Home

EpiNext™ NGS Barcode (Index) Set-12

image

Contents

1. EpiNext NGS Barcode Index Set 12 Base Catalog P 1060 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses The EpiNext NGS Barcode Index Set 12 is designed to construct multiplex DNA RNA libraries used for next generation sequencing with the Illumina platform including GAIIx HiSeq and MiSeq This product includes 12 DNA barcodes each of which contain an index and flow cell binding sequence and can be attached to the sample insert during library preparation Multiplexing several samples in a single flow cell can be achieved by pooling with the EpiNext NGS Barcodes Precautions To avoid cross contamination carefully pipette the sample or solution into the tube vials Use aerosol barrier pipette tips and always change pipette tips between liquid transfers Wear gloves throughout the entire procedure In case of contact between gloves and sample change gloves immediately 110 Bi County Blvd Ste 122 Farmingdale NY 11735 Page 1 Tel 1 877 374 4368 m Fax 1 718 484 3956 m E mail info epigentek com m Web www epigentek com Printed 2014 01 17 Epigentek Group Inc All rights reserved Products are for research use only P 1060 PRODUCT CONTENTS Component Storage 144 Reactions Upon Receipt EpiNext Barcodes 1 12 10 pM t 15 ul each 20 C EpiNext Universal Primer 10 uM 155 ul 20 C User Guide 1 RT y Spin the solution down to the bottom prior to use t The EpiNext NGS B
2. is not intended for diagnostic or therapeutic application Intellectual Property The EpiNext NGS Barcode Index Set 12 and methods of use contain proprietary technologies by Epigentek A BRIEF OVERVIEW The EpiNext NGS Barcode Index Set 12 contains indexed sequences that allow efficient multiplexing workflow and flexible setup to be carried out Pooling barcoded samples into a single flow cell significantly 110 Bi County Blvd Ste 122 Farmingdale NY 11735 Page 2 Tel 1 877 374 4368 m Fax 1 718 484 3956 m E mail info epigentek com m Web www epigentek com Printed 2014 01 17 Epigentek Group Inc All rights reserved Products are for research use only P 1060 reduces hands on time and provides robust data quality in NGS The EpiNext NGS Barcode Index Set 12 has the following features The barcodes contained in the EpiNext NGS Barcode Index Set 12 can be used with single paired end and multiplex reads and are compatible with various library preparation workflows used for Illumina NGS including DNA seq RNA seq ChIP seq MethylC seq MeDIP seq hMeDIP seq DNA bisulfite Seq oxBS seq and RNA bisulfite seq The barcodes are also optimized for use with Epigentek s EpiNext NGS library preparation kit series including EpiNext DNA Library Preparation Kit Illumina EpiNext High Sensitivity DNA Library Preparation Kit Illumina EpiNext Post Bisulfite DNA Library Preparation Kit Illumina EpiNext Bis
3. 7 Epigentek Group Inc All rights reserved Products are for research use only P 1060
4. arcode Adaptor Index 8 ACTTGA Barcode Adaptor Index 9 GATCAG Barcode Adaptor Index 10 TAGCTT Barcode Adaptor Index 11 GGCTAC Barcode Adaptor Index 12 CTTGTA Note For low level multiplexing fewer than 12 indexes are used in a lane for sequencing it is recommended to use the following indexes Pool of 2 samples Index 6 and 12 Pool of 3 samples Index 4 6 and 12 Pool of 4 samples Index 2 4 6 and 12 Pool of 6 samples Index 2 4 5 6 7 and 12 APPENDIX ADDING EPINEXT NGS BARCODES TO LIBRARY The EpiNext NGS Barcodes containing different indexed sequences may be used in the library amplification step during the sample library preparation for Illumina NGS The following is an example protocol a Prepare the PCR Reactions Thaw all reaction components including master mix DNA RNA free water primer solution and DNA template Mix well by vortexing briefly Keep components on ice while in use and return to 20 C immediately following use Add components into each PCR tube well according to the following table 110 Bi County Blvd Ste 122 Farmingdale NY 11735 Page 4 Tel 1 877 374 4368 m Fax 1 718 484 3956 m E mail info epigentek com m Web www epigentek com Printed 2014 01 17 Epigentek Group Inc All rights reserved Products are for research use only P 1060 j bb co sa g see A Component Size pl HiFi Master Mix 2X 12 5 ul EpiNext Unive
5. arcode Set 12 contains 12 DNA barcodes with sufficient volume for 12 reactions each for a total of 144 reactions The shelf life of each reagent is 6 months when stored at 20 SHIPPING amp STORAGE The product is shipped on frozen ice packs at 4 C Upon receipt Store the following components at 20 C EpiNext Barcodes 1 12 and EpiNext Universal Primer Store all other components at room temperature GENERAL PRODUCT INFORMATION Quality Control Each lot of EpiNext NGS Barcode Index Set 12 is tested against predetermined specifications to ensure consistent product quality Epigentek guarantees the performance of all products in the manner described in our product instructions Product Warranty If this product does not meet your expectations simply contact our technical support unit or your regional distributor We also encourage you to contact us if you have any suggestions about product performance or new applications and techniques Safety Suitable lab coat disposable gloves and proper eye protection are required when working with this product Product Updates Epigentek reserves the right to change or modify any product to enhance its performance and design The information in this User Guide is subject to change at any time without notice Thus only use the User Guide that was supplied with the product when using that product Usage Limitation The EpiNext NGS Barcode Index Set 12 is for research use only and
6. ion Kit P 1061 EpiNext DNA Purification HT System Sonication Instruments EQC 1100 EpiSonic Multi Functional Bioprocessor 1100 DNA Enrichment Reaction P 1015 Methylamp Methylated DNA Capture MeDIP Kit P 1038 EpiQuik Hydroxymethylated DNA Immunoprecipitation hMeDIP Kit 110 Bi County Blvd Ste 122 Farmingdale NY 11735 Page 5 Tel 1 877 374 4368 m Fax 1 718 484 3956 m E mail info epigentek com m Web www epigentek com Printed 2014 01 17 Epigentek Group Inc All rights reserved Products are for research use only P 1060 P 1052 P 2002 P 2003 P 2014 P 2025 P 2026 P 2027 P 2030 PCR Analysis P 1029 EpiQuik MeDIP Ultra Kit EpiQuik Chromatin Immunoprecipitation ChIP Kit EpiQuik Tissue Chromatin Immunoprecipitation ChIP Kit EpiQuik Plant ChIP Kit ChromaFlash One Step ChIP Kit ChromaFlash One Step Magnetic ChIP kit ChromaFlash High Sensitivity ChIP Kit EpiNext ChIP Seq High Sensitivity Kit EpiQuik Quantitative PCR Fast Kit DNA library Prep P 1051 EpiNext DNA Library Preparation Kit Illumina P 1053 EpiNext High Sensitivity DNA Library Preparation Kit Illumina P 1055 EpiNext Post Bisulfite DNA Library Preparation Kit Illumina P 1056 EpiNext Bisulfite Seq High Sensitivity Kit Illumina 110 Bi County Blvd Ste 122 Farmingdale NY 11735 Page 6 Tel 1 877 374 4368 m Fax 1 718 484 3956 m E mail info epigentek com m Web www epigentek com Printed 2014 01 1
7. rsal Primer 1 ul Barcode Index any one of 1 12 1 ul Adaptor Ligated DNA 10 5 ul Total Volume 25 ul High fidelity PCR amplification enzyme mix from Epigentek 2X HiFi PCR mix from other supplies could be also used b Program the PCR Reactions Place the reaction plate in the PCR instrument and set the PCR conditions as follows Cycle Step Temp Time Cycle Activation 98 C 30 sec 1 98 C 20 sec Cycling 55 C 20 sec Variable 72 C 20 sec Final Extension 72 C 2 min 1 Note PCR cycles may vary depending on the input DNA amount In general use 12 PCR cycles for 200 ng 13 cycles for 100 ng 15 cycles for 50 ng 17 cycles for 10 ng and 22 cycles for 1 ng DNA input Further optimization of PCR cycle number may be required by the end user The amplified DNA library can be cleaned up using your own successful method For the best results and your convenience we recommend using Epigentek s EpiNext DNA Size Selection Kit P 1059 or The EpiNext DNA Purification HT System P 1061 RELATED PRODUCTS DNA Isolation and Cleanup P 1003 FitAmp General Tissue Section DNA Isolation Kit P 1004 FitAmp Plasma Serum DNA Isolation Kit P 1006 DNA Concentrator Kit P 1007 FitAmp Gel DNA Isolation Kit P 1009 FitAmp Paraffin Tissue Section DNA Isolation Kit P 1017 FitAmp Urine DNA Isolation Kit P 1018 FitAmp Blood and Cultured Cell DNA Extraction Kit P 1059 EpiNext DNA Size Select
8. ulfite Seq High Sensitivity Kit Illumina EpiNext ChIP Seq High Sensitivity Kit Illumina EpiNext RNA Bisulfite Seq Kit and EpiNext MeDIP Seq Kit High throughput and cost reduction Up to 144 multiplexed samples can be processed which allows multiplexing of 2 12 fragment library samples on a single sequencing flow cell resulting in considerable reduction of per sample cost WORKFLOWS Input DNA 2 DNA end polishing Om o O Adaptor ligation optional Amplification with barcode index NGS Illumina Fig 1 Workflow of the DNA library preparation with EpiNext NGS Barcode Index Set 12 110 Bi County Blvd Ste 122 Farmingdale NY 11735 Page 3 Tel 1 877 374 4368 m Fax 1 718 484 3956 m E mail info epigentek com m Web www epigentek com Printed 2014 01 17 Epigentek Group Inc All rights reserved Products are for research use only P 1060 EPINEXT BARCODED ADAPTOR SEQUENCE 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG 3 NNNNNN is 6 nt index sequence contained in the adaptor EPINEXT UNIVERSAL PRIMER SEQUENCE 5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T 3 EPINEXT BARCODED ADAPTOR INDEX 5 3 Barcode Adaptor Index 1 ATCACG Barcode Adaptor Index 2 CGATGT Barcode Adaptor Index 3 TTAGGC Barcode Adaptor Index 4 TGACCA Barcode Adaptor Index 5 ACAGTG Barcode Adaptor Index 6 GCCAAT Barcode Adaptor Index 7 CAGATC B

Download Pdf Manuals

image

Related Search

Related Contents

White Rodgers 1F82-261 Wiring and Configuration  Samsung AQ30C1(2)BC User's Manual  シャワートイレ K シリーズ      M3-8 - User Guide - v1.1    Crush User and Maintenance  CLUB3D Radeon R9 280 royalKing AMD Radeon R9 280 3GB  取扱説明書 - オンキヨー  

Copyright © All rights reserved.
Failed to retrieve file