Table of Contents Pdf

Home

1. 425 ine pg TOR RRA sz MA aaa Wh d2 150d Tip tema a na d m TP1 8 1V DC ORAL ZEIIIITI TUM Tras 3 Aad FE b OE Assy PUTET OC ELT i 4 LI LI LI n LJ TP1 5 Volts DC TP4 Common Return Troubleshooting VetPro DC Light or Dark X ray Images At Power up the Operator Display Stops at VetPro DC At Power Up Continuous Beep Backlit Display No Display Characters No Ready Light Power Supplies OK At Power Up Continuous Beep with Normal Display At Power Up Buzzing Noise is Heard 13 1 Adjust the selected exposure time kilovoltage or tube current to produce an acceptable image If necessary reprogram the techniques factors as explained in the System Configuration section of this manual 2 Verify the kilovoltage and tube current during an exposure using the diagnostic mode as explained in the System Configuration section of this manual Alternatively you may employ a non invasive meter to evaluate kilovoltage and exposure time 3 Inspect the condition of the remaining imaging chain components such as the film chemistry and processor or the condition of the X ray sensor and computer 4 Check for pulsing output with fluorescent screen If this is occurring replace the Logic Board 5 Light image can be caused by the Logic Board This is characterized by a short pulse of exposure as viewed with a fluorescent screen Replace the Logic Boar
2. Installation Procedures VetPro DC Installing the Control Unit on a Metal Stud Wall Mark and Drill The mounting template 30 S0003 is a guide for locating where to drill the holes Wall Plate and used to mount the wall plate and support plate to the wall Carefully placing the mounting template on the wall will help ensure correct installation of these plates support Plate and hence of the Control Unit Mounting Holes 1 Using a stud finder locate the center of the stud on which the Control Unit will be mounted 2 Place the mounting template for the dual stud mount on the wall with the lower mounting holes 40 inches 101 5 cm above the floor 3 Place a level parallel to the vertical lines on the mounting template and adjust the mounting template until it is plumb 4 Tape the mounting template to the wall 5 Using an awl or other sharp object punch through the mounting template to mark the location of the mounting holes 6 Drill inch pilot holes at marked locations 7 Drill 1 inch clearance holes 8 Remove the mounting template from the wall and save for future use Reinforce Metal Filler material is added to the wall to prevent the metal stud wall from being tud Wall crushed during installation o 3 1 Cutan access hole 6 inches by 10 inches 15 cm x 25 cm in size between the clearance holes 2 nsert two 4x4 wooden studs in the access hole Attach the studs to the rear drywall surface with drywall screws CAUTION T
3. MIDMARI lt VetPro DC Animal Health Dental X ray System Installation and Service Manual Midmark Corporation 6 5 Heathrow Dr Lincolnshire Illinois 60069 U S A Phone 800 MIDMARK Fax 847 415 9801 midmarkanimalhealth com Midmark Corporation 2014 U S Patents D470237 D469182 D470589 6 837 468 and 6 664 853 Table of Contents VetPro DC Table of Contents X RAY PROTECTION x cc hee ea ae ate id cmd fon dieu asi teer a ra Eco die led ae l TABLE OF CONTENTS Gun ina l GENERAL INFORMATION cscscscncncncnsnenenececececeneneneseeeneeeseneeeneceeeceeeeeeeeueneueecueueneneneneneneneneneneneneneneneneneeeees 1 IND CATONS EOI o M dd ne E ELS 1 INIA ANO i NR RR P 1 PRODUCT DESCRIPTION carura TERRE em 1 REACH AND COVERAGE sad cade Seeded Mechelen isnt de cA D D Portia free rac dt lo tthe daas 4 ENVIRONMENTAL PAC TORS NR 9 SUPPORT REQUIREMENTS a a tio 9 EFECTRICAL REQUIREMENTS mm 9 COMPLIANCE WITH APPLICABLE STANDARDS 2 ral lo 10 CERTIFIED COMPONENTS o edo haute 10 EG DECLARATION OF CG ONFORMIM Y cncxcaccescscatecacseucceacsa casas teases seanaeecncasasaeasendees cn tenaeeceanasexocseaeeossndeeaasenenegsetat 11 AUTHORIZED REPRESENTATIVES cccccececececececacecececcencecucsencnescuescacavacacavavacavauaeaeauaeaesenecenecenecacacacacececeaeesaens 11 Se TeV seers est ea A ces ee ars pesto ec omnes Satake SU
4. Min reach with Compact Fes Er 82 1 2 208 5cm Max reach with Extralong Horizontal Arm 1 PA 11 1 28 194 CM l y 12 Cone reduces reach by 4 inches 10 16CM Installation Options VetPro DC i i 33 875 86cm i 92 5 235cm 5 Min me Clearance 35 5cm Height i i i 44 5 n 103cm 36 625 40 75 93cm 110cm 12 Cone 8 Cone ri 30cm 20cm 99cm Figure 3 Cabinet Mounting Dimensions 82 reach not recommended for cabinet mount Installation Options VetPro DC Figure 4 Retracted Wall Mount Figure 5 Extended Position Wall or Cabinet Mount With 12 30cm cone P7015V P 52 1 2 133 cm P7016V P 62 1 2 159 cm note 2 P7017V P 72 1 2 P7018V P 78 1 2 199 cm 13 5 8 B6 5 8 35cm 220 03 CM i 8 1 2 7 7 21 5cm see note 1 38 5 8 405 8 39 nolei P7015V P 24 5 8 62 5 cm rre 1 TEn 99cm P7016V P 34 5 8 88 cm 30cm 20cm P7017V P 44 5 8 114 cm Cone Cone P7018V P 50 5 8 128 5 cm add 5 12 7 cm for Two Stud mount 5 08cm i LL 4 5 8 i 11 75cm see note 2 see note 3 ml de 39 121 92cm 89cm see note 4 With 8 20cm cone P7015V P 56 1 2 143 5 cm P7016V P 66 1 2 169 cm P7017V P 76 1 2 194 5 cm P7018V P 82 1 2 209 5 cm To handle P7015V P 70 3 8 178 5 cm P7016V P 80 3 8 204 cm P7017V P 90 3 8 229 5 cm P7018V P 96 3 8 244
5. Installation Options VetPro DC Safety Radiation Safety Electrical Safety Explosion Safety 12 Only qualified and authorized personnel may operate this equipment observing all laws and regulations concerning radiation protection The operator at all times must remain 6ft 2m from the focal spot and the X ray beam for operator protection Full use must be made of all radiation safety features on the equipment Full use must be made of all radiation protection devices accessories and procedures available to protect the patient and operator from X ray radiation Only qualified and authorized service personnel should remove covers on the equipment This equipment must only be used in rooms or areas that comply with all applicable laws and recommendations concerning electrical safety in rooms used for medical purposes e g IEC US National Electrical code or VDE standards concerning provisions of an additional protective earth ground terminal for power supply connection Before cleaning or disinfecting this equipment must always be disconnected from the main electrical supply The VetPro DC Animal Health Dental X ray System is ordinary type medical equipment without protection against ingress of liquids To protect against short circuit and corrosion no water or any other liquid should be allowed to leak inside the equipment This equipment must not be used in the presence of flammable or potentially explosive gases
6. TP6 kV Program Figure 65 Logic Board 30 08160 87 Troubleshooting VetPro DC Incorrect mA Obtaining Technical Support Contact 88 At times various measurements of an otherwise fully functional system indicate that milliamperage may be incorrect Milliamperage mA is controlled by the microprocessor and is not adjustable The VetPro DC generates milliamperage by first establishing a reference voltage and then comparing the feedback voltage to the reference Follow these steps to establish proper operation of the mA controls 1 Onthe Logic Board place a voltmeter on TP8 or TP10 the Common Return and TP2 mA Program as shown in Figure 65 Compare measurements to the following chart volts DC 4 mA 5 mA 6 mA 7 mA 60 kV 65 kV 70 kV 3 1 3 4 3 7 3 2 3 5 3 75 3 3 3 8 3 8 3 4 3 7 NA 2 To evaluate the feedback voltages which represent the measured mA within the system refer to the table below select 1 5 seconds of exposure time and measure the DC voltages during the exposure only This measurement is made across TP8 or TP10 the Common Return and TP4 the mA Monitor as shown in Figure 65 4 mA 5 mA 6 mA 7 mA Volts DC 2 2 4 2 9 3 4 Values which approximately match the above tables represent a correctly operating system Other values may indicate that boards need to be replaced Further assistance can be obtained from Midmark Technical Support Midmark Corporation 675 Heathrow Dr Li
7. MIDMARI lt VetPro DC Animal Health Dental X ray System a Installation and Service Manual C 00 02 1606 Rev K ECN P3415 Attention The equipment must only be installed and operated in accordance with the safety procedures and operating instructions given in this manual and in the User Manual for the purposes and applications for which it was designed Modifications and or additions to the equipment may only be carried out by Midmark Corp or by third parties expressly authorized by Midmark Corp to do so Such changes must comply with legal requirements as well as with the generally accepted technical rules It is the responsibility of the user to ensure that existing legal regulations regarding installation of the equipment with respect to the building are observed X RAY PROTECTION X ray equipment may cause injury if used improperly The instructions contained in this manual must be read and followed when operating the VetPro DC Your Midmark Dental dealer will assist you in placing the VetPro DC in operation The VetPro DC Animal Health Dental X ray System provides a high degree of protection from unnecessary radiation However no practical design can provide complete protection nor prevent operators from exposing themselves or others to unnecessary radiation alm ZI Midmark Corporation 675 Heathrow Drive Lincolnshire Illinois 60069 U S A Phone 800 MIDMARK Fax 847 415 9801 midmarkanimalhealth com
8. 100 The balance and friction of the Articulating Arm and the friction of the Tubehead are initially set at the factory During the installation process check the balance and friction When moving the Tubehead the Articulating Arm should be steady in all positions and move before the Horizontal Arm Note The mechanical adjustments should not be used to compensate for a system that is not properly leveled on the wall The movement of the Tubehead is set in the factory and cannot be adjusted Note If performing this adjustment as part of the initial installation of the VetPro DC omit steps 1 3 1 2 Remove the screw from the Control Unit front cover Carefully remove the front cover Note If the Operator Panel is installed on the Control Unit carefully keep the Operator Panel together with the front cover Unplug the cable connectors and set the front cover aside Locate the brake assembly at the top of the Control Unit The brake assembly has a screw on either side of a clamping bar over the Horizontal Arm pivot post Using a 4 mm Allen wrench as shown in Figure 97 tighten the screws equally to apply adequate braking to the pivot post so that Horizontal Arm begins to move after the Articulating Arm Replace and re connect the front cover of the Control Unit Replace the screw on the front cover Maintenance VetPro DC Adjusting the Locate the friction assembly screws Using a 3 mm Allen wrench as shown in Horizo
9. 30 A2074 30 A2164 Options E1 13049 30 08101 30 A2044 30 A2198 22 11466 22 11467 30 A2099 Description Articulating Arm and Tubehead Assembly Control Unit Assembly Operator Panel Operator Panel Mounting Cradle VetPro DC Mounting Hardware Kit VetPro DC Plastic Covers Brake Kit Two Stud Mount Assembly Handswitch Assembly Line Cord 16 3 6 Wide VetPro DC Documentation Kit Extension Arm Long Extension Arm Short Extension Arm Compact Extension Arm Extra Long 8 Cond RJ45 to RJ45 50 ft Doorbell Switch Lighted Doorbell Switch 8 inch Rectangular Cone amm Adjustment Wrench Fluorescent Screen 4x4 Mount Kit Quantity I ll cl l ll 1 Note Shipment Contains One of the Following Extension Arms Per Order y y 1 1 Installation Procedures VetPro DC Installing the Control Unit on a Single Wood Stud Wall Mark and Drill Control Unit Mounting Holes 22 WARNING UNDER NO CIRCUMSTANCES SHOULD THE 82 INCH 208 CM REACH SYSTEM BE ATTACHED TO A WALL IN THE SINGLE STUD CONFIGURATION PLEASE DIRECT ANY QUESTIONS ON THIS MATTER TO MIDMARK TECHNICAL SUPPORT WARNING LAG SCREWS ARE NOT INTENDED TO BE USED AS AN ATTACHMENT METHOD FOR METAL SUPPORTS MIDMARK PROVIDES MACHINE SCREWS LARGE FLAT WASHERS AND NYLOCK NUTS TO USE WHEN FASTENING THE SYSTEM TO METAL SUPPORTS SINGLE STUD INSTALLATION WITH THE INSTALLATION GUIDE 30 P0076 Introduction The Installation Guide is inte
10. Cover Locations 49 The end cap for the Horizontal Arm is shipped in the packet of plastic parts and is put on as part of the installation procedures End caps for the Articulating Arm are shipped installed but are removable to perform mechanical adjustments The cable access cover is placed over the cable connection underneath the Horizontal Arm Cover locations are shown in Figure 39 1 Place the plastic cover from the packet on the end of the Horizontal Arm 2 Install the cable access cover over the Horizontal Arm opening using two Phillips flat head screws Installation Procedures VetPro DC VetPro DC Operator Panel Using the Operator Panel Power On Settings Exposure Settings Adjusting Exposure Settings Exposure Button and Ready Indicator Figure 40 VetPro DC Operator Panel 50 When the VetPro DC Animal Health Dental X ray System is powered on the Operator Panel shown in Figure 40 displays the selections that were in use when the system was last powered off The Operator Panel displays the exposure settings kV mA and seconds for the currently selected tooth image receptor type and patient size Use the Tooth Selection Image Receptor Type and Patient Size buttons to select other exposure settings Preset exposure settings can be adjusted prior to making an exposure Exposure time can be easily changed by simply using the up and down buttons To adjust kV and mA use the right arrow t
11. J q i A 14D zl A LA sss J7 ded E T ndi e WA ik Remove the screw holding the front cover of the Control Unit in place Place the screw in a safe location for later use Remove the front cover Cut out the notch on the base of the Control Unit front cover Route both the Operator Panel cable and the coil cord hand switch through the hole in the bottom of the Control Unit front cover Place a loop of the coil cord into the notch Carefully reassemble the Control Unit front cover keeping the coil cord in the notch Secure the front cover with the screw that was removed in step 1 Locate the Operator Panel in the top portion of the shipping carton Connect the coil cord hand switch to the left plug socket as viewed from the back on the bottom of the Operator Panel Connect the short white cable to the right plug socket Carefully dress the two cables back into the front cover of the Control Unit Snap the Operator Panel into place on the front cover of the Control Unit Mount the bracket for the coil cord hand switch in a convenient location Stow the coil cord hand switch Route the cable from the coil cord hand switch through the hole in the wall mounting plate Place a loop of the coil cord into the notch Locate the Operator Panel in the top portion of the shipping carton Connect the coil cord hand switch to the left plug socket as viewed from the back on the bottom of the Operator Panel Connect the control cable to th
12. Open the shipping carton and locate the Control Unit in the first level of the carton Remove the Phillips screw from the front cover of the Control Unit Carefully remove the front cover Place the front cover and the screw in a safe location for later reassembly Select the 3 8 x 3 long lag screws 30 H0006 and washers 30 HO008 Note For concrete walls the installer must supply the appropriate mounting bolts Put a lag screw and washer through the upper mounting hole of the Control Unit Place the Control Unit on the wall and loosely tighten the upper mounting bolt Put the remaining lag screw and washer through the lower mounting hole of the Control Unit and loosely tighten Be sure that the power wire extends through the opening at the bottom of the Control Unit Place a level on the Control Unit bearing parallel to the wall as shown in Figure 14 Level the Control Unit Tighten the upper and lower lag screws to 14 18 ft lbs 2 0 to 2 5 m kgs Pre drill a hole for a 12 wood screw below the lower lag screw as shown in Figure 15 Install and tighten the wood screw to prevent the unit from shifting CAUTION Do not over tighten the lag screws Over tightening the lag screws will damage the wooden stud and reduce the holding force Installation Procedures VetPro DC s d Gz i E a Figure 14 Leveling the Control Unit For 12 Screw Figure 15 26 Installation Procedures VetPro DC Install
13. RECALL PRESETS gt EXIT Showing Current System Configuration Figure 50 Configuration Menu 65 The VetPro DC Animal Health Dental X ray System displays the current system configuration This display is informational only 1 2 From the Main System Configuration menu Figure 47 select CONFIGURE UNIT You will see the Configuration menu shown in Figure 50 Select SHOW CONFIG The display will show e Current software version e Cone size e Diagnostic mode on or off Press any button on the Operator Panel to return to the Configuration menu CONFIGURE UNIT PSET CONFIG SHOW MAINT EXIT oystem Configuration VetPro DC Changing the Cone Size Selecting SET CONFIG from the Configuration menu Figure 50 displays the Set Configuration menu Figure 51 with options to change the cone size The VetPro DC Animal Health Dental X ray System is preset for use with the standard supplied 8 20 cm Cone The 12 30 cm Cone 30 A2033 is available Using the longer Cone requires longer exposure times which the VetPro DC automatically selects when you change the Cone size in the Set Configuration menu Using a 12 inch 1 From the Main System Configuration menu Figure 47 select CONFIGURE 30 CM Cone UNIT You will see the Configuration menu shown in Figure 50 2 Select SET CONFIG You will see the Set Configuration menu shown in Figure 51 3 From the Set Configuration menu use the up and down arrow
14. SGONTROL U NE en p 110 PAND o ce 111 SPEGIFICATIONS A ena 112 VETPRO DC ANIMAL HEALTH DENTAL X RAY SYSTEM sccssccecccsccecccscceccccccaccescceccauccaccauecaccauecaceuecuccaseeass 112 APPENDOCA tt oa 115 ASSEMBLY INSTRUCTIONS FOR DC MOBILE UNT ed as 115 APPENDIX B a ea 125 ELECTRONICS BLOCK DIAGRAMA e ed re ker 125 Installation Options VetPro DC General Information Indications for Use Contraindications The VetPro DC Animal Health Dental X ray is to be used as an extraoral source of X ray in Dental radiography None known Product Description Control Unit Tubehead Articulating Arm Horizontal Arm Modular Beam Limiting Device BLD Remote Control Mobile Unit Installation and Service The VetPro DC Animal Health Dental X ray System is a state of the art high frequency intra oral X ray machine The VetPro DC consists of five components as shown in Figure 1 Component Diagram the Control Unit the Tubehead the Articulating Arm the Horizontal Arm the Cone and the Remote Control option The Control Unit provides for the input power connection and control of the Tubehead and Operator Panel It provides automatic line voltage compensation kVp control and exposure time control The Control Unit consists of the mounting base and Operator Panel The Tubehead contains the X ray tube high voltage circuit and Cone The Tubehead is shipped already assembled to the Artic
15. is controlled by the microprocessor and is not adjustable The VetPro DC generates kilovoltage by first establishing a reference voltage and then comparing the feedback voltage to the reference Follow these steps to establish proper operation of the kV controls 1 On the Logic Board place a voltmeter on TP8 or TP10 the Common Return and TP6 kV Program as shown in Figure 65 Compare measurements to the following chart volts DC 60 kV 65 kV 70 kV 4 mA 3 1 3 4 3 7 5 mA 3 2 3 5 3 75 6 mA 3 3 3 8 3 8 7 mA 3 4 3 7 NA 2 To evaluate the feedback voltages that represent the measured kV within the system compare the observed values in the table below To properly observe these values select 1 5 seconds of exposure time and measure the DC voltages during the exposure only This measurement is made across TP8 or TP10 the common return and TP3 the kV Monitor as shown in Figure 65 60 kV 65 kV 70 kV 4 mA 3 1 3 4 3 7 5 mA 3 2 3 5 3 75 6mA 3 3 3 6 3 8 7 mA 3 3 3 65 NA Values that approximately match the above tables represent a correctly operating system Other values may indicate that boards need to be replaced Additional assistance can be obtained from Midmark Technical Support Troubleshooting VetPro DC J3 Cable Connector Use TP8 or TP10 for Common Return deor espe diei ed when measuring DC voltages SEPP RRR ERR EEE EEE ERS BEB RBBB BRR REPRE RRR 202 inj ase 50 y LE ee na TP3 kV Monitor 24 TP2 mA Program
16. the building structure must be capable of withstanding a load moment of 920 pounds 418 kilograms CAUTION Lag screws are not intended to be used as an attachment method for metal supports such as those found in center island pass through cabinets Midmark provides machine screws large flat washers and nylock nuts to use when fastening the system to metal supports 14 Installation Options VetPro DC Single Wood Stud Wall Solid Wall or Reinforced Wood Cabinet Figure 9 Wood Wall Stud Mount 15 The Control Unit should be located at a height of 39 inches 99 cm from the floor to the bottom of the control mounted on the wood stud as shown in Figure 9 The large range of travel of the Articulating Arm provides some flexibility in the vertical position Two mounting holes are provided Refer to the supplied mounting template shown in Figure 8 for specific locations In order to mount to a solid masonry type wall the same mounting holes and mounting template as the single wood wall stud are used The installer must supply appropriate fasteners The power supply 2x4 junction box should be mounted to the left of the mounting stud at the appropriate height as indicated in the mounting template Note A 4x4 junction box will not be covered by the Control Unit Refer to the supplied mounting template for specific location WARNING UNDER NO CIRCUMSTANCES SHOULD THE 82 INCH 20 CM REACH SYSTEM BE ATTACHED TO A W
17. 2cscececececacaccccccececececececececececececececscucueueanaeananaeas 34 INSTALLING THE ARTICULATING ARM AND TUBEHEAD ASSEMBLY 2 2ccecececeecececececcececucecaecececueaeaeseeesaeaeaeaeeas 36 CONNECTING IHE CABLES stus eather tls abr aer ett ela Bio euch e o iat alld des M ue cones cfl ates 38 ELECTRICAL VERA TION RELATES ee ee ees 41 MIECHANICAEJADJUSTMENTS 2 0 oxussttu tn eaten aac ce doce a 44 INSTALLING THE CONTROL UNIT FRONT COVER AND THE OPERATOR PANEL eene meme nnne nenne 45 NSA LUNG PLASTIC COVERS siria diodes 49 VEIPRO DC OPERATOR PAN L cii aaa 50 SING THE OPERATOR ANELD 5 bienes e ed tote e pedum die cod DE E e ca o di o ale 50 CHECKING SYSTEM FUNCTION Soooccocococononnononononcononononencononononcaronononenrnnononanranononanrnrnnnnannnrannnonanrnrananananaas 51 SYSTEM FUNCTION GHECKEIS sucus tando a inh arts Sn ke iari ease Mo cod he fx c so adc Ma tek eaten i Eri 52 TUBE SEASONING PROCEDURE ui ica 53 OPTIONAL INSTALLATION PROCEDURES c cococcocononocncnnononononcononononcnnanonononcanonononcnrananonenrananonanenrananananans 54 INSTALLING THE COIL CORD HAND SWITCH OPTION 30 A2040 occoccccocccoccccoocncconoconcnonononnnnonanonnarnnnnnnonnnnnnnnos 54 INSTALLING THE REMOTE EXPOSURE STATION 30 A2044 oocccocccccccnoccnnoocnccnnnocaronnnnononnonnnonncnnarnnnannnnnnnnnnns 56 CONNECTING TO A GENERIC 2 WIRE REMOTE EXPOSURE SWITCH scececececececacacaeaeauauceceseseneneneneneneneneneneness 61 INS
18. 3 and 4 volts DC If this voltage is not present replace the Logic Board If this voltage is correct inspect the condition of the ribbon cable between the Power Supply Board and the Logic Board If the cable is undamaged and seated properly replace the Logic Board Check the condition of the cables between the Control Unit and the Tubehead assembly If no X ray occurs and no errors are displayed the problem may lie within the conductors of the white connector which is primary power to the Tubehead Assembly If no X ray occurs and the attempt is accompanied by a snap sound the problem may lie with the conductors of the black connector which is transmitting the feedback signals Connections for this cable begin with controls at J1 of the Power Supply Board and J3 of the Logic Board As shown in Figure 57 an internal set of connections will be accessed below the distal side of the horizontal arm and at the inside top of the Tubehead Yoke The final set of connections is accessed by removing the Pivot Cap located at the attachment point of the Tubehead to the Yoke If D11 on the Power Supply Board is illuminated power supplies are in order and the cable connections are correct place an AC voltmeter across the Tubehead connector J1 white connector on the black and white conductors request an exposure time of at least 1 5 seconds and measure the resulting voltage during the exposure Presence of 130 volts AC will require the replacement o
19. 42 Installation Procedures VetPro DC Circuit Board Verification Figure 34 Circuit Board Verification 43 CAUTION The Power Supply Board 30 08044 when energized contains high electrical energy Avoid contact with this board After the system is turned off electrical energy will remain in the Power Supply Board for several minutes When attempting any service on this board first verify that voltage has dissipated On Power Supply Board 30 08041 shown in Figure 34 verify that LED D1 1 is illuminated The illuminated LED verifies that appropriate supply voltages are present Note Stored electrical energy is present whenever D11 is illuminated On the Power Supply Control Board 30 08160 shown in Figure 34 verify that LEDs D7 5VDC D8 12VDC and D9 24VDC are illuminated and LED D10 is flashing Each illuminated LED verifies that appropriate supply voltages are present If the LEDs are not illuminated refer to the No Operator Display but Power Switch is On procedure in the Troubleshooting on page 69 of this manual Turn off the VetPro DC Animal Health Dental X ray System using the power switch as shown in Figure 32 Power Supply Control Board 30 08160 D7 5 Volts DC D8 12 Volts DC D9 24 Volts DC E D10 Communications a T E Power Supply Board 30 08041 Installation Procedures VetPro DC Mechanical Adjustments Horizontal Arm Adjustment Figure 35 Tightening the Brake Addit
20. 92 Ensure that the wall support is adequate and that the system is properly mounted to the wall Ensure that all certified components bear labels that include the model and serial number date of manufacture and a statement of certification as noted elsewhere in this manual Check for oil leaks or other evidence that could indicate internal damage Replace the Tubehead if necessary Ensure that the Tubehead maintains its position around the horizontal axis while remaining easy to rotate and position Also check the vertical pivot of the Tubehead for easy movement while remaining in position after moving Check that all movements are smooth and quiet Verify that the Tubehead is properly counterbalanced for vertical drift and that the Horizontal and Articulating Arms do not drift horizontally Verify that the switch is working properly and that the Ready Indicator is illuminated when the power switch is in the ON position With the power switch located at the upper right of the Control Unit in the ON position verify that technique factors appear on the Operator Panel Also check the function of the selection buttons for Tooth Selection Image Heceptor Type and Patient Size Pressing a selection button should cause indicator lamps to indicate the selected item Verify that the Exposure button on the Operator Panel is functioning properly To make an exposure press and hold the Exposure button until the Radiation Indicat
21. board Swing out the Logic Board and connect the three connections as shown below e A Black connector Feedback from tubehead e B White connector Power to tubehead e C Cat5 network cable e D USB for Sensor ready units FIGURE 132 121 Appendix A VetPro DC FIGURE 133 FIGURE 134 FIGURE 135 FIGURE 136 FIGURE 137 122 19 Attach the control unit cover 20 Feed the Cat5 cable through the Operators panel cradle Feed remote exposure cable through the bottom of cradle NOTE Allow a few coils of slack inside for strain relief Attach the cradle with supplied hardware 21 Connect Cat5 cable and remote switch cable to the Operators Panel Mount the Operators Panel into cradle Appendix A VetPro DC 22 Install the mobile unit handle with the supplied hardware FIGURE 138 23 Attach the remote switch holster by removing the adhesive backer and attaching to the frame FIGURE 139 123 Appendix A VetPro DC Figure 140 Mobile Unit Assembly 124 See Fig 104 for the Arm amp Head Assy parts list Mobile Assembly Parts List Item Part Number 30 A2093 H1 15 M16020 10 30 A2111 30 A2123 H1 61 M13008 01 30 M3010 E1 13029 30 M0045 H1 61 MO5008 01 H1 P2 M04000 01 30 M0046 30 S0036 30 S0035 30 A2078 30 A1032 30 08098 30 A2040 H1 63 M09008 17 30 P0017 30 A2109 E1 13028 Description Velcro Strap Screw Mobile Stand Handle w Grips Operator Panel Vet see Figu
22. button on the control panel consult your local laws A jumper must be Coil cord Hand 3 4 o4 removed on the Operator Panel Board 30 08054 shown in Figure 41 to disable the operation of the hand switch Switch 4 2 Turn the power off Remove the Operator Panel from its mounting on the Control Unit or wall plate Unplug the cable that connects the Operator Panel to the Control Unit With a Phillips screwdriver remove the 4 screws from the back of the Operator Panel Put the screws in a safe location for later use Remove the back cover from the Operator Panel Lift out the Operator Panel Board 30 08054 To disable the use of the Exposure button on the Operator Panel locate point J7 on the Operator Panel Board 30 08054 Then remove the shunt on J7 Put the Operator Panel Board 30 08054 back in position Put the cover on the back of the Control Panel using the 4 screws J7 Exposure Switch Jumper Settings Jumper Position Switch Closure Required for Exposure 1 2 3 4 default Remote Switch or Panel Switch parallel 2 3 Remote Switch and Panel Switch series 3 4 Remote Switch panel switch disabled Optional Installation Procedures VetPro DC Figure 41 Disabling the Use of the Exposure Button Connecting the Coil cord Hand Switch Operator Panel Located on Control Unit Connecting the Coil cord Hand Switch Operator Panel in Remote Location 55 oN 10 11 1 Ed 99 NO
23. in Figure 30 40 Installation Procedures VetPro DC Electrical Verification Calibration Calibration of the VetPro DC Animal Health Dental X ray System is preset at the factory and is not required during initial installation Service replacement of the Power Supply Control Board 30 08160 or the Tubehead may require calibration oee the Calibration section of this manual Verifying Input 1 Before turning on the system verify the input voltage by measuring the Voltage and voltage at LINE and NEUT as shown in Figure 31 The reading should be within the range of 100 250V Turning On the 2 Replace the power line terminal strip cover System 3 Turn on the VetPro DC Animal Health Dental X ray System using the power switch as shown in Figure 32 On the Operator Panel Figure 33 you will see the product display screen showing the software version Then the Operator Panel will display the default technique factors wv N Ves Na YF lm F P Figure 31 Verifying Input Voltage at the Line Input 41 Installation Procedures VetPro DC Ost TTTTTTTTTTT i BARRRARRRRRRRRRRRERRRRARARARRARARRARRRRRE On Off Switch Figure 32 Turning on the Power CT STS BE OPERATED Sy ES OPERATORS INST RIE TA BRON RAYONS X ORERATIC VN Y BRATION SES BOONES AUTORISE Vicus MAN a WO UNIT MAY BE DANGEROUS 7 BIEPACTORE OPERAT ERAS 9 ARE OBSERVED Figure 33 Operator Panel W
24. instructions for the mobile unit The VetPro DC Animal Health Dental X ray System should only be installed and serviced by approved Midmark dealer personnel Contact Midmark Corporation at 800 MIDMARK if you need assistance locating an approved dealer Installation Options VetPro DC CAUTIONS When using lag screws as the method of attachment it is imperative to consider the full scope of the task Several factors must be considered for safe permanent installations Some of the key issues are e Lumber commonly used in construction projects can be different from location to location e The grade age position and overall condition can vary greatly e The attachment stud may have additional hidden loads e The location of the pilot hole with respect to the center of the stud will affect the load bearing ability e The size of the pilot hole required for the lag screw will be different based on the grade age and condition of the lumber e Never over tighten the lag screw as this will weaken the mechanical connection e Lumber with splits or cracks should not be used for attachment e Plywood particle board or similar construction materials should not be used for attachment e Consider lumber dryness or moisture when attaching to exterior framing studs e Midmark mechanical designs will exert up to 920 pounds 418 kilograms of loading on the supporting structure e Midmark provides fasteners for average installations Base
25. kilovoltage kV Approximate mA and kV levels can be observed using the Diagnostic Mode feature of the VetPro DC system If the kV needs calibration follow these steps al Energize the system 2 Press and hold the Tooth Selector switch and the Patient Size Selector switch for five seconds 3 Select the SET CONFIG option You will see the Set Configuration menu Figure 51 4 Press the down arrow to highlight the DIAGNOSTIC MODE ON option and press Enter You will see the Configure Unit menu Figure 50 5 Press the down arrow to highlight the Exit option and press Enter This displays the Menu Option screen Figure 47 6 Press the down arrow to highlight the Exit option and press Enter This returns the display to operational mode 7 Press Enter to select the kV to be adjusted 8 Press Enter to highlight the time to be adjusted 9 Observe normal radiation protection procedures in preparation for the following steps 10 Make an exposure 11 Observe the feedback values To adjust kV 1 Press the Up switch to activate the Adjust feature This displays the Current kV Modulation Level screen 2 Press the Up or Down switch while observing the Counts indicator 3 Adgjust the Counts in small increments 4 Press Enter to exit and return to operational mode 5 Make an exposure and observe the feedback 6 Repeat steps 1 5 until the desired kV level is reached Once completed it is necessary to deactivate the cal
26. the tie block Figure 29 Tying optional sensor cable out of harms way 39 Installation Procedures VetPro DC Connecting 1 Using a 3 mm Allen wrench remove the power line terminal strip cover at the base of the Power Supply Control Board to gain access to the power line terminal strip Line Power ups as shown in Figure 30 2 Attach a flanged spade and connect the hot black wire of the power line to the connection identified as LINE on the power strip 3 Attach a flanged spade and connect the neutral white wire of the line to the connection identified as NEUT on the power strip 4 Attach a flanged spade and connect the ground green wire of the line to the connection identified as GND on the power strip o Leave the power line terminal strip cover off until the following electrical verification procedure is complete Power Line Terminal Strip Cover Figure 30 eee Te Power Line Terminal Strip Cover Connecting During initial powerup and verification the Operator Panel is required Connect the the Operator Panel with the 25 ft 7 62 m interconnect cable Later you will connect the Operator Panel in its final position for use Operator 1 Identify the Operator Panel and the 25 ft 7 62 m interconnect cable Panel with 2 Plug the cable into the left socket at the base of the Operator Panel the 25 ft 3 Plug the other end of the cable into connector J1 on the Power Supply Control Cable Board 30 08160 as shown
27. the yoke collar NOTE Take care not to damage the connector CA y 30 Feed the ground wire through the yoke collar NOTE Take care not to damage the connector 31 Re attach the two ground cables that were removed in Step6 Maintenance VetPro DC Figure 93 Figure 94 Figure 95 98 32 Connect the black and white connectors that were disconnected in Step 5 aps 33 To ensure correct operation and to prevent damage to the yoke cable assembly perform the following steps 33 1 Point the tubehead down 33 2 Check that the large Phillips head screw is at the 9 o clock position and that there is a natural loop in the cable harness Large Phillips head screw at the 9 o clock position There should be a natural loop in the cable harness 34 Mount the yoke cover that was removed in Step 4 p jJ 35 Check to ensure the wires are not binding when you rotate the tubehead completely clockwise or completely counter clockwise The cabling should expand and contract cleanly and evenly without any binding Maintenance VetPro DC 36 Place the cap back on the tubehead Figure 96 3 Proceed with the automated calibration found on page 668 if Logic PCB firmware revision is 5 0 or lower 99 Maintenance VetPro DC Mechanical Adjustments Determining the Necessary Adjustment Tubehead Movement Horizontal Arm Adjustment Figure 97 Tightening the Brake
28. 5 cm add 1 2 5 cm for Two Stud mount note 3 A note 4 184 cm Z Installation Options VetPro DC Figure 6 Retracted Position for a Cabinet Mount 18 45 72cm with Compact Horizontal Arm 14 m 1 27 1 27cm 1 2 Cabinet Outline 1 27cm 82 reach not recommended for cabinet mount 28 71 12cm with Short Horizontal Arm 24 38 96 52cm with Long Horizontal Arm 34 121 92cm 4 2 54cm Installation Options VetPro DC Figure 7 Mobile Unit Extended A ME IDEEN A 56 112 27cm 143 26cm 23 58 42cm 59 149 9cm 57 1 145 03cm 35 9 91 18cm 71 9 182 63cm Installation Options VetPro DC Environmental Factors Use Storage The VetPro DC Animal Health Dental X ray System is intended for indoor use for normal dental applications at temperatures in the range 50 F 95 F 10 35 C and at a maximum altitude of 12 000 ft 3657 m Humidity should not cause condensation to form on the unit Storage temperature should not exceed the range 31 F 150 F 35 C 4 66 C Support Requirements The VetPro DC Animal Health Dental X ray System is designed to mount on a single wood 2x4 inch drywall stud or equivalent wall support It can also be mounted on concrete or other similar wall construction Mounting to a plywood or particle board wall is not acceptable Verifying the wall support capability and
29. ALL IN THE SINGLE STUD CONFIGURATION PLEASE DIRECT ANY QUESTIONS ON THIS MATTER TO MIDMARK TECHNICAL SUPPORT Installation Options VetPro DC Dual Wood Stud Wall Figure 10 Dual Wood Stud Mount 16 When installing the VetPro DC Animal Health Dental X ray System on two 16 inch 40 cm centered wood studs the Control Unit is mounted to a wall plate Two Stud Mounting Kit 30 A2042 which mounts to the wood studs as shown in Figure 10 Fasteners are provided with the wall plate In mounting configurations using the dual stud wall plate there are several holes available for incoming line power This is to provide for various locations of existing power boxes when installing as a replacement unit Refer to the reverse side of the mounting template Figure 8 for hole locations Installation Options VetPro DC Metal Stud Wall Figure 11 Metal Stud Mount 17 When installing the VetPro DC Animal Health Dental X ray System on a metal stud wall the Control Unit is mounted to a wall plate Two Stud Mounting Kit 30 A2042 and uses an additional support plate Metal Stud Support Plate Kit 30 A2043 purchased as an option positioned on the back end of the wall See Figure 11 Fasteners are provided with the wall plate and support plate The wall fabrication and attachments to the building structure must be capable of withstanding a load moment of 850 ft Ibs 118 m kgs If the wall on which the VetPro DC is to be installe
30. After selecting a menu option use the up and down arrows to increase or decrease values MENU OPTIONS P CHANGE PRESETS gt CONFIGURE UNIT Main System b EXIT Configuration Menu Figure 47 62 oystem Configuration VetPro DC Adjusting the Display The VetPro DC Animal Health Dental X ray System allows the operator to adjust the display image 1 From the Main System Configuration menu Figure 47 select ADJUST DISPLAY You will see the Display Options menu shown in Figure 48 2 Selecting EXIT returns the display to the Main System Configuration menu Adjusting 1 Select ADJUST CONTRAST from the menu You will see the Progeny logo Contrast 2 Usethe up and down arrows to increase or decrease the contrast between the menu text and the display background 3 Press the right arrow to save your settings Reversing the 1 Select REVERSE IMAGE from the menu The text and display background Image colors will be swapped 2 Press the right arrow to save your settings DISPLAY OPTIONS REVERSE IMAGE gt EXIT Figure 48 Display Options Menu 63 System Configuration VetPro DC Changing Pre programmed Exposure Settings The VetPro DC Animal Health Dental X ray System allows the operator to increase or decrease image density for all presets for a receptor simultaneously or to change each of the technique factors for a preset individually You can also restore factory default settings For charts of the fac
31. Arm nearest to the Tubehead Position the Articulating Arm with the arm nearest the Tubehead fully upward Insert a 9 23 cm long 8 mm Allen wrench T handle into the adjustment nut as shown in Figure 100 Turning the wrench clockwise will cause the Control Unit side of the Articulating Arm to lift Turning it counterclockwise will cause it to drop Adjust as necessary until the Control Unit side of the Articulating Arm no longer drifts Replace the plastic covers on the end of the Articulating Arm Remove the plastic covers at the top of the Articulating Arm Position the Articulating Arm at a 45 degree angle Place a 9 23 cm long 8 mm Allen wrench T handle into the adjustment nut inside the Articulating Arm as shown in Figure 107 Turning the wrench clockwise will cause the Control Unit side of the Articulating Arm to lift Turning it counterclockwise will cause it to drop Adjust as necessary until the Control Unit side of the Articulating Arm no longer drifts Replace the plastic covers on top of the Articulating Arm Maintenance VetPro DC Articulating Arm Friction Adjustments Figure 102 Friction Adjustments 104 The VetPro DC has four friction adjustment points located at the four pivot points of the Articulating Arm These friction points can be adjusted to reduce or increase the force needed to position the Articulating Arm 1 Remove the plastic covers on the Articulating Arm to reveal the adjustmen
32. D BD on Control Panel VetVision DC eseostoseceost oto DADA DADA A LALA MX 30 08130 Operator Panel PCB 96540920940969429294542 30 P0029 Wall Mount Cradle Maintenance VetPro DC Control Unit 30 F4024 Switch Bracket E1 19026 Rocker Switch 30 08078 VetPro 30 08151 VetPro Complete Power Switch Assy 30 A2049 30 08041 Brake Assy Power PCB EA XM 30 08072 Grey Progeny Inse L Lug 30 08160 Logic PCB H1 63 M09016 47 4 Screws 30 P0016 VetPro 30 P0088 VetPro Complete Wall Mount Cover 30 P0019 Control Insert For VetPro Complete 30 08155 Power Hub Figure 107 Control Unit Assembly 110 Maintenance VetPro DC Hand Switch 30 A2040 Handswitch Assy E1 19003 Replacement Switch for Handswitch Assy 30 P0025 Handswitch Hook Figure 108 E1 13005 dign Coil Cord Switch 111 Specifications VetPro DC Specifications VetPro DC Animal Health Dental X ray System The following specifications contain information required per 21 CFR to be provided to the user Line Voltage Line Load amp Fuse Rating Tube Potential Tube Potential Accuracy Tube Current Tube Current Accuracy Irradiation Time Irradiation Time Accuracy Minimum Source to Skin Distance Minimum Half Value Layer Minimum Inherent Filtration Focal Spot Tube Cooling Time Leakage Technique Factors Target Angle Operating T
33. IM cea test D ate LEA AID IA RI uS D D T LI 12 EXPLANATION OF SYMBOLS ON TECHNICAL LABELS ececeececececcececececeeeececuceeaecececueaeaesesucueaeaeseseeavaeseessanaes 13 OBTAINING TECHNICAESEPPORTs 55 5 cd a a a a Ue ec DL DLL De 13 INSTALLATION OPTION S 1 4 1 1 1 eec nenn nnne n enun unu nunRRRRRRRRRRRRRRRRRR RR RR NR RN NON NR RERORORER ERR ERES 14 MOUNTING SONFIGURATON Sita t tese decimos a te venue fest esatto ao 14 OPERATOR PANEL LOCATIONS xc hesitate docete tatu teca been d ce ra dl sa tad o o Ead seats 19 INSTALLATION PROCEDURES ia 20 PREPARING TO INSTALL THE VETPRO DO ccccsccceccecccecceccceccacccsccacccsccaccesecucecsecacecsccacecsecanecsecaceceecaneseeeas 20 INSTALLING THE CONTROL UNIT ON A SINGLE WOOD STUD WALL cccececcccccececececececececececececececscueueucaeanaeanaeas 22 INSTALLING THE CONTROL UNIT ON A DUAL WOOD STUD WALL ceseesesen eee eene nemen nemore tenere reis 27 INSTALLING THE CONTROL UNIT ON A METAL STUD WALL cccccececeececececeecececuceaececuceeaecececueauauseceeevanaeaeeas 29 INSTALLING VETPRO DC X RAY TO MIDMARK CHASE 8010 amp 801 1 UNIT eeeeeen nnns 31 INSTALLING VETPRO DC X RAY TO MIDMARK CHASE 8010 amp 801 1 UNIT eeeeeern nnns 32 INSTALLING VETPRO DC X RAY TO MIDMARK CHASE 8010 amp 801 1 UNIT coooooncccnnncccccnoncnccnnnnnonononannnonanonnos 33 INSTALLING THE HORIZONTAL ARM AND BRAKE ASSEMBLY
34. TAELING THE 12 INGH BO CMI CONE 930 A2200 5 dct a teskri ia 61 bein Beenljici hggem vts 62 SYSTEM CONFIGURATION MODE ccceccccccccccececececececececececececececececececucucucueueacaeaeaeaeauauaeauavavavavavauauauauaunenensss 62 ADIUSTING THE DISPLAY oscar dali dis 63 CHANGING PRE PROGRAMMED EXPOSURE SETTINGS ccccececececececacacaccccacauacauauauauauauauauaeneneneneneneneneueneneneness 64 SHOWING CURRENT SYSTEM CONFIGURATION ccocccccccccncoconocncococnnn cnn sisse sisse sese sesesesesesesesesese serere rere 65 CHANGING THE GONE SIZE 2 3 eo E ease e E eM LOL EDUC c cO Ee CE 66 BIREKIN EAN S A ute tema M A LLL ML A 67 CABIBRATIO Noreste aia dot dagvuss eu sbo sec auSdus iE vt grasos agua gasusae as de ia 68 TROUBEESHOOTINQG 555 62 tees acetoacetate Du du teu ca eu duce opu blue aca reca iie a d utet que 69 ELECTRICAE PEREORMANGE ISSUES 4 iu o ed a 69 OBTAINING TECHNICAL SUPPORT iota week dese cola so ode otia ee cedo latae ee acer eo ee ah rec 88 MAINTENANCE coso diaria aia did 89 VETPRO DC TUBEHEAD REMOVAL INSTRUCTIONS csscsecceccceccccceccecccuccacecaccacccuccacecsccacecuecaceesecacsaeeeesenseeas 89 PREPROGRAMMED EXPOSURE TIMES cccececcccccccccecececececececececececececececeeecucueneuenenenenenenenenenenenenensneas 105 ARMAND TUBEHEA Di e a e ao rs el a alt et 106 HORIZON TAN 0 ener nee ante oa ROE Or A e a a de fas 107 MOUNTING PAE Siew E ERE 108 COPERATORG ANE nea is ner M LI DEI los a a ee ae etek need dl ei a 109
35. ay into the enclosure and fasten the two pieces at the bottom with the 6 32 x 5 16 inch screw Cut the handset connector from the end of the cable that will connect to switch enclosure 2 and strip about 1 12 inch of the white jacket Strip inch of insulation from each of the conductors Connect the cable conductors to terminal block J1 on the PCB of switch enclosure 2 as shown in Figure 43 the same as the single switch configuration Make sure the two gray wires from the pushbutton switch are connected to terminals 1 and 2 of J2 Screw the inner section of enclosure 2 to the junction box using the two screws provided If the cable is routed on the surface of the wall make sure it sits in the notch on the bottom of the enclosure Confirm that no wires are being pinched between the junction box and the enclosure Hook the outer section of the enclosure onto the inner section at the top Push the wires all the way into the enclosure and fasten the two pieces at the bottom with the 6 32 x 5 16 inch screw Optional Installation Procedures VetPro DC Connecting to a Generic 2 Wire Remote Exposure Switch To use a generic 2 wire switch connect the wires to the terminal block J3 Hemote Exposure Switch Connector on the Power Supply Control Board 30 08160 as shown in Figure 46 ff vA A SENT ppn MEET RE I26 b4se4t IH AG Figure 46 Installing the Remote Exposure Switch Installing the 12 Inch 30 CM Con
36. ccessed by removing the Pivot Cap located at the attachment point of the Tubehead to the Yoke 3 If the cabling is found acceptable select 1 5 seconds of exposure time and placing a DC voltmeter on TP8 or TP10 the Common Return on the Logic Board measure the feedback values at TP4 mA Monitor and TP3 kV Monitor as shown in Figure 65 Look for the following values e P4 mA Monitor This voltage should be between 1 5 and 3 5 volts DC during exposure attempts The voltage should not oscillate between 1 5 and 3 5 instead the measurement should come to a specific value and stabilize Oscillating values or absent values will indicate the need to replace the Tubehead Assembly 4 TP3 kV Monitor This voltage should be between 3 and 4 volts DC during exposure attempts The voltage should not oscillate between 3 and 4 instead the measurement should come to a specific value and stabilize Oscillating values or absent values will indicate the need to replace the Tubehead Assembly If the feedback voltages are present and stable replace the Logic Board 84 Troubleshooting VetPro DC Figure 64 Power Supply Board 30 08041 85 Era E ER _ Orts E m3 d gc Jnd y a AN 4 nm Ue TP5 350 Volts DC Common Return Troubleshooting VetPro DC Incorrect kV 86 At times non invasive measurement of an otherwise fully functional system indicates that kilovoltages may be incorrect Kilovoltage kV
37. chase and use of the coil cord hand switch option 30 A2040 The Operator Panel is mounted on the wall remote from the Control Unit If the Operator Panel is mounted separate from the Control Unit a supplied cable must be run from the Control Panel to the Operator Panel Where local codes require a separate 2x4 junction box should be mounted to the left of the mounting stud above the power supply box Refer to the supplied mounting template for specific location Installation Procedures VetPro DC Installation Procedures Preparing to Install the VetPro DC Check Prior to beginning the installation be sure that all pre installation requirements Pre installation have been completed This includes confirming that the wall support R t requirements are adequate for mounting the unit and that the electrical power SOM menta requirements and wire locations are proper Note Midmark recommends that the VetPro DC Animal Health Dental X ray System be connected to dedicated wiring and permanently grounded The installer must determine the suitability of using a line cord at the time of installation ensuring proper grounding technique Gather Tools Items needed for all types of mounts e Stud finder Bubble level torpedo level Masking or other tape for placing the mounting template on the wall Awl Drill driver and drill bits appropriate to type of wall mounting Metric Allen wrench set English inch Allen wrench set Screwdrivers flat bla
38. d 6 Full fluorescence with light image may require adjustment of the preprogrammed techniques Replace the operator display board Replace the Operator Display Board 30 08054 or the Logic Board 30 081 60 or both Replace the Logic Board 30 08160 Replace the Logic Board 30 08160 Troubleshooting VetPro DC X ray Indicator No Exposure Termination No Radiation Produced Display Shows Error Serial Communications Display Shows Pre termination Error Early Exposure Release Determined Not to be the Cause All X ray Indicators But No Voltage Measured at J1 on the Power Supply Board Very Short Exposures Regardless of Selected Exposure Time 74 3 4 O Check if both audible indicators operate Check the Operator Panel first and check the Logic Board second If only the Operator Panel indicator works check if diode D2 on the Power Supply Board and D11 on the Logic Board illuminate during the exposure request If D2 and D11 do not illuminate this indicates that the X ray backup conductors in the CAT 5 communication cable are open Connect a substitute communication cable to test for this condition If the symptom persists contact Technical Support If the ribbon cable is open between the Logic and Power Supply Boards replace the cable This error can be caused by a high voltage breakdown in the head and is characterized by a snapping or po
39. d does not meet this requirement it must be reinforced In mounting configurations using the dual stud wall plate there are several holes available for incoming line power This is to provide for various locations of existing power boxes when installing as a replacement unit Refer to the mounting template in Figure 8 for hole locations Installation Options VetPro DC Installing The 4x4 Mount kit 30 A2099 shown in Figure 12 contains the items below the 4x4 e Power line bracket Mount e Power cord cover e Left conduit mounting plate e Right conduit mounting plate e 3 Phillips screws e 6nuts Instruction 1 Using the three Phillips screws secure the power line bracket to the power line cord cover S 2 Place the right and left conduit mounting plates on the control 3 Place the assembled power line bracket and cord cover on the two bottom most threaded studs Left Conduit Mounting Plate Right Conduit Mounting Plate Power Line Mounting Bracket Figure 12 d 4x4 Mount 3 Screws Power Cord Cover Cabinet 6 Nuts cansas r Layout TT 18 Installation Options VetPro DC Operator Panel Locations On Control Unit Remote Operator Panel 19 The Operator Panel for the VetPro DC Animal Health Dental X ray System can be installed on the Control Unit or mounted remotely on a wall The Operator Panel snaps on to the front of the Control Unit Installation of the Operator Panel on the Control Unit may require the pur
40. d on specific installation conditions it may be necessary to choose a alternate fastener or fastening methods e fthe surface of the Installation Guide falls below the surface of the wall a correspondingly longer fastener must be chosen e Seek the advice of a professional structural engineer to clarify any issues before the installation e Inspect the attachment method 30 days after the installation and every 6 months thereafter e Lag screws are not intended to be used as an attachment method for metal supports such as those found in center island pass through cabinets Midmark provides machine screws large flat washers and nylock nuts to use when fastening the system to metal supports Installation Options VetPro DC Articulating Arm i Horizontal Arm i Control Unit Remote BOR B SoB 5B BS SS BSSSSSBSSS59855285s955 Control Tubehead Figure 1 Cone Component Diagram Your Responsibilities As An Installer And Service Engineer Verification of machine performance after installation must be performed according to the guidelines identified in the System Function Checklist which may be found in the User Manual or the Installation and Service Manual on page 52 Verification of machine performance after maintenance or repair must be performed according to the guidelines identified in the System Function Checklist and the calibration instructions which may be found in the Installation and Service Manual on page 52 Installa
41. d the Logic Boards If the ribbon cable is acceptable replace the Logic Board MH le TA ETE TE vo pp oor N o FREE iononl SE ET IHAGM GP 23 13 126 5504 lil Troubleshooting VetPro DC LS1 Exposure Enable Relay D2 Exposure n Circuit Enabled ed n OF Figure 63 Power Supply Board 30 08041 83 Troubleshooting VetPro DC High voltage High voltage breakdown is characterized by a loud snap sound during an Breakdown exposure request 1 Onthe Power Supply Board measure the voltage across TP5 the Common Return and TP8 350 volts DC as shown in Figure 64 This voltage will be acceptable if measured between 330 and 390 volts DC Values above or below this number indicate the need to replace the Power Supply Board 2 If the voltage is correct inspect the condition of the cabling between the Power Supply Board Logic Board and Tubehead Assembly CAUTION High voltage present Of particular importance are the conductors held by the black connectors These conductors transmit the feedback values from the Tubehead Assembly and directly affect the control of power to the Tubehead Assembly Connections for this cable begin with controls at J1 of the Power Supply Board and J4 of the Logic Board As shown in Figure 57 an internal set of connections will be accessed below the distal side of the horizontal arm and at the inside top of the Tubehead Yoke The final set of connections is a
42. de and Phillips Torque wrench 0 40 ft lbs 0 5 53 m kgs or equivalent Sockets and ratchet driver appropriate to type of wall mounting Fluke model 73 DVM equivalent or better omall test clips such as Pomona Electronics Minigrabber Test Clip Model 6248 or Radio Shack Mini Hook Adapters catalog 270 334 Items needed only for the metal stud wall mount e 11 inch hole saw Dry wall saw Y inch diameter 12 inch long drill bit Two 4x4 wood studs Drywall screws Installation Time The VetPro DC Animal Health Dental X ray System has been designed to be installed by one person in less than one hour assuming that all pre installation requirements have been met Open the The VetPro DC Animal Health Dental X ray System is shipped in a convenient Shipping Carton two level carton as shown in Figure 13 The first level contains the items needed for the first part of the installation including the Control Unit Operator Panel Horizontal Arm mounting template documentation cables and packets containing the mounting hardware brake assembly plastic covers and additional hardware The Articulating Arm and Tubehead Assembly are in the second level of the shipping carton where they can remain until installation 20 Installation Procedures VetPro DC Figure 13 Two level Carton Packing List 21 Part Number 30 A1028 30 A1041 30 A2123 30 P0029 30 A2046 30 A2156 30 A2077 30 A2040 E1 13052 30 A2219 30 A2071 30 A2073
43. e 30 A2200 The VetPro DC Animal Health Dental X ray System is factory set for use with the standard supplied 8 inch 20 cm Cone The 12 inch 30 cm Cone 30 A2200 is recommended when using parallel film positioning techniques Using the longer cone requires longer exposure times See the System Configuration section of this manual on page 62 or setting the system to use the longer cone 61 oystem Configuration VetPro DC System Configuration System Configuration Mode About System The VetPro DC Animal Health Dental X ray System has a software driven Configuration system configuration mode When the VetPro DC is in system configuration Mode mode you can perform the following procedures e Adjusting the Display Changing the Pre programmed Exposure Settings Change the Cone Size Showing the Current System Configuration Display Diagnostic Data Using System 1 To enter system configuration mode press the Tooth Selection and Patient Configuration Size Selection buttons on the Operator Panel simultaneously for 5 seconds Mod The display shows the Main System Configuration menu as shown in 90E Figure 47 and the Ready Indicator blinks 2 To select menu items while in system configuration mode use the up and down arrows to highlight a menu option Then use the right arrow button as an Enter button to select the highlighted option When changing presets the right arrow button is also used to select the technique factor 3
44. e and loosely tighten Be sure that the power wire extends through the opening in the wall plate Level the wall plate Tighten the lag screws to 14 18 ft lbs 2 0 to 2 5 m kgs CAUTION Do not over tighten the lag screws Over tightening the lag screws will damage the wooden stud and reduce the holding force Installation Procedures VetPro DC Figure 16 Mounting Plate for Dual Stud Wall Mounts Remove Control Unit Front Cover Mount the Control Unit 28 P509 MN Open the shipping carton and locate the Control Unit in the first level of the carton Remove the Phillips screw from the front cover of the Control Unit Carefully remove the front cover Place the front cover and the screw in a safe location for later reassembly Select the 5 16 18 x 7 8 long socket cap screws H1 15 S23088 01 and washers H1 NA S12000 01 Put the one screw and washer through the upper mounting hole of the Control Unit Place the Control Unit on the wall and loosely tighten the upper screw Put the other screw and washer through the lower mounting hole of the Control Unit and loosely tighten Be sure that the power wire extends through the opening at the bottom of the Control Unit Place a level on the Control Unit bearing parallel to the wall Level the Control Unit Tighten the upper and lower screws After the VetPro DC is installed slide covers on the wall plate and fasten with the provided 8 screws H1 64 S17050 01
45. e right plug socket Carefully dress the two cables back into the wall Snap the Operator Panel into place on the wall mounting plate Mount the bracket for the coil cord hand switch in a convenient location Stow the coil cord hand switch Optional Installation Procedures VetPro DC Installing the Remote Exposure Station 30 A2044 The Remote Exposure Station is an option for the VetPro DC that allows the operator to make the exposure from a fixed location remote from the main unit As shown in Figure 42 a single switch can be used or two switches can be used in series or in parallel Two switches in series will require both switches to be pressed simultaneously to make an exposure If two switches are used in parallel only one needs to be pressed to make an exposure Tools The following tools are required to install the switch e Phillips screwdriver e Flat blade screwdriver e Telephone cable stripper for dual switch configuration only e Wire stripper for dual switch configuration only 56 Optional Installation Procedures VetPro DC VetPro DC VetPro DC Remote Remote Exposure Exposure Switch 1 Switch 2 Figure 42 Remote Switch Configurations 57 Optional Installation Procedures VetPro DC Installing the Single Switch Figure 43 Single Switch Configuration 58 1 Route the cable for the Remote Exposure Switch from the VetPro DC mounting location to the Remote Exposure Switch mounting locatio
46. e the articulated arm to the post QTY 2 This allows the articulating arm to be inserted completely into post FIGURE 120 118 Appendix A VetPro DC 10 Locate the Articulated Arm Tubehead assembly Remove the red transportation label Pull back the plastic packaging to expose shaft and remove paper tube protecting cables and connectors 11 Lift the arm tubehead carefully and guide the cables through the top off the post Carefully insert the articulated arm and take care not to pinch or damage the connectors FIGURE 121 12 Secure the articulated arm assembly to the post with the two Allen bolts that were backed out in step 9 FIGURE 122 13 Locate and install the articulating arm brake assembly Install and adjust by tightening to the point where the articulating arm does not drift when you lightly push the arm FIGURE 123 FIGURE 124 119 Appendix A VetPro DC 14 Pry apart the Isolator containing the connectors for the cables Connect the power cables white connectors FIGURE 125 FIGURE 126 15 Connect the feedback cables black connectors Insert cables into the Isolator one on each side of the divider and snap shut FIGURE 127 FIGURE 128 16 If the unit is a VetPro Complete Sensor ready connect the USB cables Insert cables into the post FIGURE 129 FIGURE 130 120 Appendix A VetPro DC 17 Install the cover plate FIGURE 131 18 Remove the screw that locks down the Logic
47. e voltages are not present after power is applied next check voltages on the Power Supply Board 6 Onthe Power Supply Board use TP2 as a common test point and check TP1 24 volts DC and TP3 8 1 volts DC as shown in Figure 52 Then use TP5 as the common return to check TP4 for the presence of 12 volts DC Should any of these voltages not be present replace the Power Supply Board If each voltage is present inspect the condition of the ribbon cable between the Power Supply Board and the Logic Board If the cable is undamaged and seated properly replace the Logic Board 7 Ifthe power supply voltages are present and the ribbon cable and communication cable are found acceptable open the Operator Panel case and measure for the presence of 5 volts DC across TP1 and TP4 of the Operator Panel Board as shown in Figure 54 Absence of this voltage indicates the need to reconfirm the power supply voltages and communication cable Presence of the voltage requires the replacement of the Operator Panel Board Troubleshooting VetPro DC Figure 52 Power Supply Board 30 08041 71 TP1 24Volts DC TP2 8 1 and 24 ar Volts DC rro 9 1 Volts nc MEE JEJE Eme m TP5 12 Volts DC Common Troubleshooting VetPro DC Figure 53 Logic Board 30 08160 Figure 54 Operator Panel Board 30 08054 12 Use TP8 or TP10 for Common Return when measuring DC voltages SPREE EEE ERP RRR eee WA uen TPO 24V DC 3 ex EDO k a
48. eedback values after each exposure After an 1 From the Main System Configuration menu Figure 47 select CONFIGURE Exposure UNIT You will see the Configuration menu shown in Figure 50 2 Select SET CONFIG You will see the Set Configuration menu shown in Figure 51 3 From the Set Configuration menu use the up and down arrows to highlight DIAG MODE ON Press the right arrow button to turn on diagnostic mode 4 Exit System Configuration mode by highlighting and selecting EXIT in the Configuration and Main menus 5 Make an exposure The display will show the following feedback values e kV e mA e Filament current 6 Press any button on the Operator Panel to clear the feedback values from the display 7 To exit diagnostic mode press the Tooth Selection and Patient Size Selection buttons simultaneously for 5 seconds to display the Main System Configuration menu From the Main menu highlight and select CONFIGURE UNIT Then highlight and select SET CONFIG On the Set Configuration menu highlight and select DIAG MODE OFF Note Feedback values are approximate 67 Calibration VetPro DC Calibration Calibrating kV Adjusting kV during Calibration Deactivating the Calibration Session 68 Devices with firmware revision of 5 0 and below will require calibration of the tube current Please contact Midmark at the number listed in the manual for calibration instructions Occasionally it may be necessary to calibrate
49. emperature Storage Temperature Maximum Altitude Cone Focal Length X ray Beam Dimension 112 AC 100 V to 250 V 50 Hz or 60 Hz maximum 5 A 250 V UL Recognized 60 kV 65 kV or 70 kV 5 of selected value 4 mA to 7 mA 1 mA 20 ms through 2 s 1 ms 596 of indicated value 8 inch 20 cm 12 inch 30 cm 1 7 mm Al equivalent at 70 kV 2 mm Al equivalent Q 70 kV 0 4 mm per IEC 60336 Automatic wait time is 15x the exposure time 70 kV and 0 4 mA 12 5 degrees 50 F to 95 F 10 C to 35 C 31 F to 150 F 35 C to 66 C 12 000 ft 3 657 m 8 inch 20 cm for bisecting angle technique 12 inch 80 cm for paralleling technique Diameter of 2 72 inches 6 9 cm at the end of the 7 inch Cone Cones with smaller diameter or rectangular beams are available Specifications VetPro DC 0 50 100 150 200 250 300 TIME s Focal spot 0 4mm HHH A H a E IEEE Toshiba Tube Rating 0 1 10 Charts Tube Current mA Time s 113 Specifications VetPro DC Figure 110 Kailong Tube Rating Charts 114 _ O NG adn sn woo E 50 100 150 200 Thermal Characteristics Chart 200 300 5 Appendix A VetPro DC Appendix A Assembly Instructions for DC Mobile Unit Tools Required 3 8 square drive hex key 10 mm 3 8 square drive hex key x 6 inch extension 3 8 square drive ratchet No 1 Phillips screwdriver mm nut driver oma
50. f the Tubehead Assembly Absence of 130 volts AC will require re inspection of the interconnect cables for open conductors Troubleshooting VetPro DC LIE Se dVoltsDe TP2 8 1 and 24 e Volts DC A EME Common Return TP3 8 1 Volts DC o LLL LO SRP TP SP VOHs DC BR Ro o ce NND DC Common D11 350 Volts DC Figure 55 Power Supply Board 30 08041 76 Troubleshooting VetPro DC Use TP8 or TP10 for Common Return when measuring DC voltages TP9 24V DC TP6 kV Program TP1 8 1V DC Figure 56 Logic Board 30 08160 J1 Primary Power da on 30 08041 AR J4 Filament Drive and Feedbacks on 30 08043 J7 White Connector j J5 Black Connector Figure 57 Interconnect Cable Locations 1 Troubleshooting VetPro DC No mA Produced Figure 58 Logic Board 30 08160 78 TP9 24V DC BEB BRB RRB RRR eee A On the Logic Board measure voltages at TP1 8 1V and TP9 24V Use TP8 or TP10 as Common Return If any of these voltages are not present after power is applied next check voltages on the Power Supply Board On the Power Supply Board use TP2 as a common test point to check TP1 24 volts DC and TP3 8 1 volts DC Then use TP5 as the common return to check TP4 for the presence of 12 volts DC as shown in Figure 59 Should any of these voltages not be present replace the Power Supply Board If these voltages are correct next check voltages on the Logic Board On the Logic Boa
51. he sheet metal stud wall must be secure to hold a load of 850 ft Ibs 118 kg m Assembling and In the metal wall stud installation the Control Unit is bolted to a wall plate Figure Mounting the 16 that has been installed to the support plate shown in Figure 1 7 The wall and S rt Plat support plates are shipped in separate cartons from the VetPro DC uppo aue 1 Putthe small then the larger washers and nut on each of the four carriage 30 A2043 bolts 2 Insert the carriage bolts into the support plate holes 3 Screw the threaded standoffs onto the carriage bolts with the slotted ends away from the back plate 4 Place the plastic sleeve bearings in the slotted ends of the carriage bolts 5 Using a 5 32 Allen key insert a set screw into each threaded standoff Screw the set screw until just below the slot in the threaded standoff but do not tighten 6 Using two sheet metal screws mount and level the support plate through the pilot holes on the back side of the wall Tighten the sheet metal screws with the screw driver 7 On the front side of the wall using a straight blade screw driver adjust the threaded standoffs until the plastic part is flush with the drywall 8 Tighten the set screws in the threaded standoffs to lock them in place 29 Installation Procedures VetPro DC Figure 17 Support Plate for Metal Stud Wall Mount Install the Wall Plate 30 A2042 Remove Control Unit Front Cover Mount the C
52. i ERR o AAA 5 99 8 P S PES RBS B RS B8 PPPS 55559955 amp Screws Installation Procedures VetPro DC Connecting the Cables Connecting 1 Connect the two Articulating Arm cables to the Horizontal Arm cables as shown in the Figure 26 and Figure 27 Once the connections are made dress the cables and push them into the opening in the Horizontal Arm Articulating and Horizontal Arm Cables Figure 26 Connecting the Articulating Arm and Horizontal Arm Cables Figure 27 Connecting optional Integrated Sensor Cable 38 Installation Procedures VetPro DC Connectin me _ CAUTION Horizontal Verify that line power is disconnected before proceeding Arm Cables 1 Attach the black connector from the Horizontal Arm to point J4 of the Power to the Supply Control Board 30 08160 as shown in Figure 28 Power Note The plug must be properly oriented Be sure that the tabs on the connector Supply are down Board 2 Attach the white connector from the Horizontal Arm to point J1 on the Power Supply Board 30 08041 as shown in Figure 28 Note The plug must be properly oriented Be sure that the tabs on the connector are down Figure 28 Connecting the Horizontal Arm Cables to the Circuit Boards Optional 1 Optional integrated sensor cable Tie wrap the USB cable to the tie block Integrated provided as shown in Figure 29 Sensor Attach provided tie block here loop and tie the cable to
53. ibration session 1 Press and hold the Tooth Selector switch and the Patient Size Selector Do switch for five seconds You will see the Menu Options screen Figure 47 Press the down arrow to highlight the CONFIGURE UNIT option and press Enter This displays the Configure Unit menu Figure 50 Press the down arrow to highlight the Set Configuration option and press Enter You will see the Set Configuration menu Figure 51 Press the down arrow to highlight the Diagnostic Mode Off option and press Enter This displays the Configure Unit screen Press the down arrow to highlight the Exit option and press Enter This displays the Menu Option screen Press the down arrow to highlight the Exit option and press Enter This returns the system to operational mode Troubleshooting VetPro DC Troubleshooting Electrical Performance Issues Contact Support General Information 69 Questions should be directed to Midmark Technical Support Phone 800 MIDMARK Fax 847 415 9801 imagingtechsupport midmark com Test Equipment Electrical measurements require specific meter test probes Use small test clips such as Pomona Electronics Minigrabber Test Clip Model 6248 or Radio Shack Mini Hook Adapters catalog 270 334 or the equivalent Replacement Parts e Kit Power Supply Board 30 A2155 e Logic Board 30 08160 e Operator Panel Board 30 08054 e 25 foot Communication Cable E1 13003 e 6 inch Communication Cable E1 13004 e Rocke
54. igure 36 Placing the Cover on the Control Unit 45 Connect the short cable at point J1 on the Power Supply Control Board 30 08160 Feed the cable through the front cover of the Control Unit Place the top of the front cover on the Control Unit and pop the bottom of the cover into place as shown in Figure 36 being careful of the power switch and cover alignment Replace the screw on the front cover of the Control Unit Plug the cable into the bottom of the Operator Panel Snap the Operator Panel into place on the front cover of the Control Unit as shown in Figure 37 Installation Procedures VetPro DC Figure 37 Snapping in the Operator Panel 46 Installation Procedures VetPro DC Remote Operator Panel 47 In the remote location the Operator Panel snaps to the Operator Panel mounting cradle which is first mounted on the wall 1 10 11 12 13 14 15 Place and level the mounting template 30 S0003 shown in Figure 8 at eye level in the location where the Operator Panel is to be installed Tape the mounting template to the wall Using an awl or other sharp object punch through the mounting template to mark the location for the bolts for the Operator Panel mounting cradle Drill pilot holes at marked locations With a drywall knife cut an opening as shown on the mounting template Remove the mounting template from the wall Using the anchors and screws from the mounting hardware packe
55. ing the Control Unit on a Dual Wood Stud Wall Mark and Drill The mounting template 30 S0003 is a guide for locating where to drill the holes Wall Plate used to mount the wall plate to the wall Carefully placing the mounting template Mounting Holes for two stud mount installations on the wall will help ensure correct installation of the mounting plate and hence the Control Unit 1 Using a stud finder locate the center of the studs on which the wall plate will be mounted 2 Place the mounting template for the two stud mount on the wall with the lower mounting holes 40 inches 101 5 cm above the floor 3 Placea level parallel to the vertical lines on the mounting template and adjust the mounting template until it is plumb 4 Tape the mounting template to the wall o Using an awl or other sharp object punch through the mounting template to mark the location of the mounting holes 6 Drill 5 32 pilot holes for common pine studs at the marked locations 7 Remove the mounting template from the wall and save for future use Install the Wall In the dual wood wall stud installation the Control Unit is bolted to a wall plate Plate 30 A2042 that has been installed on two wood studs The wall plate shown in Figure 16 is packaged separately from the VetPro DC 1 2 21 Select the 3 8 x 3 long lag screws 30 H0006 and washers 30 H0008 Put the lag screws and washers through the mounting holes on the wall plat
56. ional Adjustments 44 1 Locate the brake assembly at the top of the Control Unit The brake assembly has a screw on either side of a clamping bar over the Horizontal Arm pivot post 2 Using a 4 mm Allen wrench as shown in Figure 35 tighten the screws equally to apply adequate braking to the pivot post so that Horizontal Arm begins to move after the Articulating Arm The balance and friction of the Articulating Arm are preset at the factory During the installation process check the balance and friction When moving the Tubehead the Articulating Arm should be steady in all positions and move before the Horizontal Arm If adjustments are necessary follow the adjustment procedures in the Troubleshooting section on page 69 of this manual Note The mechanical adjustments should not be used to compensate for a system that is not properly leveled on the wall Installation Procedures VetPro DC Installing the Control Unit Front Cover and the Operator Panel The Operator Panel can be installed on the Control Unit or remote from the Control Unit Installation of the Operator Panel on the Control Unit may require the purchase and use of the coil cord hand switch option 30 A2040 Important Note In order to comply with the regulations and proper X ray practices the Operator Panel must be located where the operator can view both the patient and the technique factors prior to the exposure On the Control js Unit 2 3 4 5 6 F
57. ke Assy e 30 A2083 Yoke Assy Gray 30 P0034 Gray Male Cover Handle 30 08071 Z Oo Yoke Cable Assy 30 F0003 G lt Friction Washer 30 P0042 E 30 P0048 Harness Clamp 30 M0017 Friction Nut Yoke Cap Preva Maintenance VetPro DC Horizontal Arm Figure 104 Horizontal Arm Art Arm Brake 30 A2068 107 30 A2074 VetPro 30 A2210 VetPro Complete Extension Arm Assy Compact 30 A2073 VetPro 30 A2211 VetPro Complete Extension Arm Assy Short 30 A2071 VetPro 30 A2212 VetPro Complete E anon Arm heey l 30 A2164 VetPro Long 30 A2213 VetPro Complete Extension Arm Assy 30 08069 Extra Long Extension Arm Cable 3008067 6 3 2 z B caia LA 30 08142 eene a Arm Cable p u a Extension Long 5 e T Arm Cable 7 30 P0032 Gray Extension Arm l h End Cap H1 63 M09008 17 C Mounting S over Vioaunmimg screws H1 63 N 08 17 30 P0017 Gray 30 A2068 Cover Mounting Screws Access Cover Articulated Arm Brake 30 A2068 Articulated Arm Brake Maintenance VetPro DC Mounting Plates 30 A2042 30 A2043 Two Stud Metal Stud Mounting Plate Support Plate Figure 105 Mounting Plates 108 Maintenance VetPro DC Operator Panel Figure 106 Operator Panel Cables Cat 5 50ft E1 13034 Cat 5 2bft E1 13003 Cat 5 6 inch E1 13004 Exposure Cord Pigtail 30 08035 109 SCR SOHC ER ERE
58. l tubehead to the new tubehead The friction ring will either be on the shaft of the original tubehead or in the yoke assembly d Friction Ring 19 Feed the connectors and ground wires of the pre assembled yoke cable assembly through the opening of the yoke collar Maintenance VetPro DC Figure 84 Figure 85 Figure 86 95 20 Insert the tubehead into the yoke collar 21 Feed the connectors and ground wire of the yoke cable through the first spanner nut 22 Manually thread the spanner nut on the tubehead shaft Insert a small screwdriver into one of the alignment holes to finish tightening the spanner ring Maintenance 23 Feed the connectors and ground wire of the yoke cable through the spanner wrench 24 Align the three pins on the spanner wrench with the three holes in the VetPro DC Figure 87 Figure 88 25 26 2f 28 Figure 89 96 spanner nut NOTE Take care not to pinch or cut any of the yoke cable assembly wires Doing so will cause intermittent exposure or no exposures Alignment holes Tighten the spanner nut Carefully remove the spanner wrench NOTE Take care not to damage the connectors Repeat steps 21 through 26 for the second spanner nut Feed the black connector through the yoke collar NOTE Take care not to damage the connector Maintenance VetPro DC Figure 90 Figure 91 Figure 92 97 29 Feed the white connector through
59. ll flat blade screwdriver 4 mm hex key o mm hex key 1 Open the box from the top side FIGURE 111 2 Remove all transportation screws from the base of the crate Qty 10 FIGURE 112 115 Appendix A VetPro DC 3 Lift the shipping box and separate from the crate There are two layers of parts Separate the top layer and place on the floor or remove each piece individually NOTE This is a two person job Take extra care when handling the articulating arm assembly to avoid any damage to the tubehead FIGURE 113 4 Cut the transportation band from the lower layer that holds the mobile base FIGURE 114 116 Appendix A VetPro DC 5 Remove top cover of control unit by removing screws located at the base of the cover FIGURE 115 6 Separate the mobile unit base from the pallet CAUTION This should be done taking proper lifting precautions The base is heavy and requires two people to lift p per Sa E tea On y FIGURE 116 117 Appendix A VetPro DC 7 Locate the mobile unit post located in the top layer of parts removed in step 3 and insert into the mobile base as shown NOTE Take care not to pinch the Cat 5 cable or the tubehead connectors FIGURE 117 8 Inthe Kit Mobile Stand package Part 30 A2098 Locate and insert the bolt used to secure the post to the mobile base Requires 10mm Allen wrench FIGURE 118 FIGURE 119 9 Back out the Allen bolts used to secur
60. m oo os E LZ A gt TP ao 2 m Ba D o 9 07b 9 Y Hiis a x x ma En X gt La U N 3 gt U o io 9 3 o a BER BBR RRR RRR Ree eee IHAGRUGS 23 13 126 5404 10 gt i Eh Se ie j C pa LED SOU Cu Ja USE POR Troubleshooting VetPro DC TP9 24Volts DC o E kx EA GLDNCC Common Reurn TP3 8 1 Volts DC As CIIU SAA ER X MW TP5 12 Volts TP4 12 Volts DC eee EE DC Common Figure 59 Power Supply Board 30 08041 19 Troubleshooting VetPro DC No 1 Filament Produced Figure 60 Logic Board 30 08160 80 1 On the Logic Board measure voltages at TP1 8 1V and TP9 24V Use TP8 or TP10 as Common Return If any of these voltages are not present after power is applied next check voltages on the Power Supply Board 2 Onthe Power Supply Board Figure 61 use TP2 as a common test point to check TP1 24 volts DC and TP3 8 1 volts DC Then use TP5 as the common return to check TP4 for the presence of 12 volts DC as shown in Figure 60 Should any of these voltages not be present replace the Power Supply Board Use TP8 or TP10 for Common Return when measuring DC voltages d BEEBE EEE NANA AAA OA a TP9 24V DC f OEI ope Y5 4c130d TP1 48 1V DC BEB BBB RRR Rees FERE syyt iki kt EIIIITU TM Troubleshooting VetPro DC DIET SONS DE TP2 8 1 and 24 E Volt
61. m Cone White 30 A2222 Modular BLD 30 cm Lg 35x45 mm Cone Gray 30 A2223 Modular BLD 30 cm Lg 35x45 mm Cone White 30 A2224 Modular BLD Base Gray 30 A2205 Modular BLD Spacer Gray 30 A2206 Modular BLD Spacer White 30 A2208 10 Installation Options VetPro DC EC Declaration of Conformity Name and VetPro DC Product Sistem each Contr fam Product System eac ontro rm P7018V P 82 208 cm 30 A0019 30 A2164 P7017V P 76 208 cm 30 A0019 30 A2071 P7016V P 66 208 cm 30 A0019 30 A2073 P7015V P 56 208 cm 30 A0019 P7017VM 30 A0018 VetPro Complete 30 A2074 pove cam si s2orss emposom povr cam si s2orss reposo 0 80A 11 00ADPI0 DCV6 G2A S1 S2 or SB DCV5 G2A S1 S2 or SB 66 208 cm 56 208 cm 30 A2213 30 A2212 DOVS G2A 81 82 StL or S24 Mobie Reference The following regulatory documents apply Numbers to UL 60601 1 which EN 60601 1 Conformity is EN 60601 1 2 Declared IEC 60601 1 3 IEC 60601 2 7 IEC 60601 2 28 Contact Technical Support imagingtechsupport midmark com Authorized Representatives North America Midmark Corporation 675 Heathrow Dr Lincolnshire Illinois 60069 U S A Phone 800 MIDMARK Fax 847 415 9801 Europe CE Partner 4U Esdoornlaan 13 3951DB Maarn The Netherlands www cepartner4u eu 11 IEC 60601 2 32 EC Annex I EN 55011 IEC 801 2 IEC1000 4 2 IEC 801 3 IEC1000 4 3 IEC 801 4 IEC1000 4 4
62. must be securely fastened before attaching the VetPro DC X ray The Midmark Chase Unit and mounting hardware for the VetPro DC X ray must withstand a 100 Ib 45 36 kg shear load and a 400 Ib 182 kg withdrawal force at each of the mounting bolts The Chase Unit fabrication and attachments to the building structure must be capable of withstanding a load moment of 850 ft Ibs 118 kg m Note The Chase Unit must be properly leveled and fastened to prevent drifting of the VetPro DC X ray Articulating Arm and Tubehead Review the following VetPro DC X ray Installation and Service Manual Procedures before continuing Installation Options Installation Procedures Checking System Functions Optional Installation Procedures Figure 18 Control Unit Two Stud Mount Using the Midmark Chase Installation Manual 003 2443 00 locate the six predrilled mounting holes in the sheet metal inner frame assembly of the Chase Unit These predrilled mounting holes can be found on both the fixed and removable sides of the Chase Unit Once the predrilled mounting holes have been determined use a 13 32 drill bit to finish drilling the mounting hole through the wooden panel of the Chase Unit Equipment Alert Keep hands clear from front Wooden panels while drilling mounting holes or serious injury could occur Included with the Midmark Chase is a Hardware Mounting Mounting Hardware is Kit specific for mounting the Two Stud Wall Plate PN 30 P
63. n This can be done through conduit or on the wall surface For either method a 2 x 4 junction box should exist where the Remote Exposure Switch is to be mounted Thread the cable end with the handset connector through the opening in the wall mount cover from the inside and connect it to the Operator Panel If the cable is routed on the surface of the wall it should enter the wall mount cover through the notch on the left of the power switch Connect the cable conductors on the opposite end of the cable to terminal block J1 on the PCB in the switch enclosure as shown in Figure 43 Make sure the two gray wires from the pushbutton switch are connected to terminals 1 and 2 of J2 Screw the inner section of the enclosure to the junction box using the two screws provided If the cable is routed on the surface of the wall make sure it sits in the notch on the bottom of the enclosure Confirm that no wires are being pinched between the junction box and the enclosure Hook the outer section of the enclosure and fasten the two pieces at the bottom with the 6 32 x 5 16 screw Optional Installation Procedures VetPro DC Installing the Dual Note This configuration uses two cables One connects the VetPro DC to the Switch first switch and the other connects the first switch to the second switch 1 2 3 Figure 44 Parallel Switch Configuration 59 Route one cable from the VetPro DC to the first switch location eithe
64. ncolnshire IL 60069 Phone 800 MIDMARK Fax 847 415 9801 Maintenance VetPro DC Maintenance VetPro DC Tubehead Removal Instructions Overview Tubeheads are shipped with the yoke cable assembly already premounted to the tubehead This guide provides instructions for the installation technician on how to remove the original head install the replacement tubehead and how to calibrate the replacement tubehead CAUTION DO NOT REMOVE THE TUBEHEAD UNTIL THE ARTICULATING ARM ASSEMBLY HAS BEEN SECURED WITH THE PROVIDED CABLE TIE AND FOAM INSERT THE SPRING TENSION IS ADJUSTED TO ACCOUNT FOR THE WEIGHT OF THE TUBEHEAD THE ARTICUTING ARM WILL SPRING OPEN IF IT IS NOT SECURED AND CAN CAUSE SERIOUS INJURY Models Affected All VetPro DCs Required tools Spanner wrench 30 T0055 Needle nose pliers Metric Allen wrenches 2 Phillips head screw driver 1 Small Phillips head screw driver Fluorescent screen 22 11467 Instructions 1 The replacement head as received will have the yoke cable assembly pre attached NOTE Do not remove the yoke cable from the tubehead Figure 66 2 Remove the cone from the head being replaced The cone sits in the tubehead Grab the cone firmly pull and twist out in the same motion Figure 67 89 Maintenance VetPro DC Figure 68 Figure 69 Figure 70 Figure 71 90 3 Install the cone in the replacement tubehead 4 Remove the two Allen head screws from the yoke and remove the
65. nded to be a positive means of locating the center of a 2x4 wooden stud The Installation Guide is a necessary part of the installation and must be used whenever single stud installations are performed The Installation Guide is equipped with side tabs which can be removed if placement of the Guide is obstructed by an electrical box During installations which include attachment to a 4x4 wooden stud all of the tabs on one side of the guide can be removed in order to facilitate adequate placement and attachment 1 Locate the wooden stud 2 Make a small opening in the wall to positively identify the position of the wooden stud Installation Procedures VetPro DC 3 Draw an outline of the installation guide on the wall ensuring that the vertical height matches the requirements set forth on the Wall Mount Template 30 S0003 Open the wall so that the installation guide will rest directly on the wooden stud 4 Place the installation guide on the wooden stud If the surface of the Installation Guide falls below the surface wall a correspondingly longer fastener must be chosen 23 Installation Procedures VetPro DC 5 Drill two 5 32 inch diameter holes using the installation guide as a drill template 6 Attach the wall mounted control leaving the installation guide in place 24 Installation Procedures VetPro DC Remove Control Unit Front Cover Mount and Level the Control Unit 25 2
66. ntal Arm Figure 98 tighten or loosen screws as necessary to get proper movement without unwanted horizontal movement of the Articulating Arm Brake Assembly CAUTION Do not attempt to adjust any other screws in the Horizontal Arm i Articulating Arm Brake amp Screws Figure 98 Adjusting the Articulating Arm Brake Assembly 101 Maintenance VetPro DC Adjusting the Articulating Arm Figure 99 Adjusting the Articulating Arm 102 Follow this procedure ONLY if the yoke assembly does not stop on its own and makes contact with the horizontal arm Refer to Figure 99 while following the procedures below 1 Loosen the two set screws highlighted in Figure 99 but do not remove them completely 2 Loosen the two straight slotted screws highlighted in Figure 99 the figure shows only one of the two screws the other is located on the opposite side of the arm but do not remove them completely 3 Move the articulating arm into the position where you want it to stop before it makes contact with the horizontal arm 4 Tighten the two straight slotted screws 5 Tighten the two set screws Maintenance VetPro DC Outside Articulating Arm Vertical Movement Figure 100 Adjusting Vertical Movement of the Articulating Arm Control Unit Side of Articulating Arm Balance Adjustment Figure 101 Adjusting Articulating Arm Balance 103 gom Remove the plastic trim covers from the end of the Articulating
67. ntal X ray System the resistance of the power line should not exceed 0 4 O at nominal line voltage Installation Options VetPro DC Compliance with Applicable Standards Radiation The certified components of the VetPro DC Animal Health Dental X ray System Protection comply with Radiation Performance Standards 21 CFR Subchapter J at the time of manufacture The certified components of the VetPro DC Animal Health Dental X ray System comply with IEC 60601 1 3 Radiation protection X ray equipment UL 2601 1 File Classified by Underwriters Laboratories Inc with respect to electrical shock fire Number and mechanical hazards only in accordance with UL 2601 1 and CAN CSA E181750 C22 2 NO 601 1 M90 and to the following particular standards IEC60601 2 7 IEC60601 2 28 EMI EMC IEC60601 1 2 Certified Components System Component Reference Number Tubehead 30 A1027 Control Unit VetPro DC Mobile 30 A0018 Control Unit VetPro DC 30 A0019 Modular BLD 20 cm Lg 70 mm Cone Gray 30 A2195 Modular BLD 30 cm Lg 70 mm Cone Gray 30 A2200 Modular BLD 20 cm Lg 60 mm Cone White 30 A2196 Modular BLD 30 cm Lg 60 mm Cone White 30 A2201 Modular BLD 30 cm Lg 60 mm Cone White 30 A2229 Modular BLD 20 cm Lg 30x40 mm Cone White 30 A2198 Modular BLD 30 cm Lg 30x40 mm Cone White 30 A2203 Modular BLD 20 cm Lg 20x30 mm Cone White 30 A2199 Modular BLD 20 cm Lg 35x45 mm Cone Gray 30 A2221 Modular BLD 20 cm Lg 35x45 m
68. o select the exposure setting to adjust Then use the up and down arrow buttons to adjust the value To save new presets use the System Configuration mode described on page 62 in this manual The Exposure button is used to initiate an X ray exposure For a complete exposure the button must be pressed and held until the Radiation Indicator no longer illuminates and the audible signal is no longer heard Releasing the Exposure button immediately terminates the X ray exposure Checking System Functions VetPro DC Checking System Functions The following checks must be performed to complete the installation of the VetPro DC Animal Health Dental X ray System and as part of the recommended maintenance as indicated in the User Manual Failure to perform these checks may result in an installation that does not comply with U S Radiation Performance Standards 21 CFR Subchapter J CAUTION If the VetPro DC Animal Health Dental X ray System does not perform the functions below advise the owner that the system is not to be used See the Troubleshooting section of this manual on page 69 or contact Midmark s Technical Support o1 Checking System Functions VetPro DC System Function Checklist Wall Mounting Labels Tubehead Tubehead Rotation Suspension Power Switch Operator Panel Controls Exposure Button Exposure Indicators Premature Termination Coil cord Hand Switch Option User Information
69. ontrol Unit 30 N eo Select the 5 16 18 x 1 long hex bolts H1 00 S23100 01 Put the hex bolts through the mounting holes on the wall plate and loosely tighten Be sure that the power wire extends through the opening in the wall plate Level the wall plate Tighten the hex bolts Open the shipping carton and locate the Control Unit in the first level of the carton Remove the socket flathead screw from the front cover of the Control Unit Carefully remove the front cover Place the front cover and the screw in a safe location for later reassembly Select the 5 16 18 x 7 8 long socket cap screws H1 15 S23088 01 and washers H1 NA S12000 01 Put the one screw and washer through the upper mounting hole of the Control Unit Place the Control Unit on the wall and loosely tighten the upper screw Put the other screw and washer through the lower mounting hole of the Control Unit and loosely tighten Be sure that the power wire extends through the opening at the bottom of the Control Unit Place a level on the Control Unit bearing parallel to the wall Level the Control Unit Tighten the upper and lower screws After the VetPro DC is installed slide covers on the wall plate and fasten with the provided 8 screws H1 64 S17050 01 Installation Procedures VetPro DC Installing VetPro DC X ray to Midmark Chase 8010 amp 8011 Unit All support adjusting and mounting bolts of the Midmark Chase Unit
70. or is extinguished and the audible signal is no longer heard Make several exposures and verify that the Radiation Indicator illuminates and the audible signal is heard Select the longest exposure time possible using the up and down arrows Initiate an exposure but release the Exposure button after a brief period of time before the timer terminates the exposure Verify that the display indicates Pre termination Error and returns to normal operating mode If a coil cord hand switch is used inspect the switch housing and coil cord for damage or wear Replace if evidence of damage is present Make certain that the user of the system has received the User Manual Checking System Functions VetPro DC Tube Seasoning Procedure Note Do not use this procedure immediately after Tubehead replacement Refer to Page 66 for the Calibration procedure X ray tubes that sit dormant for several months can become electrically unstable To remedy this condition it is recommended you perform a new tube seasoning procedure This process establishes stable high voltage operation and will ultimately extend the life of the tube Repeat this procedure before returning to normal operation any time the system has been unused for more than two months 1 2 3 QUO Oe Verify system operation Energize the system Select 60 kilovolts kV 7 milliamperes mA and the exposure time of one second Make five exposures at this level obse
71. or vapors which could ignite causing personal injury and or damage to the equipment If such disinfectants are used the vapor must be allowed to disperse before using the equipment Installation Options VetPro DC Explanation of Symbols on Technical Labels Type B Protection against electric shock IEC 60601 1 1 Consult written instructions in User s Manual ATTENTION RAYONS X OPERATION SEULEMENT PAR DU PERSONNEL AUTORISE VOIR MANUEL DE L OPERATEUR WARNING X RAY THIS X RAY UNIT MAY BE DANGEROUS TO PATIENT AND OPERATOR UNLESS SAFE EXPOSURE FACTORS AND OPERATING INSTRUCTIONS ARE OBSERVED X RAY EMISSION Mains HOT WIRE Mains NEUTRAL WIRE Earth Ground 0 BBb lt p gt Obtaining Technical Support Contact Midmark Corporation 675 Heathrow Dr Lincolnshire IL 60069 Phone 800 MIDMARK Fax 847 415 9801 imagingtechsupport midmark com Installation Options VetPro DC Installation Options Mounting Configurations Mounting This section gives instructions for installing the VetPro DC Animal Health Dental X ray System in three mounting configurations Use the mounting template shown in Figure Template P 8 to guide single stud installations Reverse the template for dual stud installations Figure 8 Mounting Template CAUTION When installing the intraoral system combined with the 82 inch 209 centimeter reach arm wall fabrication and attachments to
72. p or down button to highlight the sensor or phosphor plate to change and press Enter Select YES or NO on the Verification screen Exit the Preset Options menu DOS Changing 1 Select EDIT PRESETS from the Preset Options menu The display notifies Presets you that you are entering Edit Preset Mode and Tooth Size Image Receptor Type and Patient Size are illuminated Use the Tooth Selection Image Receptor Type and Patient Size Selection buttons to select the preset to change The display shows the current values for the preset Use the right arrow button to display the technique factor to change Use the up and down arrow buttons to set the value for the selected technique factor and preset o Hepeat steps 2 4 to change additional presets 6 When you have completed all changes press the Tooth Selection and Patient Size Selection buttons simultaneously for 5 seconds to record the change Individually 2 212 08 64 oystem Configuration VetPro DC Recall Presets Figure 49 Preset Options Menu 1 To return all presets to factory defaults select RECALL PRESETS from the Preset Options menu The menu will ask you to confirm your choice Select YES using the up arrow button and return all presets to factory default settings Selecting YES will erase any custom presets that have been set up Select NO using the down arrow button and retain current presets PRESET OPTIONS EDIT PRESETS SELECT RECEPTOR
73. pping noise within the Tubehead p UID s Inspect the condition of the feedback cable Inspect the condition of the communication cable If used inspect the remote exposure switch wiring for a loose connection Hefer to the High Voltage Breakdown information in the Troubleshooting section for detailed instructions Replace the Power Supply Board 30 08041 This condition will exist if the kV or mA produced is out of tolerance To address this issue 1 Inspect the condition of the high voltage circuit by operating the VetPro DC in the diagnostic mode Confirm incorrect kV or mA 2 Inspect the VetPro s internal horizontal and articulated arm wiring Hepair as necessary 3 If wiring is intact and the firmware revision is 5 0 or less attempt system recalibration If greater replace logic PCB assy 4 f calibration cannot be achieved the problem may require replacement of the tubehead assembly Contact Midmark technical support for further assistance 5 Check if D14 DIAG LED Logic Board is on If so check that DIP Switch 22 J11 Logic Board is in the correct position for the brand of X ray tube in the unit The label on the tubehead will indicate either Toshiba or Kailong DIP Switch 2 should be in the OFF position for Toshiba ON for Kailong Troubleshooting VetPro DC No X ray Produced but Exposure Indicators Detected No kV Produced 19 When no X ray is produced the VetPro DC may still opera
74. r through conduit or on the surface of the wall Route the other cable from the first switch location to the second switch location either through conduit or on the surface of the wall Thread the first cable end with the handset connector through the opening in the wall mount cover from the inside and connect it to the Operator Panel If the cable is routed on the surface of the wall it should enter the wall mount cover through the notch on the left of the power switch For a parallel connection connect the cable conductors of both cables to terminal block J1 on the PCB of switch enclosures 1 as shown in Figure 44 The 2 indicates that two green wires will join together in terminal 1 of J1 etc For a series connection connect the wires as shown in Figure 45 green 2 red 2 black 2 yellow 2 Optional Installation Procedures VetPro DC Figure 45 Series Switch Configuration 60 11 12 13 C black 2 yellow 2 Make sure the two gray wires from the pushbutton switch are connected to terminals 1 and 2 of J2 Screw the inner section of enclosure 1 to the junction box using the two screws provided If the cable is routed on the surface of the wall make sure it sits in the notch on the bottom of the enclosure Confirm that no wires are being pinched between the junction box and the enclosure Hook the outer section of the enclosure onto the inner section at the top Push the wires all the w
75. r Switch E1 19026 e Yoke Cable Assembly 30 08071 e ubehead Assembly 30 A1027 e Ribbon Cable Assembly 30 08072 Note e If you replace the Operator Panel Board 30 08054 you must re program any customized technique factors as explained in the System Configuration section of this manual e If you replace the Logic Board 30 08160 or the Tubehead and the firmware revision is 5 0 or less you must recalibrate the system Please contact Midmark Technical Support for instructions CAUTION The VetPro DC system has the capacity to store electrical energy during operation and after the system has been turned off e The VetPro DC system will store energy for approximately three minutes after removal from power lines Before attempting service within the system observe the green LED D11 of the Power Supply Board Illumination represents the presence of stored energy e As an added safety practice it is recommended to measure for the presence of DC voltage across TP8 and TP5 of the Power Supply Board Troubleshooting VetPro DC No Operator Display but Power Switch is ON 70 Your Responsibilities As An Installer And Service Engineer Verification of machine performance after installation must be performed according to the guidelines identified in the System Function Checklist which can be found in the User Manual or the Installation and Service Manual on page 52 Verification of machine performance after main
76. rd measure between TP8 or TP10 the Common Return and TP2 mA Program This voltage should be between 1 and 2 volts DC If this voltage is not correct replace the Logic Board If this voltage is correct select 1 5 seconds of exposure time measure across pin 1 and pin 2 of the Logic Board at the connector J3 During exposures this value should be 24 volts AC Also measure across pin 2 and pin 3 of J3 This value should be 24 volts AC If either voltage is missing replace the Logic Board If these voltages are present measure for the same values at the Tubehead Assembly at the connector J5 black on the blue and gray conductors and the blue and brown conductors If the voltages are not present inspect the inter connect cables between the control and Tubehead Assembly Connections for this cable begin with controls at J1 of the Power Supply Board and J3 of the Logic Board As shown in Figure 57 an internal set of connections will be accessed below the distal side of the horizontal arm and at the inside top of the Tubehead Yoke The final set of connections is accessed by removing the Pivot Cap located at the attachment point of the Tubehead to the Yoke If the voltages are present replace the Tubehead Assembly J3 Cable Connector Use TP8 or TP10 for Common Return ERES REEL ABER seen when measuring DC voltages a BEEBE EEE y MONO PA AAA AAA 3 Erpa ET A ES n a is ge 4 P rra x uz gt 22i A wo ee
77. re 106 Screw Cradle 8 Cond RJ45 to RJ45 2m Column Screw Washer Column Screw Caster Swivel w Brake Caster Swivel Mobile Stand Base Control see Figure 107 Switch Assy VetPro DC Mobile Stand Remote Control Switch Assy Screw Access Cover Brake Line Cord Not Shown ze am ek mo es ex os ix Us 60 d EUG lec Veal Appendix B VetPro DC Appendix B Electronics Block Diagram Operator Panel Feedthrough Monitor PCB Power Supply PCB Filament Feedback Control mA kV Fil Logic PCB Operator Panel Buttons Exposure Key LCD Display Figure 141 Electronic Block Diagram 125
78. rovided with Chase A2042 to the Midmark Chase Unit The contents of the mounting hardware kit are v Quantity 6 3 8 16 x 1 3 4 Hex Head Bolts v Quantity 6 3 8 type A Plain Washers Y Quantity 6 3 8 16 Hex Flange Whiz Lock Nuts 31 Installation Procedures VetPro DC Installing VetPro DC X ray to Midmark Chase 8010 amp 801 1 Unit Illustrated example of a Dual Stud Mounting Plate and a VetPro DC X ray mounted to the fixed side of a Chase Unit Access Door Not Shown for Clarity Figure 19 Dual Stud Mounting Plate amp VetPro DC X ray Fixed Side 32 Installation Procedures VetPro DC Installing VetPro DC X ray to Midmark Chase 8010 801 1 Unit Illustrated example of a Dual Stud Mounting Plate and a X ray VetPro DC l i mounted to the removable side of a Chase Unit Figure 20 Dual Stud Mounting Plate amp VetPro DC X ray Removable Side 33 Installation Procedures VetPro DC Installing the Horizontal Arm and Brake Assembly Installing the 1 Horizontal Arm and Brake Assembly 3 4 5 6 Locate the Horizontal Arm in the top level of the shipping carton Remove the Horizontal Arm from the shipping carton Do not remove the cardboard tube around the wires but remove the red tag Insert the cardboard tube snugly into the shaft of the Horizontal Arm Note Do not lubricate the shaft of the Horizontal Arm or bearings in Control Unit Inse
79. rt the cardboard tube enclosing the wires into the opening in the top of the Control Unit Insert the Horizontal Arm completely into the Control Unit as shown in Figure 21 Ensure that the Horizontal Arm is firmly seated in place Remove the cardboard tube to free the wires Discard the cardboard tube Note Do not make the wire connections at this time Locate the brake assembly 30 A2024 in the kit pack 30 A2049 or 30 A2156 As shown in Figure 22 install and loosely tighten the brake assembly in order to put a small amount of drag on the rotation of the Horizontal Arm and to keep the Horizontal Arm from lifting out Figure 21 Installing the Horizontal Arm 34 Installation Procedures VetPro DC Brake Assembly Figure 22 Installing the Brake Assembly 35 Installation Procedures VetPro DC Installing the Articulating Arm and Tubehead Assembly Install the The Tubehead and Articulating Arm are installed as a single unit Articulating Arm 1 Remove the top level packing material from the shipping carton to gain and Tubehead access to the Articulating Arm and Tubehead Assembly Do not remove the cardboard tube enclosing the cable wires but remove the red tag Assembly 2 Remove the Articulating Arm and Tubehead Assembly from the shipping carton CAUTION Do not remove the tie holding the Articulating Arm closed Removing the tie will cause the Articulating Arm to spring open potentially causing per
80. rving the normal cooling time Select 65 kilovolts 7 milliamperes and the exposure time of one second Make five exposures at this level observing the normal cooling time Select 70 kilovolts 6 milliamperes and the exposure time of one second Make five exposures at this level observing the normal cooling time Your Responsibilities As An Installer And Service Engineer Verification of machine performance after installation must be performed according to the guidelines identified in the System Function Checklist which may be found in the User Manual or the Installation and Service Manual on page 52 Verification of machine performance after maintenance or repair must be performed according to the guidelines identified in the System Function Checklist and the calibration instructions which may be found in the Installation and Service Manual o3 Optional Installation Procedures VetPro DC Optional Installation Procedures Installing the Coil cord Hand Switch Option 30 A2040 The VetPro DC Animal Health Dental X ray System can be installed with a coil cord handswitch 30 A2040 The coil cord handswitch is used to make exposures in addition to or replacing the use of the exposure button Installation of the coil cord hand switch involves connecting the hand switch into the connector on the bottom of the Operator Panel Jumper If the coil cord hand switch is used it may be required to disable the Exposure Configuration for
81. s DC Common Return TP3 8 1 MOMs PE io EHEHEHEEHHEHHEEHHEEHHEEHRHENHHREENHNH TP5 412 Volts TPA 312 Volts DC MEETS ee 7 n ORBE DC Common eF Figure 61 Power Supply Board 30 08041 81 Troubleshooting VetPro DC No X ray Produced and No Audible Exposure Indicators Figure 62 Logic Board 30 08160 82 Two different audible exposure indicators are employed within the VetPro DC system One indicator is embedded in the Operator Panel and will initiate when any exposure switch is pressed The second audible indicator initiates when the Logic Board begins the exposure sequence During normal operation first the Operator Panel indicator will sound followed shortly thereafter by the Logic Board indicator It is important to recognize the sequence for troubleshooting purposes 1 If the Operator Panel indicator does not sound inspect the condition of any remote exposure switches Substitution is the preferred method to test these switches although a jumper wire can be applied across the contacts of J3 shown in Figure 62 on the Logic Board momentarily to simulate an exposure switch closure 2 Ifthe Operator Display indicator sounds but the Logic Board indicator does not activate observe LED D2 on the Power Supply Board and listen for the relay LS1 to activate on this same board Figure 63 LED D2 should illuminate during the exposure request If not inspect the condition of the ribbon cable between the Power Supply an
82. s to highlight the 12 CONE SIZE 4 Press the right arrow button to select the 12 Cone The display warns you that selecting the 12 Cone will override custom presets with the default factory settings for the 12 Cone 5 Using the up arrow select YES to install presets for the 12 Cone SET CONFIG 12 CONE SIZE PDIAG MODE ON PDIAG MODE OFF Figure 51 Set Configuration gt EXIT Menu 66 System Configuration VetPro DC Diagnostic Mode About Diagnostic The VetPro DC Animal Health Dental X ray System has a diagnostic mode in Mode which you can display a Summary of maintenance data or display feedback values after each exposure Showing the 1 From the Main System Configuration menu Figure 47 select CONFIGURE Maintenance UNIT You will see the Configuration menu shown in Figure 50 S 2 Select SET CONFIG You will see the Set Configuration menu shown in ummary Figure 51 3 To display a summary of maintenance data highlight select SHOW MAINT The following maintenance data are displayed e Total KJ kilojoules total system heat on the X ray tube e Exposure Count e Reboots power up cycles e OT Counts over threshold counts 4 Press any button on the Operator Panel to return to the Configuration menu Showing If you take an X ray while in diagnostic mode the display shows feedback Feedback Values values for that exposure Until you exit diagnostic mode the display will continue to show f
83. sonal injury Note Do not lubricate the shaft of the Articulating Arm or the bearings in the Control Unit 3 Position the Articulating Arm above the Horizontal Arm 4 Carefully route the cardboard tube with the arm cable plug through the opening in the Horizontal Arm o Insert the shaft of the Articulating Arm into the opening in the Horizontal Arm as shown in Figure 23 6 Press down until the shaft is completely seated in the Horizontal Arm 7 Remove the cardboard tube to free the wires Discard the cardboard tube 8 Untie the Articulating Arm and remove the plastic covering Figure 23 Installing the Articulating Arm and Tubehead Assembly 36 Installation Procedures VetPro DC Install the Articulating Arm Brake Assembly Figure 24 Installing the Hex Nut and Set Screw Figure 25 Adjusting the Articulating Arm Brake Assembly 3 N Locate the Articulating Arm brake assembly 30 A2068 Insert the M6 x 25 mm long set screw as shown in Figure 24 Usinga3 mm Allen wrench tighten the screw fully than back off turn and secure with the hex nut Using a 3 mm Allen wrench install the Articulating Arm brake Tighten screws until the Articulating Arm brake comes into contact with the shaft of the Articulating Arm If additional friction is required to prevent drifting turn the two screws evenly turn at a time until drift stops as shown in Figure 25 Hex Nut and Set Screw 2514 Lara Oh Cic
84. t install the Operator Panel mounting cradle in the position marked Locate the 25 ft 7 6 m remote control cable Run the remote control cable in compliance with local codes from the intended location of the remote Operator Panel to the back of the Control Unit Note The cable can also be run to an electrical box or opening at the top left of the wall plate assembly A sufficient length of cable should be left available to bring the remote cable out to the bottom front of the Control Unit Plug the remote control cable into the bottom of the Power Supply Control Board 30 08160 Place the top of the front cover on the Control Unit and pop the bottom of the cover into place as shown in Figure 36 being careful of the power switch and cover alignment Replace the screw on the front cover of the Control Unit Place the cover plate over the top opening and the small trim cover over the bottom opening on the front cover of the Control Unit Locate the Operator Panel in the top portion of the shipping carton Connect the other end of the remote cable to the right plug as viewed from the back on the bottom of the Operator Panel Carefully dress the white cable back into the wall Snap the Operator Panel to the mounting cradle as shown in Figure 38 Installation Procedures VetPro DC Figure 38 Snapping the Operator Panel to the Mounting Cradle 48 Installation Procedures VetPro DC Installing Plastic Covers Figure 39
85. t points 2 Using a 2 mm Allen wrench as shown in Figure 102 tighten both screws evenly at each adjustment point until the movement of the Articulating Arm is as desired Do not loosen adjustment points so far as to allow the Articulating Arm to drift Maintenance VetPro DC Preprogrammed Exposure Times The tables below show the factory default exposure settings for each combination of Tooth Image Receptor Type and Patient Size on the Operator Panel These exposure settings can be modified using the System Configuration mode See the System Configuration section for details on page 62 Setting Large Small Large Small Large Small Large Small Large Small Large Small Large Small Large Small Upper Canine Lower Canine Incisors Premolars Molars 8 Cone Progeny Schick Dexis Kodak Sirona PSP D Speed E F Speed 12 Cone Progeny Schick Dexis Kodak Sirona PSP D Speed E F Speed Setting Large Small Large Small Large Small Large Small Large Small Large Small Large Small Large Small Upper Canine Lower Canine Incisors Premolars Molars 105 Maintenance VetPro DC Arm and Tubehead 30 P0031 Pivot Joint Cover Male Gray 30 A1024 Articulating Arm amp 30 P0030 Pivot Joint Cover Female Gray 30 P0014 Yoke End Cover 30 P0033 Gray Female Cover Handle M 30 A1027 Tube Head Assy Base 30 A2195 70 mm Cone Figure 103 Arm and Tubehead 106 Yo
86. te the exposure indicators The procedure to troubleshoot a no X ray condition depends on which exposure indicators are detected 1 COH Activate diagnostic mode as explained in the System Configuration section of this manual Take an exposure Follow the appropriate procedure below e f no kV is produced go to the procedure No kV Produced e Ifno mA is produced go to the procedure No mA Produced e If no I is produced go to the procedure No lI Filament Produced On the Power Supply Board observe that the power supply indicator D1 1 350volts DC is illuminated as shown in Figure 55 Illumination represents proper stored energy for an exposure If this indicator is not illuminated it Will be necessary to replace this board On the Logic Board measure voltages at TP1 8 1V and TP9 24V Use TP8 or TP10 as Common Return If any of these voltages are not present after power is applied next check voltages on the Power Supply Board On the Power Supply Board use TP2 as a common test point to check TP1 24 volts DC and TP3 8 1 volts DC Then use TP5 as the common return to check TP4 for the presence of 12 volts DC as shown in Figure 55 Should any of these voltages not be present replace the Power Supply Board If each voltage is present check other voltages on the Logic Board On the Logic Board measure between TP8 or TP10 the Common Return and TP6 kV Program This voltage should be between
87. tenance or repair must be performed according to the guidelines identified in the System Function Checklist and the calibration instructions which can be found in the Installation and Service Manual on page 52 1 Onthe Power Supply Board 30 08041 check for the presence of 100 to 230 volts AC at J4 the Input Power Terminal Strip as shown in Figure 52 If power is absent check that the VetPro DC is connected to line power 2 Onthe Power Supply Board 30 08041 measure incoming power at J3 the Line Switch Connector as shown in Figure 52 Positions 2 and 4 carry the line voltage before the Line Switch and positions 1 and 3 carry the line voltage after the Line Switch Voltage at the input side of the switch but not at the output requires replacement of the Line Switch E1 19000 3 Inspect the condition of the communication cable between the Logic Board and the Operator Panel Midmark includes two communication cables with each VetPro DC system Should the installed communication cable be suspect temporarily substitute the other cable as a test tool 4 fthe power switch is on and there is no operator display and a faint buzzing sound is also detected check the ribbon cable installed between the Power Supply Board and the Logic Board If the cable is not properly seated reinsert it If it is damaged replace the cable 5 On the Logic Board measure voltages at TP1 8 1V and TP9 24V Use TP8 or TP10 as Common Return If any of thes
88. the selection of the proper mounting hardware is the responsibility of the installer Please note that a two stud wall plate assembly 30 A2042 is included to mount on two wooden studs A metal stud mounting kit 30 A2043 is available The wall support and mounting hardware for the VetPro DC must withstand a 100 Ib 45 4 kg shear load and a 500 Ib 227 kg withdrawal force at each of the mounting bolts The wall fabrication and attachments to the building structure must be capable of withstanding a load moment of 920 ft Ibs 418 m kg Electrical Requirements Mains Power Supply Line Cord Use Line Voltage Fuse Rating Max Line Resistance The VetPro DC Animal Health Dental X ray System requires a 3 wire single phase AC power mains that contain line conductor neutral conductor and protective earth conductor It is recommended that the unit be installed with a dedicated electrical line connected to a breaker with a minimum 15 amp rating The wiring must provide for a permanently grounded power line configuration The installer must determine the suitability of installing the VetPro DC with a line cord If a line cord is used the installer must ensure that the unit is properly grounded and has the required line rating AC 100 V to 250 V 50 Hz or 60 Hz See complete specifications on page 112 5 A 250 V UL Recognized See complete specifications on page 112 For normal function of the VetPro DC Animal Health De
89. tion Options VetPro DC Reach and Coverage Horizontal Arm Lengths Optional 12 Inch 30 cm Cone Figure 2 Reach and Coverage Diagram The reach of the system is measured from the tip of the Cone with the arm fully extended and the Cone pointing back toward the pivot of the wall plate This measurement method accommodates the normal positioning of the Tubehead to the patient A patient can therefore be positioned without difficulty with the table located within a radius outward from the pivot point to the dimensions shown in the diagrams The VetPro DC Horizontal Arm is available in four lengths Each length gives the system a different reach Catalog P7015V P with a 30 A2074 Horizontal Arm has a reach of 56 inches Catalog P7016V P with a 30 A2073 Horizontal Arm has a reach of 66 inches Catalog P7017V P with a 30 A2071 Horizontal Arm has a reach of 76 inches Catalog P7018V P with a 30 A2164 Horizontal Arm has a reach of 82 inches The diagrams show Catalog P7018V P with an 82 inch reach For Catalog P7017V P with a 76 inch reach reduce the dimensions by 8 inches For Catalog P7016V P with a 66 inch reach reduce the dimensions by 18 inches For Catalog P7015V P reduce the dimensions by 28 inches The 82 inch reach for Catalog P7018V P assumes the use of the 8 inch 20 cm Cone that is supplied with the system If the optional 12 inch 30 cm Cone 30 A2200 is used the reach is reduced by 4 inches y i i i W 22 55 58 CM
90. tory default settings refer to Factory Default Exposure Settings on page 18 in the VetPro DC manual Note If the 12 30 cm cone is going to be used configure the VetPro DC for use with the 12 cone before changing preprogrammed exposure settings Configuring the VetPro DC for use with the 12 cone will reset exposure settings to the default settings used with the 12 cone Displaying the 1 From the Main System Configuration menu Figure 47 select CHANGE Change Presets PRESETS You will see the Preset Options menu shown in Figure 49 Menu 2 Selecting EXIT returns the display to the Main System Configuration menu Changing All 1 Select ALTER DENSITIES from the Preset Options menu The first Image Receptor Receptor Type illuminates The display shows the selected Image Receptor Type and current density Settings Globally 2 Using the Image Receptor Type button select the image receptor to adjust 3 Use the up and down arrow buttons to specify a percentage by which densities will be increased or decreased for the selected receptor Densities can be increased in steps of 25 and decreased in steps of 20 4 Press the right arrow to save your settings h Preprogramming Energize the system to Digital 2 Press the Tooth Selection and Patient Size Selection buttons for five full Sensors seconds 3 Select CHANGE PRESETS from the Menu Options screen 4 Select SELECT RECEPTOR from the Preset Options menu 5 Press the u
91. ulating Arm Note There is a small hole in the plastic handle covering the back of the Tubehead Under no circumstances should this hole be blocked as it provides an air vent to allow the Tubehead oil to expand and contract as the unit is operated The Articulating Arm provides the articulation support for the Tubehead and the reach and coverage of the Tubehead to the patient The Articulating Arm allows smooth movement for precise positioning and does not drift or vibrate when left in position The Horizontal Arm helps provide the necessary reach for the VetPro DC The Horizontal Arm pivots smoothly around a shaft inserted in the top of the Control Unit The Horizontal Arm contains an access cover to connect the cable from the Horizontal Arm to the Control Unit The Horizontal Arm is available in four lengths providing reaches of 56 66 76 or 82 inches 142 167 193 or 208 cm The Cone establishes the distance from the X ray tube to the patient s skin It provides positioning assistance and collimates the X ray beam to within a defined circle at its end The VetPro DC is shipped with the standard 8 inch 20 cm Cone attached to the Tubehead A 12 inch 30 cm Cone 30 A2200 can be ordered as an option The remote control switch is used to make exposures in addition to or replacing the use of the exposure button An optional model the mobile unit provides room to room mobility for dental radiography See Appendix A for the installation
92. yoke cover 3mm screws 2x 5 Unplug the black and white connector 77 6 Remove the two Allen head screws that secure the two ground wires to the yoke Take note of the position of each ground wire 3mm screws 2X Maintenance VetPro DC Figure 72 Figure 73 Figure 74 91 7 Remove the end cap from the side of the tubehead Maintenance VetPro DC Figure 75 Figure 76 Figure 77 92 10 Remove the larger retaining ring by pulling it out with a pair of needle nose pliers 12 Secure the scissor arm with the provided cable tie and foam separator before removing both spanner rings WARNIING DO NOT REMOVE THE TUBEHEAD UNTIL THIS STEP HAS BEEN COMPLETED THE SPRING TENSION IS ADJUSTED TO INCLUDE THE WEIGHT OF THE TUBEHEAD THE ARTICUTING ARM WILL SPRING OPEN IF IT IS NOT SECURED AND CAN CAUSE SERIOUS INJURY Maintenance VetPro DC 13 Assemble the spanner wrench by threading the two leverage arms Figure 78 14 Align the three pins on the spanner tool with the alignment holes in the brass spanner nut Alignment holes Figure 79 15 Break loose the spanner ring by turning the spanner wrench counter clockwise Figure 80 16 Repeat steps 14 amp 15 to remove the second spanner ring 93 Maintenance VetPro DC Figure 81 Figure 82 Figure 83 94 17 Carefully remove the tubehead from the yoke 18 Remember to transfer the friction ring from the origina

Table of Contents

Contents

Download Pdf Manuals

Related Search

Related Contents