Home

2007 年8 月2 日(02.08.2007)

image

Contents

1. se Met BIRHis FapK se His FabK FabK se FabK ss His FabK se FabK 1 oc Bs 34 DE3 Novagen 1 00u g mL ULB sgar 37 C 1 00u g mL LB 100mL 37 C 10 Ou g mL 10omL L M ster 1 WO 2007 086583 15 0045 0046 0047 PCT JP2007 051518 Lo 1 OOug mLOP VEY YY EAE LeMa ster 100mL 1 00 g mL 5 L LeMaster 6 00hm O D 0 6 1 0
2. E 1 3 His FabK His ta g F pK 2 4 F p KK Molecular Cloning A Laboratory Manual 3rd caition Sambrook and Russell Cold Spring Hgagbor laboratory Press 2 001 001 1 K
3. 15 14 14 7 FabK mo 1 19 WO 2007 086S83 PCT JP2007 051518 1 2 1 2 WO 2007 086583 PCT JP2007 051518 2 2 13 Ser141 INTERNATIONAL SEARCH REPORT A CLASSIFICATION OF SUB JECT MATTER CO7K1 00 2006 01 i 2006 01 n According to International B FIELDS SEARCHED C12N9 02 2006 01 i Patent Classification IPC or to both national classification Intern onal pplica on No PCT JP2 007 051518 C12N15 09 2006 01 i GO1N23 20 and IPC Minimum documentation searched classification system followed by classification symbols CO7K1 00 C12N9702 C12N15 09 G01N23
4. Q Sepharose High Performance 114mL PEE OnmM PH7 WO 2007 086583 13 PCT JP2007 051518 O04 1 0042 5 5 OnM 1mM 1mM 1mM 5mL min FabK 3 7 5 OnmM PH7 5 5 OmM 1mM 1mM 1mM 0 1M s DS PAGE FabK 2 1 Fa KK 50mM PH7
5. FabK F bK FabK P2 P2 2 2 122 2 C222 4 e a P2 a 50 5A b 126 13 c 53 SA w v g0 113 11 b P2 2 2 a 59 6A b 74 7A c 12 6 13A ce gO0 c P2 2 2 a 87 9A b 16 0 16A c 1 83 18A v gO 1222 a 117 12A b 187 1gA c 2 15 22A v gO e C222 a 59 6A b 85 9A c 126 13A gO0 CHS FabK
6. F4 pbK F WO 2007 086S83 3 PCT JP2007 051518 0008 000 001 0 001 1 0012 bK FabK FabK FabK Fa bK PRSP F blI Fa bK MRSA XX Fa KK FabK X FabK
7. 57 R 0 28 2 3 WO 2007 086583 21 PCT JP2007 051518 1 FabK 2 FabK Streptococcus Streptococcus pneumoniae 1 3 P2 P2 2 2 1222 C222 1 4 F abK a P2 CH a 5 0 5A b 126 13A c 53 SA w v g 113 11 b P2 2 2 a 59 6A b 74 7A c 12 6 13A cc gO0 c P2 2 2 a 87 9A b 16 O 16A c 1 83 18A
8. ool s o LVE Terwillinger T c amp Berendzen s ActaCryst allogr D 55 849 861 199 gt REs o LVE Terwilli ger T C Acta Crystallogr Ds6 955 972 2 000 Turbo Frodo AFMB CNRS R fm c5 c ollab orati Ve Computational Project Numper 4 ccp4 s His FabK 2 2 A R 0 2 2 0 9 R _ 0 282 F j gt 002 Fl 7 1 A141s Hi FabK 15 WO 2007 086583 20 PCT JP2007 051518 0063 ORR 12 5
9. F pK 7 DNA Na l x hol LE Nal x hol pET 21b N vagen DNA Ligation Kit ver 2 co MpETENT high DH5a ToYo Bo 0x gs mL LB agar 37 C His FabKpE T 21b F abK pE 21b DNA 1 s w IssPRoT Accession 5Q8 DR17 WO 2007 086583 10 PCT JP2007 051518 0085 00 6 R6 FabK 2 FahK His FabK FabK
10. ILJ TY 1 IO rpj IJ IT SA J P 100 8915 4 3 PCT ISA 210 2 2005448 pcr WO 2003 066677 al 2oos 08 14 amp AU 2002 338064 Al amp CA 2476006 Al amp EP 1479693 Al amp US 2007 032637 Al Payne D J et al Discovery of a novel and potent class of Fabl directed antibacterial agents Anti Microbial Agents and
11. A lt F pK S c s KHis t ag 2 FahK His tag F pK His FabK Hi Fab 5 0mM PHs 0 5 OnmM 5mM 1mM 1mM
12. FahK 1 FabK FabK DNA DNA DNA TNH DNA DNA TUT FabK DNA FabK DNA lt WO 2007 086583 8 PCT JP2007 051518 009 oo d pUc pBR pUB YEp YRp Ycp
13. 2M Hi FabK QOmM WO 2007 086583 12 PCT JP2007 051518 PH7 5 2M 1mM 1mM 1mM RESOURCE PHE 6mL 5mL min 3 5 omM PH7 5 1mM 1mM 1mM 2 OM 15 SDS PAGE His FabK 089 4 G Hi FabK 3 0000 Amicon Ultra 4 30kDa NMWL 1mL
14. 1mM D KUPTG PBS 2 00mL 2 OC CR HE RF Lit Se His FabK Se FabK 1 LeMaster 1000m Se Met core 23 6g 25mg ml m 1 1 00 1 M 1m 15mM 11 iml 8 3 1 KAO and MICHAYLUK VITAMIN SOLUTION 11 6 A141S FahK A1415 His FabK A141S FabK 1 2 RHis FabK pET 21b OF abK pET 21b 14 1 A141S Hi FabK A141S FabK Stratagene QuickChange Site Directed Mutagenesis K
15. BAA POROS HQ 2 0 PerSeptive Biosystems 5 QmM PH7 5 5 OnmM EP VE 1mM 1mM 1mM 10mL min His FabK 3 5 OnM PH7 5 OnM 1mM 1mM 1mM 0 500mM 25 TA SDS PAGE AL His FabIK 008 3 Blac 2 5 His FabK OnM PH7 5 3 SM 1mM 1mM 1mM
16. F abK P2 2 2 Ch a 58 gs2A b 73 89A c 126 5 0A cc HX WO 2007 086583 5 PCT JP2007 051518 0018 0019 ow d oo 1 0 2 0 3 v gO FabK 1 FabK C222 a 58 ggA b 84 6 0A c 126 17A cc HX v g FabK 3 FabK P2 2 2 a 86 ggsA b 16 0 41A c 183 25A cc gO F bK 2 FabK
17. 1 C222 a 58 ggA b 84 6 0A c 126 17 A c gO D Se FabK P2 2 2 a 86 ggA b 16 0 41A c 183 25A ec gO 3 His FabK 1222 CH a 117 2 0A b 186 58A c 214 79A BEV cc v gO Se His FabK 1222 a 118 38A b 190 30A c 213 QA BF v gO 8 Se His FabK X 7 1
18. AR CRSA AMES Lik 4 C XX s o His FabKK WO 2007 086583 17 PCT JP2007 051518 06 1 0052 0053 0054 0055 0056 0057 008 1 P2 5 0 26A b 126 69A c 53 63A w v gO0 112 46 mm CHS 1 3 Hi FabK P2 a 5 0 61A b 12 5 95A c 53 01A a v g0 112 78 1 His FabK P2 2 2 a 58 gz2A b 73 89A c 126 50A c vzgo A141S Hi FabK
19. gO0 d 1222 a 117 12A b 187 1gA c 2 15 22A cs v gO c C222 a 59 76A b 85 9A c 126 13A c gO CHS 5 a P2 a 5 O 5A b 126 13A c 53 SA w v amp 0 113 11 4 6 b P2 2 2 a 59 6A b 74 7A c 12 6 13A ce v g 4 7 c P2 2 2 a 87 9A b 16 OF 16A c 1 83 18A ce 8 v g 4 8 d 1222 117 12A b 187 1gA c 2 15 22A c v g 4 9 e C222 a 59 6A b 85 9A c 126 13A Batya g0
20. 1 000 12 5 MpD O 1M 0 2M SmM 0 1M MES PH6 0 17 0C SPring 8 BL32B2 CD X XX 1A 1 CrystalClear A141S Hi s FabK 1 8A A141S His FabK C222 58 ggA b 84 60A c 126 17A v gO 99 8 R 6 69 Molrep CCP4 Refmac5 CCP4 R 0 244
21. Ami con Ultra 4 3 OkDa NMWL 1mL QnmM 7 5 15 OnmM 1mM 1mM 1mM Hiload 16 60 Superdex75 prep gr ade 1m L min Ss DS P AGE WO 2007 086583 14 PCT JP2007 051518 003 4 G Fa KAR 5 QmM e HH7 s 5 0mM 1mM 1mM 1mM Mo n Q HR1 0 10 FENN 5 OmM p 7 5 5 MMA EF 1mM
22. 4 WO 2007 086583 22 PCT JP2007 051518 1 d 11 12 13 14 15 16 17 18 19 2 0 FabK Streptococcus Streptococcus pneumoniae 4 FabK 1 4 4 9 1 2 2 A X 1 FabK FabK 14
23. X h 1 0 6 0 MA WO 2007 086583 6 PCT JP2007 051518 D lt MAD SPring 8 MAD XX Fa
24. 0 2 M 5mM 0 1M MES PH5 5 7 0 2 0 25 1 000 0 1M 0 2 M s mM 0 1M MEs PH5 5 7 0 G 2 5 1 06 8 000 2 5 1 06 1 000 0 1M 0 2 M s mM 0 1M MEs pH5 0 6 5 MAD x s o His FabK 1o mg mL s His FabK O u Leki mE 1 0 1 000 1 06MpD o 1M 0 2 M smM 0 1M MES PH6 5 2 0o gL 00z VDx
25. 1222 a 117 20A b 186 58A c 214 79A sc X v g OM MTHS FabK 1 F bK 1222 a a 118 38A b 19 0 30A c 213 QA cs HX v g FabK 1 X e X lt SPring 8 X X
26. WO 2007 086S83 9 PCT JP2007 051518 005 2 0033 0034 1 R ADNA Streptococcus pneumoniae R6 ATCC49 619 OR 5 37C 18s SDN y Ti u Kit Q IAGEN DNA 2 R F K FapK DNA FabK F p 5 GGA ATTCCATATGA AA cGoG TATTACAGAA 3 5 His FabK R p 5 CCcGC TcCGAGGTcATTTCTTAcAAcTccTGT 3 6 FabK R P 5 CCGCTCGAGTTAGTCATTTCTTACAACTCC 9 7 1 DNA pyrobest D NA Polymerase PcR His tag FabK His FabK 6
27. 1 000 8 15 9 MPD o 1M 0 2M 5mM 0 1M MES PHS 5 7 O 2 0 259 1 000 0 1M 0 2M 5mM 0 1M MES PH5 5 7 0 G 2 5 1 006 8 000 2 5 1 06 1000 0 1M 0 2M 5mM 0 1M MES PH5 0 6 5 1 1 MPD X 1
28. 1 His FabK pET 21b FabK pET 2 1b BL21 DE3 Novagen 1 00z g mL SB 1 2 w Y Bacto TryPtone 2 4 w v Yeast Extract 5 v v 0 072M 0 O2 8M SL 6 00m O D 0 6 1 0 1mM B RIPTG PBS 2 OOmL ICRA LER 2 0C His FabK pE 21b A 5 OmM PH8 0 3 00nmM 5mM 1mM 1mM 1mM 0 1mg mL FabK pE 2
29. MAD 2 2A WO 2007 086S83 4 PCT JP2007 051518 0013 0014 0015 0016 0017 OX te FabK tt FabK FabK 1 1 s o His FabK 2 FabK 3 3 A141s FahK FabK FabK Streptococcus Streptococcus pneumoniae
30. 1mM 1 mM mL min F uK 3 EN s OnM PH7 5 5 OnmM EP YEDDA 1mM 1m M 1mM 01M 2 0 s Ds PAGE lk VR Fay 10mM p7 5 10omM 1mM 1o mg mL mmM AF GET PCR 8 OC CRF LE 004 s F K s js FabK FabK MAD x
31. F p KK FAs I FAs lt iI FA Pro Lipid Res 2 009 4 Q467 497 1 ACP ACP ul FapH ACP CoA A abB F p
32. 1 4 FabK FabK P2 5 0 26A b 126 69A c 53 63A e v gO 112 46 FabK 1 FabK P2 a 5 0 61A b 125 g5A c 53 o1A w v gO 112 78 FabK 1
33. 323 Tokyo JP AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN C CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM GT HN HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LA LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MY MZ NA Nr NI NO NZ OM PG PH PL PT RO RS RU SC SD SE SG SK SL M V Y TJ TM TN TR TT TZ UA UG US UZ VC VN ZA ZM ZW 54 Title CRYSTAL OF ENOYL ACYL CARRIER PROTEIN REDUCTASE FabK 54 FabK 57 Abstract A crystal of enoyl acryl carrier protein reductase FabK in particular a crystal of FabK originating in Streptococcus pneumoniae which has excellent qualities and can be obtained at a high reproducibility Thus for example an FabK specific inhibitor can be efficiently designed which highly contributes to the discovery of a drug having a novel function mechanism 57 ron ro FabK Streptococcus pneumoniae Fa bK
34. Se His FabK 15 12 5 1 000 12 5 MPD o 1M 0 2M 5mM 0 1M MES PH6 17 0C WO 2007 086583 18 0059 006 0 PCT JP2007 051518 SPring 8 BL 32B2 CD XX 0 97932 0 97888 0O 90000A MAD 1 CrystalClear 2 0A P2 a 5 0 26A
35. FabK WO 2007 086583 OA OTM IM RK IN NNNMNNN NINDI TMA 84 ARIPO MW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW x AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR OAPI OF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG 2 PC7 WO 2007 086583 1 PCT JP2007 051518 000 000 006 Fan K x
36. Chemotherapy 2002 Vol 46 No 10 p 3118 3124 Stewart M J et al Structural basis and mechanism of enoyl reductase inhibition by triclosan J MoI Biol 1999 Vol 290 No 4 p 859 865 Oliveira J S et al Crystal lographic and pre steady state kinetics studies on binding of NADH to wild type and isoniazid resistant enoyl ACP CoA reductase enzymes from Mycobacterium tuberculosis J MoI Biol 2006 06 Vol 359 No 3 p 646 666 Saito J et al Crystal structure of Streptococcus pneumoniae enoyl acyl carrier protein reductase FabK 2006 06 cp Page A12389 4P B 028 SA 2 10 2 2oos 4 Pcr J P2007 05151 c O O
37. K b om4 FabK 005 FabK FabK 1 4 His FabK FabK lt Ss 1 FabK 1omg m
38. b 126 69A c 53 63A a vig0 112 46 97 2 96 1 95 49 R _ 6 2 6 4 8 6 Se His FabK Se His FabK 2 o 2 WO 2007 086S83 19 PCT JP2007 051518 P2 a 026 peo lt 3 63 deg a 0 0 112 90 00 A Q90000 Q 97888 0 97932 A 39 2 00 40 2 00 32 2 00 2 0 2 00 2 0 2 090 2 0 2 00 1 se5 130889 142999 78798 gt 79789 1 378 1 76 1 87 9 ACS 1 94 9 9 2 cc 2 R jerge Q Ge 0 Ga Q 0 0 199 0 139 0 142 I sigmaI 3 90 8 6 6 3 1 6 3 5
39. 1999 398 383 384 J Med Chem 2 00 46 1627 1635 ACP F p1 LAL F b1 F p Streptococcus pneumoniae ACP F bK ps udomonas aerugi nosa BEnter coccus teca lis F b1 Fabp KK Nature 2 000 4 05 14 5 146 F bI1 lt F bK F bK FMN 1 Bioche m J 2 08 3701 05 102 FabK
40. 5 3 5M 1mM 1mM 1 mM 2M Fa pK 5 QnmM pH7 5 2M 1mM 1mM 1mM RESOURCE PHE 6mL 5m min 3 5 OnM PH7 5 1mM 1mM 1mM 2 OM 15 sDg PAGE FabIK 3 FabK 3 0000
41. 051518 5mM 1mM 1mM 1mM 1mL min 3 5 OnmM EA PHg 0 3 00mM 20mM 1mM 1mM 1mM 5 OQmM PH 0 3 00mM 200mM 1mM 1m M 1mM CH SDS PAGE C4 US HE His FabK 087 2 Blac 1 His FabK OnmM P Hg 0 5 OnmM 1mM 1mM 1mM
42. 07 994 2007 BIOSIS WPIDS MEDLINE CA STN JMEDP1us JDream2 JST7580 TDream2 JSTP1us Dream2 c Y Marrakoh1 H et al Mechanistic diversity and regulation of Type 1 20 II fatty acid synthesis Biochemical Society Transactions 2002 Vol 30 No 6 p 1050 1055 Y JP 2005 058223 A 2005 03 10 F C A IT ER HA E X
43. 1b B 5 QmM PH7 5 OnmM EP 1mM 1mM 1mM 0 1mg mL 3 0 7 3 15 000Grpm 0 22 gm 3 s Hig Fab KORR 1 4 C His FabK pET 21b 2 Ni NTA QIAGEN 3 QOnmL 5 GmM PHe 0 3 00mM WO 2007 086583 11 PCT JP2007
44. 20 Documentation searched other than minimum documentation to the extent that such documents are included m the fields searched Koho Shinan 1922 1996 1971 2007 Shinan Jitsuyo Jitsuyo Kokai Koho Jitsuyo Toroku Jitsuyo Koho Koho 1996 2007 1994 2007 Toroku Shinan Shinan Electronic data base consulted during the international search name of data base and where practicable search terms used BIOSIS wPIDS MEDLINE Ca STN JSTPlus JDream2 C DOCUMENTS CONSIDERED TO BE RELEVANT H et al JMEDPlu s JDream2 Citation of document with indication where appropriate of the relevant passages Mechanistic JST7 580 JDream2 Relevant to claim No diversity and of Typell p 1050 1055 Special categories of ci d documents document defining the general te ofthe a which isnot considered to be of particular relevance earlier application or patent but published on or after the international filing date document which may throw doubts on priority claim s or which is cited to establish the publication date of another citation or other special reason as specified document referring to an oral disclosure use exhibition or other means document published pror to the international fling date but later than the p7to7ty date claimed Date of the actual completion of the international search 24 Apri 1 2007 24 04 07 Name and mailing ad ess of the ISA Japanese Paten
45. ACP ACP gt NADp Ac p F p G 3 ACP FapA Fapz n Acp 4 Ac p L Fabl FabK EEEF pL ACP ACP 1ec Ac p Ac p Esc herichia coli and Ss lm onella c ellular a nd Molecular Biology 1996 612 030 Am erican Society for Microbiology Was hingto n D C Biol chem 1996 271 1833 1836 ACP WO 2007 086S83 2 PCT JP2007 051518 00 0006 0005 000 KBB Esc hericnia coli Staphylococcus aur
46. AL RE WO 2007 0 65 GD 21 22 25 26 30 71 72 75 12 f 19 43 2007 8 2 02 08 2007 C07K 1 00 2006 01 CI2N 9 02 2006 01 C12N 15 08 2006 01 GOIN 23 20 2006 01 PCT JP2007 051518 2007 1 30 30 01 2007 AX 4 f82006 021384 2006 1 30 30 01 2006 lt MEUI SEIKA KAISHA LTD JP JP T 1048002 4 16 Tokyo JP 7 FE SAITO Jun JP JP 2228367 JP 74 81 og ANNAN HUA 01 AOA DON DA HL NL N 10 WO 2007 086583 A1 7 6 0 Kanagawa JP jm YAMADA Mototsugu JP JP 2228567 7 6 0 Kanagawa JP it A BR 4 YOSHITAKE Kenjiet al T 1000005 2 3
47. L TUT FabK a 2 2 4 MPD MES PHS 5 7 0 WO 2007 086583 7 PCT JP2007 051518 Lows 0 amp 7 00s 1 8 15
48. QOmM P HH7 5 15 OnM 1mM 1mM 1mM Hiload16 6 0 Superdex75 pre p gradle 1mL min SD S PAGE 10mM PH7 5 100mM 1mM 10mg mL 5mmM 8 0C oo 0 4 FahK 1 4 C FabK pET 21b 2
49. eus ACP F bI Fa J Biol chom 1995 27 026538 20542 ACp FabI F bl NAD F pI F p1 F bI NAD Nature 1998 394 531 532 J Biol Chem 1998 273 3 ie 302 0 Nature
50. ion where appropriate of the relevant passages Relevant to claim No A Payne D J et al Discovery of a novel and potent class ofFabl directed antibacterial agents Antimicrobial Agents andChemotherapy 2002 Vol 46 No 10 p 3118 3124 Stewart M J et al Structural basis and mechanism of enoylreductase inhibition by triclosan J MoI Biol 1999 Vol 290 No 4 p 859 865 Oliveira J S et al Crystallographic and pre steady statekinetics studies on binding of NADH to wild type andisoniazid resistant enoyl ACP CoA reductase enzymes from Mycobacterium tuberculosis J Mol Biol 2006 06 Vol 359 No 3 p 646 666 Saito J et al Crystal structure of Streptococcus pneumoniaeenoyl acyl carrier protein reductase FabK Seikagaku 2006 06 Shoroku CD Page A12389 4P B 028 Form PCT ISA 210 continuation of second sheet April 2005 PCT JP2007 05S1518 A H IPC Int Cl CO7K1 00 2006 01 i C12N9 02 2006 01 i C12N15 09 2006 01 i GO1N23 20 2006 01 n i PC Int Cl C07K1 00 C12N9 02 C12N15 09 GO1N23 20 o 922 1996 971 2007 996 20
51. it 1 1 0 1 FabK Mutant F P 5 GGGATAATCGTTATTCCTGTCGTTCCTA GTG 3 8 FabK Mutant R P 5 CACTAGGAACGACAGGAATAACGATTA TCCC 3 9 WO 2007 086S83 16 PCT JP2007 051518 001s 009 0G d A141s His Fab A14 1s Fab DNA DNA 4 BL21 DE3 7 FanK 1 8 15 9 1000 s 15 2 2 4 MpD 0 1M
52. t Office Facsi rule No Form PCT ISA 210 second sheet April 2005 Y Marrakchi regulation Biochemical Vol 30 No 6 Y JP 2005 058223 A Riken Japan 10 March 2005 10 03 05 Family none Y WO 2003 066677 Al Japan Science and Technology Agency 14 August 2003 14 08 03 amp AU 2002 338064 Al amp CA 2476006 Al amp EP 1479693 Al amp US 2007 032637 Further documents are listed in the contmuation of Box C fatty acid synthesis Society Transactions 2002 See patent mmily annex later document published after the international filing date or ptomty date and not in conflict with the application but cited to understand the p7nciple or theory underlying the invention X document of particular relevance the claimed invention cannot be considered novel or cannot be considered to involve an inventive step when the document is taken alone document of particular relevance the claimed invention cannot be considered to involve an inventive step when the document is combined with one or more other such documents such combination being obvious to a person skilled in the art document member of the same patent family Date of mailing of the international search report 01 May 2007 01 05 07 Authorized officer Tele phone No INTERNATIONAL SEARCH REPORT International application No PCT JP2007 051518 C Continuation DOCUMENTS CONSIDERED TO BE RELEVANT Citation of document with indicat

Download Pdf Manuals

image

Related Search

Related Contents

INSTALLATION  LG 42PJ350 Chassis PD  KitchenAid KSEG950ESS Use and Care Manual  BaByliss MS21E hair stylers    Toro ProCore Processor (09749) Specifications  Digital Terrestrial Receiver High Definition Power Plus HD2000  

Copyright © All rights reserved.
Failed to retrieve file