Home

Lexmark X548 Series 7525-63x Service Manual

1. e 7 9 Cable packet 2 2 nn ee eee eee eee 7 13 Screw packet miscellaneous screws 2222252252222 ee eee eee eee eee eee 7 9 Photo Sensor 2222s een eee eee eees 7 11 ITU paper path thermistor I TrrrrIIrIIIeme 7 13 Cover Legal extender 22 222 eee eee eee ee ee eee ee eee eee 7 3 Tray ADF input 2 2 2 2 ee eee eee eee eee eee eee rre 7 5 Cover ADF rear duplex 2 22 2222 ee ee eee eee eee ee eee eee eee eens 7 5 Cable ADF 2 2 2222 eee ee eee ee ee ee eee ee eee eee eee ee 7 5 Cable USB for thumb drive 2 2 2222 eee eee eee 7 7 Assembly Top cover 22 222 ence eet ener eee eee 7 3 Tray Output bin 2 5 5 2 eee eee eee ee ee ee eee eee eee eee 7 3 Fax interface cable 22 2222 ee een ee ee eee eee eee eee ee eee 7 11 Part number index 1 5 Previous Next D Go Back 7525 63x 40X5486 40X5487 40X5488 40X5489 40X5490 40X5534 40X5535 40X5536 40X5537 40X5538 40X5803 40X5872 40X5937 40X5938 40X5939 40X5969 40X5970 40X5971 40X5972 40X6514 40X6515 40X6516 40X6517 40X6518 40X6519 40X6520 40X6520 40X6521 40X6523 40X6997 40X7046 40X7054 40X7058 40X7529 40X7545 40X7562 40X7563 40X7564 40X8092 40X8341 40X8342 40X8395 40X8419 40X8674 Cover Right AIO
2. 3 39 BER DISK EBOTUDUDBIP 4 593 993 d CR RCRCROR nsec eee Ree a ee eC RE IR CR ACC OA 3 39 Erase All Information on Disk isseee Imm rne 3 39 T WIBB ASSI a R EERE N A erba ig de CR 3 39 Go Back Fon Sle RING 6 605645 CO ll 0 7 1 7 1L TT TT UTSTTRTST 3 40 POGUE Le SR EER PRAE 23 R XA MR sacs Ee d E xS ee ra RIA WI MAN EP SUPERNE ETE 3 40 Hedule SIMDndBW casses XGA ER XURAGHRGUAO RO RH AEROEUGR RR ERA CRX GRE NSEaAd F408 Seen Seed ws 3 40 UF re hee x saaiiese eae senna nade seas ANERE EOST ERT 3 40 Key Repeat Initial DOLI BV inq ox RURRRUR ROR OUR sweden AUR UR OUR A RCACAC RUN GECRCRCRCR RU OC Ro seeee deed eae 3 41 KOV HOBOARL Hale trove pines eenee esas On EA URCRHaOR P RR a HE A eee eee dices Qa pK Pd 3 41 caesi SIGNS AP tase vere eee ae ee ae oe Oe ee gee pam 3 41 FLUNG 08431 bG ows a8 PRE AA UOCE 20 E RS EOE RA ORG RECO 55505448005 been eee 3 41 USB SDEBM iuas9 259 VAZASCRWAYCEAS EqENI ee ee sneer FERAM PR EC RE ERERS MD RAS MS eas 3 41 USB PDE uasa d 9 PEOR RECIEN AR A om e nit er 9 edebat d dc CA ee Kel Rr ed Edd 3 42 Automatically Display Error Screens 200 c eee ee 3 42 Bx Cone MGA CTI rE 3 42 OA Pg oc cep ee a es EU eS ee ee oe eee aw ye ee a ee 3 43 FILS ec od ce hese ee ee eee ee ee EEE E A E EE E EIS 3 43 Invalid SNGING COG THOU 124a iade dex CRGA OCR COR C CR RC CIC ACRI It OCC eee CR ca AC e n 3 44 Backing up eSF applications and sSettingS 0 0 eee es 3 44 PO IBS En sees ER
3. rrurerrrr rrr 7 16 PCBA RIP 2 22 22 ene en eee eee erre rrr eee eee eee eee 7 11 PCBA UICC 2 22 22 eee ne eee ee eee eee eee ee eee eeee 7 7 Cable UICC 2 2 2 ee nee ee ee ee eee eens 7 7 Speaker 22 22 e ne ee ee ee ee ee ee eee rrr 7 7 EPROM PCBA 2222 2 e ener ne eee eee eee ee eee eee eee eee eeee 7 7 Cover Operator panel with light pipe 7 7 Cover Front 2 22 2222 eee eee ee eee eee eee eee eee eens 7 7 Cover Operator panel frame 2 22 22 e ee eee ee eee eee ee eee eens 7 7 Display 7 inch LCD with ground cable 1 7 Cover Operator panel bezel 2 52 22 e eee eee eee eee eee 7 7 Optional 650 sheet duo drawer complete 7 15 Waste toner bottle contact block rIIIIIIIIe 7 13 Fax PCBA 22222 eer een eee ee ee ee eee eee eee ee eens 7 11 Hard drive 2 2 2 ee ne ee eee eee 7 11 Asm LED flatbed 222 eee ee eee eee eee eee ee eee enue 7 5 ADF separator roll replacement CRU 7 5 Fuser assembly 110 V r r rrrrrrrrrrrr RII 7 9 Fuser assembly 220 V rrrrrrrrrrrrrre re 7 9 Fus
4. 7 11 Power cord 2 5 m straight Australia 7 11 Power cord 2 5 m straight PRC 7 11 Narrow media flag urrrrrrrrrrrrrrrrrrr e e 7 9 USB cable packaged 2 m 2222 2 e eee eee ee eee eee ee ee eee eee eee 7 16 64MB Flash card assembly 2 2 e eee cee eee eee ee ee eee eeeee 7 16 ACM Paper pick motor drive assembly e 7 9 Flatbed pivot link 2 2 2 e eee eee eee ee eee ee eee eeeee 7 5 Power cord 2 5 m straight Switzerland 7 11 Power cord 2 5 m straight South Africa 7 11 Power cord 2 5 m straight Denmark r rrr r e e 7 11 Power cord 2 5 m straight Taiwan r r rrr e 7 11 Power cord 2 5 m straight Korea rrr rrr e e 7 11 Redrive spacer screws ee rrrrerrrrrrr rrr eee eee 7 5 Front flatbed hinge 2 2 2222 eee nee ee ee eee ee eee eee eee eee 7 3 115 V Maintenance kit 2 2 e eee eee eee eee eee eee eee ee eeee 7 9 7 16 230 V Maintenance kit 2 22 ee eee een eee ee eee eee eee 7 9 7 16 100 V Maintenance ki
5. rr ruurrrrrr ee eee eee 7 3 Cover Scanner right urrrerreerrr eee eee eee eee 7 5 Cover Scanner left 22 2 e eee eee en ee ee eee eee eee eee 7 5 Cover AIO back cable 2 2 2 e eee e rr eee eee 7 3 Cover Front middle 2 22 5222 22s een eee ee eee eee eee eee 7 3 Cover AIO toner 2 2 2 e nee e ree ee ee ee ee eee eee 7 3 Cushion H flatbed 222 22 eee eee ee eee eee eee eee eee 7 5 Lever AIO release 2 2 2 e ener re ee eee eee eee 7 5 Link AIO 2222 2 e ene ee ee ee eee ee ee eee eee ee eeee 7 3 Cover Front 2 2 2222 seen en ee ee ee ee eee eee eee eee 7 3 Duplex reference edge rrrrrrrrr eee eens 7 9 Bin full flag 2 2 2222 eee eee eee ee ee ee ee ee ee ee eee eee ee eens 7 5 128MB DDR DRAM DIMM card assembly 2 22 e eee eee eee eeee 7 16 256MB DDR DRAM DIMM card assembly eee ener eee eee 7 16 512MB DDR DRAM DIMM card assembly e eee eee eee ee eeee 7 16 Korean font card assembly rrrrr rere 7 16 Simplified Chinese font card assembly 2 22 cece ee eee eee eee eee 7 16 Traditional Chinese font card assembly 2 222 c eee e eee eee eee 7 16 Japanese font card assembly
6. 0 0 cee es 1 17 Oe eee e d 26 058 TT TT TETTE CET TR T TOT ITI E E 1 17 Selagi e sau ads gens Y Suede ees u Saw GS desqqiussdqa sdE eue E E E s 66 1 17 Be aor a ee ae es qo Ee e d od E ao de CUR do o ORA iR 1 17 Cari Tie DULBUL TDI IU a s quud och oeEENOEPEHORRARERUCREIRCCPPERENESCELCFETEPERERTRPRGEF ETE 1 17 Supported COMDICSSIONS uui acea dona o dorA EE ORE X GE need doves Xo EGPE Se bee Er Pas 1 17 Supported scan destinali ns us dad cowry eerie cee decease sors DORT DIT 65 0406554855 1 17 UNG COMES rr 1 17 Table of contents iii 7525 63x Reduce Enlarge La uuu doce eben do Roe dc de decre d a ic decur nA ek ht Be ic ms BE Sn cys d 1 17 Previous rax SDOCHIBAUDS Laosweexeqa aeu HA sneer sensed 64 ARR EU AOR AA HR CRA HE RU A Rd Ra T Sees en eesn erase 1 18 Pons Hmabyork COMNCCIVIN eiu sce ego x i Hehe CADRES EXER REX RARE RAE LETINE Rd EEMAR EA 1 18 A ee el Othe peace eae one Seeue sees ae oes ee ad eee ord oe ae es E ish 1 18 Miscellaneous Tax Specifications s sra 45s Gaede Gawd PAX ER GOES 3 9 93 648 nds So eS oe Ses 1 18 v TOOLS SEGUINEd TOF SEFVICO a oa nep FRA DAL RR eee TRAC E RUE EUR MUR E XO SACRA ACC 1 19 BOTOBUMS E A raso REPRE E PEECMUPRR FERRI EDISAEREI AIRES Ka EB DRE SNR Ede dA 1 20 Next Diagnostic information 0 00000 cece e eee ee ee cece eee nhan 2 1 4 BITS oer ddadsdbsecxedxaldnddac darsi tance da MUNERE een Ra ended dE Edd aE a 2 1 oben BM te ee Lad en oS E 4 see E oo 4 8 ICI AP EC ee Ree DAP Sa 2 1 S
7. A 5 Remove the rear shield See Rear shield removal on page 4 7 6 Disconnect the waste toner bottle contact block cable from connector JWT1 on the RIP board T Remove the waste toner bottle contact block 4 74 Service Manual Previous A D Go Back Scanner component removal procedures 525 63x Previous Flatbed I A atbed remova 7 DURDONA Remove the AIO rear cable cover See AlO back cable cover removal on page 4 8 Next Remove the rear shield See Rear shield removal on page 4 7 Remove the left cover See Left cover removal on page 4 4 T Remove the ADF unit See Duplex ADF removal on page 4 87 Go Back Disconnect the CCD cable from JCCD1 on the RIP board Remove the first toroid A from the CCD cable The toroid will be reused on the new flatbed unit Repair information 4 75 525 63x T Remove the second toroid B from the toroid holder and slide it off the CCD cable This toroid will also be Previous reused on the new flatbed unit L ma d Next Go Back B 8 Remove the screw C that fastens the redrive ground cable and ADF ground cableground cable to the frame el C 9 Disconnect JADF1 and route the cable through the top of the card cage 10 Disconnect the USB cable from JUSB1 op panel cable from JUIC1 flatbed home sensor cable from JHS1 and flatbed motor cable from JFBM1 Route the cables through the right side of the card cage 4
8. Problem resolved Go to step 23 Does the 900 xx error reoccur Run a job to test the option Does the 900 xx error reoccur Go to step 24 Go to step 26 Upgrade the firmware Contact your next level of support for the correct firmware level to use Go to step 25 Restart the printer to operating mode Does the 900 xx error reoccur Replace the faulty ISP option Restart the device Go to step 31 Go to step 26 Does the 900 xx error reoccur Are there any more ISP options to install Go to step 27 Go to step 29 Problem resolved Install the next ISP option Restart the device Go to step 28 Does the 900 xx error reoccur Run a job to test the option Go to step 29 Go to step 26 Does the 900 xx error reoccur Upgrade the firmware Contact your next level of support for the correct firmware level to use Go to step 30 Go to step 26 Restart the printer to operating mode Does the 900 xx error reoccur 2 30 Service Manual Previous Next D Go Back 7525 63x Replace the faulty ISP option Restart the Go to step 31 Go to step 26 A device v Does the 900 xx error reoccur Next Contact your next level of support You will need the following information for them 5 Exact 900 xx error digits and complete error message Printed menu settings page Printed network settings page Device error log A sample print file if error appears to be isolated to a single file Fil
9. 2 AAJ 5 Oo N Ground USB_5V_Sense USB D USB D Ground NO Ground Ground 5V TXD1 5V SENSE VREF VAC GND Locations 5 15 Previous Next D Go Back 7525 63x HVPS 5 16 Service Manual 7525 63x Connectors HVPS board ome e NN e 60pm S e pean oao ewe eo eters 4 KOag e emme 00000 Locations 5 17 Previous Next D Go Back 7525 63x LVPS Co 9 U M cl z aD 5 18 Service Manual 7525 63x Connectors LVPS board Connector NM T 0 0 0 i E EY T s Gm S LENL TAN 8 Gm 8 umo S fom pe Um fom US rew w few US eem o wo pe T 7 u LN Locations 5 19 Previous Next D Go Back 71525 63x Toner meter card Connectors Toner meter card Connector From JCTM1 connector on the RIP board 5 20 Service Manual 45 V SW Cart Meter C IN Previous Next D Go Back 7525 63x 6 Preventive maintenance Previous This chapter describes procedures for printer preventive maintenance Follow these recommendations to help prevent problems and maintain optimum performance V Next Safety inspection guide pD Go Back The purpose of this inspection guide is to aid you in identifying unsafe conditions If any unsafe conditions exist find out how serious the hazard could be and if you can continue before you correct the hazard Check the following items e Damaged mi
10. Fax Send settings Previous Next D Go Back Fax error log codes Error code 80B 80C 80D 80E 811 812 813 814 815 818 819 81A 880 881 882 ae ae Check line quality Adjust Transmit Level Select a lower Max Speed value under Fax Send settings Too many errors when transmitting in ECM mode Remote device failed to respond to the CTC command Received too many requests from remote end to repeat the previous command sent Functional limitation Remote fax device does not support G3 receive capability Failed to detect a fax device at the remote end 7525 63x Previous lt gt Next J Adjust Transmit Level Go Back Select a lower Max Speed value under Fax Send settings Check line quality Adjust Transmit Level Check if line conditions on remote end will facilitate a good connection No action needed Issue with the remote device e Verify MFD is answering to fax call and not a voice call e Decrease value of Rings To Answer setting No more data rates available in V34 e Adjust to a lower modulation scheme modulation scheme Timeout occurred after waiting too long e Adjust Receive Threshold to receive a good frame Tried too many times at selected speed e Adjust Transmit Level using V 34 modulation scheme Adjust to a lower modulation scheme Fax transmission was interrupted due to power failure Fax transmission failed
11. Supported flash drives Lexar Jump Drive 2 0 Pro 256 512MB 1GB size or SanDisk Cruzer Mini 256 512MB 1GB size Supported file types pdf gif jpeg jpg bmp png tiff tif pcx dcx USB direct drive Scan and print Select formats 7525 63x Previous Next D Go Back General information 1 3 71525 63x Operating modes Eco Mode Off is default Data streams v Supported X Not supported Data streams PCL 6 emulation Designed for customers where noise levels are a very important factor Print quality is maintained at factory default level Speed is reduced Designed for customers where the environment is a key factor There are three options Energy Paper and Energy Paper Paper Duplex is on if Energy Paper or Paper is selected duplex models only can be overwritten by the driver Energy e Print quality is maintained e Power Saver is set to one minute Fuser standby is off e The operator panel back light is off Power supply energy consumption is reduced Energy Paper Settings associated with Energy mode plus duplex are enabled Lexmark X548 PostScript Level Ill emulation Version 3011 of the Adobe definition of PostScript 3 is supported PDF Supports version 1 6 PPDS By default the PPDS interpreter is inactive A user can activate the data stream by PJL or by the PPDS Emulation setting in the Configuration Menu PictB
12. 7525 63x Previous Informacio de Seguretat A e La seguretat d aquest producte es basa en l avaluaci i aprovaci del disseny original i els components especifics A El fabricant no es fa responsable de les q estions de Next seguretat si s utilitzen peces de recanvi no autoritzades e La informaci pel manteniment d aquest producte est orientada exclusivament a professionals i no esta T destinada Go Back a ning que no ho sigui e El risc de xoc el ctric i de danys personals pot augmentar durant el proc s de desmuntatge i de servei d aquest producte El personal professional ha d estar ne assabentat i prendre les mesures convenients PRECAUCIO aquest s mbol indica que el voltatge de la part de l equip amb la qual esteu treballant s perill s Abans de comencar desendolleu l equip o extremeu les precaucions si per treballar amb l equip l heu de connectar r9 r2 gt OF oe eee Sa Toa a sepe Oe os A eo ssa cen SHE MAYAN erg op NE WAS SUE scusa a eo ue ee E At Ai EI H o z B aj Ay Bat 9 AL Cf 10L A L L L Oor WH c lsseclWrtl rd8sg OF PUNT SHS ETS AS wd ee AP AS T7993 og ee ey a l P T A ee 9 91 A Ol L Cf AJ A N o ggg H 2 AjI L TI H H TL H FS WSU RA HP Rela ASP d FRY zz A AE ERO Be ob AAR XE I im TN AG AR A DE A 4i fh IAEE RAF AS PRTG EXE ANT zz ARTE TA vi AST m ED fret SRS IRA AA AR CLERC A SE H ANT win ESPEN AREY TEES ERRA n S IRIS
13. A D Go Back 5 Locations Exterior views Front Part name Operator panel Automatic Document Feeder ADF Standard exit bin Top door latch Right side cover Standard 250 sheet tray Tray 1 Manual feeder 650 sheet duo drawer with integrated multipurpose feeder Tray 2 Note When used with the 550 sheet tray the 650 sheet duo drawer must be stacked in the exact position shown in the illustration Optional 550 sheet tray Tray 3 7525 63x Previous Next D Go Back Locations 5 1 7525 63x Rear 5 2 Service Manual Part name Previous A D Go Back Print engine interior view Fuser exit rolls Duplex entry Printhead Fuser exit sensor Toner cartridges Y C M K Front cover duplex A Je FAX a EL 969 al z OX AC di Transfer N IN roll FR part of ITU i Tray 1 Tray 1 sensor Duplex sensor Paper pick motor drive asm Paper path Paper redrive rollers CLT Output bin 7525 63x Previous Next D Go Back Controller board Developers a ly Y C M K PC unit part of imaging unit ITU Locations 5 3 7525 63x Printer boards RIP board eee 22818522853 Cs O e JMOD2 JADF1 JFBM1 G O 1 O O JPH1 I JCFAN1 1 JMIRR1 o0ooooo 1 E JCTM1
14. D Go Back 7525 63x 4 Hold the fuser cover down and remove the jam Previous Note e Make sure all paper fragments are removed A e The fuser cover closes when released v Next Go Back 5 Close the fuser cover 6 Close the front door T From the printer display touch Continue jam cleared 230 paper jam 1 Open the front cover 2 Grasp the jammed paper on each side and gently pull it out Note Make sure all paper fragments are removed 3 From the printer display touch Continue jam cleared 235 paper jam This jam occurs when the paper is too short for the duplex unit 1 Open the front cover 2 Grasp the jammed paper on each side and then gently pull it out Note Make sure all paper fragments are removed Load the tray with the correct paper size Insert the tray Close the front door From the printer display touch Continue jam cleared or Si 2 3 50 Service Manual 7525 63x 241 paper jam Previous 1 Pull out the standard 250 sheet tray Tray 1 A 2 Grasp the jammed paper on each side and gently pull it out Note Make sure all paper fragments are removed v Next Go Back 3 Insert the tray 4 From the printer display touch Continue jam cleared Diagnostic aids 3 51 7525 63x 242 243 paper jam Previous Note Since the 650 sheet duo drawer and 550 sheet tray are similar in function only the procedure for clearing A the 650 sheet duo drawer is shown 1 Pull
15. JETH1 0ooooooQo JUSB1 5 4 Service Manual 000000000 000000000 JUIC4 JSP1 Q O JCARTB1 JHVPS1 JBIN1 JPJP1 e JFUSES1 JHD1 1 JBHUSB1 JTPS1 DOV UH JTRAY1 JSJ1 JINT1 EIEIEIEIEIEI EIEICIEEBEIE EE EEIEIEEIEILEI o00000 oooooo000000000o a c O E c Tl v D NOOOOUCCooooo00000000000000o0 1 O00000000 JWT1 JFP1 pronppaapaaaagaaaaaaaaagaaaum Lu a QD z OOOOOC JWIRE1 oooo o0ooooooQo ooo0oo0o00 000 0 _ oo oo oo oo oo oo oOo O O O 1 _ Previous Next D Go Back Connectors Connector JADF 1 JBHUSB1 Rear USB Host Port JBIN1 7525 63x lOA_ADF_C I1A ADF C Ground DIRA ADF C Ground IOB ADF C I1B ADF C Ground DIRB ADF C Ground V 24 ADF V 24 ADF 0 2 3 4 Ground V 5 ADF PAP PRES2 2 VREF1 ADF C VREF2 ADF C PAP PRES C ADF CVR C FIRST SCAN C FB CVR C SOL1 EN 2 Ground V BUSB USB DM2 USB DP1 Ground OJ C 8 NO c 0 O RIN 1 NO Ground V_BF S_BIN_FB Ground V_BIN_4 FUSER_ES Ground Locations 5 5 Previous Next D Go Back 71525 63x A v gt CE 77 70 s 9m 7 777 JCARTB1 5 6 Service Manual 7
16. Previous A D Go Back 7525 63x 2 Diagnostic information Start CAUTION Unplug the power cord from the electrical outlet before you connect or disconnect any cable or electronic board or assembly for personal safety and to prevent damage to the printer Disconnect any connections between the printer and PCs peripherals Use the service error code user status message user error message symptom table service checks and diagnostic aids in this chapter to determine the corrective action necessary to repair a malfunctioning printer They will lead you to solutions or service checks including use of various tests Symptom tables If the machine completes the Power On Reset POR sequence without an error and you have a symptom then go to Symptoms tables on page 2 2 Locate your symptom and take the appropriate action Service errors 1xx xx 8xx xx and 9xx xx s If a service error code appears while you are working on the machine then go to Service error messages on page 2 13 and take the indicated action for that error Service error codes are indicated by a three digit error code followed by a period and additional numbers in the format xxx xx In most cases five digits are shown User status and attendance messages User status messages provide the user with information on the current status of the printer Ready displays on the first line of the display unless invoked and then Power Saver displa
17. Print quality residual image Service tip Install a new print cartridge if available before doing this service check Residual image can be caused by the photoconductor cleaning blade and other parts inside the print cartridge Check the condition of the imaging unit using the customer menus administrative menus 1 In the Ready prompt touch 2 Navigate to Supplies Menu gt Imaging Kit Does the display indicate OK Measure the distance from the original image to the same point on the residual image Is the distance 43 9 mm Is the distance between the original image and the residual image 94 2 mm Run the Menu Setting Page twice to clear any debris To print a menu settings page 1 In the Ready prompt touch 2 Navigate to Reports Menu Settings Page Is there still any toner contamination on the fuser assembly 2 52 Service Manual Go to step 2 Replace the developer corresponding to the color of the image See Developer unit removal on page 4 47 Replace the photoconductor See Developer unit removal on page 4 47 Replace the fuser See Fuser assembly removal on page 4 32 Replace the imaging unit or the photoconductor unit See Developer unit removal on page 4 47 Replace the imaging unit or the photoconductor unit See Developer unit removal on page 4 47 Contact your next level of support Previous A D Go Back Print quality solid c
18. on page 2 60 CCD channel failure Check each channel mono R G B for identical values indicating bad cable and or SCC card Excessive noise test for the dark data indicating some sort of CCD or analog electronics issue on that channel or channels Go to CCD service check on page 2 60 Front scan module connector or cable failure Go to CCD service check on page 2 60 Rear scan module connector or cable failure Go to CCD service check on page 2 60 The connector cable is defective Go to CCD service check on page 2 60 Go to CCD service check on page 2 60 The font calibration strip is placed to high or to low Go to CCD service check on page 2 60 Go to CCD service check on page 2 60 Service error messages Error code 846 06 846 07 847 847 01 847 02 848 848 01 849 849 01 Oxx xx service errors Front magnification exceeds limits Modem failure Fax storage Modem Config ID mismatch Modem Config ID Mismatch HD Config ID mismatch HD Config ID mismatch 7525 63x Previous we 000 me Front calibration strip has excessive dark area Front excessive variability for Mono Red v Green or Blue Go to CCD service check on page 2 60 Next Hear excessive variability for Mono Red 4 Green or Blue Go to CCD service check on page 2 60 Go Back The Configuration ID bit that describes the device s m
19. 3 Remove the rear case with speaker See Rear case with speaker removal on page 4 108 4 Release the two plastic locks to disconnect the LCD cable v ANM 20798 BOC 00V t E f aminini CTTTTTTIETITETTTTTTETTT 5 Remove the four screws A from the LCD 4 100 Service Manual Previous A D Go Back 525 63x 6 Disconnect the two cables B from the user interface controller card Previous A D Go Back T Remove the LCD Repair information 4 101 525 63x The LCD with the ground cable is shown below Previous A D Go Back Operator panel assembly removal Remove the AIO rear cable cover See AlO back cable cover removal on page 4 8 Remove the rear shield See Rear shield removal on page 4 7 Remove the left cover See Left cover removal on page 4 4 Remove the ADF unit See Duplex ADF removal on page 4 87 Remove the flatbed See Flatbed removal on page 4 75 Remove the three screws under the operator panel Unroute the cables from the flatbed and remove the operator panel assembly DE DIEM IM 4 102 Service Manual Operator panel cover with light pipe removal JU eo es 525 63x Remove the operator panel bezel See Operator panel bezel removal on page 4 104 Remove the operator panel frame cover See Operator panel frame cover removal on page 4 107 Remove the rear case with speaker See Rear case with speake
20. Quiet mode duplex 48 dB printing color Environment specifications Wet bulb temperature operating 23 C 73 F maximum Web bulb temperature power off 27 C 80 F maximum Ambient operating environment 15 32 C 60 90 F and 8 80 RH Web bulb temperature power off 27 C 80 F maximum n some cases performance specifications such as paper OCF EP cartridge usage are specified to be measured at an ambient condition 1 8 Service Manual Previous Next D Go Back Media handling Input and output sources Sheet numbers are assuming 20 Ib xerographic paper Standard input sources Standard input tray 250 sheet tray 250 sheets Manual feed slot 1 sheet Second tray capacity 650 sheet duo drawer 550 sheets Multipurpose tray capacity 650 sheet duo drawer 100 sheets Optional 550 sheet drawer 550 sheets Optional input sources maximum 1 total of all inputs is 4 650 sheet duo drawer 550 sheets includes 100 sheet MP feeder or 100 sheets in MP feeder Multipurpose tray capacity 650 sheet duo drawer 100 sheets Optional third tray capacity 550 sheets 550 sheets tray 3 Maximum total input capacity 1451 Type of duplex Integrated duplex Standard output sources no optional output sources are available Standard 100 sheet bin n the 650 sheet duo drawer the 550 sheet tray and the integrated MP feeder count as two independent input sources The MF feeder is c
21. e Reroute the cables back through their retainers e After replacing a new fuser make sure to reset the Fuser Counter 1 POR the machine into Diagnostics mode d Turn off the printer b Press and hold 3 and 6 simultaneously C Turn on the printer d Release the buttons when the progress bar appears 2 Navigate to PRINTER SETUP gt Reset Fuser Cnt gt Reset Fuser Cnt 3 Resetting Fuser Cnt Value appears Repair information 4 35 525 63x Fuser drive motor assembly removal ol Open the front cover 2 Remove the right cover See Right cover removal on page 4 7 3 Disconnect the cable A from the fuser drive motor assembly Note If the toroid B is removed from the cable be sure to reinstall the toroid when reconnecting the cable 4 Remove the two screws C 5 Remove the fuser drive motor assembly 4 36 Service Manual Previous Next D Go Back 525 63x Fuser exit sensor removal Previous 1 Open the front cover A 2 Remove the right cover assembly See Right cover removal on page 4 7 V 3 Remove the left cover See Left cover removal on page 4 4 4 Disconnect the two wire fuser cable A from the LVPS Next Note You do not have to extract the cable 3 Go Back A 5 Remove the screw and grounding washer B on the right side of the frame Note Be careful not to lose the grounding washer 6 Disconnect the thermistor cables C oa b i i Ar E ACT R
22. on page 4 98 3 Remove the five screws A from the left front side Repair information 4 9 525 63x 4 Remove the screw B from the top right side of the cover 4 10 Service Manual Previous A D Go Back 525 63x 6 Remove the toroid holder D and two screws E from the rear The toroid holder will be used for the new top cover Previous A D Go Back T Detach the re drive belt F from the pulley on the fuser exit roll shaft 8 Disconnect the fan power cable from JFAN1 on the RIP board 9 Disconnect the bin full sensor cable from JPJ1 on the RIP board 10 Remove the top cover being careful to route the bin full sensor cable through the top of the RIP board cage Repair information 4 11 525 63x Installation notes Warning Make sure the belt is attached to the gear B Also check the tension spring to make sure it is properly attached to the top cover C The following illustration shows the properly attached spring and belt G H Warning After performing any repair that involves detaching the belt from the re drive pulley on the fuser run approximately 30 test pages both simplex and duplex to ensure the belt is performing properly While the pages are running listen for any noises buzzing clicking or rattling that might indicate improper routing of the re drive belt Installation note Install the narrow media sensor flag before reinstalling the flatbed
23. 525 63x 4 Repair information Previous Warning Read the following before handling electronic parts V Next Handling ESD sensitive parts Many electronic products use parts that are known to be sensitive to electrostatic discharge ESD To prevent Go Back damage to ESD sensitive parts use the following instructions in addition to all the usual precautions such as turning off power before removing logic boards Keep the ESD sensitive part in its original shipping container a special ESD bag until you are ready to install the part into the machine Make the least possible movements with your body to prevent an increase of static electricity from clothing fibers carpets and furniture Put the ESD wrist strap on your wrist Connect the wrist band to the system ground point This discharges any static electricity in your body to the machine Hold the ESD sensitive part by its edge connector shroud cover do not touch its Pin If you are removing a pluggable module use the correct tool Do not place the ESD sensitive part on the machine cover or on a metal table if you need to put down the ESD sensitive part for any reason first put it into its special bag Machine covers and metal tables are electrical grounds They increase the risk of damage because they make a discharge path from your body through the ESD sensitive part Large metal objects can be discharge paths without being grounded Prevent ESD sensitive parts f
24. For each color the toner cartridge engages the photoconductor so it is in contact with the surface Because of the charge difference between the toner on the developer roller and the electrostatic image created by the laser the toner will attract to the photoconductor only where the laser exposed the surface This process would be similar to using glue to write on a can and then rolling it over glitter The glitter sticks to the glue but won t stick to the rest of the can Service tips e Never touch the surface of the developer roller with your bare hand The oil from your skin may cause a charge differential on the surface and toner will not stick properly The result would be repeating blotches of voids light print on a page Then the affected cartridge will have to be replaced e lf the developer roller is damaged it will not contact the surface of the photoconductor properly The result could be repeating marks thin vertical voids or thin vertical lines of color on the printed page Check the surface of the developer for damage 3 58 Service Manual Previous A D Go Back 7525 63x Previous Step 4a First transfer When the latent images are developed on each Photoconductor the high voltage power supply sends voltage to A the 1st Transfer Rollers inside the ITU D The charge difference between the developed toner i
25. Left cover removal on page 4 4 3 Remove the AIO back cable cover See AlO back cable cover removal on page 4 8 v 4 Remove the rear shield See Rear shield removal on page 4 7 Next 5 Disconnect the ground cable A from the ADF assembly 6 Disconnect the ADF cable B from the relay card in the ADF unit 4 Go Back A B T Disconnect the ADF cable from connector JADF1 on the RIP board 8 Disconnect the ground cable C from the print engine 1 ies ll Repair information 4 89 525 63x 9 With your right hand pull the relay card end of the ADF cable up and away from the ADF while using your left hand to guide the ADF cable up through the card cage opening Note Be careful to avoid contact with the CCD ribbon cable 4 90 Service Manual Previous A D Go Back 525 63x ADF separator pad removal Previous 1 Remove the ADF separator roll See ADF separator roll assembly removal on page 4 92 A 2 Press the two tabs on each side of the pad inward V Next Go Back Repair information 4 91 525 63x ADF separator roll assembly removal 1 Lift the locking lever A 4 92 Service Manual A Previous A D Go Back Redrive unit removal po IT Remove the flatbed assembly See Flatbed removal on page 4 75 525 63x Place the flatbed facedown on a soft surface to avoid scratching the glass or marring the covers Remove the cable cover plate A Remove t
26. PRINTER SE TUF 5 uua uac ca d Rn in RC E Ran REEL ERR A A Pa Rua ddr d 3 21 DEDI as ich gd CTI d een ee ees IER E CER HUE IRA EUER EC CR epp Pod d qoi edo 3 21 Prt Color Pg Count Prt Mono Pg Count and Perm Page Count 000000 3 22 POPS 56 saa Seg beans ban ete ee pee es ULT DL POLEN E 3 22 Engine Setting 1 through 564 c cn deee odes pad we oe RS S4 ER XX E x ua urs diego s 3 22 POS ANS Lo og oe ye ove ee be SS EG Oe 4 ee Se A SS 0 Pda E ead REX TE Xr 3 22 CONO ON O ge yh hee ee ee qo ea ee ek Rap E ned xo ae ee ee HER 3 22 MESNE iie ea c 6 oo os Ce eee rerom 3 23 Reset Maintenance Counter 2 0 0 eee eee 3 23 ee oye ses aoe we eee ee ak ee Ee eS ETE ee ee eee 3 23 Sees ee ee ee rer ee eee er err See 3 23 le ee les onan sce 3 FbD PERIERE RARE Rude Gee OU acida iei door serene eens 3 23 User VEN ic au osc E 9 29924 2 214952 9399 BERET SHS dU HUE dedo S Ia EE EY dS pd ad ees 3 24 DC Charge Adjust Dev Bias Adj Transfer Adjust 0 0 00 ccc cee eee 3 24 TiS Seth M rcr 3 24 ee ge Wi See ee ee eat eee ee ae ee ee eee mee ee E E ee eC 3 24 ioo o neroa t PETEN eo eee Se he RE ROE Ee ES BE ee ee ee ee eee 3 24 Bie DUE acta es Rud s qeu xe Hare ee Rae ele d aaa owe ae ee eee ee 3 24 Peete PEENE TEETE TEE ne Senna ase sees ES RU WEAVAWPpEXesSe scsasecdae 3 25 Menu Salus PAGS aux eek db Gas Ea ER HER EUR CHOR EUREN TEESE ESR SEER SS 3 25 ci QE PP rrr 3 25 Bei a Ea 243 oe AW eR SEVERE E dum REEF dua qud ok uad da
27. Print Timeout Previous Next D Go Back 7525 63x Scan fax copy symptom table Previous 840 xx scanner error Go to 840 xx error service check on page 2 59 ADF won t duplex Duplex ADF only Go to ADF duplex service check on page 2 65 d ex Go to ADF feed errors service check on page 2 64 lt gt ADF skew Multiple pages feed into the ADF J Documents won t feed into the ADF Go Back Scanner makes buzzing noise on startup or Go to Flatbed home position service check on page 2 61 during a scan Document feeds but jams in the ADF Go to ADF paper jam service check on page 2 63 Black streaks on scans Go to ADF streak service check on page 2 63 Blank page Go to Black or blank page copy service check on page 2 60 No dial tone Go to Modem fax card service check on page 2 66 Device dials a number but fails to makea The other fax machine may be turned off Ask the fax recipient to connection with another fax machine check their machine e The sending fax machine may be faulty The sending fax machine may have a dirty document glass Incoming fax has blank spaces or poor quality A noisy phone line can cause errors Check the MFP print quality by making a copy The print cartridge may be empty Replace as necessary Invalid fax partition or fax partition too See Fax Low Power Support on page 3 36 small Some words on an incoming fax are The sending fax machi
28. Remove all the jammed pages See 230 paper jam on page 3 50 Remove all pages See 235 paper jam on page 3 50 e Open the door and remove all the jammed pages See 242 243 paper jam on page 3 52 e Verify the proper tray settings for the media e Fan the media e Check the condition of the pick tires See 242 243 paper jam on page 3 52 See 242 243 paper jam on page 3 52 Open the door and remove all the jammed pages See 242 243 paper jam on page 3 52 Open tray 2 to access the jam area Remove the jammed page See 250 paper jam on page 3 52 Open tray 2 to access the jam area Remove all the jammed pages See 250 paper jam on page 3 52 Remove the sheet of paper from the ADF Retry the job If the error recurs go to ADF paper jam service check on page 2 63 Remove all paper from the ADF Retry the job If the error recurs go to ADF paper jam service check on page 2 63 Remove original documents from the ADF Remove original documents from the ADF Diagnostic information 2 11 7525 63x 2xx paper jam messages Error code 291 00 Scanner Jam remove all originals from the scanner 291 01 Scanner Jam remove all originals from the scanner 292 Scanner jam remove all originals from the scanner 293 Replace all Originals if restarting job 293 02 Flatbed cover open 294 04 Scanner jam remove all originals from the scanner 294 05 Scanner
29. Typical electricity consumption test 5 13 kWh week Maximum ave current while printing 100 110 V 2 115 127 V 2 220 240 V 6 Low voltage models e 100 127 V 100 110 Japan at 50 60 Hz nominal e 90 137 V 90 110 Japan extreme 100 volt models e 100 V ac at 47 63 Hz nominal e 90 110 V ac extreme High voltage models e 220 240 V ac at 50 60 Hz nominal not available in all countries e 198 259 V ac extreme Notes Using a 220 V acto 110 V ac power converter with a low voltage printer is not recommended e Using an inverter to change DC to AC voltage 12 V to 120 V for example is not recommended e All X54x MFP models will comply with the ENERGY STAR e All models ship with Power Saver Mode On e The default timeout to Power Saver 60 minutes 220 V e Power Saver can be adjusted to 1 240 minutes e Power Saver mode cannot be disabled from the operator panel General information 1 7 71525 63x Acoustics All acoustic measurements are made in accordance with ISO 7779 1999 and reported in conformance with ISO9296 1988 04 15 Operating mode pressure level Idle standby mode Simplex printing mono Simplex printing color Duplex printing mono Duplex printing color ADF scan mono 46 dB ADF scan color 45 dB ADF copy mono 50 dB ADF copy color 51 dB Quiet mode simplex 46 dB printing mono Quiet mode simplex 46 dB printing color Quiet mode duplex 47 dB printing mono
30. card removal on page 4 66 Diagnostic information 2 55 7525 63x Transfer roll service check Remove the ITU See Image transfer unit Replace the ITU See Problem resolved ITU removal on page 4 43 Check the Image transfer unit ITU contacts between the HVPS and the ITU removal on page 4 43 Clean the contacts and recheck Go to step 2 Does the error reoccur 2 Does the new ITU fix the problem Problem resolved Go to step 3 Turn the printer off and remove the rear Replace the HVPS High Replace the RIP board See shield See Rear shield removal on voltage power supply RIP board removal on page 4 7 HVPS with spring page 4 19 assembly removal on page 4 40 Turn the printer on and check the cable at JHVPS1 connector on the RIP board without disconnecting it Verify the following voltage values JHVPS1 Pin Velas 24 V dc Ground 16 runa Are the values approximately correct Tray x sensor service check When the printer is in Ready state pull the Go to step 2 Go to step 4 standard tray out The display should indicate Tray x Missing Insert the tray Does the message remain on the display Check the vertical well at the right rear of the Replace the tray Go to step 3 tray for damage Is the tray damaged Check for a dislodged tray present sensor Replace the tray 1 sensor If Contact the next level of the 650 sheet tray is support affected r
31. to the following prints Cyan Alignment Step 1 Top T Coarse Adjustment Skew Z Coarse Adjustment i f 5604020 0 20 40 60 RO 4060 40 20 0 20 40 60 80 Top T Fine Adjustment Skew Z Fine Adjustment 20 18 16 14 3 ed 12 10 B HH 6 4 mni amp Emu a Current New Current New Cyan Cyan Cyan Cyan T value T value Z value Z value STEP 1 Adjust the Top T margin and Skew Z then confirm before going to Step 2 Press the up or down buttons until a check appears at the setting in need of adjustment Press Select Then use the lt and gt buttons to enter the new value Press Select to save NOTE If the alignment values cannot be determined by using the fine adjustment scales then use the coarse adjustment scales at the top of the page STEP 2 Go to the next page to adjust the Left L margin Right R margin and Bow P STEP 3 Reprint these pages to confirm final settings Go To Step 2 Diagnostic aids 3 11 7525 63x 4 Select the best choice for fine or coarse adjustment in Step 1 first page and add it to the current value for the Top Margin Top T Coarse Adjustment If the alignment is not close enough to use the fine adjustment get close to the ideal value by using the coarse adjustment marks Select the block that is most filled by the color on the left or approximate if 80 60 40 20 O 20 40 60 80 none of the blocks are completely filled and en
32. 1 Understanding the home Screen 00 0 c cece eee 3 2 Other buttons that may appear on the home screen 0000e cence ene teens 3 3 Meena soak cow ease eee beeen eae KSIEE a ee wae ee ac ee oe 3 4 Menu KEY COMDINGUONS 660s5sen ates 00864 Hed eh eee ee case A CX REA qna sc deere R Ra E AURA 3 5 Diagnoses Menu Diag MONU su dou cic RR RCRUECACRE RR RRCHECAK RC UR AERIAL CC RR RR OON RR ede ae es 3 6 Diagnostics Menu structure 45a os n CR OCURRE ACIRCR Ghee SAR Dae eee GRE ARCA bas wes 3 6 PINE SF od gc RUE be OG NGHE NUR ER RU RR Rd EP REPRE PNEU IN ERAN T 3 6 ese f p e eU rr rr 3 9 gii NM P T 3 9 Si E EE TE A Wen TETTE rrr 3 10 EHE REDE arua opis nae Pop Genie US EA RU M WIE eee ES EARUM PEE TIRES CSS 3 10 AINUBIment MOBIL 21a dot cand eead AE ON RR CRI C A E S A GER HR E RR niu eR Rp RR RC ACR a 3 11 PEON SCANS 640445 04 sro PROLES RORIS ER UE VERS IER EROR 40 E dr e rota e Oe 4 3 13 Pe S earra rr ead ea aad dene ten ca tea ate bane se eaeoe ee ee 3 13 scanner Calibration 6046 00 ce0enene Xa OK RE RACROCE GORROR RC RR RC CR OCX o CR s RR RC ote dx Rd 3 14 Bso LPI Wu m 3 14 Adusi Calhanon Vals ee 3 14 Reset Flatbed ADF Front ADF Back Calibration Values lille 3 14 MSE Nel ice 2c 3 urge A IORAORORACRIHEROR ERICH RR da qo Race ins 5446 RR SR aq dodi ua 3 14 MOOD CISC cu arqpog uea ck dog o d CER SE RR
33. 4 40 Image transfer unit ITU removal 0 00 0 cee ees 4 43 ITU without spring clamp kit removal 0 ccc eee eee eee 4 43 Continuing the removal with or without spring clamp kit llle 4 45 ee yee HDE VOM vals 22a X RE RSPERE ERE EE F dam Ra GE Ae TP ERE TERRE ERGRRAU S d 4 47 Low voltage power supply LVPS assembly removal 000 20 e eee eee eee 4 48 Left lower frame and right lower frame removal elles 4 50 eRe el DAMES NORTT S T E E E E E EEEE E ER sanas Renee ease beau eeeee 4 50 Pee oS 444 ee ird VARY VES q TEM d 68 56 6 eso ope oes Seber S 4 53 Main drive gear assembly with motor removal 0 000 eee 4 57 Pick tires removal integrated 250 sheet media tray 000 cee eee 4 60 Primea eMo eT c ORMTUTTST 4 61 imagina unit IU TOIHOVAL lt os denn AREA dna dae ARA OR REOR AREA RARE SAHOREG XA ORA ACA ERR RR S 4 63 Toner cartridge contacts removal 43x x RICE edew ab eee Ee eee ee ke ee 4 64 Toner meter cycle TMC card removal 2 0 c ccc eee 4 66 Toner patch sensor TPS left and right removal ellssesles 4 68 Tray present sensor removal 00 cee hh hh trn 4 69 USB COnnecior onal uu i Rc dr Re cores bac dl euni Jr dpud e Sale co werner bas 4 72 Waste toner Bolle removal a5 o 9 HROR niran ACACRUN P eee E AAA IER RICO sae Rn OR 4 73 Waste toner bottle contact block removal le
34. 5 Remove the flatbed pivot link Repair information 4 85 525 63x Duplex ADF rear cover removal 1 While lifting the ADF use a flat blade screwdriver to pry open the three tabs A on the bottom of the ADF cover 4 86 Service Manual Previous A D Go Back 525 63x Duplex ADF removal Previous 1 Remove the duplex ADF rear cover from the ADF assembly See Duplex ADF rear cover removal on A page 4 86 Save the cover for use on the new ADF unit 2 Disconnect the ground cable A from the ADF assembly v 3 Disconnect the ADF cable B from the ADF card located on the ADF assembly Next Go Back A B 4 Carefully pull the ADF cable and grommet away from the ADF assembly 5 Lift the ADF to an upright position 6 Use a screwdriver to release the right hinge C from the flatbed unit Repair information 4 87 525 63x T Remove the ADF assembly Note After installing the new ADF unit perform the scanner calibration procedure and the scanner manual registration procedure See Scanner Calibration on page 3 14 and Scanner Manual Registration on page 3 38 ADF input tray removal 1 Firmly grasp the ADF input tray on both sides 2 Pull the ADF input tray out of the ADF 4 88 Service Manual Previous A D Go Back 525 63x ADF cable removal Previous 1 Remove the the duplex ADF rear cover See Duplex ADF rear cover removal on page 4 86 A 2 Remove the left cover See
35. Note Support the door with one hand after removing the screw holding the restraining strap This is the Go Back longest of the eight screws Two flat headed Phillips screws are used in the door hinge T Remove the two screws C securing the interlock and cable Remove the media tray A ore wt C B A 8 Route the cable through the right hinge Note Make a note of the interlock sensor cable routing through the right hinge and front door 9 Remove screw D securing the left restraining strap to the front door gt BNET x w ia AEA 7 s D 10 Lower the front cover to align the flats on the hinges and remove the front cover Repair information 4 3 525 63x Front middle cover removal 1 Open the front cover 2 Remove the five screws A securing the front middle cover to the lower front cover 3 Pull the front middle cover away from the front cover Left cover removal Note Some printers may have a filter installed on the fan grill Remove the filter before continuing with the removal procedure 1 Remove the media tray 2 Open the front cover 3 Position the printer with the left side hanging over the edge of the table 4 4 Service Manual Previous A D Go Back 525 63x 4 Remove the three screws A on the rear side of the left cover Previous A D Go Back This dagiga Teten MIT ira Nm iem Pide ities m LI
36. Open a password entry screen Enter the correct password to lock the printer control panel Note This button appears only when the printer is unlocked and password has been set Open a password entry screen Enter the correct password to unlock the printer control panel Note This button appears only when the printer is locked The printer control panel buttons and shortcuts cannot be used while this appears Diagnostic aids 3 3 71525 63x lee Cancel Jobs Open the Cancel Jobs screen The Cancel Jobs screen shows three headings Print Fax and Network The following options are available under the Print Fax and Network headings V e Print job e Fax profile e FTP D e E mail send Go Back Change Language Menu map Each heading has a list of jobs shown in a column under it which can show only three jobs per screen If more than three jobs exist in a column then an arrow appears enabling you to scroll through the jobs Launch the Change Language pop up window that allows you to change the primary language of the printer This menu map identifies menus available to customers The diagram shows the menus on the operator panel and items available under each menu Some menu items or values are displayed only if a specific option or feature is installed on your printer Other menu items may be effective only for a particular printer language You can select these values at any time but they affect printer function
37. RIP board the cable for pinch points and the cable or connector for any other damage Is the cable damaged Check the connector JLVPS1 for proper connection to the RIP board the cable for pinch points and the cable or connector for any other damage Is the cable damaged Check the power cable on the left side of the fuser and the thermistor cables and connections on the right side of the fuser Are the cables or connectors damaged 2 38 Service Manual Previous Replace the fuser exit Replace the RIP board See A sensor See Fuser exit RIP board removal on sensor removal on page 4 19 v page 4 37 Next Go Back Check the switch on the side of the LVPS to verify the correct voltage is set Go to step 2 Replace the fuser cable Go to step 3 Go to step 4 Go to step 5 Repair or replace the LVPS cable See Low voltage power supply LVPS assembly removal on page 4 48 Repair the cables If the cables cannot be repaired replaced the fuser See Fuser assembly removal on page 4 32 Disconnect the cable at JFUSES1 on the RIP board and check the following voltages JFUSES1 Pin Value 24 V dc doors closed 24 V dc doors closed 3 24 V dc doors closed 24 V dc doors closed S Ground efem Are the values approximately correct Replace the fuser See Fuser assembly removal on page 4 32 Does the error clear Input sensor S2 service ch
38. at JINT1 and JCVR1 JINT1 JCVR1 RIP board removal on page 4 19 Pin Value Pin vae C Are the values approximately correct Open the front door and check the thin tall Replace the right cover Go to step 3 plastic web pivot plate at the top right of the assembly See Right printer With the other covers in place and cover removal on closed this web interacts with switches in the page 4 7 door Open the toner cover and check the motion of the web Is the web loose damaged or missing 2 36 Service Manual 7525 63x Previ Close the front cover and the toner door Be Contact your next level of Replace the front cover A sure the right cover is in place Turn the printer support assembly See Front off and then disconnect the cables at JINT 1 cover assembly removal v and JCVR1 Test continuity at the connector on page 4 3 under the following conditions Next With front cover and toner door closed 4 Test pin 1 and pin 3 at JINT1 cable end and pin 1 and pin 2 at JCVR1 cable end Go Back e With one or both doors open Pins 2 and 3 at JINT1 cable end should indicate continuity but pins 1 and 2 at JCVR1 should have no continuity Are the tests verified Fuser exit sensor service check Questions actions Rotate the flag paper diverter in and out of Sensor is good Go to step 3 the sensor Does the display indicate Media Clear and Media Present with the cy
39. being 99 999 Once all the memory is tested the test stops To stop the test POR the printer USB HS Test Mode To run the test UI NI Navigate to HARDWARE TESTS gt USB HS Test Mode Select a port Port 0 Port 1 Port 2 Port 3 Single Step Get Device Descriptor or Single Step Set Feature Select a test Test J Test K Test SEO NAK Test Packet or Test Force Enable USB High Speed Certification lesting appears To stop the test POR the printer Diagnostic aids 3 17 7525 63x DUPLEX TESTS Quick Test duplex This test prints a duplex version of the Quick Test that can be used to verify the correct placement of the top margin on the back side of a duplex page wed Peg Deviste information BUAREM SETTINGS Note Before you set the duplex top margin be sure to set the registration See REGISTRATION on page 3 9 The paper you choose to print the page on should be either Letter or A4 To run the test 1 Navigate to DUPLEX TESTS gt Quick Test 2 Select Single or Continuous e The single Duplex Quick test prints the Quick Test on front and back e The printer attempts to print the Quick Test Page from the default paper source e Check the Quick Test Page for the correct offset between the placement of the first scan line on the front and back side of the duplexed sheet For informati
40. change state Remove the media tray Activate the input sensor flag The sensor should change state Open the front door Activate the fuser exit flag The sensor should change state Remove the cyan toner cartridge Shine a flashlight on the toner level sensor The sensor should change state Remove the magenta toner cartridge Shine a flashlight on the toner level sensor The sensor should change state Remove the yellow toner cartridge Shine a flashlight on the toner level sensor The sensor should change state Remove the black toner cartridge Shine a flashlight on the toner level sensor The sensor should change state 7525 63x DEVICE TESTS Previous Flash Test A This test appears only when a non defective flash memory is installed Data is written to the flash card and read v back to check the accuracy This test destroys all data stored on the flash device Next Warning This test deletes all data stored on the flash device After the test is over reformat the flash using H Format Flash in the customer Utilities Menu Go Back To perform this test Navigate to DEVICE TESTS gt Flash Test Contents will be lost Continue appears Touch Yes to continue or touch No to return to DEVICE TESTS Flash Test Testing appears while the test is running When the test is complete Flash Test lest PassedorFlash lest lest Failed appears Erw dc Quick Disk Test This menu item appears only when a non defective disk is
41. com printerfirmware and inputting keycode x54x all lowercase Before performing a firmware update on the printer contact the technical service center or second level of support to verify the correct firmware and keycode The wrong firmware or wrong level of firmware could lead to a malfunction or render the printer inoperable 3 54 Service Manual Previous Next D Go Back 7525 63x Previous Theory of operation Print engine theory V Electrophotographic process EP process Next The method that all laser and LED printers use to print is called the electrophotographic process These T machines use differences in charge to manipulate and move toner from the toner cartridge to the printed page Go Back Even though the basic EP process is the same for every laser and LED printer the specifics for each printer are different We will discuss the X54x series print engine and its particular method of printing MFP electrophotographic process basics These MFPs are single laser MFPs that use four toner cartridges cyan yellow magenta and black to create text and images on media The MFP has four photoconductors called a photodeveloper cartridge or PC unit and an image transfer unit ITU Each color toner is painted to its respective photoconductor at the same time The transfer belt passes under the four photoconductors and the four color image is produced and transferred to the media in one pass Duri
42. contaminate the paper e Preprinted papers that can be affected by the temperature in the printer fuser e Preprinted papers that require a registration the precise location on the page greater than 2 3 mm 0 9 in such as optical character recognition OCR forms In some cases registration can be adjusted with a software application to successfully print on these forms e Coated papers erasable bond synthetic papers thermal papers e Rough edged rough or heavily textured surface papers or curled papers e Recycled papers that fail EN12281 2002 European testing e Paper weighing less than 60 g m 16 Ib e Multiple part forms or documents Selecting paper Using appropriate paper prevents jams and helps ensure trouble free printing To help avoid jams and poor print quality e Always use new undamaged paper e Before loading paper know the recommended print side of the paper This information is usually indicated on the paper package e Do not use paper that has been cut or trimmed by hand e Do not mix paper sizes types or weights in the same source mixing results in jams e Do not use coated papers unless they are specifically designed for electrophotographic printing Selecting preprinted forms and letterhead Use these guidelines when selecting preprinted forms and letterhead e Use grain long for 60 to 176 g m weight paper e Use only forms and letterhead printed using an offset lithographic or engraved printin
43. copy job with the default T settings Go Back If pressed while a job is scanning then the button has no effect Press to stop all printer activity A list of options is offered once Stopped appears on the display Press to put printer into or out of Sleep Mode Indicator Off The printer is off light Blinking green The printer is warming up processing data or printing Solid green The printer is on but idle Blinking red Operator intervention is needed Understanding the home screen When the printer is turned on the display shows a basic screen referred to as the home screen Touch the home screen buttons and icons to initiate an action such as copying faxing or scanning to open the menu Screen or to respond to messages Note Your home screen icons and buttons may vary depending on your home screen customization settings administrative setup and active embedded solutions Copy E mail Bookmarks Fax Search E F A Gy Le ET Page 5 lal 3 Changa Copy Language Shortcuts ex 85 Ready OLDRHEERLCC Access the Copy menus and make copies Held Jobs FIF usB E mail Access the E mail menus and send e mails Access the Fax menus and send faxes 3 2 Service Manual Icon Button Status message bar Status Supplies USB or USB Thumbdrive Held Jobs 7525 63x Access the printer menus Note These menus are available only when the printer
44. d FRU P lt gt J 40X6997 Optional 650 sheet duo drawer complete X548 includes a 100 sheet MPF Next 40X5168 Pick tire replacement CRU 40X2285 650 sheet duo drawer tray assembly X544n X544dn X544dw X540n X543dn includes a 100 sheet MPF Go Back Note Use only with P N 40X6997 drawer assembly 40X8341 Optional 550 sheet drawer complete X544n X544dn X544dw X540n X543dn 40X2512 550 sheet MPF latch cover Parts catalog 7 15 7525 63x Assembly 8 Options Part Units Units Description number in FRU P 7 16 Service Manual 40X2254 40X2255 40X2261 40X5937 40X5938 40X5939 40X1455 40X5969 40X5970 40X5971 40X5972 40X1368 3049485 ee Se CS 115 V maintenance kit fuser ITU duplex reference edge 230 V maintenance kit fuser ITU duplex reference edge 100 V maintenance kit fuser ITU duplex reference edge 128MB DDR DRAM DIMM card assembly 256MB DDR DRAM DIMM card assembly 512MB DDR DRAM DIMM card assembly 64MB Flash card assembly Korean font card assembly Simplified Chinese font card assembly Traditional Chinese font card assembly Japanese font card assembly USB cable packaged 2 m Field relocation package assembly Previous Next D Go Back Index Numerics 1xx xx service errors 2 13 2XX paper jams locations 3 46 messages 2 10 840 xx service check 2 59 8xx xx service errors 2 17 Oxx xx service errors 2 19 A ACM service check 2 32 acronyms 1 20 ADF cabl
45. dC HR CECRAUEKA 2 39 5 0 6 Pic DOp d EROR RO 4 4 RIO DOVBF TODIDVUM aoa SOROR LUCR narr eee GOR CA CREAR eee AAT R 4 7 Hear SIG TORIOUOLS 2122 thas 2s S06 wre i Oe oo ie a be a Ed ee REOR HR 4 7 AIO back cable cover removal i a uide RR RCRCRC RC Cn tac Kec oe Ce AR aC e eons bw ee ee 4 8 Top cover assembly removal 64 ick xk ORUCOACKOR A BOICACACACUA ence eee RRR eee ACRI RO RO EUR SOR ACA e s 4 9 Autocompensator mechanism ACM standard tray removal 4 13 Bin Tull Sensor removal uoa xad RRRRORRURR RCAACAR RARO nee HARR CR AOT ee bese CAO RHRHE A AECRORUN 4 16 Narrow media sensor flag removal lleeeleeeeeeeee nnn 4 17 HIP DOSFO TOMOVA ls e uou dad RORCRURORE ieee es tee eee RU CN RCRUM OR LAC UR dee eee 4 19 Duplex reference edge removal ee eeeleeeeeeee ehh 4 23 DURE BOTISOF TOTIDVUI uus rr RUR Ro Roa rao Rea RR cal RU AC CR RU Mae REC RC RCAC RR RC RH RC RL AE R 4 29 Fax eara COV oasce hx Sa RA RARE AXE AW LAT RE A AW TERRA Y a RHEE EE 4 31 FuserassembDiy TOO VAL a hoe 3 RE o ACA 9o RCXCRCRCAC NOR AO CR ACAD RC Eee OR OCC 4 32 Fuser drive motor assembly removal eleeeeeeeeeee nns 4 36 Fuser exi sensor removal aida dac ACCRUE ARRA wee a a ea cee ed RA a 4 37 Hard drive removal uasioiuadcit ogp d 18 ed eked se ARD at e REC hE bd E cde o ORI A o dna MCN CR RR OR acta 4 39 High voltage power supply HVPS with spring assembly removal
46. due to insufficient memory to store scanned image Fax transmission failed due to insufficient memory to store received image Troubleshoot MFP If the error persists see Modem fax card service check on page 2 66 Adjust Memory Use to allocate more memory for send jobs Adjust Memory Use to allocate more memory for send jobs A timeout occurred during transmission Select a lower Max Speed value under of a page in ECM mode Fax Send settings Failure to transmit training successfully in V17 V29 V27 terminal modulation schemes Failure to transmit training successfully in V33 V29 V27 terminal modulation schemes Failure to transmit training successfully in V17 V29 terminal modulation schemes Select a lower Max Speed value under Fax Send settings Adjust the Transmit Level Check line quality Select a lower Max Speed value under Fax Send settings Adjust Transmit Level Check line quality Select a lower Max Speed value under Fax Send settings Adjust Transmit Level Check line quality Diagnostic information 2 25 7525 63x Fax error log codes Error code 883 884 885 886 887 888 889 88A 901 902 903 904 905 907 908 2 26 Service Manual ei RR RR Failure to transmit training successfully in V 17 V 27 terminal modulation schemes Failure to transmit training successfully in V 29 V 27 terminal modulation schemes Failure t
47. each photoconductor B and writes an invisible image called a latent image or electrostatic image for each color The laser beam actually discharges the surface only where the beam hits the photoconductor This creates a difference in charge potential between the exposed area and the rest of the photoconductor surface Service tips The laser beam passes through a glass lens as it exits the laser unit If this lens gets contaminated with toner or other debris it will cause vertical streaking of white lightness on the page Cleaning the lens will solve the problem Never touch the surface of the photoconductor with your bare hand The oil from your skin may cause a charge differential on the surface and toner will not stick properly The result would be repeating blotches of voids light print on a page Then the photoconductor will have to be replaced The surface of the photoconductor is coated with an organic substance that makes it sensitive to light Be sure and cover the photoconductor when you are working on the printer so you don t burn it If exposed to light for too long it will cause light dark print quality problems and have to be replaced Diagnostic aids 3 57 Previous A D Go Back 7525 63x Step 3 Develop Once the laser exposes the photoconductor the high voltage power supply sends charge to the developer roll C
48. el mantenimiento de este producto est dirigida exclusivamente al personal cualificado de mantenimiento Existe mayor riesgo de descarga el ctrica y de danos personales durante el desmontaje y la reparaci n de la m quina El personal cualificado debe ser consciente de este peligro y tomar las precauciones necesarias PRECAUCI N este s mbolo indica que el voltaje de la parte del equipo con la que est trabajando es peligroso Antes de empezar desenchufe el equipo o tenga cuidado si para trabajar con l debe conectarlo Informacoes de Seguranca A seguran a deste produto baseia se em testes e aprova es do modelo original e de componentes espec ficos O fabricante nao respons vel pela segunranca no caso de uso de pe as de substitui o nao autorizadas As informa es de seguran a relativas a este produto destinam se a profissionais destes servi os e nao devem ser utilizadas por outras pessoas Risco de choques el ctricos e ferimentos graves durante a desmontagem e manuten o deste produto Os profissionais destes servicos devem estar avisados deste facto e tomar os cuidados necess rios CUIDADO Quando vir este s mbolo existe a poss vel presenca de uma potencial tensao perigosa na zona do produto em que est a trabalhar Antes de come ar desligue o produto da tomada el ctrica ou seja cuidadoso caso o produto tenha de estar ligado corrente el ctrica para realizar a tarefa necess ria XVill Service Manual
49. frame Note There are parts in the right lower frame that are not included in the frame The following instructions show how to remove them 17 Remove the sensor retaining plate J and press the latches K together to remove the tray present Sensor 18 Remove the screw L and remove the spring bracket 19 Remove the screw M and remove the plate from your printer if it does not have a wireless antenna M L K J Installation notes 1 Reinstall the spring bracket and the wireless antenna plate or the blank plate if this is not a wireless model 2 Clean the contact surface where you removed the sensor retaining plates or where you need to install the new ones 3 Install the sensors 4 56 Service Manual Previous A D Go Back 525 63x 4 Remove the backing from the new plates and place them on the surfaces A between the sensor Previous mounting posts Note Make sure the clips on the posts extend onto the surface of the plate A Next Go Back 5 Connect the cable to the tray present sensor and put the spring in place before installing the right lower frame Main drive gear assembly with motor removal A 1 Remove the left cover See Left cover removal on page 4 4 2 Remove the LVPS See Low voltage power supply LVPS assembly removal on page 4 48 3 Remove the five screws A on the top cover Repair information 4 57 525 63x 4 Remove the two screws B fr
50. installed This test performs a non destructive read write on one block per track on the disk Once executed the test cannot be canceled To perform this test 1 Navigate to DEVICE TESTS gt Quick Disk Test 2 Quick Disk Test Testing DO NOT POWER OFF appears 3 When the test is complete Quick Disk Test Test Passed or Quick Disk Test Test Failed appears Disk Test Clean This test performs a low level format of the hard disk which will destroy all data and should never be performed on a good disk This test will only be used when the disk contains bad data and is unusable Note This process does not erase any information stored on the device s NAND To perform this test 1 Navigate to DEVICE TESTS Disk Test Clean 2 Contents will be lost Continue appears Touch Yes to continue or touch No to return to DEVICE TESTS 3 Once the test starts it cannot be stopped 4 When the test is complete Disk Test Clean Test Passed orDisk Test Clean Test Failed appears PRINTER SETUP Defaults US Non US defaults changes whether the printer uses the US factory defaults or the non US factory defaults The settings affected include paper size envelope size PCL symbol set code pages and units of measure Warning Changing this setting resets the printer to factory defaults and data may be lost It cannot be undone To change this setting navigate to PRINTER SETUP gt Defaults Diagnostic aids 3 21 7525 63x Prt Color Pg
51. is in the Ready state Access the File Transfer Protocol FTP menus and scan documents directly to an FTP server Go Back Show the current printer status such as Ready or Busy Show printer conditions such as Toner Low or Cartridge Low Show intervention messages so the printer can continue processing Display a warning or error message whenever the printer requires intervention to continue processing eps us messages screen for more information on the message and how o clear it View select print scan or e mail photos and documents from a flash drive Note This button appears only when you return to the home screen while a memory card or flash drive is connected to the printer Create organize and save a set of bookmarks URL into a tree view of folders and file links Note The tree view supports only bookmarks created from this function and not from any other application Display all current held jobs Other buttons that may appear on the home screen Search held jobs Release Held Fax Unlock Device Search on any of the following items User name for held or confidential print jobs e Job names for held jobs excluding confidential print jobs e Profile names e Bookmark container or print job names e USB container or print job names for supported file types Access the list of held faxes Note This button appears only when there are held faxes with a scheduled hold time previously set
52. menu press 411 from the Ready screen V Note This menu should be used as directed by next level of support Next Print Se Menus GENERAL Go Back Copyright Displays copyright information Optra Forms mode On or off CODE Network Code Level Displays network code level Network Compile Info Displays compile information Printer Code Level Displays printer code information Printer Compile Info Displays compile information HISTORY Print History Mark History History Mode MAC Set Card Speed LAA Keep Alive NVRAM Dump NVRAM Reinit NVRAM NPAP Print Alerts TCP IP netstat r arp a Allow SNMP Set MTU Meditech Mode Raw LPR Mode Gather Debug Enable Debug Diagnostic aids 3 43 7525 63x Invalid engine code mode Backing up eSF applications and settings The RIP board contains default and custom eSF applications and settings These are not contained in the NVRAM or in the hard drive therefore a RIP board failure could result in loss of these applications and settings if they are not backed up When a new RIP board is installed the Lexmark default eSF applications and settings are loaded The best practice is for an administrator to have their eSF applications and settings backed up prior to encountering a problem If this hasn t been done an attempt to back up the data should be performed before replacing the RIP Board To back up the eSF applications and settings 1 POR the device into in
53. more operator panel buttons fail on not work page 2 41 Operator panel display is blank Go to Operator panel display is blank on page 2 42 Pages print blank after replacing the RIP board Tray linking does not work Unexpected page breaks occur Multipurpose feeder has constant misfeeds or jams Page that jammed does not reprint after you clear the jam Printing speed reduced for more than 10 pages This may happen after a service call Pages print blank after replacing the RIP board Unexpected page breaks occur 2 2 Service Manual When replacing the RIP board verify the cable from the high voltage power supply is seated properly The cable may have come loose from the HVPS Warning A blank page that should have toner on it could be an indication that toner is applied to the ITU belt but not transferred Therefore the toner goes into the ITU cleaner which cannot process massive amounts of toner It is important to prevent extensive blank pages from being processed if they should have toner on them e Check that the same size and type of paper are in each tray e Check the location of the paper guides e The multipurpose feeder does not automatically sense the paper size You must set the size from the Paper Size Type menu e Print a menu settings page compare the settings for each tray and adjust on the operator panel if necessary e Increase the Print Timeout value on the operator panel
54. number This error could occur ona controller with ROM or NAND flash and could occur as a result of the CRC check done when the machine is powered on The range of package numbers is from 0 to 15 Error Correction Code ECC Failure The source is a failing C6 VS page indicated by Bn where n the page number This error occurs only if a multi bit failure is detected during the ECC execution Single bit failures will be corrected automatically and will not result in a service error The range of page numbers is from O to 1023 Replace the RIP board Go to RIP board removal on page 4 19 Diagnostic information 2 21 Previous 4 Next J Go Back 7525 63x Service error messages fore owen te 958 xx Service Printer has performed more than 100 NAND Failure shift and reflash operations as a result of ECC bit corrections 959 01 Service Controller verification failure of pensive Update firmware or replace RIP board Go Invalid Firmware boot code to RIP board removal on page 4 19 959 02 Service Failure to authenticate signature Update firmware or replace RIP board Go Invalid Firmware verification code to RIP board removal on page 4 19 959 03 Service Signature verification code failure to Update firmware or replace RIP board Go Invalid Firmware authenticate a code partition to RIP board removal on page 4 19 959 04 Service Jump to unverified address Update fi
55. op panel USB cable for continuity Replace the RIP board See Replace the USB cable See Go Back RIP board removal on USB cable removal on Is there continuity page 4 19 page 4 112 USB service check Is the USB cable properly connected to the Goto step 2 Properly connect the cable MFP and host PC at both ends m Try a different USB cable Does this fix the Problem resolved Go to step 3 issue Connect a different device to the USB Replace the RIP RIP board There is an issue with the cable Did the host PC see the device See RIP board removal host machine on page 4 19 Diagnostic information 2 43 7525 63x Networking service check Note Before starting this service check print out the network setup page This page is found under Menu Reports Network Settings Consult the network administrator to verify that the physical and wireless network settings displayed on the network settings page for the device are properly configured If a wireless network is used verify that the printer is in range of the host computer or wireless access point and there is no electronic interference Have the network administrator verify that the device is using the correct SSID and wireless security protocols For more network troubleshooting information consult the Lexmark Network Setup Guide Questions actions Yes If the device is physically connected to the Go to step 3 Go to step 2 network verify th
56. or touch Back to return to PRINTER SETUP without saving any changes Note CHECK SUM DOES NOT MATCH appears if the value entered is incorrect Check and re enter the value Reset Maintenance Counter To reset the Maintenance Counter 1 Navigate to PRINTER SETUP gt Reset Maintenance Counter gt Reset Maintenance Counter 2 Resetting Maintenance Counter appears Reset Fuser Cnt Resets the fuser count value to zero The Event Log records each time that a user executes the Reset Fuser Count operation See Event Log on page 3 34 for more information This setting appears only if the Maintenance Warning and Intervention function is enabled in the printer Configuration ID Note Once Reset Fuser Count is initiated the sequence cannot be canceled The printer ignores all key inputs To reset the Fuser cnt 1 Navigate to PRINTER SETUP gt Reset Fuser Cnt gt Reset Fuser Cnt 2 Resetting Fuser Cnt Value appears EP Setup EP Defaults Warning Do not change the settings of this menu without guidance from your next level of support This setting is used to restore each printer setting listed in EP SETUP to its factory default value To restore EP Defaults 1 Navigate to EP SETUP gt EP Defaults 2 Touch Restore to reset the values to the factory settings or touch Do Not Restore to exit without resetting 3 The display returns to EP SETUP Diagnostic aids 3 23 7525 63x Fuser Temp Previous This adjustment can be u
57. page 4 19 7525 63x Print quality blurred or fuzzy print Previous A Run the automatic alignment The TPS sensor may be damaged To run Reset Color Cal 1 Enter the Diagnostics Menu Next a Turn off printer b Press and hold 3 and 6 T c Turn on the printer Go Back d Release the buttons when the progress bar appears 2 Navigate to TPS Setup gt Reset Color Cal 3 Resetting appears When the reset is complete the display returns to TPS Setup Blurred or fuzzy print is usually caused by a problem in the main drive gear assembly or in the image transfer unit ITU Check the main drive gear assembly and ITU for correct operation Blurred print can also be caused by incorrect feeding from one of the input paper sources media trays or duplex paper path Check the high voltage spring contacts to ensure they are not bent corroded or damaged Replace the high voltage power supply as necessary See High voltage power supply HVPS with spring assembly removal on page 4 40 Print quality half color page A photoconductor unit is not properly seated Reset the specific photoconductor unit Print quality horizontal banding Print the Print Defect Guide 1 In the Ready mode touch 2 Navigate to Help Print Defects Guide Measure the distance between repeating Replace the photoconductor Go to step 2 bands unit Remove the imaging Is the distance between bands either 35 or nid dc us o
58. prescritas Aviso sobre o laser Nos E U A este produto est classificado como estando em conformidade com os requisitos DHHS 21 CFR Subcap tulo J para produtos laser de Classe 1 e nas restantes regi es est classificado como um produto de Classe I estando em conformidade com os requisitos IEC 60825 1 Os produtos laser de Classe nao sao considerados perigosos A impressora possui no seu interior um laser de Classe Illb 3b AlGalnP que produz radia o num comprimento de onda de 650 670 nan metros Este encontra se fechado no conjunto da cabe a de impress o que nao pass vel de manuten o O sistema de laser e a impressora est o concebidos de forma a que nunca haja acesso humano a radia o laser que excede os n veis correspondentes Classe durante o funcionamento normal manuten o ou em condi es de assist ncia recomendada Xii Service Manual 7525 63x Previous Laserinformatie Dit product is in de Verenigde Staten gecertificeerd als een product dat voldoet aan de vereisten van DHHS 21 CFR paragraaf J voor laserproducten van klasse 1 Elders is het product gecertificeerd als een laserproduct V van klasse dat voldoet aan de vereisten van IEC 60825 1 New Laserproducten van klasse worden geacht geen gevaar op te leveren De printer bevat intern een laser van 5 klasse IIIb 3b AlGalnP die zichtbare straling produceert in een golflengtebereik van 650 670 nanometer in een niet bruikbare prin
59. process to flip the media being duplicated over The ADF uses a step motor and a series of sensors to determine the media s position in the paper path during the scan process The following steps are performed in creating a duplex scan on the X548 duplex ADF 1 The scanner control unit on the RIP board receives a command to create a scan fax or copy 2 A signalis sent to the ADF to poll the paper present sensor to check if the media to be scanned is in the correct position The media must be placed in the ADF input tray so it actuates the paper present sensor If the ADF paper present sensor isn t actuated a flatbed scan is run by default 3 If the media has actuated the paper present sensor an ADF scan is executed At this point the roller on the pick arm assembly drops and advances the paper into the ADF actuating the document sensor Actuating this sensor determines that this will be the first side of the document to be scanned 3 66 Service Manual Previous A D Go Back 7525 63x 4 When the document sensor is actuated a signal is sent to flatbed to move the CCD imaging unit to the ADF scan area When the CCD reaches the ADF scan area a calibration is performed on the CCD 5 The media is advanced to ADF scan sensor which is located by the takeaway roll If the paper does not A reach the ADF scan sensor in a predetermined length of time a jam error will be generated 6 When the ADF scan sensor is actuated the paper
60. questions about the information requested on the page Title Name of Tester our Name Date of Event Date of Event mmidd yy yy v Customer Customer Name Time of Event Time of Event hh mm A P M Next Job ID Jab ID dH Describe the Physical Connection 2 Type Description Channel Quality Analog C VolP F oIP 9 Clear Digital L PAB J 0K ISD J Some Noise O very Noisy Note The fields requesting the code levels model number type of problem are auto filled If the information is not in the fields it can be retrieved from the SE menu The SE menu can be accessed by pressing 411 on the keypad or typing http MFP ipaddress se in a Web browser T After all the requested information is entered into the Fax Checklist Web page press the Submit button on the bottom of the page A dialogue asking you to save the file will appear Note The file generated by the MFP is not automatically transmitted to second level support It is placed on the computer desktop 8 Enter a name for the file and indicate where you want to save the file 9 Press OK The file appears on the desktop 10 E mail the file to second level support Diagnostic information 2 71 7525 63x 2 2 Service Manual Previous A D Go Back 7525 63x 3 Diagnostic aids Previous This chapter explains the tests and procedures to identify printer failures and verify repairs have corrected the problem v Next User operator panel menus and messages JE
61. rrr rr 5 4 Bol jeie i PEE E PR d Optup e ee Se Se qon Ss he Ben ERR Exo HE 5 5 iiim eee eee eee M ree 5 16 doi NC NL iS Ss SS oe a ee Oe ee PIPER 5 17 LAPS aaa anaes ie qa QE Aq RR eae a be ee UA dci QR dup ae SR p X a CEP oe 5 18 Bo o h i EE a eee eye S Oe ee ee ee re se ere 5 19 Ther We Oe essc A EXE escapee er care eee See a eee eer eerie ea M ERR SEE 5 20 Ce les ee aoe fc ere See ee oe ee boob ee oe eee ee ee eee 5 20 Preventive maintenance leleleeeeeeeeer nnn 6 1 Sue Mopon QUIDG zai koi a tee 3C ar wa nee ene eee eee Cone oie oe bon Sae ees ae 6 1 Scheduled maintenance 6 cscs code ice a de ROO ORES ee ees 6 1 Customer replacable units CRUS 00 ccc ee 6 1 Mamana OO EIL sa iba gr ROR ACE OUROCRCRUE SOROR ROUX CORRI Re Acai dei Roco Ed RR oo HR cs 6 1 EuD Ole SONS Loi pad ed ewan cee en Md dea ROCK RCLR IC alee WEAR weber espe Re sere 6 2 Cleaning the DIIBIOE uua ote e d E EAR A aoe ONS en Kees Rex a d ed a cores Coen e CR CICER OR a 6 2 Cleaning the exterior of the printer 0 00 ccc es 6 2 Cleaning the scanner Glass Lus ndo basen rede eee SO ake eee S CRI SERRE Rr b E ER es 6 3 mOACICIC O NE TETTE TII TOS LUTTE TT 7 1 How to use this parts catalog 2 22nez x dete ede estan RR eee Rede ER RR Ra Res 7 1 FeSO FeO Ol Seek ne dde Rae E dFRREI EXE A EOS SUL RR nea OROR OCC ARCA ICON CR a CRESCE MR 7 2 ASSSmDIN 2 SCAG 6 4245 6400s yeas PEPSTASE TERES bene i gt eee oes ERO
62. sensor cable from JTDS1 connector A Right or JTDS2 connector A Left on 4 the RIP board If you are removing the left toner density sensor also disconnect the thermistor from JFUSES1 connector B on the RIP board Go Back A Right sensor B A Left sensor Note Observe the cable routing for reinstallation 4 Remove the two screws C securing the sensors C Left sensor C Right sensor Note Observe the cable routing for reinstallation 4 68 Service Manual 525 63x Installation notes Previous Whether you replace the left or right toner density sensors be sure to perform the TPS Setup Enter the A 32 digit TPS value set at the factory and printed on the barcode on the toner density sensor 1 Enter the Diagnostics Menu v d Turn off the printer b Press and hold 2 and 6 nex C Turn on the printer d Release the buttons when the progress bar appears Navigate to TPS Setup POEK Select Right or Left and touch the Keyboard icon Change the TPS value Touch Clear Enter the TPS value Touch Submit to save the settings Submitting changes displays e If the value is incorrect Checksum does not match appears and the original screen appears to re enter the value e fthe value is correct Saving changes to NVRAM appears NO Um E oT Tray present sensor removal Remove the media tray Remove the imaging unit See Imaging unit IU removal on page 4 63 Remove the rear screw A in the wa
63. source selected tray to custom type name Load the correct paper size and type in the tray verify the paper size and type load orientation settings are specified in the printer control panel Paper menu and then touch Paper changed continue e Touch Cancel job to cancel the print job Change paper source to custom string Change paper source to custom string load orientation Change paper source to paper size Change paper source to paper size load orientation Change paper source to paper size paper type Change paper source to paper size paper type load orientation Close front door Close the front door of the printer Insert Tray x Insert the specified tray into the printer Fax Station Name not The Fax Station Name has not been entered Sending and receiving faxes is set up Contact system disabled until fax is configured properly administrator Try one or more of the following e Touch Continue to clear the message e Complete the Analog Fax Setup If the message appears again then contact your system support person Fax Station Number not The Fax Station Number has not been entered Sending and receiving faxes is set up Contact system disabled until fax is configured properly administrator E Try one or more of the following e Touch Continue to clear the message e Complete the Analog Fax Setup If the message appears again then contact yo
64. study demonstrating that recycled paper produced by major mills in the US fed as well as non recycled paper However no blanket statement can be made that all recycled paper will feed well Lexmark consistently tests its printers with recycled paper 20 100 post consumer waste and a variety of test paper from around the world using chamber tests for different temperature and humidity conditions Lexmark has found no reason to discourage the use of today s recycled office papers but generally the following property guidelines apply to recycled paper Low moisture content 4 5 e Suitable smoothness 100 200 Sheffield units or 140 350 Bendtsen units European Note Some much smoother papers such as premium 24 Ib laser papers 50 90 Sheffield units and much rougher papers such as premium cotton papers 200 300 Sheffield units have been engineered to work very well in laser printers despite surface texture Before using these types of paper consult your paper supplier Suitable sheet to sheet coefficient of friction 0 4 0 6 e Sufficient bending resistance in the direction of feed Recycled paper paper of lower weight 60 g m 16 Ib bond and or lower caliper 3 8 mils 0 1 mm and paper that is cut grain short for portrait or short edge fed printers may have lower bending resistance than is required for reliable paper feeding Before using these types of paper for laser electrophotographic printing consult y
65. system software error service check on page 2 28 Go to 90x xx error 902 xx 907 xx service check on page 2 31 Go to 90x xx error 902 xx 907 xx service check on page 2 31 Go to 90x xx error 902 xx 907 xx service check on page 2 31 Go to 90x xx error 902 xx 907 xx service check on page 2 31 Go to 90x xx error 902 xx 907 xx service check on page 2 31 Diagnostic information 2 19 7525 63x Service error messages wem onion Dm 907 xx Service A general engine software error Engine Software 908 01 Service Board level was not obtained Engine Software 908 02 Service Timeout waiting for bullet serial data to Engine Software be updated 908 03 Service Engine Software 908 04 Service Over temperature condition detected Engine Software Main fan stalled 925 01 Service Main Fan 929 xx Service Toner Sensor 930 xx Service LVPS 940 xxService Cyan TMC Sensor 941 xx Service Magenta TMC Sensor 942 xx Service Yellow TMC Sensor 943 xx Service Black TMC Sensor 948 xx Service Engine Card 949 xx Service Engine Card 2 20 Service Manual NVM OK was not received from NV2 server for successfully submitted request The printer doesn t register a transition on the toner sensor for a set period of time Either the printer s toner sensor is faulty or its print cartridge is defective Low voltage power supply did not detect zero crossing The cyan cartridge toner
66. the duplex sensor When the duplex sensor is actuated the exit roll stops Also the duplex sensor indicates that this is the second side of the media to be scanned 12 After actuating the duplex sensor the transport roll moves the media to the take away roll and the ADF scan sensor Like the first pass of the media the image acquisition process is repeated for the second side of the media 13 When the trailing edge of the media reaches the reverse point the second time the solenoid again moves the diverter gate to the down position and reverses the exit roll The paper goes back into the ADF unit for a third time The paper passes through the paper path but no imaging occurs This pass is to turn the paper over to the original side up On the third pass of the media trailing edge over the reverse point the solenoid is not actuated and the paper passes out of the ADF Color theory What is RGB color Red green and blue light can be added together in various amounts to produce a large range of colors observed in nature For example red and green can be combined to create yellow Televisions and computer monitors create colors in this manner RGB color is a method of describing colors by indicating the amount of red green or blue needed to produce a certain color What is CMYK color Cyan magenta yellow and black inks or toners can be printed in various amounts to produce a large range of colors observed in nature For example cya
67. the test pages print the display returns to the PRINT TESTS HARDWARE TESTS Panel Test This test verifies the operator panel LCD function To run this test 1 Navigate to HARDWARE TESTS gt Panel Test 2 The Panel Test continually executes 3 Press 7 to cancel the test 3 16 Service Manual Previous Next D Go Back 7525 63x Button Test Previous This test verifies the operator panel button function To run this test v 1 Navigate to HARDWARE TESTS gt Button Test Next 2 Animage of the operator panel buttons appears on the LCD Press each operator panel button and see if its corresponding button on the LCD darkens l 3 Touch Back to return to HARDWARE TESTS Go Back DRAM Test This test checks the validity of DRAM both standard and optional The test writes patterns of data to DRAM to verify that each bit in memory can be set and read correctly To run this test ADDE 5 Navigate to HARDWARE TESTS gt DRAM Test DRAM Test Testing appears The printer initiates a POR and Resetting the Printer appears After POR the printer begins testing the memory DRAM Test 512MB P HHHH F HHHE appears P d4HHHHHE represents the number of times the memory test has passed and finished successfully Initially 000000 displays with the maximum pass count being 99 999 F HAE represents the number of times the memory test has failed and finished with errors Initially 0000 displays with the maximum fail count
68. this service check verify that the correct country code for the MFP is selected This A setting must match the country in which the MFP is used to transmit and receive faxes If the setting is wrong the modem settings can be changed in the Fax SE menu See step 14 These settings should only be performed v 7 with guidance from your second level support Next o weeeme e 0 Go Back modem card and the wall jack Properly connect the phone line to the modem Problem resolved Go to step 3 card and wall jack Did this fix the problem Test the phone line s ability to send and Go to step 5 Go to step 4 receive calls Does the phone line work properly Use the MFP on a properly functioning phone Problem resolved Go to step 5 jack Does this fix the problem Is the phone line being used by the MFPan Goto step 8 Go to step 6 analog line Is the line being used a VOIP line Go to step 7 Go to step 8 Have the system administrator verify that the Go to step 8 Stop here The issue is VOIP server is configured to receive faxes VOIP related The VOIP provider needs to change Is the server properly configured the server configuration Is the MFP on a PABX Go to step 9 Go to step 10 Enable Behind a PABX under fax settings in Problem resolved Disable Behind a PABX the Administrative menu and go to step 10 Did this fix the problem Is a dial prefix needed to get an outside Go to step 11 Go to s
69. vary depending on the media installed in the selected Next input source Check each Test Page from each source to assist in print quality and paper feed problems JE Go Back To run the Print Test Page 1 Navigate to PRINT TESTS 2 Select the media source to test 3 Select Single or Continuous e If Single is selected a single page is printed e f Continuous is selected printing continues until x is pressed to cancel the test If a source is selected that contains envelopes an envelope test pattern is printed If Continuous is selected the test pattern is printed only on the first envelope Note The Print Test Page always prints on one side of the paper regardless of the duplex setting 4 Touch Back to return to PRINT TESTS Diagnostic aids 3 15 7525 63x Print Quality Pages The print quality test consists of five pages Pages one and two contain a mixture of graphics and text The remainder of the pages contain only graphics The test prints on the media in Tray 1 Lexmark x54x Print Quality Test Dana Jada HET rasia feat fered tere eh This test may be printed from either Configuration Menu or the Diagnostics Menu To run the print quality pages from the Diag Menu 1 Navigate to PRINT TESTS gt Print Quality Pages 2 Printing Quality Test Pages appears and the pages print Note Once the test is started it cannot be cancelled While
70. x gt or Ready to appear before removing a tray Do not load the manual feeder while the printer is printing Wait for Load Manual feeder with lt x gt to appear Push all trays in firmly after loading paper Make sure the guides in the trays are properly positioned and are not pressing too tightly against the paper Make sure all paper sizes and paper types are set correctly in the operator panel menu Make sure all printer cables are attached correctly Diagnostic aids 3 45 7525 63x Understanding jam numbers and locations When a jam occurs a message indicating the jam location appears The following illustration and table list the paper jams that can occur and the location of each jam Open doors and covers and remove trays to access jam locations 10 um Jam number Jam location In the standard 250 sheet See 200 paper jam on page 3 47 tray and manual feeder Tray 1 ELM NEN Under the fuser See 201 paper ENT on page 3 48 Lm In the duplex unit See 230 paper jam on page 3 50 5 In the duplex unit See 235 paper jam on page 3 50 Note This jam number indicates that the paper being used for a duplex print job is not supported tmo In the standard 250 sheet See 241 paper jam on page 3 51 tray and manual feeder Tray 1 7 et In the 650 sheet duo drawer See 242 243 paper jam on page 3 52 Tray 2 8 J243 In the 550 sheet tray Tray 3 See 242 243 paper jam on page 3 52 2
71. you removed the sensor retaining plate or where you need to install the new one Guide the latches that hold the sensor in the bracket into place Remove the backing from the new plate and place the plate on the surface between the sensor mounting legs Squeeze the latches together until they extend onto the surface of the plate Reconnect the cable and reroute the cable through the retainer ae MU 4 18 Service Manual Previous A D Go Back 525 63x RIP board removal Previous Warning Warning Warning Observe all ESD precautions while handling electrostatic discharge sensitive parts See Handling A ESD sensitive parts on page 4 1 When replacing any one of the following components y e Operator panel assembly Next e RIP board 4 Replace only one component at a time Replace the required component and perform a POR before replacing a second component listed above If this procedure is not followed the printer will be Be Hack rendered inoperable Never replace both of the components listed above without a POR after installing each one or the printer will be rendered inoperable Never install and remove components listed above as a method of troubleshooting components Once a component has been installed in a printer it cannot be used in another printer It must be returned to the manufacturer CAUTION POTENTIAL INJURY There is danger of explosion if a lithium battery is incorrectly replaced Repl
72. 00 xx error reoccur during startup Replace the RIP board and restart the Problem resolved Go to step 31 device Does this fix the problem Note If an error different from the original 900 xx is displayed consult the service check for that error 2 28 Service Manual Check all the cables connected to the RIP Go to step 5 Go to step 4 board for proper connectivity Are the cables properly connected Print the following e Error log e Menu settings page e Network settings page Does the 900 xx error reoccur while these pages were printing Re attach the communications cable Restart the printer to operating mode Send the printer a print job Does the 900 xx error reoccur Note Before performing this step write down this information about the file being sent to the printer e Application used e Operating system e Driver type e File type PCL PostScript XPS etc Restart the printer to operating mode Senda different print job to the device Does the 900 xx error reoccur Upgrade the firmware Contact your next level of support for the correct firmware level to use Restart the printer to operating mode Send the printer a print job Does the 900 xx error reoccur Run a copy job Does the 900 xx error reoccur Run a scan to PC job Does the 900 xx error reoccur Reinstall the memory and send a print job to the device Does the 900 xx error reoccur Install a Lexmark reco
73. 1 Remove the steel hinge stud K Save this for use on the replacement flatbed ErbvisuE A D Go Back K 22 Remove the redrive unit L See Redrive unit removal on page 4 93 23 Remove the cable cover plates and scanner homing plates M These will be used on the replacement flatbed unit L M Warning When replacing the rear cable cover plate the cables must be routed as shown above Failure to do so could damage the cables and lead to possible paper skews and jamming 4 80 Service Manual 525 63x 24 Remove the screws N securing the flatbed link to the flatbed Previous A D Go Back N 25 Remove the flatbed link It will be used on the replacement flatbed unit Note The redrive cable covers operator panel assembly scanner flatbed guides op panel cable and USB cable need to be transferred to the replacement flatbed unit Repair information 4 81 525 63x Preparing and installing the new flatbed 1 Unbox the scanner and place it top down on a non marring surface 2 Unfold the ribbon cable and replace the toroid A from the old flatbed 4 82 Service Manual Previous A D Go Back 525 63x 3 Locate the folding guide line B and remove the paper backing from the adhesive strip located next to the folding guide line on the scanner Previous A D Go Back B 4 Fold the ribbon cable as shown Align the fold of the cable with the folding
74. 16 Service Manual Is a problem found Did replacing the developer unit correct the Problem resolved Go to step 4 problem Previous Next D Go Back 7525 63x Previ Replace the HVPS See High voltage power Problem resolved Go to step 8 A supply HVPS with spring assembly removal on page 4 40 A Next Does this fix the problem Clean the printhead Problem resolved Replace the printhead See Go Back Printhead removal on page 4 61 i Is all the packing material for the imaging unit Go to step 2 Remove the packing in question removed material Print a document that requires all four colors Replace the developer unit Go to step 3 with just a few characters to verify if one for the missing color specific color is a problem For example print the Print Quality Test Pages 1 Enter the Diagnostics Menu Turn off the printer press and hold 3 and 6 turn on the printer and release the buttons when the progress bar appears Does this fix the problem Print quality blank page 2 Navigate to PRINT TESTS gt Print Quality Pages 3 Printing Quality lest Pages appears and the pages print Is only one color missing Replace the imaging unit See Developer Problem resolved Go to step 4 unit removal on page 4 47 Does this fix the problem Diagnostic information 2 47 71525 63x 1 Remove the imaging unit and waste toner bottle 2 Replace the right cover an
75. 2 M3 x 6 Pan Head 2 M3 x 6 Shoulder 1 M3 5 X 5 Flat Head Plastite 1 METAL ROLN M3 5 8L 2 PLAST ROLN 2 9 8L 2 e PLAST ROLN 3 5 6L 4 Duplex reference edge Go Back Image transfer unit ITU assembly ACM Paper pick motor drive assembly Main drive gear assembly with motors Fuser assembly 110 V Fuser assembly 220 V Fuser assembly 100 V Narrow media flag 100 V Maintenance kit 115 V Maintenance kit 230 V Maintenance kit Front toner door pivot Parts catalog 7 9 7525 63x Assembly 5 Electronics 1 7 10 Service Manual Previous A D Go Back Assembly 5 Electronics 1 Part Units Units Description number iu FRU P 40X6514 2 40X5404 40X8395 4 40X5426 40X5409 40X5413 40X0269 40X3141 40X0288 40X0271 40X0275 40X1772 40X1773 40X0273 40X1774 40X4596 40X0303 40X0270 40X1792 40X1791 40X0301 40X7054 40X5485 40X7058 CON NN c c co c4 c4 c4 co c4 c4 c4 c cd OO O1 7525 63x Previous A V Next D Go Back RIP board Toner meter cycle card assembly High voltage power supply Photo sensor one per package used for A Tray present B Duplex C Narrow Media D Exit bin Low voltage power supply universal power supply Fuser exit sensor Power cord 2 5 m straight USA Canada Power cord 2 5 m straight Europe and others Power cord 2 5 m straight Argentina Power cord 2 5 m straight United Kingdom Power cord 2 5 m straight
76. 3 11 It is also the first step in aligning the duplex Next registration See Quick Test duplex on page 3 18 To adjust this setting gt Go Back 1 Print a Quick Test Page See Quick Test on page 3 10 2 Scroll up or down and select the margin setting you need to change 3 Touch or to adjust the settings 4 Touch Submit to save the settings or touch Back to return to the Diagnostics Menu without saving any changes The print registration ranges are Description Direction of change Top margin 50 to 50 A positive value moves the image down the uch EE conrecoondaie s page and increases the top margin while a ta 600 dpi ie te 0 0133 negative value moves the image up and eene e pi scan rate 0 decreases the top margin No compression or inches or 0 339 mm expansion occurs The default value is O Bottom margin 25 to 25 A positive value moves text down the page and Cah mereme Caes narrows the bottom margin while a negative seron nin he value moves text up the page and widens the p P E bottom margin The image is compressed or ottom margin expanded The default value is O Left margin 25 to 25 A positive value moves the margin to the left Each i t ds to 4 while a negative value moves the image to the AEA E wd right No image compression or expansion pixels at 600 dpi 0 00666 in or occurs 0 1693 mm The default value is O Right margin 50 to 50 A positive value moves the margin to the le
77. 3 In the multipurpose feeder See 250 paper jam on page 3 52 In the ADF See 290 294 ADF paper jams on page 3 53 See 291 xx ADF paper jams on page 3 54 3 46 Service Manual Previous Next D Go Back 7525 63x 200 paper jam Previous 1 Pull out the standard 250 sheet tray Tray 1 A 2 Grasp the jammed paper on each side and gently pull it out Note Make sure all paper fragments are removed v Next D Go Back 3 Insert the tray 4 From the printer display touch Continue jam cleared Diagnostic aids 3 47 7525 63x 201 paper jam Previous CAUTION HOT SURFACE A The inside of the printer might be hot To reduce the risk of injury from a hot component allow v the surface to cool before touching Next 1 Open the front cover Go Back 2 Grasp the jammed paper on each side and gently pull it out Note e Make sure all paper fragments are removed here may be a second sheet jammed if 200 xx Paper Jam and 202 xx Paper Jam appear 3 Close the front door 4 From the printer display touch Continue jam cleared 3 48 Service Manual 202 paper jam CAUTION 7525 63x The inside of the printer might be hot To reduce the risk of injury from a hot component allow the surface to cool before touching 1 Raise the scanner assembly to the up position 2 Open the front cover 3 Grasp the green lever and pull the fuser cover Diagnostic aids 3 49 Previous A
78. 36 See Min Copy Memory on page 3 36 See NumPad Job Assist on page 3 37 See Format Fax Storage on page 3 37 See Fax Storage Location on page 3 37 See Automatic Color Adjust on page 3 37 See ADF Edge Erase on page 3 38 See FB Edge Erase on page 3 38 See Scanner Manual Registration on page 3 38 See Disable Scanner on page 3 39 See Jobs On Disk on page 3 39 See Disk Encryption on page 3 39 See Erase All Information on Disk on page 3 39 See Wipe All Settings on page 3 39 See Font Sharpening on page 3 40 See Require Standby on page 3 40 See UI Automation on page 3 40 See Key Repeat Initial Delay on page 3 41 See Key Repeat Rate on page 3 41 See Clear Custom Status on page 3 41 See Pel Blurring on page 3 40 See USB Speed on page 3 41 See USB PnP on page 3 42 Automatically Display Error Screens See Automatically Display Error Screens on page 3 42 Exit Config Menu See Exit Config Menu on page 3 42 3 32 Service Manual 7525 63x Reset Separator Roll and Pick Assembly Counter To reset the counter 1 Navigate to Reset Separator Roll and Pick Assembly Counter 2 Touch Reset Separator Roll and Pick Assembly Counter to reset the counter 3 Resetting appears and the display returns to Reset Separator Roll and Pick Assembly Counter USB Scan to Local USB Scan to Local enumerates a
79. 4 12 Service Manual Previous A D Go Back 525 63x Autocompensator mechanism ACM standard tray removal Previous 1 Remove the toner bottles the waste toner bottle and the imaging unit IU See Imaging unit IU A removal on page 4 63 and Waste toner bottle removal on page 4 73 2 Remove the rear shield See Rear shield removal on page 4 7 v 3 Remove the left cover See Left cover removal on page 4 4 Next 4 Remove the right cover See Right cover removal on page 4 7 5 Disconnect the ACM cable connector JSP1 A from the RIP board 4 6 Unclip the cable B from the retainers C on the left side Go Back ELT d Ei i a Male DEOR LC om y 73 Y j 1 j 1 at s ir T i A of P x E x an i j F d Fi F ii m c UNE TA 1 A B C T Reinstall the rear shield to protect the RIP board Turn the printer so the bottom is facing you 8 Carefully tilt the printer so the rear shield rests on the table Repair information 4 13 525 63x 9 Remove the two springs D 4 14 Service Manual D Previous A D Go Back 525 63x 11 On the right side loosen the screw F and hold the ACM in place as you use your fingers to remove the screw Previous A D Go Back 12 Move the right side of the ACM out to free the shaft from the hole in the frame Note Observe the location of
80. 43 sensors duplex service check 2 35 duplex manual feed sensor S1 service check 2 35 front door service check 2 36 fuser exit service check 2 37 input sensor S2 service check 2 39 tray present removal 4 69 tray sensor service check 2 56 service checks 900 xx system software error 2 28 90x xx error 2 31 925 01 fan error 2 31 925 01 fan error 2 31 950 xx NVRAM failure 2 32 ADF service checks 2 62 autocompensator mechanism 2 32 bin full sensor 2 33 black page 2 60 dead printer 2 34 duplex manual feed sensor S1 2 35 fax card 2 66 fax transmission 2 67 flatbed 2 61 flatbed motor 2 61 front door sensor or switches 2 36 fuser 2 38 fuser exit sensor 2 37 input sensor S2 2 39 main drive gear assembly 2 40 modem 2 66 networking 2 44 op panel USB cable 2 43 operator panel 2 41 option trays 2 57 print quality 2 45 see also print quality service check printhead 2 54 scanner fax copy 2 59 840xx error check 2 59 black page or blank page 2 60 CCD service check 2 60 fax reception service check 2 68 flatbed home position 2 61 flatbed motor 2 61 transfer roll 2 56 tray sensor 2 56 USB 2 43 service error messages 2 13 symptom tables 2 2 symptoms print quality 2 4 printer 2 2 scan fax and copy 2 3 T theory of operation color theory 3 67 paper path transport components 3 64 print engine theory 3 55 scanner 3 66 toner cartridge contacts removal 4 64 toner meter cycle card removal 4 66 toner patch sensor remova
81. 525 63x JCCD1 CCD ribbon cable FBR AFE SDI f A y 5 G G 1 7 FBR_AFE_D 5 FBR_AFE_D 6 _D _D _D _D _D _D _D Us RBRAREOM l l w po o m FRAEXMER G ND ND ND ND ND 0 1 2 3 4 5 6 T7 18 9 0 1 2 3 4 5 JCFAN1 Locations 5 7 71525 63x Connector JCTM1 O1 lt CART_METER_C_IN CART_METER_M_IN CART METER Y IN CART METER K IN Ground V 24V CVR 24V dc COVER OPEN cover open 0V dc closed 24V dc FAN FG Ground V FAN P3 FB A FB A FB B FB B I2CDATA LED DRV YLW2 I2CCLK Ground PWR BUTTON 3 5V JCVH1 JFAN1 JFBM 1 Flatbed Motor JFP1 Ground SPEAKER1 SPEAKER2 Ground V FUSB USB DM1 USB DP1 Ground JFPUSB 1 Operator panel USB port M1 Ground M NO Ground 5 8 Service Manual Previous Next D Go Back 7525 63x V_FUSER_PHA 24V dc doors closed A JFUSES1 JHD1 JHS1 Home Sensor 5 mo 12C_DAT 12C_CLK GNDS HOME_C Next 1 ae cy ce ca a LEN LM LEN ca ca a C is LN E Em CIN is LX a Locations 5 9 71525 63x EURHESIUI Previous JHVPS1 M DEV PWM OUT A K DEV PWM OUT v C DEV PWM OUT CMY CHG PWM OUT Y DEV PWM OUT HO K_CHG_PWM_OUT Go Back CMY_SRVO_OUT ITM_TX_PWM_OUT CMY_TX_PWM_OUT ITM_SRVO_OUT K_SRVO_OUT K_TX_PWM_OUT 24V Next 0 2 ah 4 5 6 Ground 5V_HVPS_REF Ground 5V Fused Grou
82. 63x Previous Scanner Copy Fax service checks 840 xx error service check Vv Next EN C mee POR the device into Configuration mode Go Go to step 2 Stop Problem resolved Go Back to Disable Scanner and select Enabled See Disable Scanner on page 3 39 POR the device into operating mode Try running a copy from the ADF and flatbed Did the 840 xx error reoccur Re enter Configuration mode navigate to the Go to step 3 Go to step 8 Disable Scanner Does the screen display ADF Disabled or Auto Disabled Check the ADF cable connections on the ADF Go to step 5 Go to step 4 relay card and the RIP board Also inspect JFBM1 JHS1 and JCCD1 on the RIP board Are the connections properly connected Properly connect the connections on the ADF Go to step 5 Stop Problem solved relay card and RIP board POR the device into Configuration mode Go to Disable Scanner and select Enabled See Disable Scanner on page 3 39 POR the device into operating mode Try running a copy from the ADF and flatbed Did the 840 xx error reoccur Check the continuity on the ADF cable Go to step 7 Go to step 6 Is there continuity Replace the ADF cable POR the device into Go to step 7 Stop Problem resolved Configuration mode Go to Disable Scanner and select Enabled See Disable Scanner on page 3 39 POR the device into operating mode Try running a copy from the ADF and flatbed Did the 840 xx erro
83. 6dBm 59dBm Ring Detection Complies with all regulatory requirements Fax resolutions Receive 200 x 100 dpi 200 x 200 dpi 300 x 300 dpi 400 x 400 dpi 204 x 98 dpi 204 x 196 dpi 204 x 391 dpi 408 x 391 dpi 200 x 100 dpi 200 x 200 dpi 300 x 300 dpi Miscellaneous fax specifications 4MB flash More than 320 pages based on ITU chart 1 User L parameters are stored in NVRAM network attach modes 1 18 Service Manual Previous Next Go Back 7525 63x Previous Tools required for service Flat blade screwdrivers various sizes V 1 Phillips screwdriver magnetic 2 Phillips screwdriver magnetic Next 2 Phillips screwdriver magnetic short blade 7 32 inch 5 5 mm open end wrench T 7 0 mm nut driver Go Back Needlenose pliers Diagonal side cutters Spring hook Feeler gauges Analog or digital multimeter Parallel wrap plug 1319128 Flash light optional General information 1 19 Acronyms ac ACM ADF ASIC C CCD CMYK CRC CRU dc DIMM DRAM ECC ECM EEPROM EP EPROM ESD FB FRU GB HBP HTML HVPS Hz ITU K LAN LASER LCD LED LVPS M MB MFD MFP MH mm MMR MPF MR NAND NVM NVRAM OCF OPT PC PDF PIXEL PJL POR 1 20 Service Manual Alternating Current Autocompensator Mechanism or paper feed Automatic Document Feeder Application Specific Integrated Circuit Cyan Charge Coupled Device Cyan magenta yellow and black Cyclic redundancy check Customer R
84. 76 Service Manual 525 63x 11 Disconnect the operator panel ground cable D from the LVPS ErbvisuE A D Go Back E OUEE9N 12 Thread the ground cable E under the top cover Repair information 4 77 525 63x 13 Disconnect the screw F connecting the flatbed to the AIO link on the rear of the MFP 14 Carefully disconnect the AIO link from the flatbed 15 Remove the two screws G securing the flatbed hinge to the top cover 16 Remove the two springs H between the flatbed and top cover G H Note Some units don t have the springs installed 4 78 Service Manual Previous A D Go Back 525 63x 17 Gently pry the front flatbed hinge J towards the front of the top cover to disengage it from the top cover Pisis guide pin A D Go Back sae 18 Carefully pull the flatbed unit towards the front of the MFP while using your other hand to route the cables through the top cover 19 Remove the CCD ribbon route cover and homing guide attachment 20 Disconnect the op panel ground termination from the LVPS Note This completes the removal of the flatbed assembly from the print engine The removals for the FRUs attached to the flatbed are covered under different removal procedures In addition to the FRUs the following steps illustrate the additional parts that need to be removed from the old flatbed and transferred to the new flatbed Repair information 4 79 525 63x 2
85. ANSEN xvii Go Back HI ee ee ee EEEE EAEAN ee XX CONG NOR E E E E E E E E E Gur uerb E A E E E o ii XX Pe ale oie eet TEE e TII TTE eee eee eee TETTI ATT TREPI xxi General information llle nn 1 1 aaee o e E E E E AE E Hi qu EIN eee eae ee ee Rc Mud me m i a a dedi RUE E o a d 1 1 OOS and tes uiua puce bad aod d RR CEU REED ER ERE OR ba RE e x ti ed Ro I ia 1 1 POOT 4 ica cas HEROS ERRORI eesie A6 RU CRURA A NUR AU CR DOR E nRR bares Rca d E ded Sul 8 3 Ru ACCU RL 1 2 PRN Oe Co o REA RE era a pe E RAN EE RSEN RE REP ek aoa RENE CINE 1 2 Connectivity network Support 0 00 cc hh mn 1 3 SiccuneEus MDC C rerrererrrTTT 1 4 h jcE jjj PODIUM 1 4 DUHONSIURS osa 3 e540 qd PC PPIXA TE EGdIEKCXYpEPRGTIa qe e TA EWASPESDEVCA X ees heroes 1 5 IIo MCCC 1 6 Power and electrical specifications 000 cc eee ne 1 7 PONS e a5 oe e eb T ieee a eas wae EETA bee ew aes bees cae E 1 8 Environment Speci aO in 4 RAE WARE AEG RHRRRE S RSRESCO 0465514061 085s5500s EAE E 1 8 Merman acea iced a etr tea RENE REGERE GLA E E E R28 ses Shee 6a SOR eee seu cern RR E 1 9 INOUE and OUIDUE SOURCES ook RORQCASCUNRCRCROCRURA RE Nee ES RSS ee eee ee A RON CRGA 1 9 wijg4secp sence cam EREE ARA hw eenses ee ease he pede ears wee ewes 1 9 Media input size specificationS 0 0 cee nn 1 10 Media input type specifications 4 eus d ak e ROCCO RCICRCOCRCRCALCRU CREE RC ACLARAR CR CR 1 12 Media output size a
86. BX setting e Check phone line e Check MFD modem hardware Check with remote end if successive attempts fail See Modem fax card service check on page 2 66 A timeout occurred after dialing the Check with remote end if successive number and waiting for a response attempts fail Fax cancelled by user No action needed Modem detected a digital line connection Verify the MFP is connected to an analog line See Fax transmission service check on page 2 67 Phone line was disconnected Restore phone line connection 7525 63x Fax error log codes Previous meme mm ncn Received request for unsupported No action needed function from remote fax device Heceived request for unsupported No action needed image width from remote fax device lt gt Next J Go Back Received request for unsupported No action needed compression type from remote fax device Received request for unsupported No action needed image length from remote fax device A02 Received request for unsupported No action needed image resolution from remote fax device Diagnostic information 2 27 7525 63x Previous Service checks CAUTION V Service checks which involve measuring voltages on the LVPS HVPS low voltage power supply high voltage power supply board should be performed with the printer positioned on Next its back side H Note When making voltage readings always use frame ground unless another gr
87. Bar HE RD n MARA A RIX ED DUBIE Y fes FRE BE TRI T8 Ge Wid WAS SI WHER TERP in PCT GS FL ARE Wa LEFT IRR TE BU nn FY FUSE k WEET m A aE FEDER BUT ESA ze A S Safety information XiX 7525 63x Preface Previous This manual contains maintenance procedures for service personnel It is divided into the following chapters V 1 General information contains a general description of the printer and the maintenance approach used to WE repair it Special tools and test equipment as well as general environmental and safety instructions are Ee discussed 4 Diagnostic information contains an error indicator table symptom tables and service checks used to isolate failing field replaceable units FRUs ISO BAEK Diagnostic aids contains tests and checks used to locate or repeat symptoms of printer problems Repair information provides instructions for making printer adjustments and removing and installing FRUs Locations uses illustrations to identify the connector locations and test points on the printer Preventive maintenance contains the lubrication specifications and recommendations to prevent problems Parts catalog contains illustrations and part numbers for individual FRUs gt oC PO N Change history Revision date Updates 2013 07 31 Updated 40X5468 to 40X8092 and 40x5492 to 40X8342 2013 01 16 Added installation note to perform Motor detect test and Scanner manual registration after replac
88. Count Prt Mono Pg Count and Perm Page Count Previous These page counts can only be viewed and cannot be changed To view these settings V 1 Navigate to PRINTER SETUP Next 2 Navigate to the page count you wish to view H e Prt Color Pg Count e Prt Mono Pg Count Go Back Perm Page Count The value of the page count appears beside the page count category Serial Number This setting records the serial number that was assigned by manufacturing The serial number can be viewed and can also be changed To view or change the serial number 1 Navigate to PRINTER SETUP gt Serial Number 2 Type the serial number using the on screen keyboard 3 Touch Submit to save the settings or touch Back to return to PRINTER SETUP without saving any changes Engine Setting 1 through 4 Warning Do not change these settings unless requested to do so by your next level of support Model Name The model name can only be viewed and cannot be changed Configuration ID The two configuration IDs are used to communicate information about certain areas of the printer that cannot be determined using hardware sensors The configuration IDs are originally set at the factory when the printer is manufactured However the servicer may need to reset Configuration ID 1 or Configuration ID 2 whenever the HIP board is replaced The IDs consist of eight digits The first seven digits in each ID are hexadecimal numbers while the last digit is a checksum of the
89. D on page 3 22 Reset Maintenance Counter See Reset Maintenance Counter on page 3 23 ITU Barcode See ITU Barcode on page 3 23 Reset Fuser Cnt See Reset Fuser Cnt on page 3 23 EP SETUP EP Defaults See EP Defaults on page 3 23 Fuser Temp See Fuser Temp on page 3 24 See DC Charge Adjust Dev Bias Adj Transfer Adjust on page 3 24 DC Charge Adjust Dev Bias Adj Transfer Adjust Right See Right or Left TPS on page 3 24 Left Cal Ref Adj See Cal Ref Adj on page 3 24 Reset Color Cal See Reset Color Cal on page 3 24 REPORTS Menu Settings Page See Menu Settings Page on page 3 25 Diagnostic aids 3 7 71525 63x EVENT LOG Display Log See Display Log on page 3 25 Print Log See Print Log on page 3 25 Clear Log see Clear Log on page 3 26 DEVELOPMENT MENU Do not use For development use only SCANNER TESTS ASIC Test See ASIC Test on page 3 26 Feed test See Feed Test on page 3 26 Sensor Tests See Sensor Tests on page 3 26 Scanner Calibration Reset See Scanner Calibration Reset on page 3 31 ADF Magnification See ADF Magnification on page 3 31 EXIT DIAGS See EXIT DIAGS on page 3 31 3 8 Service Manual Previous Next Go Back 7525 63x REGISTRA TION Previous Printer A V Print registration makes sure the black printing is properly aligned on the page This is one of the steps in aligning a new printhead See Alignment Menu on page
90. Go Back Understanding the operator panel 10 Operator panel buttons Display Views scanning copying faxing and printing options as well as status and error messages Enters numbers letters or symbols on the display Press to cause a two or three second dial pause in a fax number In the Fax To field a Pause is represented by a comma From the home screen press to redial a fax number The button functions only within the Fax menu or with fax functions When outside of the Fax menu fax function or home screen pressing causes an error beep In the Copy menu press to delete the right most digit of the value in the Copy Count The default value of 1 appears if the entire number is deleted by pressing numerous times In the Fax Destination List press to delete the right most digit of a number entered manually You can also press to delete an entire shortcut entry Once an entire line is deleted another press of causes the cursor to move up one line In the E mail Destination List press to delete the character to the left of the cursor If the character is in a shortcut then the shortcut is deleted Diagnostic aids 3 1 71525 63x 5 USB port Insert a flash drive to send data to the printer or to scan a file to the flash drive b Press to return to the home screen Next 7 Submit Press to initiate the current job indicated on the display From the home screen press amp to start a
91. Israel Power cord 2 5 m straight Switzerland Power cord 2 5 m straight South Africa Power cord 2 5 m straight Denmark Power cord 2 5 m straight Brazil Power cord 2 5 m straight PRC Power cord 2 5 m straight Traditional Italy Power cord 2 5 m straight Japan Power cord 2 5 m straight Korea Power cord 2 5 m straight Taiwan Power cord 2 5 m straight Australia Fax PCBA Fax interface cable Hard drive Parts catalog 7 11 7525 63x Assembly 6 Electronics 2 7 12 Service Manual Previous A D Go Back 7525 63x Assembly 6 Electronics 2 Previous Part Units Units Description number option FRU P 6 1 lt gt J 40X5429 1 ITU paper path thermistor 40X5414 2 Toner patch sensors left or right one in package mn 40X7046 1 Waste toner bottle contact block 40X5421 1 Imaging unit contact Pogo pin a Back 40X5423 1 Cable packet used for A AC power in B Low voltage power supply C High voltage power supply D Fuser S 1 E CMY K motors F Option tray G Fuser exit narrow media bin full H Wire tie 1 0mm NS Tray present cable Parts catalog 7 13 7525 63x Assembly 7 Media drawers and trays 1 14 Service Manual Previous A D Go Back 7525 63x Assembly 7 Media drawers and trays Previous Part Units Units pescripilon number
92. MB Option Slots single slot is available for either font or flash memory card Font card support 1 font card Optional user flash 256MB memory card sizes USB 2 0 High Speed Ethernet 10 100 BaseTx USB A allows direct USB printing using approved USB flash memory device PictBridge allows printing photos directly from a compatible camera Print quality During the life of the printer components are subject to wear based on usage Printers continuously operating at or near the maximum duty cycle may require service for replacement of these components to ensure high quality printing and good performance throughout the life of the printer Replacement is recommended every 60 000 pages for the fuser and 60 000 pages for the ITU The fuser and ITU replacement should be determined by checking the last sheet of the Menu Settings Page Either OK or Replace appears To print a Menu Settings page from the home screen navigate to gt Reports gt Menu Settings Page Heplacement is recommended every 30 000 pages for the imaging unit e 4800 CQ default full printer speed e 1200 dpi reduced printer speed is supported in PS and PCL only 1 2 Service Manual Previous Next D Go Back Connectivity network support Network protocol supported Standard Ethernet 10 100 Base T Standard USB B Full speed device port USB A host ports In front low full speed This port only supports the following flash drives and file types
93. Menu Settings Page on page 3 25 Turn off the printer or select Exit Diags Print the Menu Settings pages from the Configuration Menu See Menu Settings Page on page 3 33 QOL GU NI gt Diagnostic aids 3 35 7525 63x To reset factory defaults Previous 1 Navigate to Factory Defaults A 2 Choose the setting to reset e Restore Base resets all non critical base NVRAM settings v e Restore STD NET resets the eSF configuration Next e Restore LES resets all network NVRAM settings 3 Restoring Factory Defaults appears followed by Resetting the Device The printer performs a POR T Go Back Energy Conserve Affects the values that display in the Sleep Mode setting in the General Settings Menu This menu item appears only when the printer model does not support Automatic Power Saver or has deactivated Automatic Power Saver The menu item affects only the values that are displayed in the Power Saver menu item Select Off in Energy Conserve to allow Power Saver in the customer menu to display Disable as an option If Disable is selected in the customer Power Saver the printer deactivates the Power Saver feature Select On the default in Energy Conserve to prevent Disable from appearing as an option in the Power Saver setting and preventing the customer from turning off Power Saver To change this setting 1 Navigate to Energy Conserve 2 Touch or to change the setting 3 Touch Submit to save the setting or to
94. Motor service check on page 2 31 141 01 Service Staging motor has exceeded the ramp Go to 90x xx error 902 xx 907 xx Staging Motor up table service check on page 2 31 141 02 Service Staging motor has exceeded number Go to 90x xx error 902 xx 907 xx Staging Motor of encoders at min PWM service check on page 2 31 141 03 Service Staging motor has exceeded number Go to 90x xx error 902 xx 907 xx Staging Motor of encoders at max PWM service check on page 2 31 141 04 Service Motor encoder count did not change Go to 90x xx error 902 xx 907 xx Staging Motor between interrupts service check on page 2 31 141 05 Service Staging motor has encountered a stall Goto 90x xx error 902 xx 907 xx Staging Motor timeout service check on page 2 31 150 xx Service Black ITU cartridge motor Go to Main drive gear assembly EP Black ITU cartridge drive service check on page 2 40 Motor 150 01 Service Failed to achieve lock for motor within Go to Main drive gear assembly EP Black ITU cartridge allotted time drive service check on page 2 40 Motor 150 02 Service Timeout waiting for SAP BLDC motor Go to Main drive gear assembly EP Black ITU cartridge to reach valid FG speed drive service check on page 2 40 Motor 150 03 Service Timeout waiting for Go to Main drive gear assembly EP Black ITU cartridge MP NUM INITIAL SAP HALLS drive service check on page 2 40 Motor 150 04 Service Timeou
95. N sone e Oe noe eae ee ean eae ee oo ewe ee ee race re ee hae 3 45 Piin et ee ee ee ee ee ee 3 45 Understanding jam numbers and locations 0 00 eee eee 3 46 ee Lada ug mE eae ene vA V eee eee ace Kane dcb EX cR eee duced d RE Ed 3 47 BOT PEODETL IE addc d 99 d 355 9 4 1599 QE dO E ORC E S dre di EQ dob dO QU ode Reh do qo pol d Rc 3 48 EO EGS I oa 3 baad bee 52S AAS SHE POI Redon Rd E E a Roa RC RR ee ee 3 49 c aee e LIE audae d do 4 dee ak dodi 9E ac acp Soin a a E Pawo Eh a don 3 50 Bee UE ao uaa ee ole ee ec uae GR CR REOR cde dd cuc Ae Ode ed RR Rar dg A KC Un 3 50 CUT TODA DU aud rA eo EOS EE d EORR OU ek Voc RICO E ET OE E 9 305 E ERR 3 51 Eqa 295 Patel IA 43 iori de a eS CORE ER AEE RAS EC EE es 3 52 ZOD DEBBIE noa qq d RrPEROEAd ES Eque 4 EI Q4 ERZASERG 1484 E ee E E 3 52 290 294 ADF paper As cresie Vue a RE CERRO ACELERAR 9 E RO RCAC RH n ue e as 3 53 SOT OC B Dae IOS acad ead doo oC A ease EE RH oe ax os bb es EE CRUCE OCCORRE 3 54 Updating PMST MNAE iban pana ROG e Un RC RO RCDCR E CC UR RC CC obo sae Ka CR eek 3 54 Theoy ol OR SIO Olas 3 5 5 oo OUR sees cease SORGE RON a Or EEG 3 55 Print enaine MOON vo qx doppi X 39 ene on OCC OS ROE DO Che ACRCR GR CR RC RCRR RC RR 3 55 Electrophotographic process EP process 0 0 0 eee ees 3 55 MFP elecirophotographic process basics hueso adus ee beere d Ex EU EX Ed Rau 3 55 SIE TCI nos 4 Ede Re a gaa teds whee ee sess ead RP Pn bud Eadem 3 56 agi EXPOSE euin depr
96. Name Fax user setting Is it enabled Disable Block No Name Fax user setting Problem resolved Did this fix the issue Go to the Administrator menu Enter the Fax Go to step 18 settings Analog Fax Settings submenu Verify the remote device number is not in the Banned Fax List user setting Is the remote device number in the banned fax list Remove the remote number from the banned Problem resolved fax list Did this fix the problem 7525 63x lt gt Go to step 9 Go to step 10 Go to step 11 Go to step 12 Stop here This is an issue with the VOIP provider Go to step 15 Go to step 15 Go to step 17 Go to step 17 Go to step 19 Go to step 19 Diagnostic information 2 69 Previous Next J Go Back 7525 63x Previ Adjust the Receive Threshold setting in the Problem resolved Go to step 20 A SE menu press 411 to enter the SE menu enter Modem settings and select Receive V Threshold d ex Test by adjusting the received signal level by decreasing increasing the Receive Threshold 4 setting in steps of 2 db For example if default value is 43 db changing it to 45 db will Go Back decrease the received signal level by 2 db and changing it to 41 db will increase the received signal level by 2 db Recommended adjustment range is between 33 db and 48 db in 2db steps Did this fix the problem Press 411 to enter the SE Menu Select Pro
97. P address to the printer V Note The printer IP address should match Next the IP address on the printer driver Did this fix the problem gt Go Back Try using a different ethernet cable Problem resolved Go to step 14 Did this remedy the situation Have the network administrator check the Replace the RIP board See Contact the network network drop for activity RIP board removal on administrator page 4 19 Is the drop functioning properly Is the device physically connected Go to step 13 Go to step15 ethernet cable to the network Print quality service checks Note This symptom may require replacement of one or more CRUs Customer Replaceable Units designated as supplies or maintenance items which are the responsibility of the customer With the customer s permission you may need to install a developer toner cartridge or photo conductor unit Service tip Before troubleshooting any print quality problems do the following 1 Print a menu settings page and check the life status of all supplies Any supplies that are low should be replaced To print a Menu Settings page from the home screen navigate to gt Reports gt Menu Settings Page Note Be sure and keep the original menu page to restore the customer s custom settings if needed 2 Onthe menu page make sure the following is set to the default level e Color Correction Set to Auto e Print Resolution Set to 1200 dpi print quality problem
98. Pad Raves ES 3 25 FIO A200 PEE TE EE ETE R24 RE MUR Sd dedos qudd ad Qu RR Eq oe hei PURA S DNA 3 25 4 iK o PCI ETT PES 3 26 SCANNER TESTIS auae 31m dichos 3E Vra RA Ue Re CALCARE ene eee oi i mca a C 3 26 no ME insdesusq3 RUSSE SOS S Chee dp S qud Dd epi qe dp ddr dd d qd pae d xa 3 26 go a eee err See E ee ee ee dedos scd doa s RC dod oa Edo a EUER RR ee ee ee ee ee 3 26 BONGO gi o cade pone Gece Shee rrr 3 26 ADF paper present Sensor 1 Sl sacs ccudaticdssied cue ius edie ease Gertnaea ds 3 27 FD Covel ODED Sens NEC 5 i3 34d a he 5 hee eee oe he ee TE eS 3 27 ADF cover open sensor test a euis cde ee od 66K WS OES E RK DROS ROK EE EER OREM 3 28 Scan Tst sensor teSt acer e oe 5645 4 8s bee Foe Os Ob ee eer eee hs bo ee eS 3 29 Scanner 2nd sensor 16S i ad been ee heeded ERE ENSE TE dea EYES vi RESRASEVS PEE WE 3 30 Scanner Calibration TRBBOL uuuiours ducere rac RRERE GOV ve pP EYYwa rdebrad KR XXE 3 31 UB aac le ec OT a urn dedi ut Ie ORA JE ee a a e e EO COE EORR eee 3 31 EXIT DAG 24334239 9 03 2 29 8 9 420209 3 250802 9 8 088 ee di cr ador ode RC e Mec a died 3 31 CONIGUIANON MGNU PTT 3 32 niri acc M viata eae ee eae gabe EREE ATN eoneae snares 3 32 Reset Separator Roll and Pick Assembly Counter lelllllee eee 3 33 USD seal IDEO uavaas sex aqoa bet a ics NA ACE ewan HO D RC CR Rr REA RACE CA Ew a M 3 33 FHOEDGUSIIV PROS 2a od ck OXQAT dOUT 9 9 47 RECON Oo RP ERR RR ooo PR ERR ROCA 3 33 HEEL sop ERCIAU E O
99. Previous Next D Go Back 7525 63x Be egy yee i eee iR EE RN ERN Q5 da E vau dca d RR ded udo es ae o deca ace ER 4 100 Operator panel assembly removal cleeeeeeeeee nnn 4 102 Operator panel cover with light pipe removal 0 00 cc eee eee eee 4 103 Operator panel bezel removal aem EROR Kae eee eres AK eee te eee e Rn 4 104 Operator panel frame cover removal 000 ce eee 4 107 Output Din May FOMN0V Sls a s aic 4aeseseac ee ae ruse een eee eee be Rectan cee Rees ACC Rs 4 108 Rear case with speaker removal 0 cece eee 4 108 Sleep DUROS FOIIBVBL 2 65 00 he ene eee ee ee ee eee aas CR GR NCC 4 110 Seep bukon PCE PEIMOV Als ise one oh CRANE dO CROCO ERROR UE RE eer acp re ens 4 110 SPARO PON ee ohana hw ea eee A ARAA 4 111 USB Cable removal sd ci cscs bes ERRERC RU AUN RUSO A AUR AE Re cuoc d d dob ar Rr cR RR 4 112 User interface controller card cable removal 000 cece eee eee eee 4 112 User interface controller card removal 00 00 e eee ee 4 113 Belen mePP 5 1 child X rtr 5 1 FREUE be poe od are ee eee ee EEE A EE eee ee eee eae awe es es eeeee re E TE 5 1 POA ia ee caw r 5 2 Print GNGING interior VIEW a6cce cc ei cs ecuwces She es odes kee e es RE OR CRUCE RCRCRONCICRUR OR CR RO 5 3 PHDIBE DOOt IS sins 050 x4 2 60a oboe AVE AERE XE eso PAESE SERIA TEERG TRES NU RAE RS 5 4 alus jo Mc
100. R CAU Pond 7 4 PSSOMDIY 3 0p rator panel a iii cacn icio e c ie E Rp OR A eee ee OR eee eee ede RR C eas 7 6 ASSOmBIV AIPADBIDAL a sss 60004 6650 6G HERE A EHE RE RATHER aa RR RUE E 7 8 ASSOMBIV ECEIBOITODIOS Toon dE 9 OC RR ee eee eee Ree eRe C CR SOR d RR C UN 7 10 ASsembDIy D EIGOI OIMNOS X Lioa ssacgaccoh d RC odes chsh RORCECAOR RC ee owe PES ees eo Rewer Rees 7 12 Assembly 7 Media drawers and trays llle nnne 7 14 ASSOmbBINV BID NOS uci oi aon RRRORON Rp ROC D CY RC NCICAL BER RC ahd tank eet e dos CN dede a d gc QU DEOR eae 7 16 Pe ieee handed eek ce eee dees e hee bead eee eee wes l 1 Parl pumMmbDer THX aoa eaten ee ed vee Rol NNR l 5 Table of contents Previous Next D Go Back 7525 63x X Service Manual Previous A D Go Back 7525 63x Notices and safety information Previous The laser notice label may be affixed to this printer Vv Next Laser notice This product is certified in the U S to conform to the requirements of DHHS 21 CFR Subchapter J for Class I 1 9 Back laser products and elsewhere is certified as a Class laser product conforming to the requirements of IEC 60825 1 Class laser products are not considered to be hazardous The printer contains internally a Class IIIb 3b AlGalnP laser producing visible radiation in the wavelength of 650 670 nanometers enclosed in a non serviceable printhead assembly The laser system a
101. RG ROI poA dada d dd Pe E Mawes Maree A eo ee Rc dr ates 3 33 Menu STINGS PRU a4 64 54 544 6 4 4505 44454 EARE EREE ESTEE RARER HF oe ee eS 3 33 ee EEE wee eA wee 6d wee eee 4 a Eu d dud Nep dap E quu d E 33 3669 we deg 3 34 elegi dg M ESTELQIIOTTIOTIQIOOOTOIT ARNA DEANA 3 34 BUS d c RETI Oo DLL TT a EE a EREN 3 34 Ponal TOPU S uackon cii Ro seek ad ee ee added Mi dedic qo iecur ap 3 34 EPIS EMUO ee ere ere P P pd a 3 35 x c 6 352p10 p PME 3 35 BBY CONSEN E Laid qoe CERRO ERE IRAE 0609009100 24900 ROC RACE EUER P ERREUR RR AR 3 36 Fax LOW Power SUDO 4 ax ari EUR OR ERR R90 cs tent stout teGewda beaseene RC AER 3 36 Mn GORY MO MOIY aus Ach AHORRO HRCEACHRRE RO HERE PARERE FARE OA SOR FC RRORERRGOE HER OER 3 36 PI 60 Job ASSIST s ga ay SAU RHCE CRUCE RN EOLAUE pfe dul dd CRUR RAS ARCA 3 37 PO Fox ls dde y X dire ORE OR AERE OCURRA RC ERR RON E en disses eres d CR aes 3 37 Service Manual Previous Next D Go Back 7525 63x Fax Storage EOCHHOD s ose S cars ERU SR RR RARE EE RAUS REN EE NUES Eripe d Dacia d Rap Aras aad d 3 37 neue Automatic Color Adjust cick soe oiii Re eden een Res ORE e CA 3C AO H8 AR ACRI Dea 3 37 ADF Edge Erase isses eese senes eret 3 38 A gee a3 9322 1 0155 9 19 3 4 1005 24 9 8 8 4 90 BRE AUS FCR RH ICD Rd RR dx f cu 3 38 Scanner Manual Regist AlO icc dci wa AC RACER REOR P GLEOG P RRAEESIERqeRRC EP TERRE PX ARR 3 38 v BILL e EDDIE TEL eee ee ee Oe eae eee ees emeaeenas 3 39 ee Le e
102. RR RON eee ee ee Rae oe Ree Cee ORA 2 59 Black or blank page copy service check 000ccc cece eh hh 2 60 eH GDDSSIVIEO EDBON a dr aao SCR AA baw ACA GB AC RC UE GR UR AC ROCA ee en trees CA RC RON 2 60 Flatbed motor Service CDBEK uua o dr naosnw ere Ser E A RR P REREYSATARPAARASYAIAEMS PT ASG I AXNTX 2 61 Flatbed home position service check eeeleeeeere eren 2 61 Go Back ADF cover open service check 0 00 ccc nnn 2 62 AUF SEBSK SOVICO COCK au dono SOR OE SCREEN ARCA UON OR SOW CR CORREO TERE WOR Eee es beams 2 63 ADF paper jam service check onsaeass bade eek XX ARA RAO SHREDS HEE CR ARCH REP C ns 2 63 ADF feed errors service check 5adurs a bx aC RO CRRCRRCRERCACC CRGA eee iw ad Oke eRe RARO 2 64 ADF duplex Service Cheb Lia did acd OR ROIORRA REROR VOR OCRCR RU ACRIOR CORRER RR RU RC ERR CAN 2 65 Modem fax card service check 0c cece ern 2 66 Fax transmission Service check 5 ua sacs xU OR eo eee nee eee RR Re RR RC RR REOR 2 67 Fax TecBpEIODn Service CNGCK 44404 938 RCDACALACR 00 6000 EROR REOR RON GR 2000050500 CR Regn 2 68 Escalating a fax issue to next level support 0 00 cece 2 70 DONOSIO OIIE TREE TOIT T OT o o 115 1107 10 1527 15 1127701 3 1 User operator panel menus and messages leleeeeeeeeee eee nn 3 1 Understanding the operator panel llellleeleeeeeee eene 3 1 Operator panel DUONG sau s dado scene cee reas 0b 50s QUARC CR C RU C HC Cn 3
103. RRR dod ede e oe E oe b doe aas 3 14 PRINT TES PS 2421433023595 052 33 434 9 009 ACE ICE ROCCO BE i e Red ol COR or ido m dc yews 3 15 ipte ds Ario PC 4061 E 44S Te eS 3 15 mil c Pados on 2 5 na ae banded aden TOTO OTT TT TRIS 3 16 HARDWAHBHE TESTS 64 4 00000500 0600050000000500050000000 4 650 020Ke PARRA RECAE MEER 3 16 mos E edhe eRe es dw eed a ead eed orm 3 16 EE TESI ddordokd 3995 dau d 591 Oe ee dede d wd Sid ve Rea eee qq qe sad 3 17 DEFUI UB EREET PEREPERE TEPEE T ES ee eed oe Sens E eng ieee ds 3 17 lo Hs HSSUNIGUB LL rius qi RE ADRESSE ERE Ee Ee Ee ee re E ETT 3 17 UIP TROIS edad ok oe EQ ee oe ee eee M CU I Oa 3 18 Gurk ona soe cee ed ee ce ee ee dee ee oe eas Fs P ESTAS E Pei 3 18 Leit Margin CC UDIEN us uc iy etn dei ae de e err HACRE IR Ed hat EU CORRIERE 3 18 ie eee a EE E E E E E E EX E Y E 3 19 INPUT TRAT TESTS 3 23939 steroid eee E a A 3 19 Pe TESI E T E E E E EAT EE EE E E B OI A E T RR EE E ded iura d 3 19 Soer e 2 94 E E T E E DAE S E E E E EST lt lt 3 20 Table of contents V 7525 63x vi BASE SENSOR TEST ws beeen et Geers codes EUN Ere dU MR RON KR d cR HERE ec OM dcwuscu end IRR rd 3 20 Bad S TIERIS auae ba ee eee ee ae ESdqeesqEgeqUSSSEqd eds 3 21 FOUND srsced3 WS WewdeucedursueERuESEAQESEREES ER RUE E E DERE SP FRE S AS 3 21 Quek DISK PERI aad beUi oed eR dex Ne iacu recital Rack bbe aceite doe ded Eod d d ded 3 21 Bo TOS le sa 2 daos E ET dan 993 qu diego desde Pad bue exREN NS qe RE pd d Taupe d 3 21
104. Repair information 4 5 525 63x 5 Remove the screw B on the bottom of the cover Previous A D Go Back B 6 With a hand on the bottom of the cover ease the cover over the off on switch and rotate the cover away from the printer Warning Be careful not to damage the rear tab at the upper rear side of the cover Installation note When replacing the left cover flex the cover slightly to engage the tab near the power switch 4 6 Service Manual 525 63x Right cover removal Previous 1 Lift and lock the flatbed assembly to the raised position A 2 Open the front cover 3 Release the green latches securing the door F 4 Lower the right cover and remove it from the hinges Next Go Back Rear shield removal The rear shield is not a field replaceable unit FRU 1 Remove the six screws A 2 Remove the rear shield Repair information 4 7 525 63x AIO back cable cover removal Note Some printers may have a filter installed on the fan grill Remove the filter first before continuing with the removal procedure 4 8 Service Manual Previous A D Go Back 525 63x 2 Place a small flat blade screwdriver under the bottom of the cover and gently pry the cover upward Previous A D Go Back Top cover assembly removal 1 Remove the flatbed assembly Go to Flatbed removal on page 4 75 2 Remove the AIO toner cover Go to AlO toner cover removal
105. Revision July 31 2013 e Service Manual Lexmark X548 Series 7525 63x Table of contents e Start diagnostics e Safety and notices e Trademarks e Index 71525 63x Edition July 31 2013 The following paragraph does not apply to any country where such provisions are inconsistent with local law LEXMARK INTERNATIONAL INC PROVIDES THIS PUBLICATION AS IS WITHOUT WARRANTY OF ANY KIND EITHER EXPRESS OR IMPLIED INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE Some states do not allow disclaimer of express or implied warranties in certain transactions therefore this statement may not apply to you This publication could include technical inaccuracies or typographical errors Changes are periodically made to the information herein these changes will be incorporated in later editions Improvements or changes in the products or the programs described may be made at any time Comments may be addressed to Lexmark International Inc Department D22A 002 1 740 West New Circle Road Lexington Kentucky 40550 U S A or e mail at ServicelnfoAndTraining 9 Lexmark com Lexmark may use or distribute any of the information you supply in any way it believes appropriate without incurring any obligation to you References in this publication to products programs or services do not imply that the manufacturer intends to make these available in all countries in which i
106. SE ole sella IlIb 3b AlGalnP PI O X17F HFA ZH o4 WAC AoH ABT BAYES yyol As AMSA FA Hel EE AN ASE MHA zm dolo ARAH BAA 1 FB olge ello A BAL LEX EE S YAUA U Notices and safety information XV Previous A D Go Back 7525 63x xvi Service Manual Previous A D Go Back 7525 63x Previous Lithium warning CAUTION v This product contains a lithium battery THERE IS A RISK OF EXPLOSION IF THE BATTERY Next IS REPLACED BY AN INCORRECT TYPE Discard used batteries according to the battery manufacturer s instructions and local regulations 4 Go Back Safety information e The safety of this product is based on testing and approvals of the original design and specific components The manufacturer is not responsible for safety in the event of use of unauthorized replacement parts e The maintenance information for this product has been prepared for use by a professional service person and is not intended to be used by others e There may be an increased risk of electric shock and personal injury during disassembly and servicing of this product Professional service personnel should understand this and take necessary precautions CAUTION When you see this symbol there is a danger from hazardous voltage in the area of the product where you are working Unplug the product before you begin or use caution if the product must receive power in order to perform the task Consignes de s curit a s
107. Service CBE us 66 Soe eww aaa eee ea ee Cama RUP SEU ROS AC ac CR RR 2 34 Duplex manual feed sensor S1 service check es 2 35 Front door sensor or switches service check 000 cece eee eee eee 2 36 Fuser exit sensor service check soc cs cetaceans eek aG UR AEN CC Gee ea eee ees amas 2 37 PUSEr GOIVICG COCK aas VERO 058 CECR QIRRCER ARE sO RCRCRAUR ee See RIED R ee ee 2 38 Input sensor S2 service check sos mache don RC RR RC ee ed eee ee RC RR RR a 2 39 Main drive gear assembly EP drive service check 0 000 eee eee es 2 40 Operator panel service CheckS 00 cc cece eee ees 2 41 One or more operator panel buttons fail lille 2 41 Operator panel display is blank i 4a uo ERE REX A ARCA Y RR 45 deed Y ERE ERE ES 2 42 Op panel USB cable service Check 1 0 ee eee eee eens 2 43 USB Service cheCR Lauda d wei esci adqad c owe abe ea eee dau did Seas 2 43 Networking service Check 2 cc eee hh hn 2 44 Print Quality Servis CHECKS Laici s RRURA ARE sti Rae ma Ra Rea x BAe ie RCNH ees 2 45 FEnEguallis Dackgr DUE es 1466 5 4005 45445 6 4045604556 ER ERR IU ege eR a nae eae ROCA 2 46 rie CUI Diane B3B quciacxdd eed RR ELEC Ge EU d died deae de draw 9 Q9 9 ead e 2 47 Print quality blurred or fuzzy print suu amd REA Re RR dre RdR doROR OPE RGROR dre Eoo 2 49 Pon OU am color DAGE 9 34 qox DAE S40 46 ON QUE ERS de PARVO I CUOR Ae ER RI ded 2 49 Print quality horizontal
108. Settings General Settings gt Timeouts gt Print Timeout e Remove and flex the paper in the tray Reload the paper and try printing Turn the paper over inside the tray Make sure the feeder is properly installed Make sure the paper is loaded correctly in the tray Make sure the paper is not damaged Make sure the paper meets specifications See Media input type specifications on page 1 12 Make sure the paper guides are positioned correctly for the paper size loaded in the tray Jam Recovery may be set to Off Change the setting to Auto or On on the operator panel To change this setting navigate to gt Settings gt General Settings Print Recovery Jam Recovery Check the narrow media sensor cable is correctly connected at the sensor and the cable is correctly connected to JBIN1 on the RIP board When replacing the RIP board verify the cable from the high voltage power supply is seated properly The cable may have come loose from the HVPS Warning A blank page that should have toner on it could be an indication that toner is applied to the ITU belt but not transferred Therefore the toner goes into the ITU cleaner which cannot process massive amounts of toner It is important to prevent extensive blank pages from being processed if they should have toner on them Increase the Print Timeout value on the operator panel To adjust this setting navigate to gt Settings gt General Settings Timeouts
109. USB simple device or USB composite device In the off position the simple USB device is enumerated in the on position the composite USB device is enumerated To change this setting 1 Navigate to USB Scan to Local 2 Touch or tochange the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Print Quality Pages The Print Quality Pages can be printed from both the Configuration Menu and the Diagnostics Menu The Configuration Menu is limited in information compared to the pages printed from the Diagnostics Menu To print the pages 1 Navigate to Print Quality Pages 2 Printing Quality Test Pages appears and the pages print The Print Quality Test Pages contain several pages The first page which is printed in English text contains only a mixture of text and graphics The information includes values of the Quality Menu settings in Settings and printer and toner cartridge configuration information The remaining pages contain only graphics For samples of the pages see Print Quality Pages on page 3 16 Reports Menu Settings Page Print the menu settings pages to list the customer settings and to verify printer options are installed correctly It is helpful to print the customer settings before you restore factory defaults or make major changes To print the menu settings 1 Navigate to Reports gt Menu Settings Page 2 Printing Menu Settin
110. a la presenza di tensione pericolosa nell area del prodotto Scollegare il prodotto prima di iniziare o usare cautela se il prodotto deve essere alimentato per eseguire l intervento Lithium warning XVII 71525 63x Sicherheitshinweise Previous Die Sicherheit dieses Produkts basiert auf Tests und Zulassungen des urspr nglichen Modells und bestimmter Bauteile Bei Verwendung nicht genehmigter Ersatzteile wird vom Hersteller keine 4 Verantwortung oder Haftung f r die Sicherheit bernommen Next Die Wartungsinformationen f r dieses Produkt sind ausschlie lich f r die Verwendung durch einen Wartungsfachmann bestimmt T W hrend des Auseinandernehmens und der Wartung des Ger ts besteht ein zus tzliches Risiko eines Go Back elektrischen Schlags und k rperlicher Verletzung Das zust ndige Fachpersonal sollte entsprechende Vorsichtsma nahmen treffen ACHTUNG Dieses Symbol weist auf eine gef hrliche elektrische Spannung hin die in diesem Bereich des Produkts auftreten kann Ziehen Sie vor den Arbeiten am Ger t den Netzstecker des Ger ts bzw arbeiten Sie mit gro er Vorsicht wenn das Produkt f r die Ausf hrung der Arbeiten an den Strom angeschlossen sein mu Pautas de Seguridad La seguridad de este producto se basa en pruebas y aprobaciones del disefio original y componentes espec ficos El fabricante no es responsable de la seguridad en caso de uso de piezas de repuesto no autorizadas La informaci n sobre
111. ace it only with the same or an equivalent type of lithium battery Do not recharge disassemble or incinerate a lithium battery Discard used batteries according to the manufacturer s instructions and local regulations Note Back up the eSF applications and settings before replacing the RIP board See Backing up eSF applications and settings on page 3 44 1 Remove the rear shield See Rear shield removal on page 4 7 2 Disconnect the fax card cable A from the RIP board par lla 1 IE T m INE 3 Remove the fax card with its standoff from the RIP board 4 Remove the hard drive See Hard drive removal on page 4 39 Repair information 4 19 525 63x 5 Disconnect all the cables from the RIP board Previous 2E 3R 10 AN 305374B Next D Go Back CEI TOEN nir REI 4 20 Service Manual 525 63x T Remove the board Previous A D Go Back Installation note Perform the Motor detect test and Scanner manual registration after replacing the RIP board See Motor Detect on page 3 14 and Scanner Manual Registration on page 3 38 Warning Do not start the machine into Ready state to test it See Testing generic FRUs on page 4 1 Warning When replacing the RIP board verify the cable from the high voltage power supply is seated properly The cable may have come loose from the HVPS e Print a few pages to verify the installation If the pages are blank confirm th
112. advances to the scan area While the paper is advancing V to the scan area the ADF motor generates pulses which are stored in an on board counter These counts Previous along with the ADF scan sensor ensure that the media is travelling at the correct speed through the scan BEN area The speed the document travels through the ADF scan area is dependent on the image DPI H specified by the user T After a predetermined number of counts the media reaches the scan area and the image acquisition Go Back process is initiated While the image acquisition process is executing the ADF scan sensor is being polled to determine if the trailing edge of the media has reached the sensor 8 Once the trailing edge of the scan media has reached the ADF scan sensor that sensor goes to the off position After the ADF scan sensor is switched off the image acquisition process continues for a predetermined length of time 9 When the image acquisition process is completed the trailing edge of the media continues to the reverse point If the scan job is simplex only the media continues to the exit roller and exits the ADF 10 If the scan job is a duplex scan job a solenoid on the ADF is actuated when the trailing edge of the media reaches the reverse point This solenoid moves a diverter gate to the down position and engages a reversing gear on the exit roll 11 The reversed exit roll pulls the paper back into the ADF The transport roll then moves the media to
113. age 3 14 Reset ADF Front Calibration Values Reset ADF Back Calibration Values MISC TESTS Motor Detect See Motor Detect on page 3 14 PRINT TESTS Tray 1 See Input source tests on page 3 15 Manual Feeder Print Quality Pgs See Print Quality Pages on page 3 16 HARDWARE TESTS Panel Test See Panel Test on page 3 16 Button Test See Button Test on page 3 17 DRAM Test See DRAM Test on page 3 17 USB HS Test Mode See USB HS Test Mode on page 3 17 Quick Test See Quick Test duplex on page 3 18 See Feed Tests on page 3 19 3 6 Service Manual Previous Next D Go Back 7525 63x Sensor Test See Sensor Test on page 3 20 Previous A Front Door See BASE SENSOR TEST on page 3 20 Standard Bin v Narrow Media Next Input S1 4 Input S2 Go Back Fuser Exit C TMC Sensor M TMC Sensor Y TMC Sensor K TMC Sensor DEVICE TESTS Quick Disk Test See Quick Disk Test on page 3 21 Disk Test Clean See Disk Test Clean on page 3 21 PRINTER SETUP Defaults See Defaults on page 3 21 Prt Color Pg Count Prt Mono Pg Count Perm Page Count Serial Number See Serial Number on page 3 22 Engine Setting 1 See Engine Setting 1 through 4 on page 3 22 See Prt Color Pg Count Prt Mono Pg Count and Perm Page Count on page 3 22 Engine Setting 2 Engine Setting 3 Engine Setting 4 Model Name See Model Name on page 3 22 Configuration ID See Configuration I
114. agenta Printhead 108 08 Service Magenta Printhead 108 11Service Magenta Printhead 108 12 Service Magenta Printhead 108 13 Service Magenta Printhead 109 xx Service Black Printhead 109 01 Service Black Printhead 2 14 Service Manual The cyan laser showed bad in EMS testing Failure writing data to printhead Failure reading data from the printhead Printhead declared error Magenta printhead error The magenta printhead lost HSYNC The magenta printhead failed to complete servo The magenta printhead mirror motors failed to achieve lock The magenta printhead mirror motors lost PLL motor lock Failure reading NVRAM from the magenta printhead The magenta laser showed bad in EMS testing Failure writing data to printhead Failure reading data from the printhead Printhead declared error Black printhead error The black printhead lost HSYNC Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If th
115. alled in a printer and the printer is powered on it cannot be Go Back used in another printer It must be returned to the manufacturer This error code indicates a mismatch between the operator panel assembly and the RIP board Have any updates been made to the Reload the firmware and try Replace the RIP board with firmware again a new and not previously installed RIP board See RIP board removal on page 4 19 Go to step 2 Does reloading the firmware correct the Problem resolved Replace the RIP board with problem a new and not previously installed RIP board See RIP board removal on page 4 19 Autocompensator mechanism service check Note The input S2 sensor is part of the autocompensator mechanism ACM and is not available separately Turn the printer off and then remove the rear Go to step 3 Properly connect the cables shield See Rear shield removal on and POR the printer page 4 7 Check the cable at JSP1 on the RIP board for proper connection Go to step 2 Is the cable properly connected Did the printer function correctly after Problem resolved Go to step 3 reconnecting the cables 2 32 Service Manual Turn the printer on and then verify the following approximate values at JSP1 JSP1 Pn vae ooo ewm ooo Ground ps Grounds Are the values approximately correct Bin full sensor service check 7525 63x Previous Replace the RIP board See RIP board
116. an job scanner Touch Scan from automatic feeder to continue scanning from the ADF immediately after the last successful scan job Replace last scanned Touch Scan from flatbed to continue scanning from the scanner immediately page x ess after the last successful scan job ag elton id Finish job without further scanning to end the last successful scan job Replace jammed Touch Restart job to restart the scan job with the same settings from the originals if restarting previous scan job job Replace all originals if restarting job Remove originals from The scanner failed to feed one or more pages through the ADF the scanner automatic document feeder 1 Remove all pages from the ADF Note The message clears when the pages are removed from the ADF 2 Flex the pages back and forth to loosen them 3 Place the pages in the ADF 4 Adjust the ADF guides Diagnostic information 2 9 7525 63x User status and attendance messages Previous User primary message Explanation A 840 01 Scanner Print without the scanner or contact your system support person disabled by admin 840 02 Scanner disabled Contact system administrator if problem persists 30 xx Color cartridge missing 82 xx Replace waste toner bottle The printer identified a problem with the scanner and automatically disabled it Try Next one or more of the following Remove all pages from the ADF 4 Turn the printer off Go Back Wait for 15 se
117. anual Feeder 250 xx Paper Jam x Pages Jammed 290 02 Scanner ADF Feed Jam 290 10 Scanner Static Jam 290 20 Scanner Static Jam Paper Present 290 30 Scanner Static Jam Paper Stop A single page of media is jammed at the exit sensors Multiple pages of media are jammed at the exit sensor Paper jam in the primary tray A single or multiple page media jam in the 650 sheet Duo Drawer tray 2 Multiple pages of media are jammed in the 650 sheet Duo Drawer tray 2 A single or multiple page media jam in the optional 550 sheet drawer tray 3 Multiple pages of media are jammed in the optional 550 sheet drawer tray 3 A single page of media is jammed in the multipurpose feeder Multiple pages of media are jammed in the multipurpose feeder The scanner ADF has failed to feed a page to the ADF interval sensor Scanner ADF detects paper at the first scanner sensor while the ADF is in an idle state This message occurs when paper is detected in the ADF during a POR or when the MFP is starting up This message displays when paper is inserted past the paper stop on the ADF Vv Open the printer rear door to access the jam area Remove the jammed page See 202 paper jam on page 3 49 Next Open the printer rear door to access the 4 jam area Remove all the jammed pages ie See 202 paper jam on page 3 49 Remove the jammed page See 230 paper jam on page 3 50
118. ar assembly EP CMY Cartridge Motor drive service check on page 2 40 152 06 Service Excessive SAP BLDC PWM Go to Main drive gear assembly EP CMY Cartridge Motor drive service check on page 2 40 152 07 Service Motor stalled in time based Go to Main drive gear assembly EP CMY Cartridge Motor commutation drive service check on page 2 40 8xx xx service errors 4 J 840 01 Scanner The scanner is disabled and can t be disabled used Enter the configuration menu and re enable the scanner module Go to 840 xx error service check on page 2 59 840 02 Scanner auto The scanner is disabled and can t be disabled used This message is posted when the MFP PORs Enter the configuration menu and re enable the scanner module Go to 840 xx error service check on page 2 59 Image pipeline Image pipeline ASIC Go to CCD service check on page 2 60 Also Go to Flatbed home position service check on page 2 61 842 Scanner failure Communication failure Go to CCD service check on page 2 60 843 Scanner failure Carriage mechanical failure Go to Flatbed motor service check on page 2 61 843 01 Scanner failure ADF mechanical failure Go to ADF paper jam service check on page 2 63 844 xx Scanner failure Lamp failure Go to CCD service check on page 2 60 844 Front scan module output level error Go to CCD service check on 844 01 Rear sca
119. as condiciones de servicio t cnico estipuladas XIV Service Manual Previous Next D Go Back 7525 63x L 7 85 ARs KBCBWTAZIAI 1 LACY DHHS 21 CFR Subchapter J NEI BML SOMOBCE IEC 60825 1 DBF ICBEMTSIFAI L 79 8mcucsmgencuizt 22A1L Y SUmBl fel amp tt Tx caxencoss 7U7ApS I REX 650 670 7 7 X HJL O DRA ZFS 7 7 A Ib 3b AlGalnP L Y RESHRENTH THO7ZULZA KkR7Tt 7UUCUSencueszj L UV LZATACZUZAl X0BIE 1 VL 4S XATZTTLA EKEMEOV EARHOFR C 1 97 2741 LAJL 8 A L RAICBMICE SENBWASICRATENTWERTF BOCA AN FT DALES ES E A F DHHS 21 CFR Subchapter J XJ 433 1 1 BF BORE MER RS CU ABL UA UE A F IEC 60825 1 HAF BF ine RMUADRABILF ia RU fe BH TT MMABSAD Ib 3b AlGalnP Wat PREP RT AE 3T DARA SP ERKAM 650 670nm ZANT ARDET DMR EBRE SHRSPRAEAHS EAR F TAEA ERDA EER ANE Al AREE REGI SE BERI HS DHHS 21 CFR ZRK Z JK I 1 RER IEC 60825 1 MIEN REE RR ARES ERR NOE oOBSUE I ELA BIG LUE E FMRBARTMRAZ Ilib 3b amp amp AlGainP FR S PIT ES E BJ RT AMHReREREA RRA 650 670 RX nanometer WRACAA RBA RISERUBEDRUGEREISZS ZEPR AEISCMERIEUR AE SE UX RR 7C BU PIT E15 75 zE TIE RE JEED S HER LES ELO EAR T EAE LARA EB TUR AR MHA EREE gBllo A1 Sal E AS IZAN glo x ABS DHHS 21 CFR Subchapter JO OF ASS EFS ole K Soll Ad IEC 60825 19 QF ASS Este gel i1 HOl ABS SATA UC oA 1 HOH ABS AHE ABE ASIA HAUC ZEEE 650 670 40E a BHA TAAL SAS SSH MHA E7 LAY sl F P
120. as the customer has selected the custom type from those types the duplex unit supports Media output size and type There is a single 100 sheet output bin available for this printer and no additional output options 1 12 Service Manual 7525 63x Weight ranges for each media type Previous Paper 9 7 8 Xerographic or 60 to 74 9 g m grain long Light Paper v business paper 16 to 19 9 Ib bond a9 Wf ex 75 to 89 9 g m grain long Plain Paper 20 to 23 8 Ib bond DD 90 to 104 9 g m grain long Heavy Paper f 23 9 to 27 8 lb bond 105 to 176 g m grain long Card stock 27 9 to 47 lb bond grai Im I eee TET 135 g m 50 Ib Card Stock upper 163 g m 90 Ib Envelopes Sulfite wood free or 60 to 105 g m to 28 Ib bond 4 Multipurpose XA 10096 cotton feeder or manual slot only For 60 to 176 g m paper grain long fibers are recommended Paper less than 75 g m 20 Ib must be printed with Paper Type set to Light Paper 3 10096 cotton content maximum weight is 24 Ib bond 28 Ib bond envelopes are limited to 25 cotton content The duplex unit supports paper weights between 60 105 g m 16 28 pound grain long bond The duplex unit does not support card stock transparencies envelopes and labels 6 Lexmark transparency part numbers 12A8240 and 12A8241 are supported from the standard tray manual slot and the multipurpose feeder Paper 90 to 104 9 g m 23 9 to 27 8 I
121. at the ethernet cable is properly connected on both ends If the network is wireless got to step 3 Is the cable properly connected Connect the ethernet cable Problem resolved Go to step 3 Did this fix the problem Check the printer s online status under Printers Go to step 5 Go to step 4 and Faxes on the host computer Delete all print jobs in the print queue Is the printer online and in a Ready state Does the IP address displayed on the Go to step 10 Go to step 6 network settings page match the IP address in the port of the drivers using the printer Does the LAN use DHCP Go to step 7 Go to step 9 Note A printer should use a static IP address on a network Are the first two segments if the IP address Goto step 8 Go to step 9 169 254 POR the printer Problem resolved Go to step 10 Is the problem resolved Reset the address on the printer to match the Problem fixed Go to step 10 IP address on the driver Did this resolve the issue 10 Have the network admin verify that the printer Go to step 12 Go to step 11 and PC s IP address have identical subnet addresses Are the subnet addresses the same 2 44 Service Manual Change the printer status to online Problem resolved Go to step 5 Did this fix the issue Previous Next D Go Back 7525 63x Previ Using the subnet address supplied by the Problem resolved Go to step 12 A network admin assign a unique I
122. at the high voltage power supply cable is properly seated The connector may have been loosened at the HVPS e A blank page that should have toner on it could be an indication that toner is applied to the ITU belt but not transferred Therefore the toner goes into the ITU cleaner which cannot process massive amounts of toner It is important to prevent extensive blank pages from being processed if they should have toner on them e When installing the RIP board make sure to route all of the cables through the correct openings Repair information 4 21 525 63x Tuck the printhead cable toroid C as shown below Failure to do so can damage the RIP board EE A D Go Back Note Pay attention to the jumper configuration D An improper configuration will cause the printer to malfunction THTLLLLLLLLLLELTETLLLIT 4 22 Service Manual 525 63x Duplex reference edge removal Previous Note If the duplex reference edge is made of plastic then replace it A If the duplex reference edge is made of metal then do not replace it v fa i i i B Next A i inii i i NI ye a M d jJ 4 4 Ww i al A ra L m Er S 1 Fo k h J ui i nc ab lp S 2 tme Plastic Metal 1 Open the front door 2 Remove the four short screws A in front and the four longer screws B in the back of the duplex aligner Repair information 4 23 525 63x 3 Lift the duplex aligner on t
123. ation on disk 1 Navigate to Erase All Information on Disk 2 Select a disk wipe method e Single Pass Erase Initiates a one time immediate single pass wipe of the entire hard disk e Multiple Pass Erase tnitiates a one time immediate multiple pass wipe of the entire hard disk Wipe All Settings This setting makes any sensitive information that may exist on the printer s volatile or non volatile storage completely indecipherable To wipe all settings 1 Navigate to Wipe All Settings 2 Erase all information on the hard disk This will erase all settings solutions and jobs on this device appears Touch Yes to continue or touch No to return to the Configuration Menu Diagnostic aids 3 39 7525 63x Font Sharpening Previous This setting is used to set a text point size value below which the high frequency screens will be used when A printing data This setting affects only PCL PostScript and PDF emulators Vv Settings are in the range of 0 150 24 is the default For example if the value is set to 24 then all fonts sized 24 ed points or less use the high frequency screens di To change this setting Go Back 1 Navigate to Font Sharpening 2 Touch the Keypad icon 3 Enter the setting 4 Touch Submit to save the setting or touch Back to return to the Font Sharpening Menu Pel Blurring The Pel Blurring setting is used if step artifacts are noticed by the customer on copies and scans When set to On Pel Blurri
124. b must be printed with Paper Type set to Heavy Paper 9 Paper 105 to 176 g m 27 9 to 47 Ib must be printed with Paper Type set to Cardstock Media guidelines Paper characteristics The following paper characteristics affect print quality and reliability Consider these characteristics when evaluating new paper stock e Weight The printer can automatically feed paper weights from 60 to 176 g m 16 to 47 Ib bond grain long Paper lighter than 75 g m 20 Ib might not be stiff enough to feed properly causing jams For best performance use 80 g m 21 Ib bond grain long paper For paper smaller than 182 x 257 mm 7 2 x 10 1 in we recommend 90 g m or heavier paper e Curl Curl is the tendency for paper to curl at its edges Excessive curl can cause paper feeding problems Curl can occur after the paper passes through the printer where it is exposed to high temperatures Storing paper unwrapped in hot humid cold or dry conditions even in the trays can contribute to paper curling prior to printing and can cause feeding problems e Smoothness Paper smoothness directly affects print quality If paper is too rough toner cannot fuse to it properly If paper is too smooth it can cause paper feeding or print quality issues Always use paper General information 1 13 7525 63x between 100 and 300 Sheffield points however smoothness between 150 and 200 Sheffield points produces the best print quality e Moisture content The a
125. banding sses sansan RUE eR RC x a HR ORA CR eee ded Ro a 2 49 Prine CUA O oie NG u dor d X VERE gets Y d q3 9 Jig ed 22Ved dod s dus d 34 2 50 Print quality insufficient fusing 444 00s4de ed a eee AR Sade beed RR E 3I RR eae 2 50 Print quality Tmissing image at edge ss cece tees seek ee ee 6 oS eee ee eee eee eee es 2 50 Print quality mottle 2 5mm speckles 000 ce eee ees 2 51 Print quality narrow vertical line 446254 p6see ses sedwe URN E RA dudes Gb dee ds dab ens 2 51 Prnt gually random MaK uade kore ee eRe EK EER REED RECS OER IR SES 2 51 Pert Guay sual NAGS uiua idee ERR EdURRRE4 RES 545505058 o ERES eke EE Tees 2 52 rie og alld CODI DEO ar dcm depo dhe one E or cd Rees C SE eae es 2 53 Print quality vertical banding 4460444200040 0004 08 ee oes EORR See eee CRURA RC ti o 2 54 Printhead Service CHOCK 6 04 2010600460000000000ee00b enw ORR ee AT DES RE EP ERG CE aE AR eee 2 54 IV Service Manual 7525 63x Toner meter cycle TMC card service check 20 0 eee cece eee eee 2 55 bisvisue Toner sensors Y C M K on TMC card service check Lll 2 55 TEADSIOF TOI SOL VICO COCK 66 5005 ea be RO RC RC ORC scene diab CRUCERO ates 2 56 A Tray O Sensor SOIVICO CHECK inu ma ERRARE RGCRUR UR AREA RA Rd RA RR ARR RE Ade Par lt 5 2 56 Option trays 2 and 3 service CHECK sens dowd s s p RRREREER bees eee thee ee beer ewes 2 57 v BIDLXX GITOr Servie CAC ua i aria 33r ACC ROGA
126. bed and then insert the spring before replacing the screw 4 96 Service Manual Previous A D Go Back AIO link removal 525 63x 1 Lift the scanner to the up position Remove the screw A securing the AIO link to the AIO toner cover 2 Return the flatbed to the down position 3 Remove the screw B securing the AIO link to the flatbed unit Repair information 4 97 Previous A D Go Back 525 63x AIO toner cover removal 1 Lift the scanner unit to the up position 2 Remove the screw A fastening the AIO toner cover to the scanner unit 3 Remove the screws B securing the AIO hinge to the MFP 4 Remove the hinge C Save this for the new AIO toner cover or top cover 5 Rotate the AIO toner cover so the tab D on the cover lines up with the hole on the AIO toner cover B C D 6 Pull the AIO toner cover to the left and remove it from the printer 4 98 Service Manual Previous A D Go Back 525 63x Bin full flag removal Previous 1 Lift the scanner assembly and lock it into the up position A 2 Gently disconnect the three snaps A from the rear shaft of the redrive unit V Next Go Back 3 Remove the bin full flag Repair information 4 99 7525 63x LCD removal 1 Remove the operator panel bezel See Operator panel bezel removal on page 4 104 2 Remove the operator panel frame cover See Operator panel frame cover removal on page 4 107
127. ble ties during reassembly to avoid pinching wires obstructing the paper path or restricting mechanical movement Remove the waste toner bottle color toner cartridges imaging unit and media tray before removing other printer parts The imaging unit should be carefully set on a clean smooth and flat surface It should also be protected from light while out of the printer Unless otherwise stated reinstall the parts in reverse order of removal When reinstalling a part held with several screws start all screws before final tightening Print engine removal procedures Notes Remove the waste toner container color toner cartridges imaging unit and media tray before removing other printer parts The imaging unit should be carefully set on a clean smooth and flat surface It should also be protected from light while out of the printer We recommend disconnecting all external cables from the printer to prevent damage during service Unless otherwise stated reinstall the parts in reverse order of removal When reinstalling a part held with several screws start all screws before final tightening 4 2 Service Manual 525 63x Front cover assembly removal Previous Open the front cover Remove the front middle cover optional See Front middle cover removal on page 4 4 Remove the five screws A from the cable cover Next Remove the cable cover Remove the screw B securing the right restraining strap to the front cover
128. blem resolved Contact your next level Print Logs support See Escalating a Print the T 30 transmission job log Check the fax issue to next level error code being reported See on support on page 2 70 page 2 27 Perform the suggested resolution for the error Did this fix the problem Escalating a fax issue to next level support Before contacting your next level support go to the SE menu on the device and generate a Fax error file This file contains machine settings information and debug information that will help second level support determine the cause of a failure To generate the fax error file perform the following steps 1 In a Web browser type http MFP ip address se 2 The MFP s SE menu page will display Click the Dump Job History link The following displays Fax Job Log Wednesday 2C06 02 08 11 25 Action Date Time Length Station Name Number Pages Status SCAN 1969 12 31 19 00 9 OK SEND 2006 02 01 13 55 73 7 53 40 9 2 CANCELED SEND 2006 02 01 13 56 7 4029 CANCELED 3 Write down the type of connection the type of error and the job in which the error occurred 4 In the Web browser address bar type http MFP ipaddress se 5 Click Report a Fax Problem A The fax check list displays 2 70 Service Manual 7525 63x 6 Fill in the requested information This is where you will type in the information you retrieved in step 3 Previous Second level support can assist you if you have
129. cable A Note Observe the cable routing for reinstallation ae a z Or ELWOBC 505357490 a 4 66 Service Manual Remove the waste toner bottle See Waste toner bottle removal on page 4 73 Previous Next D Go Back Installation notes Be sure the cable runs through the retainer The toner meter cycle card is a tight fit Insert the bottom edge inside the frame and then push down A on the top edge to clear the top cover In some cases the top cover will have to be loosened so the right edge of the top cover can be lifted v to get the toner meter cycle card back into position 1 Remove the two machine screws A 525 63x Previous Next D Go Back A Remove the two screws B Push in on the cover above the locating pins C while lifting to disengage the cover Carefully lift the cover just enough for clearance for the toner meter cycle card Position the toner meter cycle card Replace the screws D and replace the top cover ae PP Repair information 4 67 525 63x Toner patch sensor TPS left and right removal Previous The toner patch sensors are similar but the left sensor includes an extra cable and sensing device Remove them the same way v 1 Remove the ITU See Image transfer unit ITU removal on page 4 43 Next 2 Remove the rear shield See Rear shield removal on page 4 7 3 Disconnect the toner density
130. cle Does the flag rotate freely but returns to Go to step 4 Replace the fuser block the sensor See Fuser assembly removal on page 4 32 Enter Diagnostics Menu Correct the sensor or Go to step 2 replace it See Fuser exit 1 Turn off the printer sensor removal on 2 Press and hold 3 and 6 page 4 37 3 Turn on the printer 4 Release the buttons when the progress bar appears Perform the Base Sensor Test See BASE SENSOR TEST on page 3 20 1 Navigate to BASE SENSOR TEST Fuser Exit 2 Open and close the front door and inspect the fuser exit sensor located on the LVPS shield Is the sensor dislodged or damaged Is the cable correctly connected to JBIN1 on Go to step 5 Reconnect the cable the RIP board and to the sensor Is the sensor properly connected Diagnostic information 2 37 7525 63x Make sure the printer is turned off Disconnect the cable at the sensor and at JBIN1 on the RIP board Turn the printer on and check the voltage values JBIN1 FIM 4 o V dc 5V dc during cycle ES V dc unblocked 3 3 V dc unblocked EE Are the voltage values approximately correct Some low voltage power supply FRUs have a voltage selector switch If it does the switch needs to be set to the correct voltage for your area Has the LVPS been changed Turn the printer off and remove the rear shield See Rear shield removal on page 4 7 Check the cable at JFUSES 1 for proper connection to the
131. components listed above as a method of troubleshooting components JE Once a component has been installed in a printer and the printer is powered on it cannot be Go Back used in another printer It must be returned to the manufacturer One or more operator panel buttons fail Check the cable connection between the RIP Go to step 3 Go to step 2 and the UICC and check the connection from the UICC to the display Are the cables properly connected Reconnect the cables POR the device into Go to step 3 Problem resolved Diagnostics mode and perform the button test See Button Test on page 3 17 Do any of the buttons fail the test Using a multimeter check the cable Go to step 5 Go to step 4 connecting operator panel to the RIP board for continuity Is there continuity Replace the UICC See User interface Go to step 6 Problem resolved controller card removal on page 4 113 POR the MFP into Diagnostics mode and perform the button test Do any of the buttons fail the test Replace the RIP board See RIP board Contact your next level of Problem resolved removal on page 4 19 support POR the device into Diagnostics mode and perform the button test Do any of the buttons fail the test Replace the UICC cable See User interface Go to step 5 Problem resolved controller card cable removal on page 4 112 POR the device into Diagnostics mode and perform the button test Do any of the buttons fail
132. conds and then turn the printer on Note If turning the printer off and then on again does not clear the message then touch Continue with scanner disabled to return to the home screen and then contact your system support person Place the document in the ADF and then adjust the paper guides From the home screen touch Copy or use the keypad to enter the number of copies Change the copy settings as needed Touch Copy It Try one or more of the following Remove and reinstall the specified toner cartridge For instructions on removing a toner cartridge touch More information Install a new toner cartridge following the instruction sheet that came with the replacement part Replace the waste toner bottle For instructions on replacing the waste toner bottle touch More Information Touch Continue to clear the message and continue printing 82 xx Waste toner bottle Reinsert the waste toner bottle into the printer missing 88 xx Color cartridge critically low 2xx paper jam messages CC A single page of media jam at the input Remove the tray 1 unit open the front sensor door and remove the print cartridge to Error code 200 xx Paper Jam Check lt area gt 200 xx Paper Jam x Pages Jammed 201 xx Paper Jam Check area 201 xx Paper Jam x Pages Jammed 2 10 Service Manual Replace the specified toner cartridge 1 Touch More Information from the printer control pane
133. cs Menu Turn off the printer press and hold 3 and 6 turn on the printer and release the buttons when the progress bar appears 2 Navigate to Base Sensor Test 3 Select the sensor to test 4 Open the toner door remove the corresponding toner cartridge 5 Note whether the operator panel shows a change in state Note If the reflective disk is not showing on the cartridge rotate the gear clockwise to expose the reflective surface For additional information about the Base Sensor Test see BASE SENSOR TEST on page 3 20 Does the operator panel display a change of state Remove the toner cartridge and inspect the Repair or replace the TMC lenses on the toner meter cycle TMC card card See Toner meter cycle TMC card removal Are the lenses blocked damaged or dirty Page 4 66 Turn off the printer and remove the rear Replace the RIP board See shield See Rear shield removal on RIP board removal on page 4 7 Disconnect the cable at the JSP1 page 4 19 connector on the RIP board Turn the printer on and measure the voltages below JSP1 Pin Voltage Ground 3 3 V dc 3 3 V dc 43 3 V dc 43 3 V dc 6 40 0 V dc Are any of the voltage values incorrect 7525 63x Previous lt gt Replace the toner meter cycle TMC card See Next Toner meter cycle TMC card removal on page 4 66 J Go Back Go to step 2 Replace the TMC card See Toner meter cycle TMC
134. curit de ce produit repose sur des tests et des agr ations portant sur sa conception d origine et sur des composants particuliers Le fabricant n assume aucune responsabilit concernant la s curit en cas d utilisation de pi ces de rechange non agr es e Les consignes d entretien et de r paration de ce produit s adressent uniquement un personnel de maintenance qualifi e Le d montage et l entretien de ce produit pouvant pr senter certains risques lectriques le personnel d entretien qualifi devra prendre toutes les pr cautions n cessaires ATTENTION Ce symbole indique la pr sence d une tension dangereuse dans la partie du produit sur laquelle vous travaillez D branchez le produit avant de commencer ou faites preuve de vigilance si l ex cution de la t che exige que le produit reste sous tension Norme di sicurezza e La sicurezza del prodotto si basa sui test e sull approvazione del progetto originale e dei componenti specifici Il produttore non responsabile per la sicurezza in caso di sostituzione non autorizzata delle parti e Leinformazioni riguardanti la manutenzione di questo prodotto sono indirizzate soltanto al personale di assistenza autorizzato Durante lo smontaggio e la manutenzione di questo prodotto il rischio di subire scosse elettriche e danni alla persona piu elevato Il personale di assistenza autorizzato deve quindi adottare le precauzioni necessarie ATTENZIONE Questo simbolo indic
135. d 170 T 1 e cs Pme 22 E E i a A 2 Rotate the left spring B and pivot the cam away from the ITU so the spring is held out of the ITU path EE m er rp 7 Js Th i E oe Repair information 4 45 Previous Next D Go Back 525 63x 3 Rotate the release lever C in a counter clockwise direction with a spring hook or needlenose pliers to Previous decouple the ITU while pulling the ITU toward the front ee A Next Go Back 4 Hold the release lever while removing the ITU Installation notes e Write down the 16 digit numeric value of the new FRU before you begin to install it e You may have to rotate the release lever again to install the new ITU e Rotate the spring clamp so it hooks over the new ITU D Note The spring should be on the right side of the gear shaft 4 46 Service Manual e After replacing the ITU be sure to enter the 16 digit numeric value of the new ITU 1 dal cll ct ae Enter the Diagnostics Menu a Turn off the printer b Press and hold 3 and 6 C Turn on the printer d Release the buttons when the progress bar appears Navigate to PRINTER SETUP gt ITU Barcode Enter the 16 digit value Touch Submit to save the changes CHECK SUM DOES NOT MATCH appears if the value entered is incorrect Developer unit removal The developer units are not FRUs 1 Raise the scanner unit and remove the toner cartridg
136. d close the front door 3 Enter the Diagnostics Menu turn off the printer press and hold 3 and 6 turn on the printer and release the buttons when the progress bar appears and run the appropriate cartridge drive motor test for the missing color 4 Navigate to MISC TESTS Motor Detect Did the motor run Remove the developer unit See Developer unit removal on page 4 47 Check the developer cartridge contacts from the HVPS to the IU Are all the toner cartridge contacts clean on both the pin and IU Are all the spring loaded pin in the HVPS free to move in and out with an equal amount of spring force Turn the printer off and remove the rear shield See Rear shield removal on page 4 7 Check the continuity between the spring loaded pin and the JSC1 connector on the RIP board Are all conductors continuous Replace the printhead See Printhead removal on page 4 61 Did this fix the problem 2 48 Service Manual Go to step 5 Go to step 6 Go to step 7 Go to step 8 Problem resolved Previous Replace the Main drive gear A assembly See Main drive gear assembly with motor v removal on page 4 57 Next Go Back Clean the developer cartridge contacts See Developer unit removal on page 4 47 Replace the HVPS See High voltage power supply HVPS with spring assembly removal on page 4 40 Replace the cable Replace the RIP board See RIP board removal on
137. de to access the sensor posts C Repair information 4 29 525 63x 4 If there is a plate on the side of the sensor latches connected remove the old adhesive plate D Previous A D Go Back D 5 Unlatch the sensor by pushing on the latches 6 Remove the sensor and disconnect the cable E from the duplex sensor Note Close the front cover and slightly lift the front of the printer to get better access E T fthere is plate on the side where the sensor latches connect remove the old adhesive plate E Installation notes 1 Clean the contact surface where you removed the sensor retaining plate or where you need to install the new one 2 Install the new sensor 3 Remove the backing from the new plate and place the plate on the surface between the sensor mounting legs Note Make sure the clamps on the legs extend onto the surface of the plate 4 30 Service Manual 525 63x Fax card removal Previous 1 Remove the rear shield See Rear shield removal on page 4 7 A 2 Disconnect the fax card cable A from the RIP board V Next Go Back Gais NIS E r a weer ITI s T NL 5 W L F M A m am amem 0 Repair information 4 31 525 63x 4 Remove the fax card from the standoff Fuser assembly removal Remove the right cover See Right cover removal on page 4 7 Remove the left cover See Left cover removal on page 4 4 Disconnect the two wire f
138. e 94mm put them back into the new photoconductor unit and reinstall the imaging unit See Developer unit removal on page 4 47 Does the distance measure 94 or 108 mm Replace the fuser See Go to step 3 Fuser assembly removal on page 4 32 Does the distance measure 38 55 or Replace the ITU See Go to step 4 79 mm Image transfer unit ITU removal on page 4 43 Diagnostic information 2 49 7525 63x Previ Does the distance measure 44 or 46 mm Replace the developers that Check the various rollers in A match the missing color the printer for debris black cyan magenta or v yellow See Developer unit removal on Next page 4 47 Go Back Print quality horizontal line Either the photoconductor unit or one of the developer units that make up the imaging unit is defective Remove and inspect the imaging unit Replace the damaged part of the imaging unit See Developer unit removal on page 4 47 Print quality insufficient fusing Is the printer setup to use the correct media Go to step 2 Change the settings to indicate the correct media Check the fuser connections on the left and Go to step 3 Properly reconnect or right side of the printer replace the cables Are the cables and connection correct Is the fuser properly installed Go to step 4 Install the fuser properly Replace the fuser See Fuser assembly Problem resolved Replace the LVPS see removal on pa
139. e performed whenever the ADF unit flatbed unit or controller card are replaced To manually register the ADF 1 Navigate to Scanner Manual Registration Print Quick Test to print a Quick Test page 2 To view the ADF s current registration e Place the Quick Test page in the ADF with the image facing up and touch Copy Quick Test to view the frontside registration e Place the Quick Test page in the ADF with the image facing down and touch Copy Quick Test to view the backside registration 3 To adjust the ADF s registration e Touch ADF Front to adjust the frontside registration e Touch ADF Back to adjust the backside registration Touch or to adjust the settings for the Horizontal Adjust or the Top Margin Touch Submit to save the changes or touch Back to return to Scanner Manual Registration without saving any changes Repeat step 2 to verify the adjustments Repeat steps 1 6 to make further adjustments ae pe To manually register the flatbed Navigate to Scanner Manual Registration Print Quick Test to print a Quick Test page Remove all pages from the ADF Place the Quick Test page on the flatbed and touch Copy Quick Test to view the flatbed s current registration The printer performs a mono text mode scan Touch Flatbed to adjust the flatbed s registration Touch or to adjust the settings for the Left Margin or the Top Margin Touch Submit to save the changes or touch Back to return to Scanner Manual Reg
140. e removal 4 89 ADF input tray removal 4 88 ADF separator pad removal 4 91 ADF separator roll removal 4 92 ADF service checks cover open 2 62 duplex 2 65 feed errors 2 64 paper jam 2 63 streak 2 63 AIO link removal 4 97 AIO release lever removal 4 96 AIO toner cover removal 4 98 attendance messages 2 5 B bin full flag removal 4 99 bin full sensor removal 4 16 service check 2 33 C CCD service check 2 60 clearances printer 1 6 configuration menu accessing 3 5 available tests 3 32 covers removal front cover assembly 4 3 front middle cover assembly 4 4 left cover 4 4 rear shield 4 7 right cover 4 7 D dead printer service check 2 34 developer unit removal 4 47 diagnostic aids 3 1 diagnostic information 2 1 diagnostics 1xx xx service errors 2 13 2xx paper jams 2 10 840 xx error service check 2 59 7525 63x Previous A V 8xx xx service errors 2 17 900 xx error service check 2 28 Next 90x xx error service check 2 31 925 01 error service check 2 31 4 950 xx NVRAM failure service check 2 32 Go Back 9xx xx service errors 2 19 ADF service checks 2 62 autocompensator mechanism service check 2 32 bin full sensor service check 2 33 dead printer service check 2 34 duplex manual feed sensor S1 service check 2 35 fax error log codes 2 24 front door sensor service check 2 36 fuser exit sensor service check 2 37 fuser service check 2 38 input sensor S2 service check 2 39 main drive gear asse
141. e ADF See Go to step 8 Duplex ADF removal on page 4 87 Problem resolved Go to step 9 Previous Next D Go Back 7525 63x Check the ADF cable for continuity Go to step 6 Replace the ADF cable See Previous ADF cable removal on age 4 89 A Is there continuity pag Replace the ADF Go to Duplex ADF Problem resolved Replace the RIP board Go j removal on page 4 87 to RIP board removal on Next page 4 19 Does this fix the problem H Go Back Perform sensor 1 and sensor 2 sensor tests Go to step 2 Go to step 3 Go to SCANNER TESTS on page 3 26 Are the sensors working properly Check the ADF sensor actuators to see if they Go to step 3 Clean the actuators If any are dirty or jamming actuators on the ADF are broken replace the ADF Are the actuators working properly unit See Duplex ADF removal on page 4 87 Check all the connections on the ADF relay Go to step 4 Properly connect all the card connections Are they properly connected Check the ADF cable to ensure it is properly Go to step 5 Properly connect the ADF connected to CN 15 on the ADF relay card cable to its connections and main RIP board at JADF1 Is the ADF cable properly connected Check the ADF cable for continuity Make sure Go to step 6 Replace the ADF cable Go pin 22 has continuity to ADF cable removal on page 4 89 Is there continuity on pin 22 Replace the ADF Go to Duplex ADF P
142. e Application used if error is related to specific print file Device Operating System Driver used PCL PS Frequency of the occurrence of the error Go Back 90x xx error 902 xx 907 xx service check Turn the printer off and remove the rear Replace the RIP board Securely make all the shield See Rear shield removal on See RIP board removal connections POR the page 4 7 Check the cable connections on page 4 19 printer Are all the cable connections secure 925 01 fan error service check Turn off the printer and remove the rear Replace the top cover Replace the RIP board See shield See Rear shield removal on which includes the fan RIP board removal on page 4 7 Unplug the fan cable at JFAN1 and See Top cover assembly page 4 19 turn the printer on Check the following removal on page 4 9 connectors JFAN1 Voltage 1 43 3V dc 2 Ground 3 24Vdc Are the measured values correct Diagnostic information 2 31 7525 63x 950 xx NVRAM failure service check Previous Warning Replace one of the following components and perform a POR before replacing a second component A Never replace both of the components without performing a POR after installing each one or the printer will be rendered inoperable V e Operator panel assembly Next e RIP board Warning Never install and remove components listed above as a method of troubleshooting components JE Once a component has been inst
143. e Enhanced via Lexmark Scan Center 1200 x 1200 dpi 2400 x 2400 dpi 4800 x 4800 dpi Next 9600 x 9600 dpi 19200 x 19200 dpi Output resolutions GoBack e Mono 600 x 600 dpi e Color 600 x 600 dpi Duplex scan Duplex scan and copy is available on X548 series machines Scan file output formats e TIFF e JPEG PDF e XPS Supported compressions e PDF 1 bit JBIG2 CCIT G4 Flate 8 24 bit Flate JPEG e TIFF 1 bit CCITT G4 8 24 bit Packbits LZW e JPG 8 24 bit JPG Supported scan destinations Temporary profile from a user s PC e Scan to PC via network TWAIN e Scan to PC using Web applet e Scan to E mail e Scan to USB X544 models only Lexmark Scan Center Multiple copies 999 copies maximum Reduce Enlarge 25 to 400 General information 1 17 7525 63x Fax specifications Phone network connectivity Phone networks types supported PSTN or analog PABX RJ 11 ITU compatibility Group 3 ECM Mono resolution Standard resolution 8 x 3 85 pels mm 200 x 100dpi 204 x 98 Fine 8 x 7 7 pels mm 200 x 200dpi 204 x 196 Superfine 11 8 x 11 8 pels mm 300 x 300 dpi 204 x 391 Ultrafine 15 7 x 15 7 pels mm 400 x 400 dpi 408 x 391 Modem speed V 34 2 400 33 600 BPS V 17 7 200 14 400 BPS V 27ter 2 400 4 800 BPS V 29 7 200 9 600 BPS Line interface selection Modular Plug Dual RJ 11C Out Band Signal Level Guaranteed North American and Europe PTT standard Input Level Range 1
144. e SEA Sde sees ss eee Sede ees heeds qqpedtddex vi Na Ee 3 57 BEDA DOVEO cdd ae ro ee ee ae mr ee ee er ee COR JR ebd eee 3 58 Sleep me Cae eee 3 59 Step 4b Second ansie 54008 bebe ddwe este eb Y On dee Ge XAR GORGE de bet GOKA RA OR 3 60 sioe sc E ee es be eee 3 61 Step 6 LIBBIUBEIBSR Lec FEAR ER RARE GO HC GR lp CHER od 4604 508000 00005 3 62 Paper path transport components 000 eee hh 3 64 Faber pun IIO ODE i aoa d ug OE RC EE CE Xo ees EY SUP TE 3 64 Tran Pon COM S gra ee ee a ea eee eee eee ee ee ee oe ere dac dd ir od 3 65 Duplexing models with duplex support only 0 0 0 0 eee eee 3 65 oe qubd a ELITS Oo 21 7 1 7 1 tas Geman EE eee taenenaGewens 3 66 Bia o I MP rp RR 3 66 aee aescputSiat ac d S Rd SEl RSEN BLANCHE ACC RE DH ake Sd MS ici do a RC DR EROAT Mc E RICE 3 67 Repair information REESE DU TTTERMTIUUTTE 4 1 Table of contents Vii 7525 63x Handing E5D sensiliue Pais xis oaa cass x ER ROLE RC ere a R OUR eaten e REA dO CR Rr Ar OS o 4 1 Testing genere FH usas su REC RCRHERORCA CARA ACA 6 WOR RESO RRS AE RUCS ER AC E AER MCCC R CR RE URCR 4 1 PI A COO Se MO MEL C D OTTPUTTTIUUTMIUT 4 2 Print engine removal procedures 0000 cece 4 2 Front coyer assembly TOmOVAL is oacwich bene beers Lease EAR eae ee eee VE 9 cR 4 3 Front middie cover TOIIDVM ic acc d ge RR RC IRUR EA RC RC RR e aie er eR REC R 4 4 LO COVEF OMG ss 2 dados E ERROR SHERH ACCRUE ROCA
145. e fuser i A Vv The fuser F applies heat and pressure to the page to melt the tiny toner particles and bond them permanently to the media The fuser moves the paper to the redrive rolls which move the paper to the output bin DE D Go Back Service tips e lf the fuser rollers are damaged they can cause toner to be pulled off the page or cause paper jams e Toner that rubs off a printed page can be a sign of a malfunctioning fuser or an improper media setting Always check the paper type setting before replacing the fuser A common mistake is to print on heavier media such as card stock with the paper type set to plain paper e When removing paper jams from the fuser be sure to use the fuser release tabs to relieve the pressure on the page In addition never pull unfused toner through the fuser if you can help it try to back the jammed page out of the fuser in the opposite direction it was traveling Diagnostic aids 3 61 7525 63x Step 6 Clean Erase There are two main cleaning processes that take place during the EP Process One process cleans the transfer belt and the other cleans the photoconductors Transfer Unit Clean Once the toner image on the transfer belt has been transferred to the page the transfer belt rotates around and is cleaned by the cleaning blade G This occurs for every page that is printed After the toner i
146. e problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Previous Next D Go Back 7525 63x Service error messages Previous _ _ is 109 02 Service The black printhead failed to complete Perform a POR If the problem persists go Black Printhead Servo to Printhead service check on page 2 54 v 109 03 Service The black printhead mirror motors Perform a POR If the problem persists go 4 Black Printhead failed to achieve lock to Printhead service check on page 2 54 Go Back 109 04 Service The black printhead mirror motors lost Perform a POR If the problem persists go Black Printhead PLL motor lock to Printhead s
147. e siate ana eset OOO ADF Paper Present 0 Paper not present in the ADF HEN OU NNI FB Cover Open 0 Flatbed cover closed P reme O Home Sensor Closed Scanner carriage not positioned over the home sensor er pon Saar aago postoned omt a ome saren 0 ADF Cover Open 0 ADF cover closed WENN O Scan 1st sensor 0 Paper isn t above this sensor Hl C Scan 2nd sensor 0 Paper isn t above this sensor Hill am he ADF and tp ip arise 3 26 Service Manual Previous Next D Go Back ADF paper present sensor test 7525 63x This test should be used if the ADF fails to feed paper when a scan is performed To test this sensor 1 ADF Paper Present 0 appears 2 Open the ADF top cover 3 Press and hold the ADF paper present sensor actuator A at the top of the ADF unit A 4 The value of ADF Paper should change from 0 to 1 if the sensor is working properly 5 Press to return to SCANNER TESTS FB cover open sensor test This test verifies the functionality of the FB cover closed sensor To test this sensor 1 FB Cover Open 0 appears 2 Lift the flatbed cover the value of FB Cover Open changes from 0 to 1 Diagnostic aids 3 27 Previous A D Go Back 7525 63x 3 Press and hold the FB cover actuator A Previous A D Go Back 4 The value of FB Cover should change from 1 to 0 if the sensor is working properly 5 Press to return to SCANNER TESTS ADF cover open sensor test Thi
148. e the waste toner bottle See Waste toner bottle removal on page 4 73 Remove the imaging unit See Imaging unit IU removal on page 4 63 Remove the rear shield See Rear shield removal on page 4 7 Remove the rear screw A in the waste toner bottle sensor contact to allow access to the cable cover Note The waste toner bottle sensor contact does not need to be unplugged or removed Remove the four screws B securing the cable cover Note The cable cover is part of the right lower frame FRU A OPA a 8 Carefully place the printer on its left side 9 Remove the sensor See Duplex sensor removal on page 4 29 Repair information 4 53 525 63x 10 Remove the three screws C securing the lower right frame to the printer 11 Remove the screw D close to the front of the printer Previous A D Go Back iA D C 12 Swing the rear part away from the printer to access the spring and remove the spring E from the right lower frame 4 54 Service Manual 525 63x 13 Lift the right lower frame pin F out of the hole in the printer frame Previous A D Go Back 14 Swing the rear part away from the printer to access the spring G and remove it from the right lower frame G 15 Disconnect the cable H from the tray present sensor Repair information 4 55 525 63x 16 Swing the rear of the lower frame away from the printer and remove the right lower
149. ead 106 05 Service Yellow Printhead 106 08 Service Yellow Printhead 106 11Service Yellow Printhead 106 12 Service Yellow Printhead 106 13 Service Yellow Printhead 107 xx Cyan Printhead Error 107 01 Service Cyan Printhead 107 02 Service Cyan Printhead 107 03 Service Cyan Printhead 107 04 Service Cyan Printhead 107 05 Service Cyan Printhead Yellow printhead error The yellow printhead lost HSYNC The yellow printhead failed to complete servo The yellow printhead mirror motors failed to achieve lock The yellow printhead mirror motors lost PLL motor lock Failure reading NVRAM from printhead The yellow laser showed bad in EMS testing Failure writing data to printhead Failure reading data from the printhead Printhead declared error Cyan printhead error The cyan printhead lost HSYNC The cyan printhead failed to complete servo The cyan printhead mirror motors failed to achieve lock The cyan printhead mirror motors lost PLL motor lock Failure reading NVRAM from the cyan printhead Perform a POR If the problem persists go to Printhead service check on page 2 54 J Go Back Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR I
150. ear shield See Rear shield removal on page 4 7 3 Remove the RIP board See RIP board removal on page 4 19 4 Disconnect the high voltage power supply HVPS cable from the HVPS 4 40 Service Manual Previous A D Go Back 525 63x 5 Remove the screw B securing the HVPS Previous A D Go Back B 6 Press down on the spring mount and carefully slide the HVPS out Release the pressure on the spring mount when the LVPS slides out about 25mm Repair information 4 41 525 63x Installation notes Previous CAUTION A After disconnecting the high voltage power cable from the RIP board always check that the HVPS connection was not loosened Make this check anytime you are working near the HVPS v cable Next Warning Connect the high voltage power supply HVPS cable to the high voltage power supply before sliding T the board into the printer Pull the HVPS cable through the access hole and plug into the RIP board Go Back Be careful not to dislodge the cable from the HVPS e When reinserting the HVPS make sure to slightly raise the board to avoid snagging the locating pin C and the two protruding screws D Damage may occur to the components under the HVPS board if they come into contact with these points during insertion 4 42 Service Manual Image transfer unit ITU removal 1 See 525 63x Previous Write down the number on the new ITU before installing it You will n
151. eck 7525 63x Previous Go to step 6 Replace the RIP board See RIP board removal on page 4 19 v Next Go Back Problem resolved Replace the RIP board See RIP board removal on page 4 19 The Input sensor S2 is part of the autocompensator FRU and is not available otherwise Watch the display while rotating the flag Does the display indicate Input 2 Media Clear and Input 52 Media Present Enter the Diagnostics Menu 1 Turn off the printer 2 Press and hold 3 and 6 3 Turn on the printer 4 Release the buttons when the progress bar appears Perform the Base Sensor Test See BASE SENSOR TEST on page 3 20 1 Navigate to BASE SENSOR TEST Input S2 2 Pull Tray 1 out and rotate the S2 sensor flag S2 is located in front of the center autocompensator mechanism housing It should rotate freely and return to its original position Is the input sensor S2 flag damaged Replace the autocompensator mechanism Go to Autocompensator mechanism ACM standard tray removal on page 4 13 Go to step 2 Problem resolved Go to step 3 2 39 Diagnostic information 7525 63x s Previ Turn the printer off and remove the rear Go to step 4 shield See Rear shield removal on page 4 7 Is the JSP1 cable connector properly connected to the RIP board Turn the printer on and check the voltage at Replace the JSP1 pin 15 autocompensator mechanism Go to Autoco
152. ed Check the ADF cable for continuity Is there continuity Check for signals or voltages from JADF1 on the RIP board Pins 11 and 12 should measure 24 V dc Pin 5 should measure 14 V dc Are there signals or voltages present If the ADF is multi feeding check for dirt on the ADF separator pad and ADF separator rollers Is there dirt present If the paper is skewing when it is fed into the ADF check the paper guide width Is it set correctly If paper is skewing when fed or jamming check to see if the top cover is open or ajar Perform the ADF paper present sensor test Go to SCANNER TESTS on page 3 26 Is the sensor working properly Check the actuators to see if they are jammed or damaged Are they jammed or damaged Properly connect all the connections in the ADF relay card and RIP board Did this fix the problem 2 64 Service Manual Go to step 11 Secure all the connections Go to step 11 Replace the ADF cable Replace the ADF unit See Replace the RIP board Go Duplex ADF removal on to RIP board removal on page 4 87 page 4 19 Clean them with a lint free cloth and isopropyl alcohol Replace the separator pad and ADF pick roll Set the paper guides so they make contact with the edges of the paper If the paper is jamming in the ADF see ADF paper jam service check on page 2 63 Go to step 7 Properly connect all the connections in the ADF relay card Replace th
153. ee leeleee eren 4 74 Scanner component removal procedures 000 cee enhn 4 75 FDO FOIHOVAL aa 204 9 373 PEE E EROR A HR EW ORDRE 005000054 E ARCA e oC HR RO 4 75 Preparing and installing the new flatbed llle 4 82 Flatbed PIvol Ink remoVAl s 33340949 9 poi RURTECEO RR chansons ee E RON RE RA 65556 Ry s EROR RO 4 85 Duplex ADF rear COVE IBIBOVAL aas xA a R CC RC idan EROR chee es a o 4 86 DUDES ADF FODIOVII 654 565 0b hed EUR DRIN UROR RCRUA DECORA GER ee CACAU RUSO TC OCA RC RO kee CR de c ae ees 4 87 ADPEIDBUETSV OMO 2x56 ax d ERREEN C CREE eee HC RC NE cue CD RR HOP RC HEC CR CR 4 88 ADF Cable TOMOV Ghat naci XE HAC R bho ROO Sh Oe eek 646d ra E CRACK ROCA 4 89 ADP Separator pad IBRBIOVAL iud eR AERE C CR RR ARE RAN E X RR RXERRRAEEXRSEEG AA ERR 4 91 ADF separator roll assembly removal eller 4 92 H dgnvs unm rem a 2 vane aic ORC HR CR RO he ke See ee E p 4 93 Scanner left CDVBE removal s occi RA RC CIAR ERE OCA AG OR ee RR ews 4 94 Scanner righi COVE FOImmDVB a iai Vd d PRLECRODORU ACRIOR CRUCE RR ARCREOR CREER RO ER 3m GRO d7 4 94 AIO release lever TOTIOVAL 2 sue such RR REOR RO EOS US ORARE A CRUS ona ere ee eee ee eens sd 4 96 Lien d 07 6 aac 6 ond 2 rrrrrrDP 4 97 AIO toner cover removal 666i dis oh dee hae edie d aT Ae eee ode ere kee ee ee D CR a 4 98 En no JI TOMO Al i gos dox esse bens biweseew nse eu Jo 328 9 A 8338 a AE AA 4 99 Vili Service Manual
154. eed the 16 digit numeric value from A the barcode after the installation and it is easier to see at this point Remove the right cover See Right cover removal on page 4 7 v Remove the rear shield See Rear shield removal on page 4 7 Next Remove the waste toner bottle See Waste toner bottle removal on page 4 73 Remove the imaging unit IU See Imaging unit IU removal on page 4 63 Note The ITU FRU includes a spring clamp kit If the printer does not have this kit installed perform the Go Back following steps to prepare for the later installation Continue below with ITU without spring clamp kit removal on page 4 43 If the spring clamp kit is not installed skip to Continuing the removal with or without spring clamp kit on page 4 45 ITU without spring clamp kit removal 1 Pull the gear A straight out to unsnap it and then discard it A new gear is included in the spring clamp kit and must be used with the new spring clamp m um ji 2 Repair information 4 43 525 63x 2 Remove the rubber pad C 3 Place the spring clamp onto the shaft D 4 Snap the new gear onto the shaft D The installation is the same as the old gear 4 44 Service Manual HM Previous A D Go Back Continuing the removal with or without spring clamp kit 525 63x 1 Disconnect the one spring A from the side frames leaving them attached to the ITU or spring clamp P jun mie uA i m ini
155. eeltaan sellaisia etta kayttaja ei joudu alttiiksi luokkaa 1 suuremmalle sateilylle normaalin kayton yllapidon tai huollon aikana Huomautus laserlaitteesta Tama tuote on sertifioitu Yhdysvalloissa DHHS 21 CFR Subchapter J standardin mukaiseksi luokan 1 lasertuotteeksi ja muualla IEC 60825 1 standardin mukaiseksi luokan lasertuotteeksi Luokan lasertuotteita ei pidet haitallisina Laitteen tulostusp kokoonpanossa ei huollettavissa on sis nrakennettu luokan llIb 3b AlGalnP laser joka tuottaa silminnahtavaa s teily 650 670 nanometrin aallonpituudella Laserjarjestelma ja tulostin ovat rakenteeltaan sellaisia etta kayttaja ei joudu alttiiksi luokkaa 1 suuremmalle sateilylle normaalin kayton yllapidon tai huollon aikana Notices and safety information Xiii 71525 63x Laser notis Denna produkt ar certifierad i USA i enlighet med kraven i DHHS 21 CFR underkapitel J f r klass 1 laserprodukter och pa andra platser certifierad som en klass l laserprodukt i enlighet med kraven i IEC 60825 1 Klass l laserprodukter betraktas inte som skadliga Skrivaren inneh ller en klass IIIb 3b AlGalnP laser som producerar synlig stralning inom vaglangden 650 670 nm innesluten i en icke servicebar skrivhuvudenhet Lasersystemet och skrivaren ar utformade sa att manniskor aldrig uts tts for laserstralning som 6verskrider klass I nivaerna under normala f rh llanden vid anv ndning underh ll eller service Laser meldin
156. een the sensor mounting posts 5 Connect the cable to the tray present sensor 6 Replace the spring USB connector removal u Remove the rear shield See Rear shield removal on page 4 7 2 Disconnect the USB connector from the RIP board 3 Remove the flatbed assembly See Flatbed removal on page 4 75 Note Do not remove the flatbed covers or any of the hinges The flatbed needs to be removed from the print engine only 4 Remove the operator panel from the flatbed assembly See Operator panel assembly removal on page 4 102 5 Remove the CCD ribbon cable cover A and route the USB cable out through the cable channel on the flatbed unit 4 72 Service Manual Previous A D Go Back 525 63x Waste toner bottle removal Previous The waste toner bottle is a customer replaceable unit Open the front cover v 1 2 Liftthe toner cover Next 3 Remove the right cover assembly See Right cover removal on page 4 7 4 Press the two tabs A to release the waste toner bottle and remove it Go Back LUE ni a FS VM gi LY m Repair information 4 73 525 63x Waste toner bottle contact block removal Open the front cover Remove the right cover assembly See Right cover removal on page 4 7 Remove the waste toner bottle See Waste toner bottle removal on page 4 73 Remove the screw A from the back of the waste toner bottle contact block AADI
157. el Check line quality Adjust Receive Threshold Select a lower Max Speed value under Fax Send settings Check line quality Adjust Transmit Level Select a lower Max Speed value under Fax Send settings No action needed Issue is with the other device e Check line quality e Adjust Receive Threshold e Check line quality e Adjust Transmit Level e Select a lower Max Speed value under Fax Send settings Received EOT unexpectedly from the modem in V 34 mode Too many timeouts occurred during ECM reception Fax canceled by user Unexpectedly received a disconnect command from the remote end Remote fax device failed to respond to the DCS command T1 timeout occurred when trying to establish a connection with a remote fax device T2 Timeout occurred due to loss of command response synchronization T5 Timeout occurred when transmitting image data to remote fax device If error persists disable V 34 modulation scheme If error persists disable ECM mode No action needed e Check line quality Adjust Transmit Level Receive Threshold values Remote device could be requesting an unsupported feature Adjust Transmit Level Receive Threshold values Remote device could be malfunctioning Adjust Transmit Level Receive Threshold values e Adjust Transmit Level Receive Threshold values e Check line quality e Adjust Transmit Level e Select a lower Max Speed value under
158. el with water Next 2 Open the scanner cover D Go Back White underside ADF cover White underside scanner glass cover ADF glass 3 Wipe the scanner glass until it is clean and dry 4 Wipe the white underside of the scanner cover until it is clean and dry 5 Close the scanner cover Preventive maintenance 6 3 7525 63x 6 4 Service Manual Previous A D Go Back 7525 63x 7 Parts catalog Previous How to use this parts catalog V Next The following legend is used in the parts catalog Units mach Go Back Part Units Or Units option Description number FRU e Asm index Identifies the assembly and the item in the diagram For example 3 1 indicates Assembly 3 and item number 1 in the table e Part number Refers to the unique number that identifies the FRU e Units mach Refers to the number of units actually used in the base machine or product e Units option Refers to the number of units in a particular option It does not include the rest of the base machine e Units FRU Refers to the number of units packaged together and identified by the part number NS Not shown in the Asm Index column indicates that the part is procurable but is not pictured in the illustration e PP Parts Packet in the parts description column indicates the part is contained in a parts packet e Model information used in the parts catalog The Lexmark X548 series MFPs are available in the foll
159. emoval on page 4 29 page 4 19 values at JFUSES1 JFUSES1 Pin Value 8 Ground 43 3 V dc Are the values approximately correct Diagnostic information 2 35 7525 63x Front door sensor or switches service check Previous 0 Ww O POR the device into Diagnostics mode Sensor toner door and Go to step 2 1 Turn off the printer Henn goots uo DEM 2 Press and hold 3 and 6 3 Turn on the printer T 4 Release the buttons when the progress bar Go Back appears Perform the Base Sensor Test See BASE SENSOR TEST on page 3 20 1 Navigate to BASE SENSOR TEST gt Front Door 2 Open and close the front door and observe the display Does the display indicate Front Door Closed with the door closed and Front Door Open with the door opened Open the toner door and inspect the vertical Replace the top cover Go to step 4 web that pushes and rotates the pivot plate assembly See Top cover assembly removal on Is it damaged pagea With the front cover open inspect the two Replace the right cover Go to step 5 switches Using a tool such as a spring hook assembly See Right push the metal arms to check the movement cover removal on page 4 7 Is there any damage to the switches or the surrounding area Turn the printer off and remove the rear Go to step 6 Replace the RIP board See shield See Rear shield removal on page 4 7 Turn the printer on and verify the following values
160. enu contains settings for fine tuning the communication settings for the network interfaces and protocols This should be used only under the guidance of second level support See Fax transmission service check on page 2 67 and Fax reception service check on page 2 68 See Updating printer firmware on page 3 54 Diagnostic aids 3 5 71525 63x Diagnostics Menu Diag Menu Note Tray 2 refers to the 650 sheet tray located in the 650 sheet duo drawer assembly Diagnostics Menu structure When the Diagnostics mode is entered each Diagnostics main menu item displays on the operator panel When a diagnostic test is selected from the main menu a sub menu displays and each individual test displays in the order shown Any options that are referred to in the menus are displayed when the option is installed Available tests The tests display on the operator panel in the order shown REGISTRATION Printer See Printer on page 3 9 Quick Test See Quick Test on page 3 10 Alignment Menu Cyan These tests are performed to align the color planes See Alignment Magenta Menu on page 3 11 Yellow Factory Scanner See Factory Scanner on page 3 13 Factory Manual See Factory Manual on page 3 13 Copy Quick Test See Copy Quick Test on page 3 14 Adjust Calibration Values See Adjust Calibration Values on page 3 14 Reset Flatbed Calibration See Reset Flatbed ADF Front ADF Back Calibration Values on Values p
161. epair information 4 37 525 63x T Disconnect the narrow medial sensor cable and remove the cable from the fuser frame See Narrow Previous media sensor flag removal on page 4 17 Note Observe the cable routing A 8 Unhook the springs D from both sides of the fuser y Next Go Back 9 Rotate the fuser toward the front of the printer until the screw E can be accessed and removed 10 Disconnect the cable G from the fuser exit sensor 11 Remove the screw F securing the fuser exit sensor 12 Remove the lower end of the sensor with a flat blade screwdriver and gently pull the sensor from the frame 4 38 Service Manual 525 63x Hard drive removal Previous 1 Remove the rear shield See Rear shield removal on page 4 7 A 2 Disconnect the hard drive cable A from the RIP board Vv Next Y Go Back BTA 3 DOR Ltd IM Hitachi Girbal L DEL jarwi i gt Ge karin APR LU BONS Ji KEME i Eier HA NT LES e i LLLAITIJI e BAET31 i IDEM TL LEE Hi ut Tore Case mAFRAMNTE WIG s il i ik d Hun mot LL A A i r i Li p n AW A A 3 Pullthe hard drive and remove Repair information 4 39 525 63x High voltage power supply HVPS with spring assembly removal 1 Remove the left cover Note There should be a leaf spring A biasing the HVPS upward 4 m i scent NC ER fr bat Se Li oe on E LP 2 Remove the r
162. eplace the 650 sheet drawer assembly If the 550 sheet assembly is affected replace the entire 550 sheet assembly Is the sensor dislodged Does the message Tray x Missing fail to Go to step 5 Problem resolved appear when the tray is pulled out 2 56 Service Manual Previous Next D Go Back 7525 63x Turn off the printer and remove the rear Problem resolved Replace the RIP board See A shield Rear shield removal on page 4 7 RIP board removal on Disconnect the cable at JTRAY1 connector for page 4 19 v Tray 1 or JOPT1 for Tray 2 and 3 on the RIP board Turn the printer on and measure the Next voltages below JTRAY1 for Tray Go Back 1 Voltage LS Check these voltages for Tray 2 and 3 JOPT1 for Tray 2 or 3 Pin vonage e Ground e Ground Are the voltage values approximately correct Option trays 2 and 3 service check Are two option trays being used Go to step 2 Go to step 4 If two option trays are being used is the Go to step 4 Go to step 3 550 sheet tray on the bottom Switch the order of the trays so the 500 sheet Problem resolved Go to step 4 tray is on the bottom and print a page from both trays Did the pages print from both trays Inspect the paperfeed tires on the tray that fails Go to step 5 Go to step 6 to pick Do they appear worn Replace the paperfeed tires on the faulty tray Problem resolved Go to step 6 and print a page with med
163. eplaceable Unit Direct Current Dual Inline Memory Module Dynamic Random Access Memory Error correcting code Error correction mode Electrical Erasable Programmable Read Only Memory Electrophotographic process Erasable Programmable Read Only Memory Electrostatic Discharge Flatbed Field Replaceable Unit Gigabyte Host Based Printing Hypertext markup language High voltage power supply Hertz Image Transfer Unit Black Key Local Area Network Light Amplification by Stimulated Emission of Radiation Liquid Crystal Display Light Emitting Diode Low voltage power supply Magenta Megabyte Multifunction Device Multifunction Printer Message handling Millimeter Modified modified read Multipurpose feeder Modem ready NAND usage NAND gate Nonvolatile Memory Nonvolatile Random Access Memory Operator correctable failure Optical Sensor Photoconductor Portable Document Format Picture element Printer Job Language Power on reset Previous Next D Go Back POST PPDS ppm RAM RH SCC SEF TPS USB V ac V dc VOIP Power on self test Personal Printer Data Stream Pages per minute Random access memory Relative humidity Scanner Control Card Short edge feed Toner Patch Sensing Universal Serial Bus Volts Volts alternating current Volts direct current Voice over internet protocol Yellow 7525 63x Previous A D Go Back General information 1 21 7525 63x 1 22 Service Manual
164. equire replacing 82 xx Waste toner bottle Order a replacement waste toner bottle immediately nearly full 1 Replace the waste toner bottle For instructions on installing the waste toner bottle touch More Information 2 Touch Continue to clear the message and continue printing 84 xx color imaging kit Install the specified color imaging kit following the instruction sheet that came with missing the replacement part 84 unsupported color Remove the specified imaging kit and then install a supported one imaging kit 2 8 Service Manual Previous Next D Go Back 7525 63x User status and attendance messages Previous 84 xx color imaging kit 1 Order a replacement imaging kit v nearly low 2 When print quality is reduced install the new imaging kit following the instruction sheet that came with the replacement part Next 3 Touch Continue to clear the message and continue printing 84 Defective color The specified imaging kit is either missing or not functioning properly Try one or imaging kit more of the following Go Back Remove the specified imaging kit and then reinstall it Remove the specified imaging kit and then install a new one 84 xx color imaging kit Order a replacement imaging unit immediately low 2 When print quality is reduced install the new imaging kit following the instruction sheet that came with the replacement part Touch Continue to clear the message and c
165. er Error temperature within expected time page 2 38 122 06 Service EWC Error Did not reach EWC stop Go to Fuser service check on Fuser Error temperature in time page 2 38 930 09 Service Fuser zero crossings out of range Go to Fuser service check on LVPS Zero crossing detected page 2 38 122 10 Service Fuser failed to warm up Go to Fuser service check on Fuser Error page 2 38 122 11 Service decipi ind temperature error while in Go to Fuser service check on Fuser Error standb page 2 38 122 12 Service Fuser under temperature error while Go to Fuser service check on Fuser Error printing page 2 38 Diagnostic information 2 15 7525 63x Service error messages Previous fesse ome an 122 13 Service Fuser open thermistor check failed for Goto Fuser service check on v Fuser Error second thermistor page 2 38 d ex 122 14 Service Fuser shorted thermistor check failed Go to Fuser service check on Fuser Error for hot roll thermistor page 2 38 H 122 15 Service Fuser started thermistor check failed Go to Fuser service check on cade Fuser Error for second thermistor page 2 38 122 16 Service EWC Error Estimated power is at or Go to Fuser service check on Fuser Error above maximum power page 2 38 122 17 Service Total failure to close fuser nip Go to Fuser service check on Fuser Error page 2 38 141 xx Service Staging motor error Go to 90x xx error 902 xx 907 xx Staging
166. er assembly 100 V r rrrrrrrrrrrr rre 7 9 Asm Duplex ADF r crurreeerrerrre erre eee eee 7 5 Optional 550 sheet drawer complete X546dtn and X548 r mee 7 15 Asm Redrive e rrerrrrerrrerrrr rrr rrrrrrrr 7 5 High voltage power supply rrrIIIIIIIIIIIIe 7 11 ADF separator pad replacement CRU r rrrrrrrrrrrr ee 7 5 Front toner door pivot r rreurrrre erre 7 9 l 6 Service Manual Previous Next D Go Back 7525 63x Previous A D Go Back Part number index l 7
167. ervice check on page 2 54 109 05 Service Failure reading NVRAM from printhead Perform a POR If the problem persists go Black Printhead to Printhead service check on page 2 54 109 08 Service The black laser showed bad in EMS Perform a POR If the problem persists go Black Printhead testing to Printhead service check on page 2 54 109 11Service Failure writing data to printhead Perform a POR If the problem persists go Black Printhead to Printhead service check on page 2 54 109 12 Service Failure reading data from the printhead Perform a POR If the problem persists go Black Printhead to Printhead service check on page 2 54 109 13 Service Printhead declared error Perform a POR If the problem persists go Black Printhead to Printhead service check on page 2 54 122 xx Service Fuser error Go to Fuser service check on Fuser Error page 2 38 122 01 Service EWC error Attempting to print with Go to Fuser service check on Fuser Error estimated power at or below minimum page 2 38 power 122 02 Service Fuser over temperature Go to Fuser service check on Fuser Error page 2 38 122 03 Service Fuser open thermistor check failed Go to Fuser service check on Fuser Error page 2 38 122 04 Service EWC Error Did not reach EWC start Goto Fuser service check on Fuser Error temperature in time page 2 38 122 05 Service EWC Error Did not change Go to Fuser service check on Fus
168. ervice errors CDocxx 90006 and 9XX XX S bce cs eas ame xA ied evens teed ene des Ran 2 1 User status and attendance messatgBs 2 ii si vxore s Euacc 3E dA d P Pu e d puis dude d duds 2 1 Power On Reset POR sequence scura cece dae ned hen eee ACA ee Meee eee dee R R 2 1 IOS ASS igri RR OR ee oa hd Re ee eee d odios oa doi di abc ee 2 2 Peer NR Rc rien coe eek sae UM 2 2 Scan fax copy symptom table i 4160cc005 50 ane ORK en ORE ee ee 2 3 Print Guay SymbpIOms PIbBIB s ea pa Rech o ERRARE RC CAE R HE cdot CR ad 2 4 Error codes and MESSAGES saab nonc ds ede CR URRCRUR ds desl Sed AE Oe 2 5 User status and attendance messages lleeeeeeeeeee nne 2 5 2XX Daper jam mossa S cc oq aoc ad dA Cae AL RCRGRC CEU CAD CRACK a C d S Lg E ELE MR MARK 2 10 SVICE BITOFINnBSSDUBS 6 6010065400000 06080 0082S RR RRELAEHES ER EAHRER E AH RR 2 13 Fox enor lOD CONCE sariri rinn ROC Gwe en CAR eee eae eee ee hese RR Se S HRCPSUR COE Cn 2 24 lg e Rorpre E DP R rrmr 2 28 900 xx system software error service Check 000 cee eee es 2 28 90x xx error 902 xx 907 xx service check 000 cee eee ee 2 31 SES DH lan SIL OF Service CGC a us dci cad ae REOR OH Saas eRe RU RU TURE eRe See C ACC 2 31 950 xx NVRAM failure service Check 0c c eee eee 2 32 Autocompensator mechanism service ChecK 0 0000 cee eee eee ees 2 32 Bin full sensor service Check 00 c eee eee 2 33 Dead primer
169. es f 2 Remove the imaging unit See Imaging unit IU removal Warning Do not touch the underside of the imaging unit This could damage the developer units 3 Remove the developer unit you need V TAS SS NSS SEES SS SS zr Ga 7 525 63x Previous A D Go Back Check and re enter the value Repair information 4 47 525 63x Low voltage power supply LVPS assembly removal Previous N Next 1 Remove the left cover See Left cover removal on page 4 4 2 Disconnect the three cables A from the LVPS Go Back A 3 Remove the six screws B and the ground cable connected to the LVPS cage 4 48 Service Manual 525 63x 4 Remove the LVPS Previous Warning If you receive a new low voltage power supply with a voltage selector switch C be sure to set the switch to the correct setting for your voltage requirements before installing the low voltage A power supply The switch can be set for either 115 V or 230 V Failure to do so will result in damage to the power supply v Note Some LVPS FRUs are auto sensing and do not have the switch even though the opening may still Next be present in the shield 4 Go Back Repair information 4 49 525 63x Left lower frame and right lower frame removal The left lower frame and right lower frame are in the same FRU Left lower frame 1 Remove the media tray and remove the screw A in front A Remove
170. ese are also available from the Color Samples page of the Embedded Web Server Selecting any sample set generates a multiple page printout consisting of hundreds of colored boxes Either a CMYK or RGB combination is located on each box depending on the table selected The observed color of each box is obtained by passing the CMYK or RGB combination labelled on the box through the selected color conversion table To print Color samples from the printer 1 Touch to access the Administrative menus 2 Navigate to Settings Print Settings Quality Menu Color Samples 3 Select the Color Conversion table to print By examining Color Samples sets a user can identify the box whose color is the closest to the desired color The color combination labelled on the box can then be used for modifying the color of the object in a software program For more information see the software program Help topics Manual color correction may be necessary to utilize the selected color conversion table for the particular object Selecting which Color Samples set to use for a particular color matching problem depends on the Color Correction setting being used Auto Off or Manual the type of object being printed text graphics or images and how the color of the object is specified in the software program RGB or CMYK combinations When the printer Color Correction setting is set to Off the color is based on the print job information and no color conversi
171. f the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Perform a POR If the problem persists go to Printhead service check on page 2 54 Diagnostic information 2 13 7525 63x Service error messages frre meme Dm 107 08 Service Cyan Printhead 107 11Service Cyan Printhead 107 12 Service Cyan Printhead 107 13 Service Cyan Printhead 108 xx Service Magenta Printhead 108 01 Service Magenta Printhead 108 02 Service Magenta Printhead 108 03 Service Magenta Printhead 108 04 Service Magenta Printhead 108 05 Service M
172. failure Note lt device gt can be one of the following e Duplex unit e Tray 2 e Tray 3 The following actions may be taken Vv 1 Disable the Download Emulation Next 2 Program the download emulation into the code overlay SIMM again 3 If the problem is not resolved replace the code overlay SIMM and download emulation again Go Back Replace the standard network card or the card in the specified slot If unable to clear the error message check the following e f installed check the RIP board for correct installation e f correctly installed replace the RIP board See RIP board removal on page 4 19 Check the following e f installed check the RIP board for correct installation e f correctly installed replace the RIP board See RIP board removal on page 4 19 Diagnostic information 2 23 7525 63x Fax error log codes Error code 200 3XX 4xx 5xx 6xx 7XX 800 802 803 804 805 808 809 80A 2 24 Service Manual No error occurred during fax transmission Error occurred when transmitting training Error occurred when receiving image data Error occurred when sending image data Received unknown response from remote fax device Error occurred when receiving a frame Error occurred when sending a frame No action needed Check line quality Select a lower Max Speed value under Fax Send settings Adjust the transmit lev
173. ff the printer Press and hold 3 and 6 simultaneously Turn on the printer Release the buttons when the splash screen appears Diagnostics Menu Invalid Engine Code Mode Turn off the printer 2 Press and hold 3 4 and 6 simultaneously Turn on the printer Release the buttons when the splash screen appears These menus do not require a POR to access them 1 Touch 2 Navigate to Networks Ports gt Standard Network gt Std Network Setup 3 Press and hold 6 7 and 9 simultaneously Enter 411 while in the Home Prime screen Network SE Menu Fax SE Menu From a Web browser on a host PC add se to the printer IP address SE Menu Firmware update from USB For use on machines with operator panel USB 7525 63x Previous The Configuration Menu group contains a set of F menus settings and operations which are Next infrequently required by a user Generally the options made available in this menu group are used to configure a printer for operation 4 Go Back Go to Configuration Menu on page 3 32 for more information The Diagnostics Menu group contains the settings and operations used while manufacturing and servicing the printer Go to Diagnostics Menu Diag Menu on page 3 6 for more information This mode is used if the machine has invalid code and needs the correct code loaded After entering this mode the firmware code can be updated This m
174. ft Each i t des while a negative value moves the margin to the acn Increment correspones toan right No image compression or expansion approximate shift of 4 pixels at 600 occurs dpi The default value is O Skew 100 to 100 Each increment A positive value causes the left end of the scan corresponds to 1 1200 of an inch line to move up the page while a negative The default value is 0 value causes the left end of the scan line to i move down the page The right end stays fixed There is no compression or expansion of the image 5 Repeat step 1 to verify the adjustments 6 Repeat steps 1 5 to make further adjustments Diagnostic aids 3 9 7525 63x Skew One printhead houses the four color planes The black plane is aligned to the printer and the other color planes are internally aligned to black Electronic alignment fine tunes the alignment of the color planes to the black plane once the printhead is installed See Alignment Menu on page 3 11 for instructions on setting printhead alignment This must be performed before color skew adjustment is attempted The following illustration shows proper alignment versus skewed alignment Quick Test The Quick Test contains the following information e Print registration settings e Alig
175. g Dette produktet er sertifisert i USA for samsvar med kravene i DHHS 21 CFR underkapittel J for laserprodukter av klasse 1 og er andre steder sertifisert som et laserprodukt av klasse som samsvarer med kravene i IEC 60825 1 Laserprodukter av klasse anses ikke som helseskadelige Skriveren inneholder en intern AlGalnP laser av klasse IIIb 3b som produserer synlig str ling i belgelender pa 650 670 nanometer i en ikke reparerbar skrivehodeenhet Lasersystemet og skriveren er utformet slik at mennesker ikke utsettes for laserstr ling utover nivaene i klasse under normal drift vedlikehold eller foreskrevet service Aviso de l ser Este producto est certificado en Estados Unidos para el cumplimiento de los requisitos estipulados en DHHS 21 CFR Subcap tulo J para productos l ser de Clase 1 y cuenta con certificaci n para otros paises como producto l ser de Clase de conformidad con los requisitos de IEC 60825 1 Los productos l ser de Clase no se consideran peligrosos La impresora contiene en su interior radiaci n l ser visible AlGalnP Clase IIIb 3b en la longitud de onda de 650 670 nan metros dentro de un mecanismo de cabezal de impresi n que no requiere servicio t cnico La impresora y el sistema l ser est n disenados de forma tal que no exista nunca acceso humano a radiaci n l ser que supere los niveles de Clase durante el funcionamiento normal las tareas de mantenimiento por parte del usuario o l
176. g process e Avoid papers with rough or heavily textured surfaces Use papers printed with heat resistant inks designed for use in xerographic copiers The ink must be able to withstand temperatures up to 200 C 392 F without melting or releasing hazardous emissions Use inks that are not affected by the resin in toner Inks that are oxidation set or oil based generally meet these requirements latex inks might not When in doubt contact the paper supplier Preprinted papers such as letterhead must be able to withstand temperatures up to 200 C 392 F without melting or releasing hazardous emissions 1 14 Service Manual 7525 63x Storing paper Previous Use these paper storage guidelines to help avoid jams and uneven print quality A e For best results store paper where the temperature is 21 C 70 F and the relative humidity is 40 Most v label manufacturers recommend printing in a temperature range of 18 to 24 C 65 to 75 F with relative humidity between 40 and 60 Next e Store paper in cartons when possible on a pallet or shelf rather than on the floor e Store individual packages on a flat surface T e Do not store anything on top of individual paper packages Go Back Using recycled paper and other office papers As an environmentally conscious company Lexmark supports the use of recycled office paper produced specifically for use in laser electrophotographic printers In 1998 Lexmark presented to the US government a
177. ge 4 32 Low voltage power supply LVPS assembly removal on page 4 48 Does this fix the problem Print quality missing image at edge Hemove and reseat the following e Toner cartridge e Imaging unit e Developer units 2 50 Service Manual 7525 63x Print quality mottle 2 5mm speckles Previous Keep running prints through and the problem normally clears up If the problem persists replace the developer cartridge Go Back Print quality narrow vertical line Replace the photoconductor unit See Problem solved Replace the developer unit Developer unit removal on page 4 47 See Developer unit removal on page 4 47 Print quality random marks Service tip The primary cause of random marks is due to loose material moving around inside the printer and attaching to the photoconductor unit developer roll or transfer belt Is there any loose or foreign material on the Inspect the imaging unit by Go to step 2 imaging unit looking at the individual developers and photoconductors Clean or replace the faulty unit See Developer unit removal on page 4 47 Is there any loose or foreign material on the Replace the developer unit Go to step 3 developer roll Is there any loose or foreign material on the Replace the image transfer Contact your next level of transfer belt unit See Image transfer support unit ITU removal on page 4 43 Diagnostic information 2 51 7525 63x
178. gs Page appears and the pages print Diagnostic aids 3 33 Previous Next D Go Back 7525 63x Event Log Previous Lets the system support person print a limited set of the information contained in the Diagnostics Menu version A of the printed Event Log For a sample of a printout see Event Log on page 3 25 The limited Configuration log and the full Diagnostics log printed versions show the same operator panel messages when they print and v follow the same layout guidelines Next To print the event log 1 Navigate to Reports Event Log Go Back 2 Printing EVENT LOG appears and the pages print Color Trapping Color trapping uses an algorithm to compensate for mechanical misregistration in the printer When small black text or fine black lines are being printed the printer checks to see if they are being printed on top of a colored background If so rather than remove the color from beneath the black content the printer leaves the color around the edge of the text or line The hole in the colored region is reduced in size which prevents the characteristic white gap that is caused by incorrect registration To adjust this setting 1 Navigate to Color Trapping 2 Touch or to adjust the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Values include Off and numbers 1 5 the default is 2 Values 1 through 5 indicate the amount
179. guide line on the flatbed Press down the cable so that it sticks to the adhesive strip Repair information 4 83 525 63x 5 Locate the second folding guide line C and remove the paper backing from the adhesive strip bisvisue A D Go Back C 6 Fold the ribbon cable a second time as shown Align the fold of the cable with the folding guide line on the flatbed Press down the cable so that it sticks to the adhesive strip The ribbon cable should lie flat against the flatbed and there should be no slack on the ribbon cable between the two folds Replace the plastic front hinge from the old scanner Replace the cable cover plates and scanner alignment guides from the old scanner Replace the steel hinge stud from the old scanner Replace the redrive unit AIO release lever side covers and operator panel Note After installing the new flatbed unit perform the scanner calibration procedure and the scanner manual registration procedure See Scanner Calibration on page 3 14 and Scanner Manual Registration on page 3 38 Oo o 4 84 Service Manual 525 63x Flatbed pivot link removal Previous 1 Remove the AIO link See AIO link removal on page 4 97 A 2 Remove the right scanner cover See Scanner right cover removal on page 4 94 3 Remove the AIO release lever See AIO release lever removal on page 4 96 v 4 Remove the screws A securing the flatbed link to the flatbed Next Go Back
180. he display returns to the Configuration Menu Fax Storage Location To change this setting 1 Navigate to Fax Storage Location 2 Touch or tochange the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Automatic Color Adjust Sets the suggested number of pages which the printer should print between consecutive calibrations Selections are Off and the values between 100 and 1000 in increments of 50 The default is 500 pages If the printer exceeds the set value while printing a job it completes the current job and any other jobs received while printing the current job before it initiates a calibration The printer does not cancel or suspend an active job in order to perform a calibration If a user is using the menus including the Configuration Menu and the Diagnostics Menu an automatic color adjust calibration does not occur When an event other than page count triggers this calibration the count that monitors the maximum number of pages printed will be reset For example if the user replaces an empty toner cartridge the next time the printer is started it will sense the new cartridge and perform the automatic color adjustment even though the page counter for Auto Color Adj is fewer than required The Auto Color Adj page counter is then reset Note An automatic color adjust can also be initiated manually This calibration procedure should be performed
181. he following ype name e Load the specified paper in the tray or feeder Load src with custom e Touch Paper loaded continue to clear the message and continue printing string If the printer finds a tray that has the correct paper type and size it feeds from Load src with size that tray If the printer cannot find a tray with the correct paper type and size it prints from the default paper source Sao Lare witi ype e Cancel the print job Load Manual Feeder Try one or more of the following MI IGBSIOUEDIDSTISIDBE x Load the specified paper in the manual feeder Load Manual Feeder Touch Prompt each page paper loaded or Do not prompt paper loaded to with custom string clear the message and continue printing Load Manual Feeder Touch Automatically select paper to use the paper loaded in the tray with paper size e Cancel the print job Load Manual Feeder with paper type paper size Remove paper from Remove the stack of paper from the standard exit bin standard output bin Remove packaging Hemove any remaining packaging material from the specified location material area name Error reading USB An unsupported USB device has been inserted Remove the USB device and then drive Remove drive install a supported one Error reading USB hub An unsupported USB hub has been inserted Remove the USB hub and then install Remove hub a supported one Unsupported camera The camera mode does not suppor
182. he four screws B securing the redrive to the flatbed unit Remove the bin full sensor flag located on the rear shaft Repair information 4 93 Previous A D Go Back 525 63x Scanner left cover removal Previous 1 Remove the flatbed assembly See Flatbed removal on page 4 75 A 2 Release the tabs A securing the left flatbed cover to the flatbed unit using a small flat blade screwdriver V Next Go Back Scanner right cover removal 1 Remove the imaging unit in the print engine See Imaging unit IU removal on page 4 63 2 Raise the scanner assembly to the up position and lock in place 3 Remove the four screws A securing the right scanner cover to the flatbed unit 4 94 Service Manual 525 63x 4 While holding the ADF away from the flatbed use the other hand to lift and disengage the right scanner cover from the flatbed unit Repair information 4 95 Previous A D Go Back 525 63x AIO release lever removal A Remove the right scanner cover See Scanner right cover removal on page 4 94 2 Remove the screw A securing the AIO link to the flatbed unit 3 Disengage the AIO link from the flatbed unit 4 Remove the screw B securing the AIO release lever to the flatbed 5 Slide the AIO release lever towards the back of the flatbed 6 Remove the spring and AIO release lever Note When reinstalling the AIO release lever place the release lever on the flat
183. he operator panel Remove the operator panel frame cover Repair information 4 107 Previous A D Go Back 525 63x Output bin tray removal Previeus Grasp and lift the rear output bin tray away from the MFP A Next Go Back Rear case with speaker removal The rear case with speaker is not a field replaceable unit FRU 1 Remove the operator panel bezel See Operator panel bezel removal on page 4 104 2 Remove the operator panel frame cover See Operator panel frame cover removal on page 4 107 3 Remove the two screws A securing the rear case 4 108 Service Manual 525 63x 4 Pull the operator panel cover away from the rear case and disconnect the four cables B Previous A D Go Back 5 Route the cables off the rear case 6 Remove the rear case with speaker Repair information 4 109 525 63x Sleep button removal Remove the operator panel bezel See Operator panel bezel removal on page 4 104 Remove the operator panel frame cover See Operator panel frame cover removal on page 4 107 Remove the rear case with speaker See Rear case with speaker removal on page 4 108 Remove the sleep button PCB See Sleep button PCB removal on page 4 110 Remove the sleep button vim EIE Sleep button PCB removal Remove the operator panel bezel See Operator panel bezel removal on page 4 104 Remove the operator panel frame cover See Operator pa
184. he right side and disengage the gears C on the left 4 24 Service Manual PE C C Previous A D Go Back 525 63x Installation notes Previous 1 Depending on the kind of front cover follow the procedure that applies e If the front cover has a slot a Place the tab in the slot v Slot Tab Next D Go Back Repair information 4 25 525 63x b Rotate the tab into position and replace the three screws A 4 26 Service Manual Previous A D Go Back 525 63x If the front cover does not have a slot Previous d Place the tab against the cover 2 E V Next Go Back Tab b Replace the two screws B Repair information 4 27 525 63x 2 Be sure the shaft and bearing have not shifted out of the guide and that the bearing on the left is aligned with the slot C facing down towards the front door Note Improperly aligned bearings or shafts incorrectly seated may cause vibration and noise in the front door 4 Replace the eight screws in the duplex aligner 5 Close the front door 4 28 Service Manual Previous A D Go Back 525 63x Duplex sensor removal Previous 1 Remove the waste toner bottle See Waste toner bottle removal on page 4 73 A 2 Remove the two screws A from the cable channel cover V OBERE Next Go Back A 3 Pull the corner of the cable channel cover B away from the right si
185. hile the sheet is being transported through the front door and paper tray it is the only piece of media being processed by the print engine A user should not attempt to insert a piece of media into the manual paper feed while a duplex job is being processed This would invoke a paper jam error Diagnostic aids 3 65 7525 63x When the trailing edge of the media clears the fuser the fuser engine rotates forward to prepare the fuser for the page travelling through the duplexer As the media reaches the gate aligner a sensor S1 is triggered indicating the presence of the leading edge When the S1 sensor is triggered the paper continues to the S2 sensor When the S2 signal is detected the speed of the paper is adjusted to accommodate the speed of the transfer belt ensuring the proper registration of the image on the media The paper travels to the ITU C and the second image is transferred to the reverse side of the media Once the imaged is transferred the media travels to the fuser D the fuser exit rolls E and the output bin Scanner theory Duplex ADF The following illustration shows the paperpath rollers and sensors used in the X548 duplex ADF Duplex Document ADF sensor sensor Pick roll Paper path in Paper path out ADF scan Takeaway Scan Transport Reverse Exit sensor roll area roll point roll The X548 duplex ADF enables the user to create duplex scans automatically eliminating the need to stop the scanning
186. ia from the affected tray Did the page print Diagnostic information 2 57 7525 63x Check the option cable connected to JOPT 1 Go to step 8 Go to step 7 for continuity Is there continuity Replace the cable and print from both option Problem resolved Go to step 8 trays Did the pages print from both trays Print a menu settings page Go to step 9 If the 550 sheet option failed to appear got step 9 Are all the attached option trays listed on If the 650 sheet tray failed to the first page of the menu settings pages appear go to step 10 Note If two option trays are used the 650 sheet will appear as tray 2 and the 550 sheet tray will appear as tray 3 Remove the 650 sheet tray from the printer Go to step 11 Replace the 550 sheet tray attach the 550 sheet tray directly to the printer and print a page from the 550 sheet tray Did the page print Turn off the printer and remove the rear shield Rear shield removal on page 4 7 Disconnect the cable at JOPT1 on the RIP board Turn the printer on and measure the voltages below Consult your next level support Replace the RIP board See RIP board removal on page 4 19 Pi vonage DS Ground o Gm Are the voltages correct With only the 650 sheet tray attached to the Go to step 11 Replace the 650 sheet tray printer print a page from the 650 sheet tray Did the page print 2 58 Service Manual Previous Next Go Back 7525
187. ing the RIP board 2012 09 19 Changed ADF separator pad PN from 40X5472 to 40X8419 2012 09 17 Added PN 40X8674 Front toner door pivot to Paperpath on page 7 9 2012 08 31 e Added installation note Install the narrow media sensor flag before reinstalling the flatbed on page 4 12 e Added installation note Install the narrow media sensor flag to the fuser before putting the fuser into the printer on page 4 35 XX Service Manual 7525 63x S lllllllllllllalalalllllMlMlMlMlMlMlMMlMlMssssslMl Previous Conventions Note A note provides additional information V Warning A warning identifies something that might damage the product hardware or software Next There are several types of caution statements CAUTION m 2 A caution identifies something that might cause a servicer harm CAUTION This type of caution indicates there is a danger from hazardous voltage in the area of the product where you are working Unplug the product before you begin or use caution if the product must receive power in order to perform the task CAUTION This type of caution indicates a hot surface Conventions XXI 7525 63x xxii Service Manual Previous A D Go Back 7525 63x 1 General information Previous The Lexmark X548 Series MFPs combine print scan copy and fax functions They are the ideal MFPs for presentations business graphics line art and text They use laser diode electropho
188. istration without saving any changes Hepeat step 3 to verify the adjustments Repeat steps 1 7 to make further adjustments a d e IM et 3 38 Service Manual 7525 63x Disable Scanner Previous This menu item is used to disable the MFP scanner if it is malfunctioning The MFP must be powered off and on A for the new settings to take effect V To change this setting ME 1 Navigate to Disable Scanner 2 Touch or tochange the setting 3 Touch Submit to save the changes or touch Back to return to the Configuration Menu without saving any Co Back changes Jobs On Disk This setting allows you to delete buffered jobs saved on the disk To delete jobs saved on the disk 1 Navigate to Jobs On Disk 2 Touch Delete to delete the jobs or touch Do not delete to return to the Configuration Menu Disk Encryption This setting controls whether the device encrypts the information that it writes to the hard disk Note The device deletes all information from the hard disk whenever this setting s value is changed Erase All Information on Disk Note Due to the lengthy amount of time required to wipe the entire hard disk a wipe should not be initiated unless it is absolutely unavoidable or unless the device can remain offline for several hours without inconveniencing users A disk wipe should not be initiated if the hard disk contains downloaded fonts macros or held jobs that should not be erased To erase all inform
189. jam remove all originals from the scanner 2 12 Service Manual ee Ea Scanner ADF detects paper at the second scanner sensor while the ADF is in an idle state This message is posted if a jam is detected at the first scanner sensor This message appears if the ADF cover is open while paper is fed through the ADF No paper sensed in the ADF The MFP senses that the flatbed cover is open Jam at the ADF exit sensor A jam is detected at the ADF exit sensor Open the ADF cover to access the jam area Remove all the jammed pages See Go to 291 xx ADF paper jams on page 3 54 Open the ADF cover to access the jam area Remove all the jammed pages See Go to 291 xx ADF paper jams on page 3 54 Remove the paper from the ADF and close the ADF cover If the error recurs go to ADF cover open service check on page 2 62 Ensure that the paper present actuator is in the correct position Go to ADF paper jam service check on page 2 63 Close the flatbed cover Go to ADF cover open service check on page 2 62 Remove all paper from the ADF If the error recurs go to ADF paper jam service check on page 2 63 Previous Next Go Back 7525 63x Service error messages 1xx xx service errors Previous lt gt Next 106 xx Service Yellow Printhead 106 01 Service Yellow Printhead 106 02 Service Yellow Printhead 106 03 Service Yellow Printhead 106 04 Service Yellow Printh
190. l 4 68 tools required 1 19 transfer roll service check 2 56 U USB connector removal 4 72 W waste toner bottle contact removal 4 74 waste toner bottle removal 4 73 7525 63x Previous Next D Go Back Index l 3 7525 63x l 4 Service Manual Previous A D Go Back 7525 63x Part number index P N 3049485 40X0269 40X0270 40X027 1 40X0273 40X0275 40X0288 40X0301 40X0303 40X041 1 40X1368 40X1455 40X1557 40X1569 40X1772 40X1773 40X1774 40X1791 40X1792 40X2252 40X2253 40X2254 40X2255 40X2261 40X2285 40X2512 40X3141 40X4596 40X5168 40X5168 40X5403 40X5404 40X5409 40X5411 40X5412 40X5413 40X5414 40X5415 40X5417 40X5419 40X5421 40X5422 40X5423 40X5424 40X5426 40X5429 40X5441 40X5470 40X5478 40X5479 40X5480 40X5482 40X5484 40X5485 Description Page Field relocation package assembly urrrrrrrrrrrrlIre 7 16 Power cord 2 5 m straight USA Canada 7 11 Power cord 2 5 m straight Japan r rrr ee 7 11 Power cord 2 5 m straight United Kingdom 7 11 Power cord 2 5 m straight Traditional Italy 7 11 Power cord 2 5 m straight Israel 7 11 Power cord 2 5 m straight Argentina
191. l for instructions on replacing a print cartridge 2 Touch Continue to clear the message and continue printing access the jam area Remove the jammed page See 200 paper jam on page 3 47 Multiple pages of media are jammed at Open the front door and remove the print the input sensor cartridge to access the jam area Remove all the jammed pages See 200 paper jam on page 3 47 A single page of media is jammed Open the front door and remove the print between the input and exit sensors cartridge to access the jam area Remove the jammed page See 201 paper jam on page 3 48 Multiple pages of media are jammed Open the front door and remove the print between the input and exit sensors cartridge to access the jam area Remove all the jammed pages See 201 paper jam on page 3 48 7525 63x 2xx paper jam messages Previous meme om mm 202 xx Paper Jam Check area 202 xx Paper Jam x Pages Jammed 230 xx Paper Jam A single page of media is jammed at Check area the inner door 230 xx Paper Jam Multiple pages of media are jammed at x Pages Jammed the inner door 235 Paper Jam Paper jam in the duplex area Check Duplex 241 xx Paper Jam Check area Or 241 xx Paper Jam x Pages Jammed 242 xx Paper Jam Check lt area gt 242 xx Paper Jam x Pages Jammed 243 xx Paper Jam Check lt area gt or 243 xx Paper Jam x Pages Jammed 250 xx Paper Jam Check M
192. lasse Illb 3b AlGalnP qui produit des radiations visibles op rant sur une longueur d onde de l ordre de 650 670 nanometres au sein d un boitier non d montable de la t te d impression Le systeme laser et l imprimante ont t concus de maniere ce que personne ne soit jamais expos a des radiations laser d passant le niveau de classe dans le cadre d un fonctionnement normal de l entretien par l utilisateur ou de la maintenance Notices and safety information Xi 7525 63x Previous Avvertenze sui prodotti laser Questo prodotto certificato negli Stati Uniti come prodotto conforme ai requisiti DHHS 21 CFR Sottocapitolo J per i prodotti laser di Classe 1 mentre in altri paesi certificato come prodotto laser di Classe conforme ai v requisiti IEC 60825 1 Next prodotti laser di Classe non sono considerati pericolosi La stampante contiene un laser Classe IIIb 3b 5 AlGalnP che emette una radiazione visibile a una lunghezza d onda di 650 670 nanometri all interno dell unit Go Back testina di stampa non sottoponibile a manutenzione ll sistema laser e la stampante sono stati progettati in modo da impedire l esposizione a radiazioni laser superiori al livello previsto dalla Classe durante le normali operazioni di stampa manutenzione o assistenza Avisos sobre el laser Este producto se ha certificado en EE UU cumpliendo con los requisitos de DHHS 21 CFR subcap tulo J para los productos l ser de Clase 1 y en
193. mage on the Photoconductor surface and the 1st Transfer Roller causes the images to transfer to the surface of the ITU belt for each color This takes place by a direct nen surface to surface contact between the Photoconductors and the ITU belt a Go Back uu A DO ANA TNI NINS A N 7 All Service tips Never touch the surface of the ITU belt with your bare hand The oil from your skin will cause a charge differential on the surface and toner will not stick properly The result would be repeating blotches of voids light print on a page Then the ITU belt will have to be replaced Don t use solvents or other cleaners to clean the ITU belt surface No matter how careful you are the surface will be compromised causing scratches or a charge differential that will produce a void or light blotch on the printed page Then the ITU belt will need to be replaced Diagnostic aids 3 59 7525 63x Step 4b Second transfer Once the four planes of color are transferred to the transfer belt from the photoconductors the image is carried towards the transfer roll E This transfer roll is also part of the ITU Based on the speed of the transfer belt the proper time to send the signal to pick the media from an input source is determined The timing of the pick is such that the media reaches the point where the tra
194. mbly service check 2 40 networking service check 2 44 operator panel service checks 2 41 option trays service check 2 57 paper jam messages 2 10 print quality service checks 2 45 printhead service check 2 54 service checks 2 28 service error messages 2 13 TMC card service check 2 55 toner sensors service check 2 55 transfer roll service check 2 56 tray sensor service check 2 56 user attendance message table 2 5 diagnostics menu accessing 3 5 available tests 3 6 digital imaging specifications 1 16 duplex ADF rear cover removal 4 86 duplex ADF unit removal 4 87 duplex sensor removal 4 29 service check 2 35 E error codes and messages 2 5 1xx xx service errors 2 13 2xx paper jams 2 10 8xx xx service errors 2 17 9xx service errors 2 19 9xx xx service errors 2 19 fax error log 2 24 service error messages 2 13 ESD sensitive parts 4 1 F fax card service check 2 66 fax service checks escalating issue to next level support 2 70 Index l 1 7525 63x reception 2 68 transmission 2 67 fax specifications 1 18 flatbed installation 4 82 removal 4 75 flatbed home position service check 2 61 flatbed motor service check 2 61 flatbed pivot link removal 4 85 front door sensor service check 2 36 fuser assembly removal 4 32 service check 2 38 fuser drive motor assembly removal 4 36 fuser exit sensor removal 4 37 service check 2 37 G general information 1 1 H high voltage power supply removal 4 40 image tran
195. meter cycle TMC switch error 01 Recoverable 02 Non recoverable The magenta cartridge toner meter cycle TMC switch error 01 Recoverable 02 Non recoverable The yellow cartridge toner meter cycle TMC switch error 01 Recoverable 02 Non recoverable The black cartridge toner meter cycle TMC switch error 01 Recoverable 02 Non recoverable The pel clock check failed Delay line calibration failure Previous Go to 90x xx error 902 xx 907 xx v service check on page 2 31 Next Go Back Go to 925 01 fan error service check on page 2 31 The Servicer should follow these steps to resolve this problem 1 Use the base sensor test in Diagnostics mode to inspect the toner sensor s operation 2 f the toner sensor is operating correctly then the problem is the print cartridge Replace the LVPS Go to Low voltage power supply LVPS assembly removal on page 4 48 Go to Toner sensors Y C M K on TMC card service check on page 2 55 Go to Toner sensors Y C M K on TMC card service check on page 2 55 Go to Toner sensors Y C M K on TMC card service check on page 2 55 Go to Toner sensors Y C M K on TMC card service check on page 2 55 If this error message persists replace the RIP board Go to RIP board removal on page 4 19 If this error message persists replace the RIP board Go to RIP board removal on page 4 19 Service error mes
196. mmended memory option Send a print job to the device Does the 900 xx error reoccur Action and questions Is the device a Multi function printer Is there optional memory installed Is there a modem installed on the device Yes Go to step 31 Go to step 8 Go to step 9 Go to step 31 Go to step 11 Go to step 31 Go to step 31 Go to step 14 Go to step 15 Go to step 31 Go to step 17 7525 63x Go to step 7 Go to step 10 Go to step 10 Go to step 10 Go to step 13 Go to step 12 Go to step 13 Go to step16 Go to step 16 Problem resolved Go to step 21 Diagnostic information 2 29 Previous Next D Go Back 7525 63x Action and questions Yes Reinstall the modem Restart the device Go to step 18 Go to step 20 Does the 900 xx error reoccur Problem resolved Upgrade the firmware Contact your next level of support for the correct firmware level to use Go to step 19 Restart the printer to operating mode Send the printer a print job Does the 900 xx error reoccur Replace the modem Restart the device Go to step 31 Problem resolved Does the 900 xx error reoccur Run a fax job Go to step 31 Go to step 21 Problem resolved Does the 900 xx error reoccur Are there any ISP internal solutions port Go to step 22 options installed Reinstall the first ISP option Restart the Go to step 24 device
197. mount of moisture in paper affects both print quality and the ability of the printer A to feed the paper correctly Leave paper in its original wrapper until it is time to use it This limits the v Previous exposure of paper to moisture changes that can degrade its performance Condition paper before printing by storing it in its original wrapper in the same environment as the printer for 24 to 48 hours before printing Extend the time several days if the storage or transportation environment is very different from the printer nex environment Thick paper may also require a longer conditioning period H e Grain direction Grain refers to the alignment of the paper fibers in a sheet of paper Grain is either grain long running the length of the paper or grain short running the width of the paper For 60 to 176 g m Go Back 16 to 47 Ib bond paper use grain long fibers e Fiber content Most high quality xerographic paper is made from 100 chemically treated pulped wood This content provides the paper with a high degree of stability resulting in fewer paper feeding problems and better print quality Paper containing fibers such as cotton possesses characteristics that can negatively affect paper handling Unacceptable paper The following paper types are not recommended for use with the printer e Chemically treated papers used to make copies without carbon paper also known as carbonless papers e Preprinted papers with chemicals that may
198. mpensator mechanism ACM standard tray removal on page 4 13 Is the voltage approximately 5 V dc Turn the printer off and remove the rear Replace the JCARTB1 shield See Rear shield removal on cable page 4 7 Check the cable at JCARTB1 for proper connection to the RIP board the cable for pinch points and the cable or connector for any other damage Is the cable damaged Disconnect the cable at JCARTB1 on the RIP Go to step 3 board and verify the following values JCARTB1 Pin Value 4 24V dc 6 424 V dc 8 24 V dc 9 Ground EJ 12 Ground 424 V dc 24 V dc 424 V dc Are the voltages correct Replace the main drive assembly See Main Problem resolved drive gear assembly with motor removal on page 4 57 Does the error clear 2 40 Service Manual Reseat the connector A Next D Replace the RIP board Go Back See RIP board removal on page 4 19 Go to step 2 Replace the RIP board See RIP board removal on page 4 19 Replace the RIP board See RIP board removal on page 4 19 7525 63x Operator panel service checks Previous Warning Replace one of the following components and perform a POR before replacing a second component A Never replace both of the components without performing a POR after installing each one or the printer will be rendered inoperable V e Operator panel assembly Next e RIP board Warning Never install and remove
199. n and yellow can be combined to create green Printing presses inkjet printers and color laser printers create colors in this manner CMYK color is a method of describing colors by indicating the amount of cyan magenta yellow and black needed to reproduce a particular color How is color specified in a document to be printed Software programs typically specify document color using RGB or CMYK color combinations Additionally they allow users to modify the color of each object in a document For more information see the software program Help topics Diagnostic aids 3 67 7525 63x How does the printer know what color to print Previous When a user prints a document information describing the type and color of each object is sent to the printer A The color information is passed through color conversion tables that translate the color into the appropriate amounts of cyan magenta yellow and black toner needed to produce the desired color The object information V determines the application of color conversion tables For example it is possible to apply one type of color conversion table to text while applying a different color conversion table to photographic images dn Should use PostScript or PCL emulation What settings produce the best color 2 O bac The PostScript driver is strongly recommended for best color quality The default settings in the PostScript driver provide the preferred color quality for the majority of printout
200. n module output level error 844 02 Front scan module lamp level too low Front Mono channel Front Color channels Front Red channel Front Green channel and or Front Blue channel is detected to have low lamp level Go to CCD service check on page 2 60 Diagnostic information 2 17 7525 63x Service error messages 844 03 845 xx Scanner failure 845 Front scan module cable failure or SCC card failure 845 01 card failure 845 02 Cable SCC failure 845 03 Cable SCC failure 845 04 Cable failure 846 Front calibration strip unusable 846 01 Rear calibration strip unusable 846 02 846 03 Front calibration strip too far right 846 04 Front calibration strip has excessive skew 846 05 Front calibration strip has excessive bow 2 18 Service Manual Rear scan module cable failure or SCC Front calibration strip too far left Previous Rear scan module lamp level too low Rear Mono channel Rear Color channels Rear Red channel Rear Green channel and or Rear Blue channel is detected to Next have low lamp level Go to CCD service check on page 2 60 4 CCD failure Go Back Go to CCD service check on page 2 60 CCD channel failure Check each channel mono R G B for identical values indicating bad cable and or SCC card Excessive noise test for the dark data indicating some sort of CCD or analog electronics issue on that channel or channels Go to CCD service check
201. nd VS INT 5V Ground 5V JINT1 JLVPS1 Ground 5V Ground 24VC Ground 24VC Ground 24VC 2 Ground RELAY DRIVE ZERO_XING_IN HEAT1_ON C2 O CO 4 5 G Z U 5 10 Service Manual Connector JMIRR1 JMOD2 JOPT1 0 2 3 4 EE a a O1 6 7 a a Co 9 0 O 7525 63x MM_REFR MM_LOCK 3 3 V dc MM_START Z 24V_VC NC_30V_CUHD NC_JMOD2_2 POR CHUD R 3 3V 3 3V NC_TONE_CUHD 5 IRQ_CUHD Ground SDA_CUHD Ground SCL_CUHD Ground CLK_CUHD Ground SDO_CUHD Ground SDI_CUHD Ground CS_CUHD TXD_PP Ground Ground RXD_PP 24V Ground 5V_OPTIONS 5 V dc 09 N O lt O Ground Ground Locations 5 11 Previous Next D Go Back 71525 63x A y 5 e pome ooo 3 WBORODSIGMS JPH1 5 12 Service Manual 7525 63x JPH1 continued Groud A a pm v LEM NNNM VDO LAD J 3 3 V dc w omose Lo E Next Locations 5 13 71525 63x Connector JSP1 JTHM1 JTPS1 JTPS2 JTRAY1 5 14 Service Manual m a VOUTB ANODE ANODE CATHODE Ground Previous Next Go Back Connector JUIC1 JUSB1 Port JWIN1 JWT1 7525 63x UI RESET NR Ground Y1M LVDS Y1P LVDS Y2M LVDS Y2P LVDS CLK TX CLK_TX Ground 5 0 V dc RXD232_N TXD232_N YOM_LVDS YOP_LVDS Ground 5 0 V dc 5 0 V dc 5 0 V dc
202. nd printer are designed so there is never any human access to laser radiation exceeding Class levels during normal operation user maintenance or prescribed service condition Laser Hinweis Dieses Produkt ist in den USA zertifiziert und entspricht den Anforderungen der Vorschriften DHHS 21 CFR Unterkapitel J f r Laserprodukte der Klasse 1 andernorts ist er als Laserprodukt der Klasse zertifiziert das den Anforderungen von IEC 60825 1 entspricht Laserprodukte der Klasse werden nicht als gef hrlich betrachtet Der Drucker enthalt im Inneren einen Laser der Klasse IIIb 3b AlGalnP der sichtbare Strahlung im Wellenlangenbereich von 650 bis 670 Nanometern abgibt Dieser befindet sich in einer Druckkopfeinheit die nicht gewartet werden kann Das Lasersystem und der Drucker sind so konstruiert dass unter normalen Betriebsbedingungen bei der Wartung durch den Benutzer oder bei den vorgeschriebenen Wartungsbedingungen Menschen keiner Laserstrahlung ausgesetzt sind die die Werte f r Klasse berschreitet Avis relatif a l utilisation de laser Ce produit est certifi conforme aux exigences de la r glementation des Etats Unis relative aux produits laser DHHS 21 CFR Sous chapitre J pour Classe 1 Pour les autres pays il est certifi conforme aux exigences des normes CEI 60825 1 relatives aux produits laser de classe l Les produits laser de Classe ne sont pas consid r s comme dangereux L imprimante contient un laser de C
203. nd the first scan line on the back of the page Therefore be sure to set the top margin in REGISTRATION before setting the duplex top margin See REGISTRATION on page 3 9 To adjust the setting Navigate to DUPLEX TESTS Quick Test Single to print a Quick Test page Hold the page to the light to see whether the top margin of the back aligns with the top margin of the front Select Top Margin from DUPLEX TESTS Touch or to adjust the margin setting e Each increment shifts the duplex top margin by 1 100 of an inch e The Top Margin duplex range is 50 to 50 and the default value is O e An increase in the value moves the backside top margin down and widens the top margin A decrease moves the top margin upward and narrows the top margin 5 Touch Submit to save the settings 6 Print the Quick Test duplex again steps 1 4 to verify the adjustment Repeat if necessary ONS INPUT TRAY TESTS Feed Tests This test allows you to observe the paper path of media as it passes through the printer Any installed input tray can be tested The pages fed through the printer are blank To run the Feed Test 1 Navigate to INPUT TRAY TESTS gt Feed Tests 2 Select the tray to be tested Choices are installed trays including Tray 1 Tray 2 and MP Feeder 3 Open the upper rear door to view the paper path Note Do not open the upper front door The test will not run if the front door is open 4 Select Single or Continuo
204. nd type icc cc eid Rea Rw OR RON GR eee ee RCOR TIC 1 12 MEOIS HIS cus ee ogee eee eae E Re Ex RR ER READ eee RN ee pare aw aes EIER 1 13 Papel CORIFRCIBEISIOS 4 6564 dus deere ad eaa d basi EX d wd A dives Pack ko 6 ER ear dd 1 13 Unco pADR DAP MEMO x rrrm 1 14 POCO BUDE iss ausi uEessUdseguasesaesedipxud E E Kad d dE Eurba dd ed die Se 1 14 Selecting preprinted forms and letterhead llli 1 14 Se ieu ie uu amasuseseumseidadesxuz msmadd oe ees bodes da E dde dM PEU 1 15 Using recycled paper and other office papers 0 ccc eee 1 15 ital NAGI SDBENICAIIOTIS aae RR AC RON CE S ARCA GI ROC eae eee rire m RR S cR RR n en 1 16 General specifications Los uace cine cared een ke eked eR Ne ee wh Reena ees 1 16 ADIP SCA SDEOLL Laco do CR CN Ade dee de eee CARLA ORC DOR UE E ee ess 1 16 ADI g cpmbspr NANGIN uad REIR Seb SS eee HS ERR ATESEYYESETTEQPLEFESERTES 1 16 Resolution and color depth a duck Nocera w dace hades has ie hei Eo b ER OR e ROB e 1 16 Flatbed document specifications 4 aque deseedes dudes dudes ba ER EC EC waren des 1 16 PS BOSC 4k quiu dod Jor de Ee dei diode de dedi e deli e p Ce dete d p de 1 16 Scanner operating environments assas AUGE RF RR bended E ac RR RE RU RUR Ep ER p Era 1 16 Sigel EVO HEB s e adam 29d aio do dedecus eens ea gea opo ed YORUR C SURE M eR RU dees 1 16 i AER POETE NEUSTEN T RE LN TREE TETUR E 1 16 Scan and copy specific specificationS
205. ne had a temporary jam stretched Faxes fail to transmit Go to Fax transmission service check on page 2 67 Fax reception fails Go to Fax reception service check on page 2 68 Rattling noise coming from the ADF unit Inspect the ADF separator roll and ADF separator pad for proper installation If needed remove the separator pad and separator roll and reinstall them See ADF separator pad removal on page 4 91 and ADF separator roll assembly removal on page 4 92 for removal instructions Diagnostic information 2 3 71525 63x Print quality symptoms table Previous Mottle 2 5mm speckles Go to Print quality mottle 2 5mm speckles on page 2 51 Next 2 4 Service Manual 7525 63x Previous Error codes and messages User status and attendance messages wv User primary message Explanation Next 290 294 ADF scanning The scanner failed to feed one or more pages through the ADF 1 Remove all original documents from the ADF D Note The message clears when the pages are removed from the ADF Go Back 2 Do not fold or crease original documents Straighten the edges on a level surface 3 Load the original documents in the ADF 4 Adjust the ADF guides 5 Touch Continue jam cleared Adjusting color Wait for the process to complete Change paper source Try one or more of the following ee my Pe namel Touch Use current paper source to ignore the message and print from the Change paper
206. nel frame cover removal on page 4 107 Remove the rear case with speaker See Rear case with speaker removal on page 4 108 Remove the two screws A from the sleep button PCB ab o dicum 4 110 Service Manual Previous A D Go Back 5 525 63x Remove the sleep button PCB Previous A D Go Back Speaker removal Dom Remove the operator panel bezel See Operator panel bezel removal on page 4 104 Remove the operator panel frame cover See Operator panel frame cover removal on page 4 107 Remove the rear case with speaker See Rear case with speaker removal on page 4 108 Remove the two screws A from the speaker Repair information 4 111 525 63x 5 Remove the speaker Previous A D Go Back USB cable removal Remove the AIO rear cable cover See AlO back cable cover removal on page 4 8 Remove the rear shield See Rear shield removal on page 4 7 Remove the left cover See Left cover removal on page 4 4 Remove the ADF unit See Duplex ADF removal on page 4 87 Remove the flatbed See Flatbed removal on page 4 75 Remove the operator panel assembly See Operator panel assembly removal on page 4 102 Pry the front cover off the operator panel Remove the two screws securing the rear case to the operator panel cover Pull the operator panel cover away from the rear case to access the USB cable Route the USB cable off
207. ng smooths out the artifacts to produce a higher quality image To change this setting 1 Navigate to Pel Blurring 2 Touch or tochange the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Require Standby This setting determines if the Standby Mode is On or Off The default is On To change this setting 1 Navigate to Require Standby 2 Touch or tochange the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes If Standby Mode is on the printer begins functioning in Standby Mode when it remains idle for an amount of time The Standby Mode enables the printer e oconsume less energy than when operating in normal mode but not as little as when operating in Power Saver e To return to the Ready state more quickly than when operating in Power Saver UI Automation When enabled this setting allows external developers to measure the stability of their applications by performing their own automated testing against the device To change this setting 1 Navigate to UI Automation 2 Touch or tochange the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes 3 40 Service Manual 7525 63x Key Repeat Initial Delay Previous When a key is touched repeatedly this is the delay before the key begi
208. ng the printing process the MFP follows the six basic EP Process steps to create its output to the page These six steps are Charge the photoconductor PC unit Expose the photoconductor PC unit with the laser Develop toner on the photoconductor PC unit First transfer to the ITU and second transfer to the media Fuse the toner to the media Clean erase the photoconductor and the ITU D p a c Nr In summary the printer s RIP board receives print data and the command to print The RIP board then initiates the print process The RIP board is the command center for the EP process and coordinates the various motors and signals The high voltage power supply sends charge to various components in the EP process The laser fires on the photoconductors and alters the surface charge relative to the planed image for each photoconductor Each photoconductor rotates past its respective developer roll and toner is developed on the surface of each photoconductor The four separate color images are then transferred to the transfer belt on the ITU as it passes under the photoconductors After the image is transferred to the transfer belt the photoconductors are cleaned and recharged The transfer belt carries the four colored image towards the transfer roll Media is picked up from the tray and carried to the transfer roll where the image is transferred from the transfer belt to the media The timing of the paper pick is determined by the speed of
209. ng used matches the user s settings It is not uncommon to find a user printing on cardstock with the printer programmed to print on a plain paper setting D Go Back The printers feed and transport components can fail and cause paper jams or other feed and transport problems These components should be examined for damage or wear and replaced if necessary Below is a summary of the paper path and transport components Paper path Information The MFP has a simple C shaped paper path The paper paths are shown in red Paper is fed from the bottom of the printer from the paper tray or manual feed and travels upward through the front cover There is a duplex unit on this MFP The duplex unit is built into the front cover and drawer 1 Duplexing is described later Fuser exit sensor Front cover a re T Transfer Tray 1 Paper path 3 64 Service Manual il Fuser exit rolls Duplex entry Printhead Toner cartridges Y C M K Paper redrive rollers V i FAST ARE AS MCN SS j WARNA M Lm j t UL xl Developers N CO y 1 Y C M K JA JL Ji Tray 1 sensor Paper pick motor drive asm Pick roller CLT Output bin Controller board PC unit part of imaging unit ITU 7525 63x Trans
210. ngs or touch Back to return to Scanner Calibration without saving any changes Reset Flatbed ADF Front ADF Back Calibration Values These settings revert the selected scan source s IQT related black values to Nominal Black setting and its white values to Nominal White setting Note This operation should be performed only when the printer s scanner has been replaced To reset these settings 1 Navigate to Diag Menu gt Scanner Calibration 2 Touch Reset Flatbed Calibration Values Reset ADF Front Calibration Values or Reset ADF Back Calibration Values 3 Scanner calibration values should only be reset when the scanner is replaced All customized scanner calibration data will be lost Do you wish to continue appears Touch Yes to reset the settings or touch No to return to Scanner Calibration MISC TESTS Motor Detect This test initiates an automatic motor detection process that should be performed whenever the RIP board is replaced To run the test Navigate to MISC TESTS Touch Motor Detect Motor Detection In Progress appears The process takes about 10 seconds and stops automatically Motor Auto Detect Test Passed appears and the display returns to MISC TESTS Aoma 3 14 Service Manual 7525 63x PRINT TESTS Previous Input source tests A The purpose of the diagnostic PRINT TESTS is to verify that the printer can print on media from each of the installed input options The contents of the Print Test Page
211. nment diamonds at the left right top and bottom e Horizontal lines to check for skew e General printer information including current page count installed memory serial number and code level A Lexmark x54x Gach Test Dewire information BUAREM SETTINGS Bae Lets amp inj a To print the Quick Test page Note Print the Quick Test Page on Letter or A4 paper 1 Navigate to REGISTRATION gt Quick Test 2 Quick Test Printing appears and the page prints Retain this page to determine the changes you need to make to the margin settings Once the Quick Test Page completes printing the display returns to REGISTRATION 3 10 Service Manual Previous Next D Go Back 7525 63x Alignment Menu Previous Aligns each of the color planes to the black plane Print the Quick Test under each color Cyan Yellow and A Magenta and adjust the Top Margin Left Margin Right Margin Skew and Bow Vv Prints the Print Alignment Pages and requires that the best line in each set of lines must be selected Mes X To get started 4 1 Navigate to Alignment Menu Go Back 2 Select a color Cyan Yellow or Magenta Note The yellow alignment page markings are more difficult to see so you might not want to pick it first 3 Navigate to Quick Test to print the Quick Test pages Quick Test Printing appears and a page similar
212. no 10 oil P N 1280443 Approved equivalents Mobil DTE27 Shell Tellus 100 Next Fuchs Renolin MR30 IBM no 23 grease Approved equivalent Shell Darina 1 and grease P N 99A0394 to lubricate appropriate areas Use Nyogel type 774 to lubricate the Fuser Drive Assembly and Nyogel 744 to T lubricate the ITU and Cartridge Drive assemblies ok Cleaning the printer Cleaning the exterior of the printer CAUTION SHOCK HAZARD To avoid the risk of electric shock when cleaning the exterior of the printer unplug the power cord from the wall outlet and disconnect all cables to the printer before proceeding 1 Make sure that the printer is turned off and unplugged from the wall outlet 2 Remove paper from the standard exit bin 3 Dampen a clean lint free cloth with water Warning Do not use household cleaners or detergents as they may damage the printer s finish 4 Wipe only the outside of the printer making sure to include the standard exit bin Warning Using a damp cloth to clean the interior may cause damage to your printer 5 Make sure the paper support and standard exit bin are dry before beginning a new print job 6 2 Service Manual 7525 63x Cleaning the scanner glass Previous Clean the scanner glass if you encounter print quality problems such as streaks on copied or scanned images A Note Clean both areas of the scanner glass and both white underside areas v 1 Slightly dampen a soft lint free cloth or paper tow
213. nostics Menu Go to step 2 Go to step 4 lt gt J 1 Turn off the printer 2 Press and hold 3 and 6 Go Back 3 Turn on the printer 4 Release the buttons when the progress bar appears Perform the Base Sensor Test See BASE SENSOR TEST on page 3 20 1 Navigate to BASE SENSOR TEST gt Input S1 2 Install Tray 1 Does the display indicate Input Sl Media Clear Pull Tray 1 out The sensor is functioning Go to step 3 correctly Does the display indicate Input Sl Media Present Remove the tray and inspect sensor Remove the obstruction and Go to step 4 restart the test Is there something obstructing the sensor Inspect the spring loaded shaft flag in the tray Go to step 5 Replace the tray with a new The flag portion of the shaft intercepts the one sensor except when a sheet is being staged for duplexing Does the shaft rotate freely and return to home position flag at top of rotation Is the flag on the shaft broken Replace the tray Go to step 6 Is the cable correctly connected to JFUSES1 Go to step 7 Reconnect the cable on the RIP board and to the sensor l If the problem persists go to step 7 Is the sensor cable properly connected 7 Turn the printer off and remove the rear Replace the duplex sensor Replace the RIP board See shield See Rear shield removal on See Duplex sensor RIP board removal on page 4 7 Turn the printer on and check the r
214. ns repeating The range is 0 25 5 A seconds with increments of 0 25 The default is value is 1 second Vv To adjust this setting Next 1 Navigate to Key Repeat Initial Delay 2 Touch or to adjust the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any Go Back changes Key Repeat Rate This is the number of presses per second for a repeating key The range is 0 5 100 with increments of 0 5 The default value is 15 times per second To change this setting 1 Navigate to Key Repeat Rate 2 Touch or to adjust the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Clear Custom Status Executing this operation erases any strings that have been defined by the user for the default or alternate custom messages To clear custom status 1 Navigate to Clear Custom Status 2 Touch Clear Custom Status 3 Clear Custom Status appears and the display returns to the Clear Custom Status menu Pel Blurring This setting enables customers who notice step artifacts in their error diffused copies to activate the pel synthesis function To change this setting 1 Navigate to Pel Blurring 2 Touch or to adjust the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes USB Speed This setting is used to set
215. nsfer belt and transfer roll meet The paper passes between the transfer belt and transfer roll when the image on the belt reaches the second transfer area The high voltage power supply sends voltage to the transfer roll E to create a positive charge Once the image on the transfer belt reaches the transfer roll the negatively charged toner clings to the media and the entire image is transferred from the transfer belt to the media Service tips e lf the transfer roller has nicks pits or flat spots on it the surface doesn t come into contact with the media and transfer unit properly This will cause voids or light spots on the page or repeating voids light areas because the toner can t be fully transferred due to the charge difference in the areas of damage e fthe transfer roller does not engage the transfer unit or does not have voltage coming from the high voltage power supply the toner will not fully transfer from the transfer unit the entire page will be very light or blank Any toner that does transfer will be due to a contact transfer instead of a charge transfer Check the high voltage power supply contacts to the transfer roller 3 60 Service Manual Previous A D Go Back 7525 63x Step 5 Fuse Previous Once the image has been fully transferred to the media the transfer roll helps move the paper into th
216. nual 7525 63x 3 Touch or to select Manual from the Color Correction setting TTA 4 Touch Submit to save the setting The display returns to the Print Settings menu 5 Navigate to Manual Color A 6 Select the appropriate color conversion table for the affected object type y Object type Next RGB Image Vivid Produces brighter more saturated colors and may be applied to 45 RGB Text all incoming color formats RGB Graphics sRGB Display Produces an output that approximates the colors Go Back displayed on a computer monitor Black toner usage is optimized for printing photographs Display True Black Produces an output that approximates the colors displayed on a computer monitor Uses only black toner to create all levels of neutral gray SRGB Vivid Provides an increased color saturation for the sRGB Display color correction Black usage is optimized for printing business graphics Off No color correction is implemented CMYK Image US CMYK Applies color correction to approximate the SWOP CMYK Text Specifications for Web Offset Publishing color output CMYK Graphics Euro CMYK Applies color correction to approximate EuroScale color output Vivid CMYK Increases the color saturation of the US CMYK color correction setting Off No color correction is implemented How can I match a particular color such as a corporate logo From the printer Quality menu nine types of Color Samples sets are available Th
217. nvelope 98 x 225 mm 3 9 x 8 9 in 10 Envelope 105 x 241 mm 4 12 x 9 5 in DL Envelope 110 x 220 mm 4 3 x 8 7 in C5 Envelope 162 x 229 mm 6 4 x 9 in B5 Envelope 176 x 250 mm 6 9 x 9 8 in Other envelope 98 x 162 mm to 176 x 250 mm 3 9 x 6 3 in to 6 9 x 9 8 in a The MP feeder runs slower if A5 Statement B5 A6 Executive Statement Universal narrower than 210mm or envelopes are loaded p Japanese Industry Standard Although the user may select Universal paper size for these sources not all tray guides can be adjusted to all Universal media sizes General information 1 11 7525 63x Media input type specifications Previous VY Supported E Vv X Not supported S bi z er Lm O gt Next m LO i O os of s oO SC OD dc O TY lt cc C oo T Input type ki 225 T o Go Back Q Q ou o Bac A O8s O Sis Plain paper Card stock Transparency Recycled Glossy Paper backed labels Bond Envelopes Rough envelopes Letterhead Preprinted Colored Light Heavy Rough or cotton o Mem _ Custom type lt x gt O oon oe ON ONDA DN roe PE ebore ONNENN ebore PPP PEE a For MP feeder and manual feeders the Default Source Menu displays Manual Paper and Manual Env Select Manual Env for envelopes or when the type in Custom Type x is an envelope For other types use Manual Paper b The duplex unit supports this media type as long
218. o drawer is installed remove the option and check the base printer for correct operation If the base printer operates correctly replace the 650 sheet duo drawer BER Warning Observe all necessary ESD precautions when removing and handling the RIP board or any installed T option cards or assemblies See Handling ESD sensitive parts on page 4 1 Go Back Remove any input paper handling options from the printer Check the AC line voltage Go to step 2 Inform the customer Is the line voltage correct Is the AC line cord damaged Replace the line cord Go to step 3 Is the JLVPS1 cable correctly connected at Go to step 5 Reconnect the JLVPS1 JLVPS1 on the RIP board cable and go to step 4 Turn the printer off and then on Go to step 5 Problem resolved Does the problem persist Warning Damage to the printer is possible Replace the RIP board See Replace the LVPS See Be careful to touch only one conductor at a RIP board removal on Low voltage power time Rest the probe against the connector to page 4 19 supply LVPS assembly steady it removal on page 4 48 With the printer on verify the following values at JLVPS1 JLVPS1 exposed conductors Ground Are the values approximately correct 2 34 Service Manual 7525 63x Duplex manual feed sensor S1 service check Previous Note Before performing this service check ensure that the printer is on a hard level surface Next Enter the Diag
219. o transmit training successfully in V 17 terminal modulation scheme Failure to transmit training successfully in V 29 terminal modulation scheme Failure to transmit training successfully in V 27 terminal modulation scheme Failure to transmit training successfully at 2400 bps in V 27 terminal modulation scheme Previous e Select a lower Max Speed under Fax V Send settings e Adjust Transmit Level pen e Check line quality 4 e Select a lower Max Speed under Fax Go Back Send settings e Adjust Transmit Level e Check line quality e Select a lower Max Speed under Fax Send settings e Adjust Transmit Level e Check line quality e Select a lower Max Speed under Fax Send settings e Adjust Transmit Level e Check line quality e Select a lower Max Speed under Fax Send settings e Adjust Transmit Level e Check line quality e Adjust Transmit Level e Check line quality Failed to connect at the minimum e Adjust Transmit Level speed supported by the MFP e Incompatible connection Failed to connect using V 34 modulation scheme No fax tones detected from remote end No dial tone detected Busy tone detected S Hardware error detected e Check line quality e Adjust to a lower modulation scheme e Adjust Transmit Level Receive Threshold values e Verify destination phone number e Verify that the remote fax is authorized to receive faxes e Check by enabling Behind a PA
220. occurred Page count Earliest error code The printed event log can be faxed to your next level of support for verification or diagnosis To print the event log navigate to EVENT LOG gt Print Log Diagnostic aids 3 25 7525 63x Clear Log Use Clear Log to remove the current information in the Event Log This affects both the viewed log and the printed log information 1 Navigate to EVENT LOG gt Clear Log 2 Touch YES to clear the Event Log or NO to exit the Clear Log menu SCANNER TESTS ASIC Test This test initiates a scan of the scanners ASIC memory navigate to SCANNER TESTS gt ASIC Test While this test is executing ASIC Test Running is displayed When the test is complete ASIC Test Passed displays or if the ASIC fails ASIC Test Failed displays Feed Test This test executes a continuous feed test from the ADF or flatbed Note Neither test produces printed output or increments any MPS counters Navigate to SCANNER TESTS gt Feed Test Touch or to select the paper size Touch Submit Feed Test Running appears Running Flatbed xxxx ADF xxxx appears while the feed test is executing Press Stop to end the test aS SN Sensor Tests A series of sensor tests are available to test the scanners ADF and flatbed sensor functionality The following table lists the available tests To access the sensor tests navigate to SCANNER TESTS gt Sensor Tests Sensor rogg
221. odem card and the wall jack Properly connect the phone line to the modem Problem resolved Go to step 3 card and wall jack Did this fix the problem Check for a dial tone Go to step 4 Go to step 6 Is there a dial tone Use a telephone to test the phone line s ability Go to 7 Go to step 5 to send and receive calls Did the phone line work properly Use a telephone handset to verify the phone Go to step 7 Go to step 6 line is free of static or external noise Is the phone line noise free Use the MFP on a properly functioning phone Problem resolved Go to step 7 Did this fix the problem In diags config menus verify that the Enable Go to step 9 Go to step 8 Fax Receive setting is on Is the setting set to on 2 68 Service Manual 17 Questions actions Yes Set Enable Fax Receive to On Problem resolved Did this fix the problem Is Distinctive Ring enabled Go to step 11 Turn on Distinctive ring Problem resolved Did this fix the problem Is the phone line analog Go to step 13 Is the VOIP server configured to support Go to step13 fax Does the MFP have reception issues with Go to step 14 only a certain remote device Verify communications with a different remote The issue is with the other device device Can the other device receive faxes Go to the Administrative menu Enter the Fax Go to step 16 settings Analog Fax Settings submenu Verify the Block No
222. odem doesn t match the actual modem installed in the device The amount of flash storage available on the device is too small Note The NAND Flash partition can shrink as bit failures cause blocks to be invalidated Go to Format Fax Storage on page 3 37 If the issue is not fixed replace the RIP board Go to RIP board removal on page 4 19 The devices flash partition is invalid or unavailable Go to Format Fax Storage on page 3 37 If the issue is not fixed replace the RIP board Go to RIP board removal on page 4 19 A device doesn t have a modem installed even though its Configuration ID indicates that a modem should be present A device has a modem installed but its Configuration ID indicates that a modem shouldn t be present A device doesn t have a hard drive installed even though its Configuration ID indicates that a hard drive should be present A device has a hard drive installed but its Configuration ID indicates that a hard drive shouldn t be present 900 xx Service RIP Software 902 xx Service Engine Software 903 xx Service Engine Software 904 xx Service Engine Software 905 xx Service Engine Software 906 xx Service Engine Software Unrecoverable RIP software error illegal trap A general engine software error A general engine software error A general engine software error A general engine software error A general engine software error Go to 900 xx
223. of color remaining beneath the black content The default is each setting increments by 1 600 of an inch The more inaccurate the registration setting the higher the setting needs to be adjusted Selecting Off disables color trapping Tray Insert Msg This setting determines how many seconds the panel will display the Tray Insert message after a tray is inserted into the printer To change this setting 1 Navigate to Tray Insert 2 Touch or to adjust the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Panel Menus Lets the system support person enable or disable the operator panel menus To change this setting 1 Navigate to Panel Menus 2 Touch or tochange the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes 3 34 Service Manual 7525 63x PPDS Emulation Previous The value of the PPDS Emulation menu item determines if a device can recognize and use the PPDS data stream The current value of this setting appears in parentheses to the right of the setting on the Configuration Menu screen v The following table indicates how the value of this setting affects the user default value for the SmartSwitch and PES Printer Language settings H Go Back Resulting value of SmartSwitch setting all ports Value of PPDS Emulation setting Resulting value for Printe
224. olor page Service tip A solid color page is generally caused by a problem in the high voltage controller or an incorrect high voltage in the printing process resulting in toner development on the entire photoconductor drum Replace the photoconductor unit part of the imaging unit Remove the imaging unit and remove the developers Place the original developers in the new photoconductor and then replace the imaging unit See Developer unit removal on page 4 47 Does this fix the problem A faulty printhead can cause the problem To test the printhead for solid colors place a narrow strip of paper over the gap between the developers Make sure the paper stays in place when you replace the imaging unit This will block the laser from discharging the photoconductors Print a Quality Test Page Does the page have a white vertical band Check the high voltage contact from the HVPS to the photoconductor charge roll Ensure the contact springs are properly mounted and that the charge roll contact spring is making good contact with the HPVS spring that runs through the left printer frame See Toner cartridge contacts removal on page 4 64 to view the proper mounting and for removal procedures Are the spring s defective Turn the printer off and check the continuity of the HVPS cable Is there continuity Replace the HVPS See High voltage power supply HVPS with spring assembly removal on page 4 40 Does this
225. om the inner left side Disconnect the cable from the fuser exit sensor Remove the screws securing the LVPS shield Unplug the cables C from the motors and remove all cables from the retainer D Note Pay attention to the cable routing for reinstallation Remove the two screws E from the rear p d 4 58 Service Manual Previous A D Go Back 525 63x 9 Remove the two screws F from below the main drive gear assembly 10 Remove the two screws G from the right of the main drive gear assembly Previous A D Go Back 11 Liftthe main drive gear assembly with motor and remove Repair information 4 59 525 63x Pick tires removal integrated 250 sheet media tray Note You will need to have a soft padded work surface Warning Remove only the rubber tires and not the paper pick tire assembly to avoid losing small parts The paper pick tires are located in the base printer There are also tires in the optional 550 page media tray If you have this additional option and you are having problems with media picking replace these tires also Always replace the paper pick tires in pairs The tires come in a package of two Remove the media tray Place the printer so the front edge extends over the edge of the table or desk Lower the autocompensator mechanism Remove the rubber tires A from the pick roll assembly B Repeat for the other tire Warning Be very careful not to unlatch the
226. ome position sensor test Go to Go to step 3 Go to step 5 SCANNER TESTS on page 3 26 Is the sensor working properly Check JFBM 1 on the controller for proper Go to step 4 Properly connect the cable connection Is it connected properly Check pin 1 in JFBM1 for voltage The voltage Go to step 5 Replace the RIP board Go is only present when a flatbed copy job is to RIP board removal on running The voltage should measure 24 V page 4 19 ac Is voltage present Ensure that the home position cable JHS1 is Go to step 6 Properly connect the cable connected Is the cable connected Diagnostic information 2 61 7525 63x Check pin 1 in JHS1 for voltage The voltage Replace the flatbed unit Replace the RIP board Go should measure 5 V dc pin 2 should be GND See Flatbed removal on to RIP board removal on page 4 75 page 4 19 Is voltage present and is it correct ADF cover open service check Is the ADF cover properly closed Go to step 3 Go to step 2 Close the ADF cover Issue resolved Go to step 3 Does the problem go away Perform the ADF cover open sensor test Goto Goto step 4 Go to step 8 SCANNER TESTS on page 3 26 Does the sensor work properly On the bottom of the ADF cover inspect the Go to step 6 Go to step 5 ADF cover closed sensor actuator Does it move freely Fix the actuator so it moves freely Problem resolved Go to step 6 Did this fix the problem Remo
227. ome slick or coated papers may also cause background problems Some problems occur with printers that run a large amount of graphics in a humid environment Head the current status of the imaging unit Reset the value To reset Go to step 2 from the customer menus this value To view the status of the photoconductor units 1 In the Ready mode 1 In the Ready mode touch touch i 2 Navigate to Reports Device Statistics 2 Navigate to Supplies i Menu gt Replace It is possible a new imaging unit was installed Supplies but the counter was not reset 3 Select the imaging unit to reset Has the imaging unit been recently replaced If this does not fix the problem go to step 2 Is the background only one of the primary Replace the developer unit Go to step 4 colors yellow cyan magenta or black for the background color and retest See Developer unit removal on page 4 47 Go to step 3 Replace the photoconductor unit Problem resolved Go to step 5 Does this fix the problem Check the high voltage contact from the HVPS Replace the failing part Go to step 6 to the image transfer unit ITU Image transfer unit ITU See Image transfer unit ITU removal on page 4 43 High voltage power supply HVPS See High voltage power supply HVPS with spring assembly removal on page 4 40 Reseat the cable in the JHVPS1 connector Problem resolved Go to step 7 Does this fix the problem 2
228. on about changing the margin see Top Margin duplex on page 3 19 The single test stops automatically when a single duplex sheet is printed and the continuous test continues until Stop is pressed Left Margin duplex This setting shifts the image on the backside of the duplex sheet to the left or right to correctly position it on the page Therefore be sure to set the top margin in REGISTRATION before setting the duplex top margin See REGISTRATION on page 3 9 To adjust the setting 1 Navigate to DUPLEX TESTS gt Quick Test gt Single to print a Quick Test page 2 Hold the page to the light to see whether the left margin of the back aligns with the left margin of the front 3 Select Left Margin from DUPLEX TESTS 3 18 Service Manual Previous Next D Go Back 7525 63x 4 Touch or to adjust the margin setting e Each increment shifts the duplex left margin by 4 pixels at 600 dpi 0 00666 inches or 0 1693 mm e The Left Margin duplex range is 25 to 25 and the default value is O e An increase in the value moves the backside margin to the right and widens the left margin A decrease moves the backside margin to the left and narrows the left margin 5 Touch Submit to save the settings 6 Print the Quick Test duplex again steps 1 4 to verify the adjustment Repeat if necessary Top Margin duplex This setting controls the offset between the first scan line on the front of the duplex page a
229. on is implemented Note The Color Samples pages are not useful if the software program does not specify colors with RGB or CMYK combinations Additionally certain situations exist in which the software program or the computer operating system adjusts the RGB or CMYK combinations specified in the program through color management The resulting printed color may not be an exact match of the Color Samples pages Diagnostic aids 3 69 7525 63x What are detailed Color Samples and how do access them Detailed Color Samples sets are available only through the Embedded Web Server of a network printer A detailed Color Samples set contains a range of shades displayed as colored boxes that are similar to a user defined RGBor CMYK value The likeness of the colors in the set are dependent on the value entered in the RGB or CMYK Increment box To access a detailed Color Samples set from the Embedded Web Server Open a Web browser In the address bar type the network printer IP address Click Configuration Click Color Samples Click Detailed Options to narrow the set to one color range When the Detailed Options page appears select a color conversion table Enter the RGB or CMYK color number Enter an Increment value from 1 255 Note The closer the value is to 1 the narrower the color sample range will appear Click Print to print the detailed Color Samples set O Ses SY m 3 70 Service Manual Previous Next D Go Back
230. onfigured as cassette does not show up as Configure MP in the Paper Menu Duplex capability v Supported Duplex Type Models Automatic duplex Lexmark X548dte 7525 63x Previous Next D Go Back General information 1 9 7525 63x Media input size specifications v Supported without size sensing X Not supported Input source Optional 650 sheet 650 sheet duo drawer duo drawer Optional 550 sheet MP feeder in the is dum lt b Ken ir e LO N A4 210 x 297 mm 8 3 x 11 7 in A5 148 x 210 mm 5 83 x 8 3 in A6 105 x 148 mm 4 1 x 5 8 in JIS B52 182 x 257 mm 7 2 x 10 1 in Letter 216x279 mm 8 5 x 11 in Legal 216 x 356 mm 8 5 x 14 in Executive 184 x 267 mm 7 3 x 10 5 in Oficio Mexico 216 x 340 mm 8 5 x 13 in Folio 216 x 330 mm 8 5 x 13 in Statement 140 x 216 mm 5 5 x 8 5 in Universal 148 x 210 mm to 216 x 356 mm 5 8 x 8 3 in to 8 5 x 14 in 76 x 127 mm to 216 x 356 mm 3 x 5 in to 8 5 x 14 in EBMEEEEEEEEEKE ENEEEEEEEEEKE ENBEEEEEEEEEKE ENMEEEEEEEEEK 1 10 Service Manual Previous Next D Go Back 7525 63x Previous VY Supported without size sensing X Not supported Input source Optional 650 sheet 650 sheet duo drawer duo drawer Optional 550 sheet 250 sheet tray MP feeder in the 734 Envelope 98 x 191 mm 3 9 x 7 5 in 9 E
231. only when you have the optional equipment feature on your model or the specified printer language Supplies Menu Replace Supply Cyan Cartridge Magenta Cartridge Yellow Cartridge Black Cartridge Imaging Kit Separator Roll and Pick Assembly Waste Toner Bottle Fuser Help Print All Guides Copy Guide E mail Guide Fax Guide FTP Guide Print Defects Guide Information Guide Supplies Guide 3 4 Service Manual Paper Menu Default Source Paper Size Type Substitute Size Paper Texture Paper Weight Paper Loading Custom Types Custom Names Custom Scan Sizes Universal Setup Manage Shortcuts Fax Shortcuts E mail Shortcuts FTP Shortcuts Copy Shortcuts Profile Shortcuts Reports Menu Settings Page Device Statistics Network Setup Page Network x Setup Page Shortcut List Fax Job Log Fax Call Log Copy Shortcuts E mail Shortcuts Fax Shortcuts FTP Shortcuts Profiles List Print Fonts Print Directory Asset Report Settings General Settings Copy Settings Fax Settings E mail Settings FTP Settings Flash Drive Print Settings Network Ports Active NIC Network Standard USB Menu SMTP Setup Menu key combinations There are different test menus that can be accessed during POR to identify problems with the printer Turn off the printer 2 Press and hold 2 and 6 simultaneously Turn on the printer Release the buttons when the splash screen appears Configuration Menu Turn o
232. ontinue printing 84 xx Replace color Replace the imaging kit and color cartridge following the instruction sheets that imaging kit and color came with the replacement parts cartridge Touch Continue to clear the message and continue printing 88 xx color cartridge Order a replacement toner cartridge nearly low Remove the specified cartridge Firmly shake the cartridge side to side and front to back several times to redistribute the toner Reinsert the cartridge and then touch Continue to clear the message and continue printing Note Repeat this procedure multiple times until the print remains faded and then replace the cartridge 88 xx color cartridge 1 Order a replacement toner cartridge immediately low 2 Remove the specified cartridge 3 Firmly shake the cartridge side to side and front to back several times to redistribute the toner 4 Reinsert the cartridge and then touch Continue to clear the message and continue printing Note Repeat this procedure multiple times until the print remains faded and then replace the cartridge Scanner automatic Close the ADF cover to clear the message feeder cover open Scan document too long The scan job exceeds the maximum number of pages Touch Cancel job to clear the message and cancel the scan job If restarting job replace Try one or more of the following originals that have not begun to exit the Touch Cancel job to clear the message and cancel the sc
233. ontinue printing e Cancel the current print job e Install additional printer memory Try one or more of the following e Touch Continue to clear the message and continue printing e Cancel the current print job Try one or more of the following e Touch Continue to clear the message and continue printing Downloaded fonts and macros not previously stored in flash memory are deleted Delete fonts macros and other data stored in flash memory Upgrade to a larger capacity flash memory card Try one or more of the following e Touch Continue to stop the defragment operation and continue printing e Format the flash memory If the error message remains the flash memory may be defective and require replacing Diagnostic information 2 7 71525 63x User status and attendance messages User primary message Explanation 54 Standard network Try one or more of the following software error e Touch Continue to continue printing e Turn the printer off and then back on to reset the printer Upgrade flash the network firmware in the printer or print server 54 Network x software Try one or more of the following error e Touch Continue to continue printing e Turn the printer off wait for about 10 seconds and then turn the printer back on Upgrade flash the network firmware in the printer 56 Standard USB port Try one or more of the following disabled e Touch Continue to clear the message The
234. or planes using pre programmed default values To reset the programmed value 1 Navigate to TPS Setup Reset Color Cal 2 Resetting appears When the reset is complete the display returns to TPS Setup Cal Ref Adj Used with Reset Color Cal which resets to a default value Cal Ref Adj allows you to fine tune the TPS function To change this setting 1 Navigate to TPS Setup Cal Ref Adj 2 Touch or to adjust the values of Tps CMY and Black 3 Touch Submit to save the settings 3 24 Service Manual 7525 63x REPORTS Previous Menu Settings Page A V The Menu Settings Page report generates a list of the Diagnostics Menu settings and each setting s current value Next To print the Menu Settings Page navigate to Reports Menu Settings Page 4 Go Back Event Log Display Log Log entries appear in chronological order beginning with the most recent entry at the top of the list If more than one screen of entries exists you may scroll down to view the next set of entries To view the event log navigate to EVENT LOG gt Display Log Print Log The Event Log printed from DIAGNOSTICS includes e Detailed printer information including code versions e Time and date stamps e Page counts for most errors e Additional debug information in some cases Model and Event Log Serial number Lexmark x54x s n 98P104V Device Information Printer information Lag lnformat Panel display T when error
235. otros pa ses est certificada como un producto l ser de Clase de acuerdo con los requisitos de IEC 60825 1 Los productos l ser de Clase no se consideran peligrosos Este producto contiene un l ser interno de Clase IIIb 3b AlGalnP que produce una radiaci n visible en una longitud de onda de 650 670 nan metros cerrado en un conjunto de cabezal de impresi n que no se puede reparar El sistema l ser y la impresora se han disenado para que el ser humano no acceda nunca a las radiaciones l ser por encima del nivel de Clase durante el funcionamiento normal mantenimiento del usuario o condici n de servicio prescrita Declaracao sobre Laser Este produto foi certificado nos EUA por estar em conformidade com os requisitos do DHHS 21 CFR subcap tulo J para produtos a laser de Classe 1 e nos demais pa ses foi certificado como um produto a laser de Classe em conformidade com os requisitos da IEC 60825 1 Os produtos a laser de Classe nao sao considerados prejudiciais A impressora cont m internamente um laser de Classe Illb 3b AlGalnP que produz radia o vis vel no comprimento de onda de 650 670 nan metros incluso em um conjunto do cabe ote de impress o cuja manuten o nao facilitada O sistema do laser e a impressora foram projetados para que jamais haja acesso humano radia o do laser acima dos n veis da Classe durante a opera o normal ou a manuten o pelo usuario ou sob as condi es de manuten o
236. ound is So Back specified See the wiring diagram in the back of the book for more information 900 xx system software error service check There are different types of 900 xx errors that can occur There may be a communication problem Bad cable network connection and so on software issue or a hardware problem with the RIP board or ISP Internal solutions port The communication and software aspects should be checked first Determine if the problem is constant or intermittent Use the troubleshooting procedure below to isolate the issue Take any notes as instructed You will need that information in the event you need to contact your next level of support Note Before troubleshooting determine the operating system used when the error occurred If possible determine whether a PostScript or PCL file was sent to the device when the error occurred Ask the customer which Lexmark Solutions applications are installed on the device POR the device Go to step 2 Problem resolved Does the error reoccur Write down the exact 900 xx error code Go to step 3 Go to step 6 displayed Turn the device off Clear the print queues Disconnect all communication cables and remove all memory options Remove all ISP and modem cards Restart the device into Diagnostics mode Does the 900 xx error reoccur during startup Properly connect the cables to the RIP board Go to step 5 Go to step 6 Restart the device into Diagnostic mode Does the 9
237. our paper supplier Remember that these are general guidelines only and that paper meeting these guidelines may still cause paper feeding problems in any laser printer for example if the paper curls excessively under normal printing conditions General information 1 15 7525 63x Digital imaging specifications General specifications ADF scan speed e Simplex ADF Up to 5 ppm e Duplex ADF Up to 5 ppm page sides ADF document handling e ADF input capacity 50 sheets e ADF output capacity 50 sheets e ADF document width 4 9 in 125 mm to 8 5 in 216 mm e ADF document length 5 in 127 mm to 14 0 in 356 mm Resolution and color depth e Resolution 1200 dpi optical e CDD 1200 dpi and 600 dpi Selectable through electronics e Color depth 48 bit RGB output 16 bit channel Flatbed document specifications e Document size Up to A4 and letter 4 5 x 5 5 to 8 5 x11 SEF Flatbed speed 3 seconds to scan 3 seconds to return Scanner operating environments e Temperature 10 35 C e Humidity 15 85 RH Storage environments e Temperature 20 43 C Humidity 5 95 RH Tilt This device should operate within the stated parameters when it is level within 10 mm from front to back and 10 mm side to side 1 16 Service Manual Previous Next D Go Back 7525 63x Scan and copy specific specifications Previous Scan resolutions A V e Optical 600 dpi Local TWAIN only
238. out the 650 sheet duo drawer Tray 2 or the 550 sheet tray Tray 3 v 2 Grasp the jammed paper on each side and then gently pull it out Next Note Make sure all paper fragments are removed D Go Back 3 Align the tray and insert it 4 From the printer display touch Continue jam cleared 250 paper jam 1 Remove all paper from the multipurpose feeder 2 Push the lever in the multipurpose feeder to access the jammed paper Note Make sure all paper fragments are removed 3 From the printer display touch Continue jam cleared 3 52 Service Manual 7525 63x 290 294 ADF paper jams Previous 1 Remove all original documents from the ADF input tray A 2 Open the ADF cover Remove the jammed paper v Next Go Back ll 3 Close the ADF cover 4 Open the flatbed cover Remove any jammed pages Note Make sure all paper fragments are removed 5 Close the scanner lid 6 From the printer display touch Continue jam cleared Diagnostic aids 3 53 7525 63x 291 xx ADF paper jams 1 Remove all original documents from the ADF input tray 2 Remove the ADF input tray See ADF input tray removal on page 4 88 3 Remove the original from the ADF by pulling the lower of the two sheets A from the ADF exit 4 Replace the ADF input tray 5 From the printer display touch Continue jam cleared Updating printer firmware The latest firmware can be found by going to http support lexmark
239. oval on page 4 19 961 xx Service RAM memory error Slot 1 RAM is Check RAM If RAM is ok replace the Memory Failure bad controller See RIP board removal on page 4 19 959 22 Service Challenge secret failure RIP board 962 xx Service RAM memory error Slot 2 RAM is Check RAM If RAM is ok replace the Memory Failure bad controller See RIP board removal on page 4 19 2 22 Service Manual Previous Next D Go Back 7525 63x Service error messages Previous fren om mm 964 xx Service Emulation Error 975 xx Service Standard Network or 975 xx Service Network Card x 976 xx Service Standard Network or 976 xx Service Network Card x 979 xx Service Standard Network or 979 xx Service Network Card x 982 xx Service lt device gt Comm 990 xx Service lt device gt Download emulation cyclic redundancy check CRC failure has occurred A checksum failure detected in the emulation header or emulation file Network error Unrecognizable network port Unrecoverable software or error in network or network port Flash parts failed while programming the network port Communications error detected by the specified device Note lt device gt can be one of the following e Duplex unit e Tray 2 e Tray 3 This error message indicates that an equipment check condition has occurred in the specified device but the device is unable to identify the exact component
240. owing models 7525 630 Lexmark X548de Duplex printer duplex ADF touch panel modem 7525 631 Lexmark X548de Duplex printer duplex ADF touch panel 7525 632 Lexmark X548dte Duplex printer duplex ADF touch panel hard drive modem 7525 636 Lexmark X548dte Duplex printer duplex ADF touch panel hard drive Parts catalog 7 1 7525 63x Assembly 1 7 2 Service Manual Covers Previous Next J Go Back Assembly 1 Covers Part Units Units m mme ma m memm 2 3 4 5 6 4 8 9 40X5484 40X5489 40X5482 40X5537 40X5534 40X5486 40X5419 40X5168 40X5538 40X5490 40X5417 40X5441 40X2253 Tray Output bin Cover AIO back cable Assembly Top cover Link AIO Cover AIO toner Cover Right AIO Tray asm 250 sheet Pick tires Cover Front Cover Front middle Cover Left Cover Legal extender Front flatbed hinge 7525 63x Parts catalog 7 3 Previous A Go Back 7525 63x Assembly 2 Scanner 7 4 Service Manual Previous A D Go Back Assembly 2 Scanner 7525 63x Previous Part Units Units D seription A number mach FRU p V 2 3 4 5 6 4 8 9 40X5470 40X5478 40X5479 40X5872 40X8342 40X7529 40X5536 40X1569 40X5487 40X5488 40X8092 40X8419 40X7545 40X5535 40X2252 Tray ADF input Cover ADF rear duplex Cable ADF 4 Bin full flag Go Back Asm Redrive Asm LED flatbed Lever AlO release Flatbed pivot link Cover Scanner
241. perly connected Go to step 6 Properly connect the ribbon to JCCD1 on the RIP board cable to JCCD1 6 Check for 14 V dc on pins 33 and 34 on Replace the flatbed unit Replace the RIP board See connector JCCD1 Check for 5 V dc on pins See Flatbed removal on RIP board removal on SIS page 4 75 page 4 19 Are the voltages present CCD service check Restart the device and retry the scan copy Go to step 2 No issue job Repeat this step with a few copy jobs Does the error reoccur 2 60 Service Manual Previous Next Go Back 7525 63x Is the CCD ribbon cable properly connected Go to step 3 ae connect the ribbon to JCCD1 on the RIP board cable to JCCD1 Replace the flatbed unit See Flatbed Problem resolved Replace the RIP board See removal on page 4 75 RIP board removal on page 4 19 i Next J Did this resolve the issue Go Back Ensure that the flatbed motor cable JFB1 is Go to step 2 Properly connect the cable connected Is the cable connected Check pin 1 in JFBM1 for voltage The voltage Replace the flatbed unit Replace the RIP board Go is only present when a flatbed copy job is See Flatbed removal on to RIP board removal on running The voltage should measure 24 V page 4 75 page 4 19 ac l Is voltage present POR the printer Problem solved Go to step 2 Does the CCD move and return to the home position Perform the h
242. port components Previous In summary the media is fed from the tray into the printer by a feed roll and carried to the transfer roll ITU The A pick rollers time the media to enter the EP process at just the right moment The pick rollers push the media to the ITU where the image is transferred to the page Next The transfer roller moves the media to the fuser where heat and pressure are applied to the page The fuser rollers push the media toward the exit bin and past the exit sensor The exit rollers guide the paper into the t output bin Go Back Note If the printer posts a paper jam message but no paper is found paper dust or paper particles may have fallen in one of the sensor eyes Use a can of compressed air to gently clean the sensor Duplexing models with duplex support only The MFPs with duplex support use a secondary paper path in the front cover and the 250 sheet paper tray to print on the second side of a sheet of paper The following steps summarize the duplexing process After the first side of the media is printed and the trailing edge of the paper clears the fuser exit sensor the fuser motor reverses The reversed motor pulls the media into the duplexer paper path In addition to the fuser motor reversing the pick motor also reverses The pick motor drives the duplex aligner rolls A which push the media down to the bottom turnaround in the paper tray and gate aligner B Note W
243. preceding seven digits Each ID can contain a combination of the digits O through 9 and the letters A through F Note When the printer detects a Configuration ID that is not defined or invalid the following occurs The default standard model Configuration ID is used instead e Configuration ID is the only function available in DIAGNOSTICS Unless the menu is in DIAGNOSTICS Check Config ID displays To set the configuration ID Navigate to PRINTER SETUP gt Configuration ID The cursor appears in the Configuration ID 1 field Touch Backspace to delete Configuration ID 1 Enter the new Configuration ID 1 Touch the Next icon to switch to the Configuration ID 2 field Touch Backspace to delete Configuration ID 2 Enter the new Configuration ID 2 SOLEO NS 3 22 Service Manual 7525 63x 7 Touch Submit to save the settings or touch Back to return to PRINTER SETUP without saving any eis changes Note If either Configuration ID is invalid Invalid ID appears The printer discards the changes and the A display returns to PRINTER SETUP If both Configuration IDs are valid Submitting changes appears and the display returns to PRINTER SETUP V ITU Barcode The 16 digit numeric value matches the ITU installed in the printer If you replace the ITU re enter this value gt Go Back To enter the ITU barcode 1 Navigate to PRINTER SETUP gt ITU Barcode 2 Enter the 16 digit value 3 Touch Submit to save the settings
244. printer discards any data received through the USB port Make sure the USB Buffer menu item is not set to Disabled 58 Too many flash options installed Turn the printer off Unplug the power cord from the wall outlet Remove the excess flash memory Connect the power cord to a properly grounded outlet Turn the printer back on 58 Too many trays attached Turn the printer off Unplug the power cord from the wall outlet Remove the additional trays Connect the power cord to a properly grounded outlet Turn the printer back on RWONMH aAR WN C1 59 Incompatible tray x Try one or more of the following e Remove the specified tray e Touch Continue to clear the message and continue printing without using the specified tray 61 Remove defective Try one or more of the following is e Touch Continue to clear the message and continue printing e Install a different printer hard disk before performing any operations that require a printer hard disk 62 Disk full Try one or more of the following e Touch Continue to clear the message and continue processing e Delete fonts macros and other data stored on the printer hard disk e Install a printer hard disk with larger capacity 63 Unformatted disk Try one or more of the following e Touch Continue to clear the message and continue printing e Format the printer hard disk If the error message remains the hard disk may be defective and may r
245. r Language settings Activate PPDS Emulation Note You can still switch languages on the operator panel or through the PJL ENTER LANGUAGE command Deactivate Printer s factory default value To change this setting 1 Navigate to PPDS Emulation 2 Touch or tochange the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Factory Defaults Sets the majority of printer values back to their factory default settings Warning This selection cannot be reversed so this operation should be used only as a last resort to fix any printer problem When factory default settings are restored e All downloaded resources fonts macros symbol sets in the printer memory RAM are deleted e All menu settings return to the factory default setting except The Display Language setting in the Setup Menu All settings in the Parallel Menu Serial Menu Network Menu Infrared Menu Local Talk Menu and USB Menu It is recommended to view current settings by printing the Menu Settings pages Customer settings are available from the Ready prompt Diagnostics Menu settings are available in the Diag Menu and Configuration Menu settings are available in the Configuration Menu Turn off the printer or select Exit Config Menu At the home screen touch Navigate to Reports Menu Settings Page Print the Menu Settings pages from the Diagnostics Menu See
246. r cartridge and then install a supported one JE Go Back Try one or more of the following Load the appropriate paper or specialty media in the proper tray Confirm that the wheel on tray 1 is set to the paper size loaded in the tray Make sure this size is the size you are trying to print Touch Continue to clear the message and print using a different tray Check length and width guides of the tray and make sure the paper is properly loaded in the tray Make sure the Print Properties or Print dialog settings have the correct paper size and type Check that the paper size is correctly set For example if the MP Feeder Size is set to Universal make sure the paper is large enough for the data being printed Cancel the print job Try one or more of the following e Touch Continue to disable Resource Save and continue printing e To enable Resource Save after receiving this message make sure the link buffers are set to Auto and then exit the menus to activate the link buffer changes When Ready appears enable Resource Save e Install additional memory Try one or more of the following e Touch Continue to print the portion of the job already stored and begin collating the rest of the print job e Cancel the current print job Try one or more of the following e Touch Cancel job to clear the message e Install additional printer memory Try one or more of the following e Touch Continue to clear the message and c
247. r removal on page 4 108 Remove the sleep button PCB See Sleep button PCB removal on page 4 110 Remove the sleep button See Sleep button removal on page 4 110 Remove the user interface controller card See User interface controller card removal on page 4 113 Remove the LCD See LCD removal on page 4 100 The operator panel cover with light pipe is shown below Repair information 4 103 Previous A D Go Back 525 63x Operator panel bezel removal 1 Open the front door 2 Open the top door 4 104 Service Manual Previous A D Go Back 525 63x 3 Remove the screw A from the joint linking the flatbed to the printer Warning Do not over extend the flatbed when lifting it after the screw A has been removed Previous A D Go Back Repair information 4 105 525 63x 5 Slightly pull the operator panel away from the printer then pry the operator panel bezel off the operator panel Previous A D Go Back Warning During reinstallation be sure to properly engage the tabs of the operator panel bezel to their corresponding slots Failure to align them may cause the tabs to break or deform 4 106 Service Manual Operator panel frame cover removal d 525 63x Remove the operator panel bezel See Operator panel bezel removal on page 4 104 Using a 1 0 Phillips screwdriver remove the three screws A from the rear side of t
248. r reoccur Replace the ADF unit See Duplex ADF Go to step 8 Stop Problem resolved removal on page 4 87 POR the device into Configuration mode Go to Disable Scanner and select Enabled See Disable Scanner on page 3 39 POR the device into operating mode Run a copy from the ADF Did the 840 xx error reoccur Diagnostic information 2 59 7525 63x Inspect JFBM1 JHS1 and JCCD1 on the RIP Go to step 10 Go to step 9 board Are they properly connected Properly connect all the connections Stop Problem solved Go to step 10 Did the 840 xx error reoccur Replace the RIP board See RIP board Problem resolved Contact your next level of removal on page 4 19 support Replace the flatbed unit See Flatbed Go to step 11 Stop Problem resolved removal on page 4 75 POR the device into Configuration mode Go to Disable Scanner and select Enabled See Disable Scanner on page 3 39 POR the device into operating mode Run a copy from the flatbed Did the 840 xx error reoccur Did this fix the problem Black or blank page copy service check Questions actions Yes Print a menu page or a page from the host See Print quality solid Go to step 2 color page on page 2 53 Is the page black Is the copy an ADF scan Go to step 3 Go to step 4 Run a flatbed copy Go to step 5 Go to step 4 Is it blank or black Does the sheet feed into the ADF i Go to step 5 Is the CCD ribbon cable pro
249. rear screw A in the waste toner bottle sensor contact to allow access to the cable cover Note The waste toner bottle sensor contact does not need to be unplugged or removed T 6 Remove the four screws B securing the cable cover Go Back T Turn the printer on the left side 8 Remove the screw C securing the spring contacts 9 Release the tabs D on the spring contact to release the spring contacts 4 64 Service Manual 525 63x 10 Disconnect the cable E from the RIP board at JSC1 Previous x oe a E NN nir EE i oo x b v ien 7 5 N T oa E r E Ea i ae d P L is a Lettie ELPOSC NT enna C and pore i j rh a pee er pepe pee T T et z cx NECI u E E eA T H i b j 4 x E zie 7 ai E k i th a T em i L zd k ji y a bere AT d a j 4 hea TES T Il mer at j an th i r ttt a i T Es E a4 ats 1 a I Next D Go Back E 11 Remove the cable from the retainer on the bottom of the printer 12 Extract the cable through the frame and remove the cable with the spring contacts Repair information 4 65 525 63x Toner meter cycle TMC card removal Remove the right cover See Right cover removal on page 4 7 Remove the imaging unit IU See Imaging unit IU removal on page 4 63 Remove the rear shield See Rear shield removal on page 4 7 Disconnect and remove the toner meter cycle card
250. removal on page 4 19 Replace the autocompensator mechanism See Autocompensator mechanism ACM Next standard tray removal on page 4 13 Go Back Inspect the bin full sensor located towards the rear of the top cover assembly Is the bin full sensor dislodged or damaged With the scanner assembly in the down position perform the standard bin sensor base sensor test See BASE SENSOR TEST on page 3 20 Toggle the bin full flag attached to the rear shaft of the redrive unit Does the flag rotate freely and interrupt the sensor beam when in normal position Turn the printer off and remove the rear shield See Rear shield removal on page 4 7 Turn the printer on and then check the values below at JBIN1 JBIN1 1 0V dc 5V dc during cycle 2 3 3 V dc beam blocked O V dc unblocked Are the values correct Repair or replace the bin full Go to step 2 sensor See Bin full sensor removal on page 4 16 Reposition or replace the flag If the flag is broken replace the bin full flag See Bin full flag removal on page 4 99 Go to step 3 Replace the RIP board See RIP board removal on page 4 19 Problem resolved Diagnostic information 2 33 7525 63x Dead printer service check Previous A dead printer is a condition where the display is blank the LED on the operator panel is off the fan does not A turn no motors turn and the fuser does not heat V If a 650 sheet du
251. ridge Directimage Devices that support Directimage support all of the following graphics formats TIFF TIF JPEG JPG GIF PNG BMP PCX and DCX 1 4 Service Manual Previous A D Go Back 7525 63X Previous Next v Supported Lexmark X Not supported X548 Data streams v Host Based Printing HBP Graphics Device Interface GDI Version 3 color uses PCL XL Go Back Dimensions Lexmark X548de 463 mm 18 2 in 440 mm 17 3 in 597 mm 23 5 in 27 8 kg 61 3 Ib 32 1 kg 70 7 Ib Lexmark X548dte 597 mm 23 5 in 440 mm 17 3 in 597 mm 23 5 in 550 sheet duo drawer 133 mm 5 2 in 424 mm 16 7 in 416 mm 16 4 in 4 3 kg 9 4 Ib 9 4 Ib 650 sheet duo drawer 133 mm 5 2 in 424 mm 16 7 in 416 mm 16 4 in 4 3 kg 9 4 Ib General information 1 5 7525 63x Clearances 1 6 Service Manual 32 07 kg 70 71 Ib 7 Y IN 3 9 ES o memes o eanes joe mm in Right side 508 mm 20 in s2 mm in Left side 76 mm 3 in 254 mm 10i Previous A D Go Back 7525 63x Power and electrical specifications Previous The following table specifies nominal average power requirements for the base printer configurations All power A levels are shown in Watts W Maximum current is given in Amperes A Vv Printing states nn Next of Go Back Simplex printing 540 W Duplex printing 380 W Copying 530 W
252. right Cover Scanner left Asm Duplex ADF ADF separator pad replacement CRU ADF separator roll replacement CRU Flatbed cushion duplex Redrive spacer screws Parts catalog 7 5 7525 63x Assembly 3 Operator panel 7 6 Service Manual Previous A D Go Back 7525 63x Assembly 3 Operator panel Previous LX O ON OO 2 C I 40X6523 40X6521 40X6519 40X6515 40X6516 40X5480 40X6520 40X6517 40X6518 Part Units Units Describtion A number mach FRU p V Cover Operator panel bezel Display 7 inch LCD with ground cable DEN Cover Operator panel with keypads sleep button and light pipe 4 PCBA UICC Go Back Cable UICC Cable USB for thumbdrive Cover Operator panel frame Speaker EPROM PCBA Parts catalog 7 7 7525 63x Previous Paperpath Assembly 4 Next x O ig co O 7 8 Service Manual Assembly 4 Paperpath 4 1 40X5411 40X5415 40X5422 40X5424 40X5803 40X5403 40X1557 40X5412 40X7562 40X7563 40X7564 40X0411 40X2261 40X2254 40X2255 40X8674 1 1 1 l M IL IL IL IL Il ll 7525 63x Previous Part Units Units p e ation A number mach FRU P V 1 Printhead Fuser drive motor assembly Bottom left and right frame and cable cover 4 Screw packet miscellaneous screws e TAPTITE M3 L6 PANHD 4 e Tray Bias 2 e Fuser Latch 2 e ITU Front Hold Down 1 Front Cover Latch Spring
253. right side hub or the clutch may be damaged If the ball bearings come out of the clutch it will have to be reassembled on a flat surface BM 4 60 Service Manual Previous A D Go Back 525 63x Installation notes Previous A D Go Back Install the new rubber tires with the surface texture turning in the direction as shown Note Feel each rubber surface to verify it turns properly in the direction shown Printhead removal 1 Remove the scanner assembly See Flatbed removal on page 4 75 2 Remove the top cover See Top cover assembly removal on page 4 9 3 Disconnect the cables 4 Remove the printhead cable toroid A from the flat cable Note Tuck the printhead cable toroid as shown below when reinstalling Failure to do so can damage the RIP board Repair information 4 61 525 63x 5 Remove the three screws B UU QUUUUUU QUUM JL o We i s 1 EE 1 Cm ES 6 Remove the printhead Installation note When the printhead is replaced perform the registration black planes and alignment color planes See REGISTRATION on page 3 9 and Alignment Menu on page 3 11 4 62 Service Manual Previous A D Go Back 525 63x Imaging unit IU removal Previous The imaging unit is customer replaceable unit and not a FRU Note The imaging unit contains v e Photoconductor unit Next e Developer unit
254. rking properly 4 Press x to return to SCANNER TESTS 3 30 Service Manual B A Previous A D Go Back 7525 63x Scanner Calibration Reset Previous This procedure should be run after the scanner or ADF has been replaced A ADF Magnification v Next This setting enables the adjustment of the ADF s magnification To adjust this setting T Go Back 1 Navigate to SCANNER TESTS gt ADF Magnification 2 Touch or to adjust the setting 3 Touch Submit to save the setting or touch Back to return to the Diagnostics Menu without saving any changes EXIT DIAGS This setting appears as a button on the bottom right hand corner of the display and is always accessible from the Diagnostics Menu Touch this to exit the Diagnostics Menu The printer performs a POR and starts in normal mode Diagnostic aids 3 31 7525 63x Previous Configuration Menu Available test A vailable tests V The tests display on the operator panel in the order shown Next See Reset Separator Roll and Pick Assembly Counter on Assembly Counter page 3 33 Go Back See USB Scan to Local on page 3 33 See Print Quality Pages on page 3 33 See Reports on page 3 33 See Color Trapping on page 3 34 See Panel Menus on page 3 34 See PPDS Emulation on page 3 35 See Factory Defaults on page 3 35 See Energy Conserve on page 3 36 See Fax Low Power Support on page 3
255. rmware or replace RIP board Invalid Firmware See RIP board removal on page 4 19 959 05 Service Unknown boot failure Update firmware or replace RIP board Invalid Firmware See RIP board removal on page 4 19 959 20 Service System hardware failure Replace RIP board See RIP board RIP board removal on page 4 19 959 21 ServicRIP System did not respond to command boarde request RIP board Replace RIP board See RIP board removal on page 4 19 ASIC SP mismatch Replace RIP board See RIP board removal on page 4 19 959 23 Service System self test failure during Replace RIP board See RIP board RIP board initialization removal on page 4 19 959 24 Service EEPROM retention error write failure Replace RIP board See RIP board RIP board removal on page 4 19 959 25 Service Insufficient device space during Replace RIP board See RIP board RIP board hardware programming removal on page 4 19 959 26 Service Incremental counter reset exceeds Replace RIP board See RIP board RIP board maximum value removal on page 4 19 959 27 Service Increment count failed due to Replace RIP board See RIP board RIP board maximum value limit removal on page 4 19 959 28 Service Invalid SP memory configuration Replace RIP board See RIP board RIP board removal on page 4 19 960 xx Service RAM memory error RAM soldered on Replace RIP board See RIP board Memory Error the board is bad rem
256. roblem resolved Replace the RIP board Go removal on page 4 87 to RIP board removal on page 4 19 Does this fix the problem Diagnostic information 2 65 7525 63x Modem fax card service check Previous Is the phone line properly connected to the Go to step 2 Go to step 3 modem card and the wall jack Next Properly connect the phone line to the modem Problem resolved Go to step 3 4 card and wall jack Go Back Did this fix the problem Test the phone line s ability to send and Go to step 5 Go to step 4 receive Calls Did the phone line work properly Use the MFP on a properly functioning phone Problem resolved Go to step 5 jack Did this fix the problem Is the modem card ribbon cable properly Go to step 7 Go to step 6 connected to the RIP board at JMOD2 and the modem card Properly connect the modem card cable to the Problem resolved Go to step 7 modem card and RIP board Did this fix the problem Check the modem card ribbon cable for Go to step 8 Replace the modem card continuity cable Is there continuity Check the voltages from connector JMOD2 on the RIP board Ground 11 Ground Ground Ground Ground Ground Are the voltages approximately correct 2 66 Service Manual Replace the RIP board Go to RIP board removal on page 4 19 Replace the fax card See Fax card removal on page 4 31 7525 63x Fax transmission service check Previous Note Before performing
257. rom being accidentally touched by other personnel Install machine covers when you are not working on the machine and do not put unprotected ESD sensitive parts on a table If possible keep all ESD sensitive parts in a grounded metal cabinet case Be extra careful in working with ESD sensitive parts when cold weather heating is used because low humidity increases static electricity Testing generic FRUs The X54x series MFP s RIP board and operator panel can be tested after installation When testing the board it is critical to POR the machine only into Diagnostics mode DO NOT POR THE MACHINE TO A READY STATE In Diagnostics mode machine specific information is not written to the NVRAM on the replacement part To properly test a replacement generic FRU perform the following steps ae Ic Replace the faulty RIP board Start the machine into diagnostics mode See Menu key combinations on page 3 5 Turn the machine off If the replacement part is not the cause of the issue remove the replacement part Repair information 4 1 525 63x Previous Removal procedures CAUTION Remove the power cord from the electrical outlet before you connect or disconnect any cable or electronic board or assembly for personal safety and to prevent damage to the printer Next Disconnect any connections between the printer and PCs peripherals 4 Go Back Notes Some removal procedures require removing cable ties You must replace ca
258. rove the color This problem most commonly occurs when projecting transparencies with reflective overhead projectors To obtain the highest projected color quality transmissive overhead projectors are recommended If a reflective projector must be used then adjusting the Toner Darkness setting to 1 2 or 3 will lighten the transparency Make sure to print on the recommended type of color transparencies What is manual color correction When manual color correction is enabled the printer employs user selected color conversion tables to process objects However Color Correction must be set to Manual or no user defined color conversion will be implemented Manual color correction settings are specific to the type of object being printed text graphics or images and how the color of the object is specified in the software program RGB or CMYK combinations Notes e Manual color correction is not useful if the software program does not specify colors with RGB or CMYK combinations It is also not effective in situations in which the software program or the computer operating system controls the adjustment of colors e The color conversion tables applied to each object when Color Correction is set to Auto generate preferred colors for the majority of documents To manually apply a different color conversion table 1 Touch to open the Administrative menus 2 Navigate to Settings Print Settings Quality Menu 3 68 Service Ma
259. s Why doesn t the printed color match the color see on the computer screen The color conversion tables used in Auto Color Correction mode generally approximate the colors of a standard computer monitor However because of technology differences that exist between printers and monitors there are many colors that can also be affected by monitor variations and lighting conditions For recommendations on how the printer color sample pages may be useful in solving certain color matching problems see How can I match a particular color such as a corporate logo on page 3 69 The printed page appears tinted Can I adjust the color Sometimes a printed page may appear tinted for example everything printed seems to be too red This can be caused by environmental conditions paper type lighting conditions or user preference In these instances adjust the Color Balance setting to create a more preferable color Color Balance provides the user with the ability to make subtle adjustments to the amount of toner being used in each color plane Selecting positive or negative values for cyan magenta yellow and black from the Color Balance menu will slightly increase or decrease the amount of toner used for the chosen color For example if a printed page has a red tint then decreasing both magenta and yellow could potentially improve the color balance My color transparencies seem dark when they are projected Is there anything I can do to imp
260. s To remove only the photoconductor remove the entire imaging unit remove the developer units place the iad ed l Go Back original developer units in the new photoconductor and reinstall the imaging unit When you replace the imaging kit you are replacing both the photoconductor and the developer units Open the front cover Lift the scanner unit by sliding the latch to the left Remove the right cover assembly See Right cover removal on page 4 7 Remove the waste toner bottle See Waste toner bottle removal on page 4 73 Remove the toner cartridges Lift the two latches A to unlock the imaging unit Pull the two latches until the imaging unit meets resistance oeerAoN V H 4 m A f A A 7 T Press and hold the handles B and pull the imaging unit straight out Warning When pulling the imaging unit out grab only the release levers B Do not touch the photoconductors at the bottom of the imaging unit Note Store the imaging unit in a dark place or cover it with a blanket B Repair information 4 63 525 63x Toner cartridge contacts removal Previous 1 Remove the right cover assembly See Right cover removal on page 4 7 A 2 Remove the waste toner bottle See Waste toner bottle removal on page 4 73 V 3 Remove the imaging unit See Imaging unit IU removal on page 4 63 4 Remove the rear cover See Right cover removal on page 4 7 Next 5 Remove the
261. s moved to the cleaning blade the toner is moved from the cleaning blade G to the waste toner area using an auger system 3 62 Service Manual Previous A D Go Back Photoconductor Clean Erase 7525 63x After each plane of color has been transferred to the transfer belt from the photoconductors a cleaning blade H scrapes the remaining toner from the surface of each photoconductor This is the clean erase process Now the photoconductor surface is prepared to begin the EP cycle once again This cleaning erasing cycle happens after each plane of color is transferred to the transfer belt Diagnostic aids 3 63 Previous A D Go Back 7525 63x Paper path transport components In order for an image to be printed the media has to be moved from an input source such as a tray into the printer and eventually exit into an output source The most important component in this process is this media itself Old damaged or out of specification media Previous A V Next can and will cause feed and transport problems If you encounter problems you should always check the media first Media guidelines on page 1 13 In addition it is always good practice to check the printer and driver settings to see if the media bei
262. s should be checked at different resolution settings e Toner Darkness Set to 4 default e Color Saver Set to OFF e RGB Brightness RGB Contrast RGB Saturation Set to O e Color Balance Select Reset Defaults to zero out all colors e Check the paper type texture and weight settings against what is loaded in the printer Once the printer has been restored to its default levels do the following 1 Inspect the imaging unit for damage including the developers and toner cartridges Replace if damaged 2 If paper other than 20lb plain letter A4 paper is being used load 20lb plain letter A4 3 Print the Print Quality pages to see if the problem remains Look for variations in the print from what is expected To print the quality pages a Enter the Diagnostics Menu Turn off the printer press and hold 3 and 6 turn on the printer and release the buttons when the progress bar appears b Navigate to PRINT TESTS gt Print Quality Pages c Printing Quality Test Pages appears and the pages print Diagnostic information 2 45 7525 63x An incorrect printer driver for the installed software can cause problems Incorrect characters could print and the copy may not fit the page correctly Measure all voltages from the connector to the printer ground Print quality background Service tip Some background problems can be caused by rough papers non Lexmark toner cartridges or if the media texture is set to the rough setting S
263. s test verifies the functionality of the ADF cover closed sensor To test this sensor perform the following steps ADF Cover Open 0 appears Lift the ADF top cover The value of ADF Cover Open should change from 0 to 1 if the sensor is working properly Press x to return to SCANNER TESTS ey 3 28 Service Manual 7525 63x Scan 1st sensor test Previous This test verifies the functionality of scan sensor 1 To test this sensor perform the following steps 1 Scan 1st Sensor 0 appears v 2 Lift the ADF top cover and close the ADF cover sensor by pressing down on the ADF sensor actuator A with a small flat blade screwdriver Next D Go Back 3 Press the Sensor 1 actuator B located in the ADF paper path The value of Scan 1st Sensor should change from 0 to 1 if the sensor is working properly l ant E te i k j 4 ht kN u N P zo 4 Press x to return to SCANNER TESTS Diagnostic aids 3 29 7525 63x Scanner 2nd sensor test This test verifies the functionality of scan Sensor 2 To test this sensor perform the following steps 1 Scan 2nd Sensor 0 appears 2 Lift the ADF top cover and close the ADF cover sensor A by pressing down on the ADF sensor actuator with a small flat blade screwdriver 3 Move the Sensor 2 actuator by inserting a small screwdriver into the hole B and gently toggling the actuator The value of Sensor 2 should change from 0 to 1 if the sensor is wo
264. sages There is a mismatch between controller 950 xx Service NVRAM Failure 951 xx Service NVRAM Failure 952 xx Service NVRAM Failure EEPROM and mirror e 950 00 through 950 29 codes Mismatch between controller and mirror e 950 30 through 950 60 codes Mismatch between secure and controller Mismatch between controller EEPROM and mirror e 951 00 through 951 29 codes Mismatch between controller and mirror e 951 30 through 951 60 Mismatch between secure and controller A recoverable MVRAM Cyclic Redundancy Check CRC error occurred n is the offset at which the error occurred 7525 63x Go to 950 xx NVRAM failure service check on page 2 32 Performing a POR will clear this error 953 xx Service NVRAM Failure 954 xx Service NVRAM Failure 955 xx Service Code CRC lt loc gt 956 00 Service RIP board failure Processor failure RIP board 956 01 Service Processor over temperature RIP board 957 xx Service RIP board failure ASIC failure RIP board NVRAM chip failure with mirror The NVRAM chip failure with controller part The Code ROM or NAND flash failed the Cyclic Redundancy Check CRC check or the NAND experienced an uncorrectible multi bit failure lt oc gt indicates the source of the failure and has one of the following values CRC Failure The source is a failing package indicated by Pn where n is the package
265. sed to help solve some problems of paper curl on low grade papers and or melting of A letterheads on some types of media To change this setting Next 1 Navigate to EP SETUP gt Fuser Temp 2 Touch or to select Normal High or Low The default is Normal T Go Back 3 Touch Submit to save the settings or touch Back to return to the Diagnostics Menu without saving any changes DC Charge Adjust Dev Bias Adj Transfer Adjust Each of these three settings enables you to adjust the high voltage levels controlling the electro photographic process You will use these settings to compensate for unusual operating circumstances such as high humidity The printer uses the value of these settings together with other settings to calculate printing speed and media selection TPS Setup Right or Left TPS The value of the TPS sensor is set at manufacturing If a sensor is replaced enter the 32 digit hexadecimal TPS value associated with the sensor To enter the value 1 Navigate to TPS Setup 2 Select Right or Left and touch the Keyboard icon 3 Change the TPS value d Touch Clear b Enter the TPS value C Touch Submit to save the settings 4 Submitting changes appears e If the number is incorrect Checksum does not match appears and the original screen appears to re enter the value e fthe number is correct Saving changes to NVRAM appears Reset Color Cal This setting allows the device to adjust the alignment of the col
266. sfer unit removal 4 43 imaging unit IU removal 4 63 L left scanner cover removal 4 94 lithium battery warning ii Xvii locations 5 1 low voltage power supply removal 4 48 lower frame removal left 4 50 right 4 53 lubrication specifications 6 2 main drive gear assembly with motors removal 4 57 media handling 1 9 menu users map 3 4 messages attendance 2 5 models 1 1 modem service check 2 66 O operator panel buttons 3 1 service check 2 41 option trays service check 2 57 options and features 1 1 output bin tray removal 4 108 P paper jams avoiding 3 45 locations 3 46 paper specifications 1 10 parts catalog 7 1 covers 7 3 l 2 Service Manual electronics 7 11 7 13 media drawers and trays 7 15 operator panel 7 7 options 7 16 paperpath 7 9 scanner 7 5 pick tires integrated 250 sheet media tray removal 4 60 POR sequence 2 1 power on reset sequence see POR sequence preventive maintenance 6 1 print quality service checks 2 45 print quality symptoms 2 4 printhead service check 2 54 printhead removal 4 61 product specifications 1 2 R rear shield removal 4 7 redirve unit removal 4 93 removals ACM standard tray 4 13 ADF cable 4 89 ADF input tray 4 88 ADF separator pad 4 91 ADF separator roll 4 92 AlO link 4 97 AlO release lever 4 96 AlO toner cover 4 98 bin full flag 4 99 bin full sensor 4 16 covers AIO back cable cover 4 8 right cover 4 7 scanner left 4 94 scanner right 4 94
267. solve the problem 7525 63x Previous Next D Go Back bS Go to step 2 Go to step 3 Go to step 4 Replace the cable assembly Problem resolved Replace the printhead See Printhead removal on page 4 61 Replace the transfer contact assembly See Toner cartridge contacts removal on page 4 64 Go to step 5 Replace the RIP board See RIP board removal on page 4 19 Problem resolved Diagnostic information 2 53 7525 63x Print quality vertical banding Previous Next D Go Back Replace the developer cartridge Printhead service check This service check includes the following errors Error codes Color Turn the printer off and remove the rear Replace the printhead See Go to step 2 shield See Rear shield removal on Printhead removal on page 4 7 Check the cable at JMIRR1 for page 4 61 proper connection to the RIP board the printhead cable for pinch points and the cable or connector for any other damage Is the cable damaged Turn the printer on and verify the following Replace the printhead See Replace the RIP board See values at JMIRR1 Printhead removal on RIP board removal on JAR page 4 61 page 4 19 Are the values approximately correct 2 54 Service Manual Toner meter cycle TMC card service check Questions actions Perform the Base Sensor Test Replace the toner cartridge 1 Enter the Diagnosti
268. ssing or altered parts especially in the area of the On Off switch and the power supply e Damaged missing or altered covers especially in the area of the top cover and the power supply cover e Possible safety exposure from any non Lexmark attachments Scheduled maintenance Customer replacable units CRUS The following parts also need to be checked for wear or damage and replaced if necessary 40X5168 Pick tire replacement CRU 120 000 pages sides 40X7545 ADF separator roll replacement CRU 60 000 pages sides 40X8419 ADF separator pad replacement CRU 60 000 pages sides Maintenance kit After 60 000 printed pages sides a maintenance kit may be required It is necessary to replace the fuser assembly ITU and duplex reference plate to maintain the print quality and reliability of the printer The parts are available as a maintenance kit with the following part numbers Description Part number 115 V Maintenance kit 115 V fuser ITU duplex reference edge 40X2254 230 V Maintenance kit 230 V fuser ITU duplex reference edge 40X2255 100 V Maintenance kit 100 V fuser ITU duplex reference edge 40X2261 Preventive maintenance 6 1 71525 63x Previous Lubrication specifications A Lubricate only when parts are replaced or as needed not on a scheduled basis Use of lubricants other than those specified can cause premature failure Some unauthorized lubricants may chemically attack V polycarbonate parts Use IBM
269. ste toner bottle sensor contact to allow access to the cable cover Note The waste toner bottle sensor contact does not need to be unplugged or removed Remove the four screws B from the cable cover and remove the cable cover SNE A o3 Bs ez 1 mm ij we a Tr n 5 Turn the printer on its back 6 Remove the three screws C securing the lower right frame to the printer Repair information 4 69 525 63x T Remove the screw D closer to the front of the printer Previous A D Go Back 8 l j UN hl a LJ din cc Lois e a f mo 47 m 8 Lift the right lower frame pin E out of the hole in the printer frame 9 Swing the rear of the lower frame away from the printer to access the tray present sensor latches 4 70 Service Manual 525 63x 10 Remove and secure the spring F from the right lower frame prse Note The spring easily gets lost A D Go Back 11 Disconnect the tray present sensor cable 12 Remove the sensor retaining plate G and then squeeze the latches together to remove the tray present Sensor Installation notes 1 Clean the contact surface where you removed the sensor retaining plate or where you need to install the new one 2 Install the sensor 3 Make sure the clips on the posts latch to the frame Repair information 4 71 525 63x 4 Remove the backing from the new plate and place the plate on the surface betw
270. t 2 22 e eee e ee eee eee eee eee eee 7 9 7 16 650 sheet duo drawer tray assembly rrrrr e e 7 15 550 sheet MPF latch cover r rurrrrrrr rrr 7 15 Power cord 2 5 m straight Europe and others 7 11 Power cord 2 5 m straight Brazil 7 11 Pick tire replacement CRU 2 2 2 ee eee eee eee eee eee eee rre 7 15 Pick tires 2 nn en ee ee ee ee eee eee eee 7 3 Image transfer unit ITU assembly 2 2 222 222 2255 7 9 Toner meter cycle card assembly 2 22 e seen eee eee eee eee eee eeeee 7 11 Low voltage power supply universal power Supply IIee 7 11 Printhead r u rurrrrrrrErrrr eee eee eee 7 9 Main drive gear assembly with motors 2 2 2 eee eee eee ee eee eee 7 9 Fuser exit sensor 22 ttt ter eee eee eens 7 11 Toner patch sensors 2 222 esse ee ee ee eee eeee 7 13 Fuser drive motor assembly 2 22 e eee e eee eee eee eee eee eeeee 7 9 Cover Left 2 2 eee cen rrr 7 3 Tray asm 250 sheet 2 2 2 e een ce re ee eee eee ee eee eee 7 3 Imaging unit contact Pogo pin 222s eee e ree eee eee eee eee eee 7 13 Bottom left and right frame and cable cover
271. t PictBridge mode unplug camera and change mode Unsupported disk An unsupported disk has been inserted Remove the unsupported disk and then install a supported one 30 xx Missing color Try one or more of the following cartridge and or color imaging kit Unplug the camera change the mode and plug the camera back into the printer e Remove and reinstall the specified toner cartridge or imaging kit For instructions on removing a toner cartridge or imaging kit touch More information Install a new toner cartridge or imaging kit following the instruction sheet that came with the replacement part 2 6 Service Manual 7525 63x User status and attendance messages Previous User primary message Explanation A 31 xx Defective color cartridge 32 xx color cartridge part number unsupported by device 34 Incorrect paper size open src 35 Insufficient memory to support Resource Save feature 37 Insufficient memory to collate job 38 Memory full 39 Complex page some data may not have printed 51 Defective flash detected 52 Not enough free space in flash memory for resources 53 Unformatted flash detected The specified toner cartridge is either missing or not functioning properly Try one or more of the following Vv e Remove the specified toner cartridge and then reinstall it Next e Remove the specified toner cartridge and then install a new one Remove the unsupported tone
272. t operates Any reference to a product program or service is not intended to state or imply that only that product program or service may be used Any functionally equivalent product program or service that does not infringe any existing intellectual property right may be used instead Evaluation and verification of operation in conjunction with other products programs or services except those expressly designated by the manufacturer are the user s responsibility Lexmark and Lexmark with diamond design are trademarks of Lexmark International Inc registered in the United States and or other countries Optra Forms is a trademark of Lexmark International Inc PCL is a registered trademark of the Hewlett Packard Company All other trademarks are the property of their respective owners 2011 Lexmark International Inc All rights reserved UNITED STATES GOVERNMENT RIGHTS This software and any accompanying documentation provided under this agreement are commercial computer software and documentation developed exclusively at private expense P N 12G0479 7525 63x Table of contents Pisvigus Table of CONICN Ss 600404868554 5b5604 58006 6etbtGbe ckte dad EcaruoR E xREG MSS lii y NOTICES and safety IMOrMmation uuksoacxuraos s On9 9 E RCRCA RI RCRC R0 RCRORCA RC DOOR Cdi xi i eee NOt MM Ar ender ea ee eee A a E cease xi Lithium warning 0 ccecceccecccccccccuccuccuccuucauceuceueeueeueetutenutuuenues xvii T cq legiti aA A
273. t waiting for SAP BLDC motor Go to Main drive gear assembly EP Black ITU cartridge FG drive service check on page 2 40 Motor 150 05 Service Lost lock for motor Go to Main drive gear assembly EP Black ITU cartridge drive service check on page 2 40 Motor 150 06 Service Excessive SAP BLDC PWM Go to Main drive gear assembly EP Black ITU cartridge drive service check on page 2 40 Motor 150 07 Service Motor stalled in time based Go to Main drive gear assembly EP Black ITU cartridge commutation drive service check on page 2 40 Motor 2 16 Service Manual 7525 63x Service error messages Previous 152 xx Service Go to Main drive gear assembly EP CMY Cartridge Motor drive service check on page 2 40 d ex 152 01 Service Failed to achieve lock for motor within Goto Main drive gear assembly EP CMY Cartridge Motor allotted time drive service check on page 2 40 152 02 Service Timeout waiting for SAP BLDC motor Go to Main drive gear assembly EP cade CMY Cartridge Motor to reach valid FG speed drive service check on page 2 40 152 03 Service Timeout waiting for Go to Main drive gear assembly EP CMY Cartridge Motor MP_NUM_INITIAL_SAP_HALLS drive service check on page 2 40 152 04 Service Timeout waiting for SAP BLDC motor Go to Main drive gear assembly EP CMY Cartridge Motor FG drive service check on page 2 40 152 05 Service Lost lock for motor Go to Main drive ge
274. tep 12 line Try sending a fax using a dial prefix Problem resolved Go to step 12 Does the fax transmit Is the fax failing to send to one specific Go to step 13 Go to step 14 destination Check the device that cannot receive a fax Go to step 14 Stop here The issue is with the other device Can it send a fax Diagnostic information 2 67 7525 63x Previ Press 411 to enter the Fax SE Menu Select Problem resolved Go to step 15 A Print Logs V Print the T 30 transmission log Check the error being reported with the fax error code Next table See on page 2 27 Perform the suggested resolution for the error 4 Did this fix the problem Go Back Adjust the Transmit Level setting in the SE Problem resolved Go to your second level of menu press 411 to enter the SE menu enter support See Escalating a Modem settings and select Transmit Level fax issue to next level Test by adjusting the transmitted signal support on page 2 70 strength by decreasing increasing the Transmit Level setting in steps of 1db For example if default value is 11 db changing it to 12 db will decrease the signal strength by 1 db and changing it to 10 db will increase the signal strength by 1db Recommended adjustment range is 5 db in 1 db increments from the default value Did this fix the problem Is the phone line properly connected to the Go to step 2 Go to step 3 m
275. ter it for the new value Reprint the quick test page and then use the fine adjustment n Top T Fine Adjustment 20 18 First locate the line of the color that you are aligning that lines up best with the scale line In this example it is 18 If none of the colored lines match up use the coarse adjustment to get close reprint this page and then use the fine adjustment T2 0 4 18 18 i Current New Cyan Cyan T value T value 5 Usethe or ofthe Top Margin setting to enter the sum of the numbers and touch Submit Submitting changes appears and the display returns to the Alignment Menu Print the Quick Test again to verify if the observed value is the same as the current value no change is needed If change is still needed repeat steps 4 5 When the observed values and the current value are the same continue to the next step 3 12 Service Manual Previous A D Go Back 6 Select the Skew value in the same way and touch Submit Print the Alignment pages to see if the observed values and the current values are the same T20 4 18 Current Cyan T value 18 New Cyan T value Z 0 18 14 Current Cyan Z value 7525 63x Previous Next D Go Back T On the second page of the latest Quick Test pages printed proceed to Step 2 adjust the left right and bow settings Continue printing the Quick Test after each adjustment to verify the set
276. the rear case and remove Se eae DEO unl User interface controller card cable removal Remove the AlO rear cable cover See AlO back cable cover removal on page 4 8 Remove the rear shield See Rear shield removal on page 4 7 Remove the left cover See Left cover removal on page 4 4 Remove the ADF unit See Duplex ADF removal on page 4 87 Remove the flatbed See Flatbed removal on page 4 75 Remove the operator panel assembly See Operator panel assembly removal on page 4 102 Pry the front cover off the operator panel Remove the two screws securing the rear case to the operator panel cover Pull the operator panel cover away from the rear case to access the UICC cable Route the UICC cable off the rear case and remove SOD AO ee ol 4 112 Service Manual User interface controller card removal oN Disconnect the two cables A from the user interface controller card 525 63x Remove the operator bezel cover See Operator panel bezel removal on page 4 104 Remove the operator panel frame cover See Operator panel frame cover removal on page 4 107 Remove the rear case with speaker See Rear case with speaker removal on page 4 108 A 5 Remove the four screws B from the user interface controller card Repair information 4 113 Previous A D Go Back 525 63x 6 Remove the user interface controller card 4 114 Service Manual Previous
277. the separator pad ADF separator pad and ADF separator rollers cloth and isopropyl alcohol and ADF pick roll Is there dirt present If the paper is skewing when it is fed into the Go to step 3 Set the paper guides so ADF check the paper guide width they contact the edges of the paper Is it set correctly If paper is skewing when fed or jamming check Properly close the top cover If the paper is jamming in to see if the top cover is open or ajar the ADF go to step 6 Is the ADF top cover open or ajar Is paper failing to feed into the ADF Go to step 5 Perform the ADF paper present scan 1st and Go to step 6 Go to step 9 scan 2nd sensor tests SCANNER TESTS on page 3 26 Are the sensors working properly Check the leading edge of the paper to ensure Bad media Go to step 7 the paper is not curled or bent in a way that would keep it from contacting the paper present sensor actuator Is the paper damaged Is there dirt in the sensors or is the paper Clean the sensors or Go to step 8 present actuator stuck remove debris from the actuators Are the sensor actuators on the ADF Replace the ADF Go to step 9 mechanism cover damaged Is the ADF connector properly connected to Go to step 10 Properly connect the cable JADF1 on the RIP board to the RIP board Diagnostic information 2 63 7525 63x Inspect the connections on the ADF relay card in the ADF Are all the connections properly connect
278. the shaft and hole for reinstallation 13 Remove the ACM Installation notes 1 Place the left side of the ACM in the printer Make sure the shaft on the left side aligns with the hole in the frame Turn the printer to the proper upright position Route the cable through the frame and through the cable channel making sure to clamp the cables into the two retainers on the left side Remove the rear shield and connect the cable Replace the rear shield ae SN Repair information 4 15 525 63x Bin full sensor removal 1 Remove the flatbed unit See Flatbed removal on page 4 75 2 Using a small flat blade screwdriver gently depress the tabs A which secure the sensor to the top cover assembly A 3 Pull the sensor away from the top cover assembly 4 Disconnect the sensor from the cable 4 16 Service Manual Previous A D Go Back 525 63x Narrow media sensor flag removal Previous 1 Open the front cover A 2 Remove the narrow media sensor flag V 3 Remove the cable from the retainer Note Be sure to note the routing for reinstallation Next 4 Disconnect the cable A from the narrow media sensor 5 Go Back Repair information 4 17 525 63x 5 If there is a sensor retaining plate B remove the plate B 6 Squeeze the retainers on the rear of the sensor and gently remove the sensor from the bracket by hand Installation notes 1 Clean the contact surface where
279. the test Diagnostic information 2 41 7525 63x Operator panel display is blank Check the cable connections between the RIP Go to step 3 Go to step 2 board and the UICC and check the connections from the UICC to the display Are the cables properly connected Reconnect the cables POR the device Problem resolved Go to step 3 Does this fix the problem Using a multimeter check the UICC cable for Go to step 5 Go to step 4 continuity Is there continuity Replace the defective cable See User Problem resolved Go to step 5 interface controller card cable removal on page 4 112 POR the device Does this fix the problem Are the LEDs on the operator panel lit Go to step 6 Go to step 7 Replace the display See LCD removal on Problem resolved Go to step 7 page 4 100 Does this fix the problem 7 Check connector JUIC1 on the RIP board for Go to step 9 Go to step 8 the following voltages and grounds Do the voltages and ground readings approximately match the table Replace the RIP board See RIP board Problem resolved Go to step 9 removal on page 4 19 POR the device into Diagnostics mode Does this fix the problem 2 42 Service Manual Previous Next D Go Back 7525 63x Replace the UICC POR the device into Problem resolved Contact your next level of diagnostics mode support Does this fix the problem Op panel USB cable service check Check the
280. the throughput of the USB port on the printer The settings are Auto which is the default and Full Full forces the USB port to run at full speed and also disables its high speed capabilities To change this setting 1 Navigate to USB Speed 2 Touch or tochange the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Diagnostic aids 3 41 7525 63x USB PnP Previous This setting is used to improve the MFP s compatibility with the host PC A Note Some PCs contain chipsets that may be incompatible with this MFP V To change this setting DE 1 Navigate to USB PnP T Go Back 2 Touch or to change the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Automatically Display Error Screens To change this setting 1 Navigate to Automatically Display Error Screens 2 Touch or tochange the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Exit Config Menu This setting appears as a button on the bottom right hand corner of the display and is always accessible from the Configuration Menu Touch this to exit the Configuration Menu The printer performs a POR and starts in normal mode 3 42 Service Manual 7525 63x Previous SE Menu Note This is not the Fax SE menu To enter the Fax SE
281. the transfer belt The media is carried to the fuser rollers where heat and pressure are applied to the page to permanently bond the toner to the page The fuser rollers push the media into the output bin The transfer unit is cleaned and the process begins again for the next page Diagnostic aids 3 55 7525 63x Step 1 Charge During the charge step voltage is sent from the high voltage power supply to the charge roller A beside each of the four photoconductors The charge roller is part of the photoconductor unit The charge roller A puts a uniform negative charge over the entire surface of the photoconductor to prepare it for the laser beam Service tips e lf the surface of the charge roller is damaged such as a nick or pit it will cause the charge to be uneven on the photoconductor This will cause a repeating mark on the printed page Check the service manual for the repeating marks table e lf the charge roller is severely damaged the surface of the photoconductor will not be charged properly and heavy amounts of toner will be deposited on the photoconductor This will cause the printed page to be saturated with 10096 of each color The imaging basket will need to be replaced sooner 3 56 Service Manual Previous A D Go Back 7525 63x Step 2 Expose During the expose step the laser fires a focused beam of light at the surface of
282. the waste toner bottle See Waste toner bottle removal on page 4 73 Remove the imaging unit See Imaging unit IU removal on page 4 63 Remove the low voltage power supply See Low voltage power supply LVPS assembly removal on page 4 48 Place the printer on the right side Remove the tray 2 connector B by squeezing the tabs and lowering the connector into the printer Oo PYN 4 50 Service Manual Previous A D Go Back 525 63x T At the rear of the printer remove the ground screw C and two screws D from the AC receptacle y Previous A D Go Back C D 8 Remove the three screws E securing the left lower frame E 9 Remove the LVPS See Low voltage power supply LVPS assembly removal on page 4 48 Repair information 4 51 525 63x 10 Remove the screw F on top of the frame 4 52 Service Manual T ONT C CN Previous A D Go Back 525 63x Right lower frame Previous Note Remove the duplex sensor the tray present sensor the spring spring holder and the wireless antenna A plate which are not part of the right and left lower frames The cable cover is part of the right lower frame FRU v Note To properly reinstall the duplex sensor and the tray present sensor also order two sensor retaining Next plates Open the front cover lt Remove the right cover assembly See Right cover removal on page 4 7 Go Back Remov
283. tings Lett L Fine Adjustment Loft L HH Coarse L20 4 Current Cyan L value s Adjustment New Cyan L value Cyan Alignment Right R Fine Adjustment Step 2 t Bow P Coarse Adjustment Right R tA Coarse IHH Adjustment DEZXIEXENI 40 40 30 0 320 40 amp Bow P Fine Adjustment 4 R 0 Current Cyan P R value P 0 Current New Cyan Cyan P value P value 8 Continue on to the other two colors in the same manner Factory Scanner Note This setting is not used by field service Factory Manual Note This setting is not used by field service dM J New Cyan R value Diagnostic aids 3 13 7525 63x Scanner Calibration Previous Copy Quick Test A V This test performs a copy from the scanner flatbed or duplex ADF using the printer s current settings Next To perform this test navigate to Diag Menu Scanner Calibration Copy Quick Test Adjust Calibration Values D Go Back This setting adjusts the black value mono and color bands used in the gamma curve for a specific scan source This should only be used to manually tune a replacement scanners black gamma value To adjust these settings 1 Navigate to Diag Menu gt Scanner Calibration gt Adjust Calibration Values 2 Touch or to adjust the settings of the following e Flatbed Black e ADF Front Black e ADF Back Black 3 Touch Submit to save the setti
284. tkopeenheid Het lasersysteem en de printer zijn zodanig ontworpen dat gebruikers nooit Go Back blootstaan aan laserstraling die hoger is dan het toegestane niveau voor klasse l apparaten tijdens normaal gebruik onderhoudswerkzaamheden door de gebruiker of voorgeschreven servicewerkzaamheden Lasermeddelelse Dette produkt er certificeret i USA i henhold til kravene i DHHS 21 CFRi underafsnit J for klasse 1 laserprodukter og er andre steder certificeret som et klasse laserprodukt i henhold til kravene i IEC 60825 1 Klasse l laserprodukter er ikke anset som farlige Printeren indeholder en intern klasse IIIb 3b AlGalnP laser der producerer synlig str ling med en belgelaengde p 650 670 nanometer indkapslet i en ikke servicerbar printhovedsamling Lasersystemet og printeren er udviklet pa en sadan made at der ikke er en direkte laserstr ling der overskrider Klasse l niveauet under normal brug brugers vedligeholdelse eller de foreskrevne servicebetingelser Laserilmoitus Tama tuote on sertifioitu Yhdysvalloissa DHHS 21 CFR Subchapter J standardin mukaiseksi luokan 1 lasertuotteeksi ja muualla IEC 60825 1 standardin mukaiseksi luokan lasertuotteeksi Luokan lasertuotteita ei pidet haitallisina Laitteen tulostusp kokoonpanossa ei huollettavissa on sis nrakennettu luokan Illb 3b AlGalnP laser joka tuottaa silminnahtavaa s teily 650 670 nanometrin aallonpituudella Laserjarjestelma ja tulostin ovat rakent
285. tographic technology to v deliver remarkable quality print images and text The scan and copy functions work with A4 letter and legal ADF only size paper Photographic quality images are possible with scan function The fax function delivers a wide range of functionality to the office user The MFPs can be used as shared network or desktop devices The 4 MFPs can also support a 550 sheet option while the 650 sheet duo drawer is attached Next Go Back Models The Lexmark X548 Series MFPs are available in the following models Model Configuration Machine type model X548de Duplex printer duplex ADF touch panel 7525 631 X548de Duplex printer duplex ADF touch panel modem 7525 630 X548dte Duplex printer duplex ADF touch panel hard drive 7525 636 X548dte Duplex printer duplex ADF touch panel hard drive modem 7525 632 Options and features Certain options are available on selected printer models only Available options include e 650 sheet duo drawer A 550 sheet drawer with a 100 sheet multipurpose feeder MPF e 550 sheet drawer e Additional memory One 128MB 256MB 512MB or 1GB memory card may be added e Flash memory card One 256MB card may be added e Font cards One language card can be added General information 1 1 71525 63x Memory Memory Optional slots One slot Standard DIMM 512MB Sizes Optional DDR2 256MB 512MB and 1GB Maximum printer 1536MB memory Flash memory 256
286. top cover 4 9 developer unit 4 47 duplex ADF 4 87 duplex ADF rear cover 4 86 duplex sensor 4 29 flatbed 4 75 4 82 flatbed pivot link 4 85 front cover assembly 4 3 front middle cover 4 4 fuser 4 32 fuser drive motor assembly 4 36 fuser exit sensor 4 37 high voltage power supply 4 40 image transfer unit 4 43 imaging unit IU 4 63 LCD 4 100 left cover 4 4 left lower frame 4 50 left scanner cover 4 94 low voltage power supply 4 48 main drive gear assembly with motors 4 57 operator panel assembly 4 102 operator panel bezel 4 104 Previous Next D Go Back operator panel cover with light pipe 4 103 operator panel frame cover 4 107 output bin tray 4 108 photoconductor unit 4 63 pick tires integrated 250 sheet media tray 4 60 printhead 4 61 procedures 4 2 rear case with speaker 4 108 rear shield 4 7 redrive unit 4 93 right lower frame 4 53 right scanner cover 4 94 RIP board 4 19 sleep button 4 110 sleep button pcb 4 110 speaker 4 111 toner cartridge contacts 4 64 toner meter cycle card 4 66 toner patch sensor 4 68 tray present sensor 4 69 USB cable 4 112 USB connector 4 72 user interface controller card 4 113 user interface controller card cable 4 112 waste toner bottle 4 73 waste toner bottle contact 4 74 repair information 4 1 right scanner cover removal 4 94 RIP board removal 4 19 S S1 sensor service check 2 35 safety information ii xvii safety inspection guide 6 1 scan fax and copy symptoms 2 3 SE Menu 3
287. uch Back to return to the Configuration Menu without saving any changes Fax Low Power Support To change this setting 1 Navigate to Fax Low Power Support 2 Touch or tochange the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Min Copy Memory This setting allocates the amount of DRAM memory to be used for storing copy jobs in the priority queue 25 35 50 80 and 100 MB are the available settings 80 MB is the default setting To adjust this setting 1 Navigate to Min Copy Memory 2 Touch or to adjust the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes 3 36 Service Manual 7525 63x NumPad Job Assist This setting determines if a user can configure and initiate a job using the panel s hard buttons To change this setting 1 Navigate to NumPad Job Assist 2 Touch or tochange the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Format Fax Storage This setting allows the user to format non volatile fax storage memory To format the fax storage 1 Navigate to Format Fax Storage 2 Touch Yes to continue or touch No to return to the Configuration Menu 3 While formatting is taking place Formatting fax flash DO NOT POWER OFF appears After formatting is complete t
288. ur system support person Memory full cannot There is not enough memory to print the fax job print faxes Touch Continue to clear the message without printing Held faxes will attempt to print after the printer has been restarted Diagnostic information 2 5 71525 63x User status and attendance messages Previous No analog phone line The analog phone line was not detected the fax is disabled Connect the printer to connected to modem an analog phone line and then touch Continue fax is disabled Next Some held jobs were Touch Continue to delete the specified job not restored 4 Note Held jobs that are not restored stay on the hard disk and are inaccessible 37 Insufficient memory The printer deleted some held jobs in order to process current jobs oa some held jobs will not be restored User primary message Explanation A Touch Continue to clear the message 57 Configuration Something has changed in the printer to invalidate the held jobs Possible changes change some held jobs include were not restored The printer firmware has been updated e Paper input options needed for the print job were removed e The print job was created using data from a device in the USB port and the device is no longer in the USB port e The printer hard disk contains print jobs that were stored while installed in a different printer model Touch Continue to clear the message Load src with custom Try one or more of t
289. us e Single a single sheet of blank paper is fed and the test stops e Continuous sheets are fed continuously until Stop is pressed Diagnostic aids 3 19 Previous A D Go Back 7525 63x Sensor Test This test is used to verify that the sensors are working correctly for an individual input tray 1 Navigate to INPUT TRAY TESTS gt Sensor Test 2 Select the tray where you want to test the sensors Depending on the tray selected you may have Empty Sensor Low Sensor or Pass thru Sensor Sensors will be displayed with either Open or Closed Toggle the sensor you want to test and note the change of state of that sensor Input Tray Tray 2 650 sheet duo tray MP Feeder To Exit the test press Stop BASE SENSOR TEST Previous Next D Go Back These tests allow you to verify the correct functioning of the front door input and output sensors 1 Navigate to BASE SENSOR TEST 2 Select the sensor to test The following tests are available Value Bin empty Bin full Standard Bin Toggle the bin full media flag attached to the redrive unit Front Door Value open Open and close front door The sensor should change Value closed state Media clear Media present Input S1 Input S2 Not closed Closed C TMC Sensor M TMC Sensor Y TMC Sensor K TMC Sensor 3 To stop the test press 3 20 Service Manual Remove and re insert the media tray The sensor should
290. user cable A from the LVPS Position the fuser cable so that it can be pulled through from the front of the printer and guide the cable to the front Warning Be careful not to damage the cable by pulling too hard or cutting the cable insulation 1 2 3 4 A 5 Remove the screw B on the right side of the frame 4 32 Service Manual Previous Next D Go Back 525 63x 6 Disconnect the two thermistor cables C from the fuser Previous lt gt Next J Go Back T Unhook the springs D from either side of the fuser 8 Detach the geared belt E from the drive pulley on the fuser exit roll shaft Note Do not remove the pulley or spacer from the shaft D 9 Rotate the top of the fuser toward the front slide it to the left to align the fuser side frame with the flat areas of the shaft F and lift to remove the fuser Repair information 4 33 525 63x Warning Be careful not to interfere or damage the fuser exit sensor located to the left of the fuser 4 34 Service Manual Previous A D Go Back 525 63x Installation notes Previous e Install the narrow media sensor flag to the fuser before putting the fuser into the printer A e Make sure the springs are resting on the top so they can be reached once the fuser is in place Next Go Back e When reinstalling on the right make sure the gears mesh e Be careful not to interfere with the exit sensor on the left side
291. valid engine code mode See Menu key combinations on page 3 5 2 Access the device s Web page from a web browser 3 From the Web page navigate to Settings Solutions Embedded Solutions select the application Export Note Don t click Import Export to back up the eSF applications and settings There is a size limit of 128kb on the export file Customers with a large number of applications or settings may exceed the file size limit and have information truncated in the exported file 4 Once the new RIP board is installed repeat steps 1 2 and navigate to Settings gt Solutions gt Embedded Solutions gt select the ucf file gt Import 3 44 Service Manual Previous Next D Go Back 7525 63x Previous Paper jams ae A voiding jams v The following hints can help you avoid jams Next Use only recommended paper or specialty media T For more information see the Card Stock amp Label Guide available on the Lexmark Web site at Go Back www lexmark com publications Do not load too much paper Make sure the stack height does not exceed the indicated maximum height Do not load wrinkled creased damp or curled paper Flex fan and straighten paper before loading it Do not use paper that has been cut or trimmed by hand Do not mix paper sizes weights or types in the same stack Store the paper in an appropriate environment Do not remove trays while the printer is printing Wait for Load tray lt
292. ve the ADF rear cover and inspect the Go to step 7 Go to step 8 ADF cover closed sensor for dirt and debris Are there dirt and debris present Clean the dirt and debris from the sensor Problem resolved Go to step 8 Did this fix the problem Inspect the connections on the ADF relay card Go to step 9 Secure all the connections in the ADF Are they properly connected Check the ADF cable for continuity Go to step 10 Replace the ADF cable See ADF cable removal on TM age 4 89 Is there continuity pag Check for signals or voltages from JADF1 on Replace the ADF See the RIP board Pins 11 and 12 should measure Duplex ADF removal on 24VDC Pin 5 should measure 14VDC Replace the RIP board See RIP board removal on page 4 87 page 4 19 Are there signals or voltages present 2 62 Service Manual Previous Next D Go Back 7525 63x ADF streak service check Previous Do streaks appear on the middle of scans Clean the ADF glass on the No issue to fix when using the ADF flatbed using a lint free Next cloth Also clean the separator roll and pad with a damp cloth Go Back lt gt J ADF paper jam service check Note This service check should be used if the paper feeds and jams in the ADF If the paper is not feeding into the ADF see ADF feed errors service check on page 2 64 If the ADF is multi feeding check for dirt on the Clean them with a lint free Replace
293. when the MFPs internal print settings are changed To perform and automatic color adjust perform the following steps To adjust this setting 1 Navigate to Automatic Color Adjust 2 Touch or to adjust the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Diagnostic aids 3 37 Previous Next D Go Back 7525 63x ADF Edge Erase Previous This menu item sets the size in millimeters of the no print area around an ADF scan job All copy jobs have a A two millimeter minimum border Copy jobs will use the setting or two millimeters whichever is larger V To adjust this setting Next 1 Navigate to ADF Edge Erase 2 Touch or to adjust the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any Go Back changes FB Edge Erase This menu item sets the size in millimeters of the no print are around a flatbed scan job All copy jobs have a two millimeter minimum border Copy jobs will use the setting or two millimeters whichever is larger To adjust this setting 1 Navigate to FB Edge Erase 2 Touch or to adjust the setting 3 Touch Submit to save the setting or touch Back to return to the Configuration Menu without saving any changes Scanner Manual Registration This item is used to manually register the flatbed and ADF on the MFP s scanner unit Registration should b
294. ys If a user status message is displayed then go to User status and attendance messages on page 2 5 e User attendance messages are indicated by a two or three digit error code that provides the user with information that explains a problem with a print cartridge paper jam option port and so on If a user error message displays then go to User status and attendance messages on page 2 5 and 2xx paper jam messages on page 2 10 Power On Reset POR sequence The following is an example of the events that occur during the POR sequence when the printer is turned on Display screen illuminates and the memory test is initiated The Lexmark splash screen is displayed with a progress bar The firmware revision is displayed in the lower left portion of the screen Scanner calibration and testing initiates when the progress bar is two thirds finished Not Ready will be displayed if any cover is open Any cartridge errors such as Defective Cartridge are displayed in the message area at the bottom of the Screen Applicable maintenance messages are displayed Applicable toner low messages are displayed The red indicator light will flash if there are errors The printer displays Ready Leone Vee NS Diagnostic information 2 1 Previous Next D Go Back 71525 63x Symptoms tables Printer symptoms table Dead printer Go to Dead printer service check on page 2 34 Operator panel one or more buttons do Go to One or

Lexmark X548 Series 7525-63x Service Manual

Contents

Download Pdf Manuals

Related Search

Related Contents