pcDNA 5/FRT/TO - Thermo Fisher Scientific
Contents
1. Pme Xba pcDNA 5 FRT TO CAT Comments for pcDNA 5 FRT TO CAT 5926 nucleotides CMV promoter bases 232 958 RUC on TATA box bases 804 810 Tetracycline operator 2X TetO sequences bases 820 859 CMV forward priming site bases 769 789 CAT ORF bases 1093 1752 BGH reverse priming site bases 1878 1895 BGH polyadenylation signal bases 1884 2108 FRT site bases 2392 2439 Hygromycin resistance gene no ATG bases 2447 3467 SV40 early polyadenylation signal bases 3599 3729 pUC origin bases 4112 4785 complementary strand bla promoter bases 5791 5889 complementary strand Ampicillin bla resistance gene bases 4930 5790 complementary strand 11 Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 920082. host cell lines stably express the lacZ Zeocin fusion gene and contain a single integrated FRT site but do not express the Tet repressor By simply transfecting the pcDNA 6 TR plasmid into a Flp In host cell line a Flp In T REx host cell line can be generated For more information about the Flp In cell lines and pcDNA 6 TR go to www invitrogen com or contact Technical Support see page 12 Note It is possible to cotransfect pcDNA 5 FRT TO and pOG44 into a Flp In host cell line to generate an expression cell line In this case the TetO sequences in the hybrid CMV TetO promoter of pcDNA 5 FRT TO are inert and the CMV TetO2 promoter functions to allow constitutive expression of your gene of interest at levels similar to the native CMV promoter We have observed down regulation of the viral CMV promoter and subsequent loss of gene expression when pcDNA 5 FRT based expression constructs are introduced into Flp In 3T3 or Flp In BHK cells We recommend that you DO NOT use 3T3 or BHK cells when generating your Flp In T REx host cell line Plasmid DNA for transfection into eukaryotic cells must be clean and free of contamination from phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating plasmid DNA using the PureLink HQ Mini Plasmid Purification Kit page v Other methods of obtaining
3. host cell line and are only brought into the correct proximity and frame with the hygromycin resistance gene through Flp recombinase mediated integration of pcDNA 5 FRT TO at the FRT site For more information about the generation of the Flp In T REx host cell line and details of the Flp In T REx System refer to the Flp In T REx Core Kit manual In the Flp In T REx System integration of your peDNA 5 FRT TO inducible expression construct into the genome occurs via Flp recombinase mediated intermolecular DNA recombination The hallmarks of Flp mediated recombination are listed below e Recombination occurs between specific FRT sites see below on the interacting DNA molecules e Recombination is conservative and requires no DNA synthesis the FRT sites are preserved following recombination and there is minimal opportunity for introduction of mutations at the recombination site e Strand exchange requires only the small 34 bp minimal FRT site see next page For more information about the Flp recombinase and conservative site specific recombination refer to published reviews Craig 1988 Sauer 1994 continued on next page Overview continued FRT Site Experimental Outline The FRT site originally isolated from Saccharomyces cerevisiae serves as a binding site for Flp recombinase and has been well characterized Gronostajski and Sadowski 1985 Jayaram 1985 Sauer 1994 Senecoff et al 1985 The mi
4. 1983 for selection of stable transfectants with the antibiotic hygromycin B Palmer et al 1987 When added to cultured mammalian cells hygromycin B acts as an aminocyclitol to inhibit protein synthesis Hygromycin B liquid is available separately from Invitrogen Cat no 10687 010 For instructions TM TM to handle and store hygromycin B refer to the Flp In T REx Core Kit manual Before generating a stable cell line that inducibly expresses your protein of interest Flp In T REx expression cell line we recommend that you generate a kill curve to determine the minimum concentration of hygromycin required to kill your untransfected Flp In T REx host cell line Generally concentrations between 10 and 400 pg ml hygromycin are required for selection of most mammalian cell lines General guidelines for performing a kill curve are provided in the Flp In T REx Core Kit manual TM TM TM To generate Flp In T REx expression cell lines you will cotransfect your pcDNA 5 FRT TO expression construct and pOG44 into the Flp In T REx host cell line and use hygromycin to select for stable transfectants Refer to the Flp In T REx Core Kit manual for detailed guidelines and instructions for transfection and selection Once you have generated a Flp In T REx expression cell line you will use tetracycline to induce expression of the gene of interest We generally use 1 pg ml tetracycline and treat
5. internal research purposes only and is not for use in commercial applications of any kind including without limitation quality control and commercial services such as reporting the results of purchaser s activities for a fee or other form of consideration For information on obtaining additional rights please contact outlicensing lifetech com or Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 continued on next page 13 Purchaser Notification continued Limited Use Label License No 64 Flp In System Life Technologies Corporation Life Technologies has a license to sell the Flp In System and its components System to scientists for research purposes only under the terms described below Use of the System for any Commercial Purpose as defined be low requires the user to obtain commercial licenses as detailed below Before using the System please read the terms and conditions set forth below Your use of the System shall constitute acknowledgment and acceptance of these terms and conditions If you do not wish to use the System pursuant to these terms and conditions please contact Life Technologies Technical Services within 10 days to return the unused and unopened System for a full refund Otherwise please complete the User Registration Card and return it to Life Technologies Life Technologies grants you a non exclusive license to use the enclosed System for research
6. NA 5 FRT TO Restriction sites are labeled to indicate the cleavage site Potential stop codons are underlined The multiple cloning site has been confirmed by sequencing and functional testing For a map and a description of the features of peDNA 5 FRT TO refer to the Appendix pages 9 10 The complete sequence of pcDNA 5 FRT TO is available for downloading from www invitrogen com or from Technical Support see page 12 CMV Forward priming site AAAATCAACG GGACTTTCCA AAATGTCGTA ACAACTCCGC CCCATTGACG CAAATGGGCG TATA box Tetracycline operator TetO Oem a El GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTCT CCCTATCAGT GATAGAGATC Tetracycline operator TetO2 TCCCTATCAG TGATAGAGAT CGTCGACGAG CTCGTTTAGT GAACCGTCAG ATCGCCTGGA GACGCCATCC ACGCTGTTTT GACCTCCATA GAAGACACCG GGACCGATCC AGCCTCCGGA c1 ATTCI CTGAT Pme Afl Il Hind 11 aprte Kpnl BamH BstX CTAGCGTT TAAACTTAAG CTTGGTACCG AGCTCGGATC CACTAGTCCA GTGTGGTGGA EcoR V Bek I Nor Xho l Eca0109 l Apa Pme I TGCAGA TATCCAGCAC AGTGGCGGCC GCTCGAGTCT AGAGGGCCCG TTTAAACCCG BGH Reverse priming site I 1 TCAGCC TCGACTGTGC CTTCTAGTTG CCAGCCATCT Note that there are two Pme I sites and two BstX I sites in the polylinker continued on next page Cloning into pcDNA 5 FRT TO continued E coli Transformation e REC Nous Preparing a Glycerol Stock Transform your ligation mixtures into a com
7. USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com MSDS MSDSs Material Safety Data Sheets are available on our web site at www invitrogen com msds Certificate of The Certificate of Analysis CofA provides detailed quality control information for each An alysi s product and is searchable by product lot number which is printed on each box Cof As are available on our website at www invitrogen com support Limited Warranty Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unle
8. V1025 20 40 ul at 0 5 ug ul pOG44 20 ug in TE pH 8 0 6005 20 40 pl at 0 5 ug ul PureLink HQ Plasmid Miniprep Kit 100 reactions K2100 01 continued on next page Kit Contents and Storage continued Other Flp In T REX Products Flp In Host Cell Lines vi TM A number of other Flp In T REx products are available from Invitrogen to facilitate expression of your gene of interest in the Flp In T REx System The Flp In T REx Core Kit contains vectors pFRT lacZeo p DNA 6 TR pcDNA 5 FRT TO and pOG44 primers and tetracycline The pcDNA 5 FRT TO TOPO TA Expression Kit allows rapid and efficient TOPO Cloning of Taq amplified PCR products into the pcDNA 5 FRT TO TOPO vector The Flp In T REx 293 Cell Line contains a single integrated FRT site and stably expresses the Tet repressor and allows the user to proceed directly to generation of the Flp In T REx expression cell line For more information about these products go to www invitrogen com or contact Technical Support see page 12 Cell Line Amount Cat no Flp In T REx Core Kit 1 kit K6500 01 pcDNA 5 FRT TO 20 reactions K6510 20 TOPO TA Expression Kit Flp In T REx 293 3 x 10 cells frozen R780 07 For your convenience Invitrogen has available several mammalian Flp In host cell lines that stably express the lacZ Zeocin fusion gene from pFRT lacZeo or pFRT lacZ
9. arch use only Not intended for any animal or human therapeutic or diagnostic use 16 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
10. cells for 24 hours to induce expression Expression conditions may vary depending on the nature of your gene of interest and the cell line therefore we recommend that you perform dose response and or time course experiments to optimize expression conditions for your protein of interest For protocols and guidelines to prepare tetracycline and induce expression of TM TM your protein of interest refer to the Flp In T REx Core Kit manual Appendix pcDNA 5 FRT TO Vector Map of pcDNA 5 FRT TO Comments for pcDNA 5 FRT TO 5137 nucleotides CMV promoter bases 232 958 The figure below summarizes the features of the pcDNA 5 FRT TO vector Note that the hygromycin resistance gene lacks a promoter and its native ATG start codon Transfection of the pcDNA 5 FRT TO plasmid alone into mammalian cells will not confer hygromycin resistance to the cells The complete nucleotide sequence for pcDNA 5 FRT TO is available for downloading from www invitrogen com or by contacting Technical Support see page 12 Hind II Asp718 Kpn BamH BstX EcoRV BstX Not Eco0109 Pme Q lt Xho v Ex AS PUC ori TATA box bases 804 810 Tetracycline operator 2X TetO sequences bases 820 859 CMV forward priming site bases 769 789 Multiple cloning site bases 968 1077 BGH reverse priming site bases 1089 1106 BGH polyadenylation signal bases 1095 1319 FRT site bases 1603 1650 Hygromycin resistanc
11. diate Early Gene of Human Cytomegalovirus Cell 41 521 530 Craig N L 1988 The Mechanism of Conservative Site Specific Recombination Ann Rev Genet 22 77 105 Goodwin E C and Rottman F M 1992 The 3 Flanking Sequence of the Bovine Growth Hormone Gene Contains Novel Elements Required for Efficient and Accurate Polyadenylation J Biol Chem 267 16330 16334 Gritz L and Davies J 1983 Plasmid Encoded Hygromycin B Resistance The Sequence of Hygromycin B Phosphotransferase Gene and its Expression in E coli and S cerevisiae Gene 25 179 188 Gronostajski R M and Sadowski P D 1985 Determination of DNA Sequences Essential for FLP mediated Recombination by a Novel Method J Biol Chem 260 12320 12327 Hillen W and Berens C 1994 Mechanisms Underlying Expression of Tn10 Encoded Tetracycline Resistance Annu Rev Microbiol 48 345 369 Hillen W Gatz C Altschmied L Schollmeier K and Meier I 1983 Control of Expression of the Tn10 encoded Tetracycline Resistance Genes Equilibrium and Kinetic Investigations of the Regulatory Reactions J Mol Biol 169 707 721 Jayaram M 1985 Two micrometer Circle Site specific Recombination The Minimal Substrate and the Possible Role of Flanking Sequences Proc Natl Acad Sci USA 82 5875 5879 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nuc Acids Res 15 8125 8148 Kozak M 1991 An Ana
12. e gene no ATG bases 1658 2678 SV40 early polyadenylation signal bases 2810 2940 pUC origin bases 3323 3996 complementary strand bla promoter bases 5002 5100 complementary strand Ampicillin bla resistance gene bases 4141 5001 complementary strand continued on next page pcDNA 5 FRT TO Vector continued Features of pcDNA 5 FRT TO 10 TM pcDNA 5 FRT TO is a 5137 bp vector that inducibly expresses your gene of interest under the control of a hybrid CMV TetO promoter The table below describes the relevant features of pcDNA 5 FRT TO All features have been functionally tested Feature Benefit Human cytomegalovirus CMV immediate early promoter Permits high level expression of your gene of interest Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 CMV Forward priming site Allows sequencing in the sense orientation Tetracycline operator 2 O sequences Two tandem 19 nucleotide repeats which serve as binding sites for tet repressor homodimers Hillen and Berens 1994 Hillen et al 1983 Multiple cloning site Allows insertion of your gene of interest BGH Reverse priming site Permits sequencing of the non coding strand Bovine growth hormone BGH polyadenylation signal Permits efficient transcription termination and polyadenylation of mRNA Goodwin and Rottman 1992 Flp Recombination Target FRT site Encodes a 34 bp 14 bp of n
13. eo2 Flp In CHO Each cell line contains a single integrated FRT site as confirmed by Southern blot analysis By transfecting the pcDNA 6 TR plasmid into these cell lines you can easily generate Flp In T REx host cell lines For more information go to www invitrogen com or contact Technical Support see page 12 Cell Line Amount Cat no Flp In 293 3 x 10 cells frozen R750 07 Flp In CV 1 3 x 10 cells frozen R752 07 Flp In CHO 3 x 10 cells frozen R758 07 Overview Introduction Hybrid CMV TetO Promoter Methods pcDNA 5 FRT TO is a 5 1 kb inducible expression vector designed for use with the Flp In T REx System Cat no K6500 01 available from Invitrogen When cotransfected with the pOG44 Flp recombinase expression plasmid into a Flp In T REx mammalian host cell line the peDNA 5 FRT TO vector containing the gene of interest is integrated in a Flp recombinase dependent manner into the genome Expression of the gene of interest may be induced by the addition of tetracycline to the culture medium The vector contains the following elements TM e Ahybrid human cytomegalovirus CMV TetO promoter for high level tetracycline regulated expression of the gene of interest in a wide range of mammalian cells Andersson et al 1989 Boshart et al 1985 Hillen and Berens 1994 Hillen et al 1983 Nelson et al 1987 e Multiple cloning site with 10 unique res
14. f interest into pcDNA 5 FRT TO and have prepared clean plasmid preparations of your pcDNA5 FRT TO construct and pOG44 you are ready to cotransfect the plasmids into your mammalian Flp In T REx host cell line to generate your stable Flp In T REx expression cell line We recommend that you include the peDNA 5 FRT TO CAT positive control vector and a mock transfection negative control to evaluate your results General information about transfection and selection is provided below Specific guidelines and protocols for generation of the Flp In T REx expression cell line can be found in the Flp In T REx Core Kit manual TM TM For detailed information about pOG44 and generation of the Flp In T REx host cell line refer to the Flp In T REx Core Kit manual The Flp In T REx 293 host cell line is available from Invitrogen to facilitate generation of your Flp In T REx expression cell line see page vi for ordering information The Flp In T REx 293 cell line stably expresses the lacZ Zeocin fusion gene and the Tet repressor and contains a single integrated FRT site If you wish to express your gene of interest in 293 you may want to use this Flp In T REx host cell line to establish your expression cell line For more information go to www invitrogen com or contact Technical Support see page 12 TM TM Several Flp In host cell lines are also available from Invitrogen Flp In
15. fication to and written approval from Life Technologies You may not assign sub license rent lease or otherwise transfer any of the rights or obligations set forth herein except as expressly permitted by Life Technologies This product is licensed under U S Patent Nos 5 654 182 and 5 677 177 and is for research purposes only Inquiries about licensing for commercial or other uses should be directed to The Salk Institute for Biological Studies 10010 North_ Torrey Pines Road La Jolla CA 92037 Attn Department of Intellectual Property and Technology Transfer Phone 858 453 4100 ext 1703 Fax 858 450 0509 Email mwhite salk edu 15 References Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Andrews B J Proteau G A Beatty L G and Sadowski P D 1985 The FLP Recombinase of the 2 Micron Circle DNA of Yeast Interaction with its Target Sequences Cell 40 795 803 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Boshart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Imme
16. high quality plasmid DNA may be suitable continued on next page Transfection continued Positive Control Assay for CAT Protein Hygromycin B Determination of Hygromycin Sensitivity Generation of Flp In T REx Expression Cell Lines Induction of Gene Expression TM pcDNA 5 FRT TO CAT is provided as a positive control vector for mammalian cell transfection and expression see page 11 and may be used to assay for recombinant protein expression levels in your Flp In T REx expression cell line Cotransfection of the positive control vector and pOG44 into your Flp In T REx host cell line allows you to generate a stable cell line which inducibly expresses chloramphenicol acetyl transferase CAT at the same genomic locus as your gene of interest If you have several different Flp In T REx host cell lines you may use the pcDNA 5 FRT TO CAT control vector to compare protein expression levels between the various cell lines The CAT protein expressed from the pcDNA 5 EFRT TO CAT control plasmid is approximately 32 kDa in size You may assay for CAT expression by ELISA assay western blot analysis fluorometric assay or radioactive assay Ausubel et al 1994 Neumann et al 1987 The Anti CAT Antiserum Cat no R902 25 is available from Invitrogen for detection of CAT protein by western blot analysis TM The pcDNA 5 FRT TO vector contains the hygromycin resistance gene Gritz and Davies
17. hod of your choice for transformation Chemical transformation is the most convenient method for many researchers Electroporation is the most efficient and the method of choice for large plasmids To propagate and maintain the p DNA 5 FRT TO and pcDNA 5 FRT TO CAT vectors use 10 ng of each vector to transform a recA endA E coli strain like TOP10 DHb5a T1 JM109 or equivalent Select transformants on LB agar plates containing 50 to 100 pg ml ampicillin Be sure to prepare a glycerol stock of each plasmid for long term storage see page 6 continued on next page Cloning into pcDNA 5 FRT TO continued Cloning Considerations Multiple Cloning Site of pcDNA 5 FRT TO 721 781 841 901 961 1021 1081 Your insert should contain a Kozak consensus sequence with an ATG initiation codon for proper initiation of translation Kozak 1987 Kozak 1991 Kozak 1990 An example of a Kozak consensus sequence is provided below Other sequences are possible but the G or A at position 3 and the G at position 4 shown in bold illustrate the most commonly occurring sequence with strong consensus Replacing one of the two bases at these positions provides moderate consensus while having neither results in weak consensus The ATG initiation codon is shown underlined G A NNATGG Your insert must also contain a stop codon for proper termination of your gene Below is the multiple cloning site for pcD
18. invitrogen pcDNA 5 FRT TO Inducible expression vector designed for use with the Flp In T REx System Cat no V6520 20 Version G 11 November 2010 25 0368 Table of Contents Kit Contents and Storage assssevarsannsansnonen on saas nrncnancnno diran cnica idad v Methods En 1 OVERVIEW rt ccs a e a aa a IAEA a a a CIA AI cot tans aE 1 Cloning into pPDPNA 5 FRT TO touren eiiiai an er SLR ERBE sah lei 4 Transfeetion nurse en a a ls il 7 APpENdIX NN aaa 9 PEDNAFS ERT IO Vecto nrun RENE 9 PEDNA D ERT TO EAT Vektor ana knn eelt ela 11 Technical support TS RS 12 Purchaser Noticas e ed aa 13 References u a ner be tele in nen tende arter 16 111 iv Kit Contents and Storage Contents Shipping Storage Accessory Products 20 ug of pcDNA 5 FRT TO in TE buffer pH 8 0 40 ul at 0 5 ug ul 20 ug of pe DNA 5 FRT TO CAT in TE buffer pH 8 0 40 ul at 0 5 ug ul TE Buffer 10 mM Tris HCl 1 mM EDTA pH 8 0 Plasmids are supplied in TE buffer and shipped on wet ice They should be stored at 20 C upon arrival TM TM Many of the reagents used in the Flp In T REx System are available separately from Invitrogen See the table below for ordering information Item Amount Cat no Zeocin 1g R250 01 58 R250 05 pFRT lacZeo 20 ugin TE pH 8 0 V6015 20 40 ul at 0 5 ug ul pFRT lacZeo2 20 ugin TE pH 8 0 V6022 20 40 ul at 0 5 ug ul pcDNA 6 TR 20 pg in TE pH 8 0
19. lysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biol 115 887 903 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Mol Cell Biol 7 4125 4129 Neumann J R Morency C A and Russian K O 1987 A Novel Rapid Assay for Chloramphenicol Acetyltransferase Gene Expression BioTechniques 5 444 447 Palmer T D Hock R A Osborne W R A and Miller A D 1987 Efficient Retrovirus Mediated Transfer and Expression of a Human Adenosine Deaminase Gene in Diploid Skin Fibroblasts from an Adenosine Deficient Human Proc Natl Acad Sci U S A 84 1055 1059 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Sauer B 1994 Site Specific Recombination Developments and Applications Curr Opin Biotechnol 5 521 527 Senecoff J F Bruckner R C and Cox M M 1985 The FLP Recombinase of the Yeast 2 micron Plasmid Characterization of its Recombination Site Proc Natl Acad Sci USA 82 7270 7274 2000 2008 2010 Invitrogen Corporation All rights reserved For rese
20. nduce expression of the gene of interest see the Flp In T REx Core Kit manual for more information 7 Assay for expression of the gene of interest Cloning into pcDNA 5 FRT TO Introduction General Molecular Biology Techniques E coli Strain Transformation Method Maintenance of Plasmids A diagram is provided on the next page to help you clone your gene of interest into pcDNA 5 FRT TO General considerations for cloning and transformation are listed below For help with DNA ligations E coli transformations restriction enzyme analysis DNA sequencing and DNA biochemistry refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 Many E coli strains are suitable for the propagation and maintenance of this vector We recommend that you propagate vectors containing inserts in E coli strains that are recombination deficient recA and endonuclease A deficient endA For your convenience TOP10 and DH5a T1 cells are available as chemically competent or electrocompetent TOP10 only cells from Invitrogen Item Quantity Cat no One Shot TOP10 Chemically Competent Cells 20 reactions C4040 03 One Shot TOP10 Electrocomp Cells 20 reactions C4040 52 One Shot DH5a T1 Max Efficiency Chemically 20 reactions 12297 016 Competent Cells You may use any met
21. nimal FRT site consists of a 34 bp sequence containing two 13 bp imperfect inverted repeats separated by an 8 bp spacer that includes an Xba I restriction site see figure below An additional 13 bp repeat is found in most FRT sites but is not required for cleavage Andrews et al 1985 While Flp recombinase binds to all three of the 13 bp repeats strand cleavage actually occurs at the boundaries of the 8 bp spacer region see figure below Andrews et al 1985 Senecoff et al 1985 Minimal FRT site cs GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAAC TTC Xba cs CS cleavage site The following table outlines the steps required to clone and inducibly express your gene of interest in pcDNA 5 FRT TO Step Action 1 Consult the multiple cloning site diagrammed on page 5 to design your cloning strategy 2 Ligate your insert into p DNA 5 FRT TO and transform into E coli Select transformants on 50 to 100 ug ml ampicillin 3 Analyze your transformants for the presence of insert by restriction digestion 4 Select a transformant with the correct restriction pattern and sequence to confirm that your gene is cloned in the correct orientation 5 Cotransfect your pcDNA 5 FRT TO construct and pOG44 into the Flp In T REx host cell line using your own method of choice and select for hygromycin resistant clones see the Flp In T REx Core Kit manual for more information 6 Add tetracycline to i
22. on essential sequence that serves as the binding and cleavage site for Flp recombinase Gronostajski and Sadowski 1985 Jayaram 1985 Senecoff et al 1985 Hygromycin resistance gene no ATG Permits selection of stable transfectants in mammalian cells Gritz and Davies 1983 when brought in frame with a promoter and an ATG initiation codon through Flp recombinase mediated recombination via the FRT site SV40 early polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin Allows high copy number replication and growth in E coli bla promoter Allows expression of the ampicillin bia resistance gene Ampicillin bla resistance gene B lactamase Permits selection of transformants in E coli pcDNA 5 FRT TO CAT Vector Description pcDNA 5 FRT TO CAT is a 5926 bp control vector containing the gene for chloramphenicol acetyl transferase CAT This vector was constructed by ligating a 0 7 kb Xho I Apa I fragment containing the CAT gene into the Xho I Apa I site of pcDNA 5 FRT TO The CAT protein expressed from pcDNA 5 FRT TO CAT is about 32 kDa in size Map of The figure below summarizes the features of the p DNA 5 FRT TO CAT pcDNA S5 FRT vector The complete nucleotide sequence for peDNA 5 FRT TO CAT is CAT available for downloading from www invitrogen com or from Technical Support see the next page Eco0109 I Apa
23. petent recA endA E coli strain e g TOP10 DH5a T1 and select on LB agar plates containing 50 to 100 ug ml ampicillin Select 10 20 clones and analyze for the presence and orientation of your insert We recommend that you sequence your construct with the CMV Forward and BGH Reverse primers to confirm that your gene is in the correct orientation for expression and contains an ATG initiation codon and a stop codon See the previous page for the location of the primer binding sites Primer Sequence BGH Reverse 5 TAGAAGGCACAGTCGAGG 3 CMV Forward 5 CGCAAATGGGCGGTAGGCGTG 3 For your convenience Invitrogen offers a custom primer synthesis service Go to www invitrogen com for more details Once you have identified the correct clone purify the colony and make a glycerol stock for long term storage You should keep a DNA stock of your plasmid at 20 C e Streak the original colony out on an LB plate containing 50 ug ml ampicillin Incubate the plate at 37 C overnight e Isolate a single colony and inoculate into 1 2 ml of LB containing 50 pg ml ampicillin e Grow the culture to mid log phase OD q 0 5 0 7 e Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial e Store at 80 C Transfection Introduction N 7 N D L1 Sy Ya A O eN z Flp In Host Cell Lines Important Plasmid Preparation TM Once you have cloned your gene o
24. purposes only The System is being transferred to you in furtherance of and reliance on such license You may not use the System or the materials contained therein for any Commercial Purpose without licenses for such purpose Commercial Purpose in cludes any use of the System or Expression Products in a Commercial Product any use of the System or Expression Products in the manufacture of a Commercial Product any sale of the System or Expression Products any use of the System or Expression Products to facilitate or advance research or development of a Commercial Product and any use of the System or Expression Products to facilitate or advance any research or development program the results of which will be applied to the development of a Commercial Product Expression Products means products expressed with the System or with the use of any vectors or host strains in the System Commercial Product means any product intended for sale or commercial use Access to the System must be limited solely to those officers employees and students of your entity who need access to perform the aforementioned research Each such officer employee and student must be informed of these terms and conditions and agree in writing to be bound by same You may not distribute the System or the vectors or host strains contained in it to others You may not transfer modified altered or original material from the System to a third party without written noti
25. quence serves as the binding site for 2 molecules of the Tet repressor For more information about the mechanism of tetracycline regulation in the Flp In T REx System refer to the Flp In T REx Core Kit manual continued on next page Overview continued A Note About pcDNA 5 FRT TO Important Flp Recombinase Mediated DNA Recombination TM The pcDNA 5 FRT TO vector contains a single FRT site immediately upstream of the hygromycin resistance gene for Flp recombinase mediated integration and selection of the pcDNA 5 FRT TO plasmid following cotransfection of the vector with pOG44 into Flp In T REx mammalian host cells The FRT site serves as both the recognition and cleavage site for the Flp recombinase and allows recombination to occur immediately adjacent to the hygromycin resistance gene The Flp recombinase is expressed from the pOG44 plasmid For more information about the FRT site and recombination see the next page For more TM TM information about pOG44 refer to the Flp In T REx Core Kit manual TM The hygromycin resistance gene in pcDNA 5 FRT TO lacks a promoter and an ATG initiation codon therefore transfection of the pcDNA 5 FRT TO plasmid alone into mammalian host cells will not confer hygromycin resistance to the cells The SV40 promoter and ATG initiation codon required for expression of the hygromycin resistance gene are integrated into the genome in the Flp In T REx
26. ss all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 12 Purchaser Notification Introduction Limited Use Label License No 358 Research Use Only Use of the pcDNA 5 FRT TO vector is covered under the licenses detailed below The purchase of this product conveys to the purchaser the limited non transferable right to use the purchased amount of the product only to perform internal research for the sole benefit of the purchaser No right to resell this product or any of its components is conveyed expressly by implication or by estoppel This product is for
27. triction sites to facilitate cloning the gene of interest e FLP Recombination Target FRT site for Flp recombinase mediated integration of the vector into the Flp In T REx host cell line see page 2 for more information e Hygromycin resistance gene for selection of stable cell lines Gritz and Davies 1983 The control plasmid pcDNA 5 FRT TO CAT is included for use as a positive control for transfection and expression in the Flp In T REx host cell line of choice TM TM For more information about the Flp In T REx System the pOG44 plasmid and generation of the Flp In T REx host cell line refer to the Flp In T REx Core Kit manual The Flp In T REx Core Kit manual is supplied with the Flp In T REx Core Kit but is also available from www invitrogen com or by contacting Technical Support see page 12 TM Expression of your gene of interest from pcDNA 5 FRT TO is controlled by the strong CMV immediate early enhancer promoter Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 into which 2 copies of the tet operator 2 TetO sequence have been inserted in tandem Insertion of these TetO sequences into the CMV promoter confers regulation by tetracycline to the promoter The TetO sequences consist of 2 copies of the 19 nucleotide sequence 5 TCCCTATCAGTGATAGAGA 3 separated by a 2 base pair spacer Hillen and Berens 1994 Hillen et al 1983 Each 19 nucleotide TetO se
Download Pdf Manuals
Related Search