP 004B ND NA ak A A OM A A ana 2 A ANA A zl MAM A 21 5000 21 9000 199 0000 65 0000 98 5000 7 5000 8 5000 5 0000 16 0000 18 0000 9 44 11 80 21 5000 35 2000 220 5000 0 50 16 5000 24 7000 269 5000 5 75 7 50 5 0000 8 5000 13 2500 15 0000 18 0000 16 0000 18 0000 1390 0000 34 9500 14 9500 0 99 0 64 0 50 51 21 50 21 90 199 00 65 00 98 50 15 00 17 00 25 00 16 00 18 00 9 44 23 60 21 50 35 20 220 50 6 00 16 50 24 70 269 50 11 50 15 00 35 00 8 50 13 25 30 00 72 00 16 00 18 00 1 390 00 34 95 14 95 1 98 1 28 0 50 Inkjet Microarrayer Manual version 1 4 C3 PCB 1503 Components for printed circuit board 1503 Total 86 52 Label Component Description Supplier Partno Costa Cost Circuit board 1503 File 1503 pcb Express PCB File 1503 pcb 3 20 6667 62 00 Aluminum stand off 344 40 1 long threaded Digi Key 8405K ND 8 0 4850 3 88 Aluminum stand off 344 40 1 long threaded Digi Key 8405K ND 8 0 4850 3 88 CN8a CN8b Molex micro connector 15 conducter 15 pin Mouser 538 52806 151 8 0 7100 5 68 D25 D SUB 25 pin connector plug male D25 Digi Key A2098 2 4 8400 9 68 R1 R6 resistor 2 2 kOhm 1 8W Digi Key 2 2KQBK ND 25 0 0560 1 40 52 Inkjet Microarrayer Manual version 1 4 C4
68. nter 2 4 1 X axis encoder DIO32 HS LSB Device 1 Port Inkjet D A Analog Inputs O lt Hygrometer MSB7 1 LATO akil 556122 8523 5 Inkjet nozzle SIG3 4 selection INCHG 5 6 Port D Trigger 1 6K4 ouput 1 44 Inkjet Microarrayer Manual version 1 4 B3 Board 1503 Circuit schematic CN9 b CN9 a Malex 15 pin Molex 15 pin 2 4 8 12 12 14 2 4 6 8 10 12 14 1 14 15 1 12 121 n 139 15 o pes 2 30v 719 eI lo 52 R3 0 32 v Rel 2 6 2 2 2k d Sy 1 11 RS cnn 9 2 mp A 19 P22 5166 3164 5165 THERM 8 0 ANCHG 8161 SIG2 5163 LAT EV 1 Tune 14666 6 ESEJE 514 15 5 15 53 5 14 12 10 8 6 4 2 14 12 18 8 6 4 2 Molex 15 pin Molex 15 pin CNS b C
69. number specified by SetDrops slide gt integer 1 27 slide number from 1 to 27 Default All selected slides Load Init Prog Clear Figure 16 The playbook file selection dialog Three playbooks can be opened and viewed The PRE SYNTHESIS script PP1 is executed first and only once It often includes commands to start the inert gas flow and to wait 45 minutes for drying The STEPWISE SYNTHESIS script PP2 is times where N is the number of bases in the longest oligonucleotide The POST SYNTHESIS script PP2 is run last and only once 3 The Exit item This exits the Pogo program The servo drives are deactivated but the robot s coordinates are retained 2 The Options menu 1 The Configuration item This dialog box is used to modify all POSaM coordinates and various Pogo settings The settings file is called Pogo conf but copies can be saved under other names 24 Inkjet Microarrayer Manual version 1 4 Sides Column Position lt Coordinate 1 Left 45600 20600 4 35600 4 70600 Leem 20600 ban 254 3 Right 54400 Raw Position Y coordinates 1 Top 112000 2 Middle 25000 3 Bottom Elevation Z coordinate 66000 Configuration File 0 0 conf Load Save Reset to Defaults Figure 17 The configuration dialog box 2 The Show Test Camera item This panel allows the use
70. oelectric pulse and CN7 6K4 outputs printhead signals respectively Insert the box into the electronics rack between the PC shelf and the servo amplifier panel 8 Assemble printed circuit board 1902 In the same manner that board 1804 was finished assemble the circuit board using the layout information in the 1902 schematic sch and circuit board pcb files This board connects to the PCI MIO 16E multifunction board and contains the droplet detection circuit an encoder signal conditioning circuit and a set of relays Although it is large in size there isn t much on it It primarily provides input output connections and a lot of prototyping area The encoder signal conditioning circuit is not required by the current Lombardi software Screw terminals allow additional voltage signals to be connected to the POSaM This board uses two 5VDC power 14 Inkjet Microarrayer Manual version 1 4 supplies Most components use the 5 supplied by the PC The droplet detection circuit uses a separate 5VDC supply 9 Assemble electronics box 2 Package board 1902 into an aluminum rack mount enclosure As with the previous box drill or punch holes first insert the board insert sockets LEDs and the power switch and make the internal connections The inside of the box contains only the circuit board 5VDC power supply and two solid state relays Mount the relays to the side wall of the box and make a thermal connection with heat c
71. ogy org We actually have some funds for user support and will be happy to try to answer your questions so we can make a better machine together Note that this is the first edition of the user manuals and while it makes perfect sense to us we are familiar with the instrument It is possible that some of the instructions are really as clear as mud to everybody else we are counting on your input to make this a better document SYSTEM OVERVIEW Here is a quick overview of how we built the arrayer We tried to use off the shelf components wherever possible and we tried to keep the size reasonably compact As a very rough estimate it can take one person three months to assemble this machine This is based on the time spent by students here on our second machine and includes purchasing lead time Overview of the arrayer The arrayer is build around a three axis servo positioning system mounted to an 89x119cm optical table and enclosed within a sealed acrylic cover Array substrates are chucked into a Teflon slide holder mounted to the Y axis stage A piezoelectric print head and six valved wash Inkjet Microarrayer Manual version 1 4 nozzles are mounted to the X and Z axis stages which move above the slide holder Reagent and waste bottles also remain inside the cover Servo amplifiers the servo controller 6K4 power supplies the supervisory computer PC and most electronics are packaged in a 19 rack outside the cover All processes of the
72. oid 57 Ba S e amp m 42 S Kee Use 8 18101 solenoid drivers 5 w B C gatens Au 430v Gnd YS fro Artan Y ly Solenoid5 Sk EE Y7 A lt Salenoid lt I A 740 t utd solenoid al 2 z 7 CY LED7 az vj E 800 270 t Solenoid Common 41 n hi 1 1 M 1 m 28 8107 10k 10 l 1 20 eu us f b 9 12 Z 4 4 30 dl 5 8 1340 49 9 ir hotoclocdgz ve ve 49 94 5v 8 AM 3 oos rises LK 2 56k LR E ar 1 B T Sk 1 DIDS 820k InF 49 Inkjet Microarrayer Manual version 1 4 B7 Configuration file for Gemini drives Download and install this file to all three Gemini digital servo amplifiers using Motion Planner or a serial terminal communication program This requires an RS 232 cable to be connected one at a time to each amplifier Gemini GV Servo Drive Setup File name Gemini GV SM231AE config prg otor Setup TR 1303 Motor ID SM SE231AE TIC 1 98 Continuous Current Amps RMS TICD 22 90 Continuous Current Derating derating at rated speed TKE 17 7 otor Ke Volts 0 to peak krpm TRES 5 22 otor Winding Resistance Ohm TJ 51 970 otor Rotor Inertia kg m m 10e 6 POLE 2 Number of Motor Pole Pairs TW 100 0 Motor Rated Speed rev sec 5 94 Peak Current Amps RMS TLMN 2 2 inimum Motor Inductance mH TLMX 2 9 a
73. olenoid Out Matches CN3 Amp 2 174225 5 Screw Terminal 1N4007 Fuse 16 pin Header mount DAC0802 7404 LM6361 LT1010 PS2502 7408 74138 DRV101T Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key LED RED T1 3 4 W STDDigi Key LED 3MM FLUSH YELLCDigi Key LED GREEN HI BRITE T Digi Key LED FLUSH GREE Digi Key Linear Dual 5V 1 5 A Digi Key Linear Single 28V 1A 4 7k Ohms 5 6 kOhm 1 8W 1 kOhm 1 8W 10k Ohms 1 8W 100 Ohm 1 8W 2 2 kOhm 1 8W 1 1 kOhm 1 8W 4 7 kOhms 270 kOhms 820 Ohms 16 pin Socket 8 pin Socket 14 pin Socket Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key 8405K ND 67 1148 ND 67 1147 ND PS1H152J ND P5559 ND PS1H822J ND 182 825F ND 1125M ND A2098 1125F ND 2101 2215M ND A29093 ND 277 1257 ND 1N4007DICT ND 283 2111 ND WM6880 ND DAC0802LCN ND 296 1605 5 ND LM6361N ND LT1010CN8 PS2502 4 DM74LS08N SN74HC138N DRV101T ND HLMP3750ACM ND 67 1149 ND P461 ND 67 1148 ND 271 2010 ND 271 2017 ND 3214J 103ECT ND 5 6KEBK ND 1 0KEBK ND 10KEBK ND 100EBK ND 2 2KQBK ND 1 1KEBK ND 4116R 1 472 ND 4116R 1 274 ND 4116R 1 821 ND A9416 ND A9408 ND A9414 ND 2 27 10 10 8 20
74. on register and latched with a single pulse of the latch signal The clocking frequency used here is 500 kHz though 3 MHz is possible Digital signals are TTL compatible and active high The piezoelectric drive signal resembles a trapezoidal waveform rising from OV to 28V 5ps holding at 28V for bus stepping up to 30V for 101 and falling back to OV linearly over 20us Each waveform pulse results in the ejection of one droplet from each selected nozzle Pulse frequencies as high as 14 4 kHz may be used The digital signals are transmitted directly from DIO 32HS output port D Unused digital lines in port D allow for an additional print head to be added if needed The waveform output is provided by output port C and converted to analog by the DAC0802 integrated circuit IC These two 8 bit ports are configured as a single 16 bit output port referred to in software as Group 1 The six PTFE solenoid valves Model 190224830 Angar Florham Park NJ used to control reagent flow are normally closed and require 24V to open Three digital output lines of DIO 32HS port B are used to select the active solenoid via the 3 to 8 decoder IC The solenoid driver DRV101 is a low side power switch employing a pulse width modulated PWM ouput The driver provides a strong initial 100 ms pulse to open the solenoid valve followed by a PWM square wave Inkjet Microarrayer Manual version 1 4 with a 2096 duty cycle to hold the solenoid open without generating si
75. onducting grease Connect the relay to screw terminals 4 amp 5 signal inputs and 3 amp 6 signal ground Connect the 120VAC output sockets to the 120VAC receptacle via the solid state relays The front panel requires a SPST 120VAC power switch and a power indicator LED The back of the box requires the following holes for the 1902 board two D connectors a 68 pin connector a BNC and three 2 5mm round sockets The box requires holes for the 120VAC input receptacle fuse holder and two 120VAC solid state relay output sockets The photo below shows all of the connectors at the rear although some placement has changed with the current board 1902 An updated template is available in Appendix B Insert the box into the electronics rack between the PC shelf and the servo amplifier panel Figure 8 View of the rear of the rack mount enclosure housing the predecessor of the 1902 board From the left one 120VAC receptacle two 120VAC sockets hygrometer D connector Unused D connector gas solenoid power jacks 5VDC supply for the droplet detector laser 5VDC BNC for the the droplet detector photodiode and 68 pin interface board connector 10 Place reagent solenoids Construct a the solenoid tower and place at position M coordinates 17 5 of Figure 2 To construct the tower cut a 12 inch length of 1 inch square aluminum tubing Using the base of an Angar teflon solenoid as the template drill and tap 44 40 threads for mounting hole
76. ox 2 15 10 Place reagent solenoidSi 2 da 15 Press vrake 16 12 Place slide a S ete add 16 LES install print head sese enu a ph 16 14 Install print head and phosphoramidite vais 16 15 Assemble pressurized gas and liquid plumbing esee 17 15a Install pressure regulator and rotameter 17 15b Install the air amplifier iei etae eter Ro y eaten eer 17 156 Connect reagent DOLOS pe rs aa RR E 18 15d Install th slide ua cog eive ORDRE RAT VNDE t 18 16 Connect vacuum Components e tene ie edet en eee 18 17 Install hygrometet ieu EUR 19 18 Install droplet detection laser and pobotodtode 19 19 Assemble Optical SSE e ose torre to eder d o Tere 20 Install cover ee 21 21 Connect fume exhause 22 Siw ate Ne 22 Pogo Mess 22 Using Pogo the first vr iier e E Pet 26 Ree E EE SS 28 Sample PIayDOOKS u 29 Inkjet Microarrayer Manual version 1 4 sample Limeups i ie at n 31 WHATS NEA Lee 32 APPENDIX A Mechanical
77. p development of new methods that can take advantage of the speed and flexibility inherent in this design So we the Hood Laboratory now at the ISB decided to develop an inkjet arrayer that almost anybody can build and operate That is where the POSaM platform came from We were not trying to compete with the throughput of the industrial size Agilent Rosetta arrayer It would cost too much to build that into a machine for the end users at this stage at least We just wanted to make an instrument that could be built and used by anybody interested so that new methods and designs could be investigated to make better in situ synthesis array much as the release of the plans for the pin spotter did for more traditional arrays We are not guaranteeing this instrument or the arrays it makes It is an academic instrument that works fairly well It is good for prototyping arrays and designing and testing reporters You might want to start the design for your arrays on this machine and when they work the way you want have Agilent or Nimblegen or Xeotron or Affymetrix make them for you in large enough quantities and in high enough quality that you can do all your experiments You could also use the arrays from the POSaM platform itself and not order commercially made arrays That is up to you and how comfortable you feel with the results you have gotten Presently we feel most array results need to be confirmed using different methods anyway The bottom line is
78. r to take pictures of slides using the CCD imaging system A grid can be specified that can be used to determine droplet presence positional error and diameter In the future it will also be used for registering masked slides 3 The Show Servo Control item This panel is used to manually control the servo positioners Fast gt gt and slow gt jog buttons provided for all three axes or numerical coordinates can be entered The actual positions reported by the 6K encoders are reported Eight convenience buttons are provided to quickly move the print head to predefined positions Servo Panel __ Commanded Actual Go To Laser x 0 0 0 Inkjet Purge 0 D o Sol Purging 7 0 0 Gloves Go To Coordinates User Def 6 lt lt lt XAsis gt gt gt YAxisHome gt User Def 8 lt lt lt ZAxisHome gt Figure 18 The servo control panel 25 Inkjet Microarrayer Manual version 1 4 4 The Show Reagent Panel item This panel is used to dispense bulk reagents like acetonitrile oxidizer and acid Solenoid dispense times are given in seconds Reagents can be dispensed onto specific slide positions or into a predefined Purging Area This panel can also be used to print with the inkjet onto slides to turn the inert gas box dryer on and off and to keep the inkjet print head fresh by periodically jetting 10 minute intervals into the inkjet purging area
79. reagent name given in the Wash Lines or bulk reagent area is not important The durations specified are meaningful These are the default values loaded whenever a playbook is run a synthesis process is started or restarted 7 Choose the Other tab The Jetting parameters specify the default number of drops to print or thousands of drops to eject when purging out the print head The Camera parameters specify the location of the CCD imaging system relative to the inkjet print head and specify the expected droplet size 21 Inkjet Microarrayer Manual version 1 4 Using Pogo There are many steps needed for making inkjet arrays before Pogo is fired up Slides have to be derivatized reagents prepared inkjets loaded etc Those topics are covered in the second part of this manual The following steps only deal with running Pogo 1 Create playbook and lineup files Create presynthesis stepwise synthesis and postsynthesis playbook files Give them PP1 PP2 and PP3 extensions respectively Create microarray lineup files in CSV or LNP format 2 Launch pogo exe 3 Test the inkjet nozzles Check that all six print head reagent banks are loaded with tetrazole and phosphoramidites and that no droplets are handing from the bottom of the print head Click the 6 button in the Working Nozzles area of the Main Panel This will fire from 1000 to 10000 droplets from all 32 nozzles in each bank We usually use 5000 drops Watc
80. s Mount six solenoids with 74 40 screws Cut a 14 inch length of 74 20 threaded rod Use the rod 17 2 inch fender washer and a 74 20 nut to fasten the tower in place 15 Inkjet Microarrayer Manual version 1 4 11 Place gas solenoids Make a 2 x6 mounting plate for the ET 2 solenoids from 74 thick PVC sheet Drill and counterbore four mounting holes for the two solenoids in the plate Drill two 72 holes 5 inches apart for mounting the plate to the optical table Mount the two solenoids to the plate Fasten the plate to the left rear corner of the optical table outside the area enclosed by the acrylic cover 12 Place slide holder Mount the slide holder to the Y axis positioner using four 2 72 long 7 20 screws Use four spacer bushings 22 thick 4 hole between the positioner and the holder This gap will allow the bellows of the Y axis positioner to flex without touching the holder Orient the slide holder so that the waste liquid will drain from right to left Figure 9 Teflon slide holder The slide holder is mounted on the X axis positioner 13 Install print head brackets Use four long 74 20 screws to mount the left and right printhead bracket pieces to the Z axis positioner Figure 10 Print head brackets shown with inkjet vials slider rod and teflon tubing installed 14 Install print head and phosphoramidite vials Extract the black plastic print head ink cartridge holder from an Epson Sty
81. s common ground to all solenoids 15d Install the slide dryer Microarray slides are blown dry during synthesis by a six jet nitrogen manifold MG10 Bend a 90 angle in a 12 long aluminum tube MG09 using a tubing bender to avoid kinking The bend should be 1 25 from the end of the tube with a radius of about 7 2 Insert the tube into the sixth groove of the print head assembly The bend should be orthogonal to the print head assembly Coat the inlet tube the large one of the manifold with flexible silicone sealant or another viscous weak glue Insert the inlet into the bottom of tube MGO9 Angle the manifold jets outlet tubes downward at 45 Mount two solenoids MG03 near the psi solenoid MG04 Feed 30 psi pressure into the solenoids The second solenoid is reserved for future use The first is used to control the slide dryer Connect the solenoid output to the top of tube MGO09 using 3 16 OD flexible tubing Route the tubing through the conduit as in the previous step Make two two conductor cables to connect the solenoids to connectors 7 amp 8 of board 1902 Use two 2 5mm power plugs PLUGO3 16 Connect the vacuum components Vacuum is used both to chuck the slides into the slide holder and to suck waste from the bottom of the slide holder This requires the use of teflon tubing and fittings a 2L liquid waste 18 Inkjet Microarrayer Manual version 1 4 bottle MRO3 a 500mL trap MRO2 and a charcoal fi
82. sides 33 Inkjet Microarrayer Manual version 1 4 TOP FRON LEFT 8 H E 8 8 400 BOTTOM Vd i AB MATERIAL ACRYLIC 0 25 INCH 9 5 SH s MICROARRAY COVER MAIN VIEW MICROARRAY COVER 22 MAY 2000 CHRISTOPHER LAUST INSTITUTE FOR SYSTEMS BIOLOGY 34 Inkjet Microarrayer Manual version 1 4 037 3 01 15 50 15 50 0 78 0 78 0 78 0 68 _ 108 E 18 00 37 00 FRONT PANEL DOOR MICROARRAY COVER 22 MAY 2000 CHRISTOPHER LAUSTI INSTITUTE FOR SYSTEMS BIOLOGY CY T Y SZ n fs LEFT PANEL COVER RIGHT PANEL COVER MICROARRAY COVER MICROARRAY COVER 22 MAY 2000 CHRISTOPHER LAUSTE 22 MAY 2000 CHR
83. tameter output to the left read corner of the breadboard This tube will be used to fill the working area of the POSaM with inert gas 15b Install the air amplifier The inert gas enters the POSaM cover through the air amplifier MG11 The air amplifier is a flow powered blower that uses the inflow of fresh gas to recirculate the POSaM atmosphere 17 Inkjet Microarrayer Manual version 1 4 through a filter of calcium sulfate and activated charcoal Our home built filter tower is constructed from three black ABS plastic 172 pipe pieces a MG13 a 4 adapter MG14 and an end cap MG15 The ABS pieces fit together with friction The air amplifier needs a rubber seal to friction fit into the T We pour Drierite dessicant and pet store variety charcoal into low resistance porous filter bags and pack the bags into the top funnel of the filter tower Place the tower in the left rear corner of the breadboard and connect the 3 8 gas supply tube to the small barbed inlet of the air amplifier When gas flows into the barbed inlet at 10 Ipm gas circulates through the tower at rates up to 100 lpm 15c Connect reagent bottles Reagents are delivered to the print head assembly by gas pressure of 3 psi Add a second to the outlet of the 30 psi regulator and feed this pressure into the 3 psi regulator MG04 We mounted this regulator at the exposed breadboard top at the left rear edge of the table Connect five check valves MG05
84. the print head A template is available in Appendix B Print out the template at 20096 scale or else print out the template at 10096 scale and xerox copy at 200 scale Figure 7 View of the 1804 board installed in a 19 rack before installation of the power supply power connectors switch and front panel diodes The 120VAC receptacle the power supplies and the front panel parts are not yet installed Next finish the internal connections This will take a bit of soldering Connect the 120VAC socket neutral terminal to the neutral posts of the power supplies using 18 gauge stranded wire Connect the 120VAC receptacle live terminal to the live posts of the power supplies via the DPDT power switch For the other connections smaller wire gauges 22 26 may be used Connect the 5 5 and 30VDC power supply output posts to the appropriate circuit board screw terminals The 30VDC screw terminal is unused Connect the 5VDC and 5VDC indicator LEDs to the 5VDC and 5VDC power supply output terminals through 1k current limiting resistors Connect the 30VDC indicator LED to the 30VDC power supply output terminals through a 6k current limiting resistor The other LEDs are connected to the circuit board without using any extra current limiting resistors Connect the eight solenoid indicator LEDs to connector CN6 The BNCs and the other LEDs may be connected to various optional points in the circuit board such as screw terminal position 3 piez
85. to build on Currently microarrays come in several flavors cDNA arrays PCR DNA arrays BAC arrays and oligonucleotide arrays that are constructed using pre existing libraries of characterized DNA molecules These are usually pin spotted onto glass slides or membranes although some non contact printing systems are available One of the problems with these arrays is that you have to collect all those clones amplify them and store them in freezers where they can be collected by a dedicated grad student technician or post doc before they can be printed onto the glass slides That means that you have to have a complete library for every organism you want to study stored in a freezer somewhere in your lab area and then you have to keep track of where every clone is in that library If you want to expand the array to include new genes you first have to acquire physical copies of those genes Any of you involved in the Human Genome Project know that this is really a nightmare of book keeping and lots of mistakes can happen as you are getting that well characterized clone onto a microarray in the spots you want it in SPOTS not singular you want replicates You need replicates The more replicates the better both of the specific gene and the experiment itself There is also a fair amount of cost both initial and continuing that goes along with acquiring replicating storing and retrieving these libraries Wouldn t it be nice to be able to do wit
86. trols Corp 2023301 580M c iprocessmart com Burkert 450914V Dwyer Michigan City IVFA 27 BV Hardware store NA Small Parts Miami LakB TCM 13 20 6 Small Parts Miami LakB DC 1 4 ARTX Hardware store Hardware store NA Hardware store NA Hardware store NA Westem Analytical BC 1 72 24 VWR 16157 169 VWR 16157 227 Upchurch Scientific 15091 Upchurch Scientific 306 Upchurch Scientific 300 Upchurch Scientific 1548 Upchurch Scientific 215 Angar 190057 Epson or Ebay Photo 700 Epson Extract from Epson Stylus Phoi Epson Extract from Epson Stylus Phoi Epson Extract from Epson Stylus Phoi Fisher 06 444B Fisher 2712 Fisher 14 825 15AD Agson F057020 Hardware store NA Hardware store Hardware store Hardware store e g Small Parts LSAT 063 16 1 e g Small Parts B TRX 1420 e g Small Parts B RSA 14 16 Hardware store e g Small Parts B RSA 14 8 Port Plastics 28000190 Small Parts Miami LakB ORS 010 Small Parts Miami LakB ARCH 6 Fisher 09 744 37 RANN 5 Lech NDD Iech Iech I tt ODIN 5 5 Aa gt gt OM gt gt gt 16 100 78 8000 26 4000 2 0900 5 0800 0 2300 8 9100 49 5000 82 8000 40 9900 3 2500 5 8600 995 00 845 00 95 00 125 00 6 6000 39 9500 5 2000 6 9500 5 0000 5 0000 100 5000 33 6500 15 0000 800 0000 10 0000 100 0000 98 5000 12 0000 20 0000 120
87. ture use of a second print head As shown in the photo below you do not need to insert the second pair of connectors Figure 4 Top view of the 1503 board after assembly Note that only the two necessary Molex connectors have been installed 6 Assemble printed circuit board 1804 In the same manner as the previous step assemble the circuit board using the layout information in the 1804 schematic sch and circuit board pcb files This board connects to the PCI DIO 32HS board and contains the piezoelectric driver circuit the solenoid driver circuits and an optoisolator for the jetting trigger signal There is an large empty area of solder pads at the upper right corner available for prototyping If you ordered the board without the silkscreen layer to save some money print out that layer from the schematic file for reference You may want to write notes or labels on the board using a Sharpie marking pen 12 Inkjet Microarrayer Manual version 1 4 Figure 5 Top view of the 1804 board as it arrives in the mail This board is considerably larger and so it has holes for attaching nine stand off posts careful when attaching the cable connectors at the bottom edge of the board The high density 68 pin connector has a conducting metal shell that should not touch the copper pads and tracings of the circuit board s top layer Separate this connector and the three D style connectors from the board by using nylon washers as spac
88. tute for Systems Biology 1441 N 34th St Seattle WA 98103 206 732 1200 TITLE SLIDE CHUCK SLIDE CHUCK dft SHEET 50F7 SCALE 1 1 33 REV B 40 Inkjet Microarrayer Manual version 1 4 ALL DIMENSIONS IN INCHES ANGULAR 1 ALL BENDS AT YNLESBEFHERWISE STATED Institute for Systems Biology 1441 344 FOLD FOLD AND FOLD TO HOLE XXXX 1 020 EDGE TO HOLE AND HOLE TO HOLE XX XXX XXXX 9 Y EDGE TO EDGE UNILESS OTHERWISE STATED 8 Seattle WA 98103 206 732 1200 ENGINEERING PURCHASING PRODUCTION SALESIMARKETING SIZE DATE TITLE REV A 02 25 04 SLIDE CHUCK B FINAL APPROVAL FILE SLIDE CHUCK dt 5 7 OF 7 SCALE 41 A4 Machine Vision Inkjet Microarrayer Manual version 1 4 RED LED 1 MOUNT 441 1005 ND 1 2 SM1 BARREL SM1L05 1 SM1 BARREL SM1L10 C MOUNT SM1 ADAPTER SM1A9 1024x768 CCD IEEE 1394 SE E N N ENT UNIBRAIN M1024 1 4 BARREL C MOUNT 54 628 HELICOID BARREL 54 392 18mm DIA LENS 35mm 32 709 C MOUNT SM1 ADAPTER SM1A9 1 SM1 EXT THD ADAPTER SMIT2 1 DIA RG630 FILTER 32 155 2 SM1 BARREL SM1L20 C MOUNT SM1 ADAPTER PLATE BEAMSPLITTER P 7 NT54
89. ximum Motor Inductance mH TD 0 000017 otor Damping Nm rad sec oo agog ggo ogg goog g g TRWC 0 85 Motor Thermal Resistance degrees Celsius Watt TTCM 20 0 Motor Thermal Time Constant minutes TTCW 0 33 Motor Winding Time Constant minutes TAMB 40 00 Motor Ambient Temperature degrees Celsius TMAX 125 00 Maximum Motor Winding Temperature degrees Celsius Drive Setup DMODE 2 Drive Control Mode DRES 4000 Drive Resolution counts rev DPWM 0 Drive PWM Frequency kHz ERES 4000 Encoder Resolution counts rev ORES 4000 Encoder Output Resolution counts rev DMEPIT 0 00 Electrical Pitch mm DMTLIM 1 2 Torque Limit Nm DMTSCL 1 2 Torque Scaling Nm DMVLIM 100 000000 Velocity Limit rev sec DMVSCL 100 000000 Velocity Scaling rev sec Load Setup LJRAT 0 0 Load to Rotor Inertia Ratio LDAMP 0 0000 Load Damping Nm rad sec Fault Setup FLTSTP 1 Fault on Startup Indexer Pulses Enable FLTDSB 1 Fault on Drive Disable Enable SMPER 4000 Maximum Allowable Position Error counts SMVER 0 000000 Maximum Allowable Velocity Error rev sec DIFOLD 0 Current Foldback Enable Digital Input Setup LH 0 Hardware EOT Limits Enable INLVL 11000000 Input Active Level INDEB 50 Input Debounce Time milliseconds Digital Output Setup OUTLVL 0000000 Output Active Level Analog Monitor Setup DMONAV 0 Analog Monitor A Variable DMONAS 100 Analog Monitor A Scaling of full scale output
90. y or at the local hardware store Useful tools include adjustable wrenches combination wrenches metric and English hex drivers slotted and Phillips drivers a hack saw file a Dremel style rotary tool a sheet metal nibbler a drill a level soldering irons of 15 and 35 watt size and a multimeter Useful supplies include wire 14 gauge single and multiple strand heat shrinkable tubing wire labels drill bits cap screws inch with 20 threads per inch or quarter twenties of various length a screw kit of various sizes between 4 and 8 and corresponding washers and nuts We have attempted to use commercial off the shelf components wherever possible Nevertheless some of the components must be custom fabricated For the print head bracket and the slide holder this requires the services of a machine shop For the cover we use the services of Clear Cut Plastics of Seattle Washington although any local plastic fabrication shop should work CAD drawings are available for downloading For the printing of the three circuit Inkjet Microarrayer Manual version 1 4 boards we use the services of ExpressPCB www expresspcb com These boards may be purchased online and delivered within the week ready for soldering ASSEMBLING THE ARRAYER 1 Assemble the table Unpack and assemble the leveling stand Set the optical breadboard on the stand This will require at least two people Place a level along the long direction of the

User manual chapter 1: Assembly - Techdev Home

Contents

Download Pdf Manuals

Related Search

Related Contents