Home

Title シアノバクテリア概日時計におけるKaiタンパク質間相互 作用動態の

image

Contents

1. Kai Kai Kai Kai Golden et al 1997 Rensing et al 2002
2. TKai KaiB 12 16 20 24 28 32 50 C 30 KaiB
3. 61 1996 1999 2000 2002 62 THE JOURNAL OF BIOLOGICAL CHEMISTRY ik amp Bioscience Biot
4. jp H EA TOA
5. Kai
6. Kai Tvlena et al 2006 Kim et al 2012 Kai SasA CikA Iwasaki et al 2000 Kato et al 2012 Takai et al 2006 AXE Kai
7. kai 3 kai4 kaiB kaiC Hshiura et aL 1998 3 kai 1 kai eta 3 gz r az4 za7 ra7C r az az7C kaiA
8. HY5 HY5 Hardtke et al 2000 1 1 Millar et al 1992
9. 4 TAMRA X aminophenylalanine KI 8A 4 kDa KaiB 39 GFP Schmid et al 2005 GFP CH 28 kDa
10. Nakajima et al 2005 Mori et al 2007 Yoshida et al 2009 Kai 3 Ito et al 2007 Mori et al 2007 Rust et al 2011 Terauchi et al 2007 Yoshida et al 2009 Kai Kai 1 KaiC ATPase Terauchi e al 2007 KaiC KaiB 1 KaiA 3 15 ATP 1 ATPase
11. X Y XY X D MF20 e Ratio of phosphorylated KaiC Yt TAMRA L KaiBORF 9 translation KaB His 4 4 gt 16 102 20 the number of amino acid residues tag E o gt oo gt D o iN bo Incubation time h D Size kDa Labeled KaiB 3 KaiB A 4 TAMRA KaiB His TAMRA KaiB His NN 16 9 TAMRA X aminophenylalanine KaiB 102 C 20 B SDS PAGE TAMRA KaiB His
12. kai Kondo ez al 1993 Ishiura et al 1998 Tomita et al 2005 2000 lchikawa et al 2003 Yamamoto et aZ 2003 Kai 2 KaiB Kai 3
13. Golden et al 1997 Rensing et al 2002 Kai KaiC Mori et al 2007 Yoshida et al 2009 ADP ATP ATP ADP Rust ATP ADP Kai KaiC ADP Kait 14 ATP Rust et al 2011 ATP ADP
14. 20 9 23 8 E 9B 26 6 LC 28 20 Kai KaiB 29 3 Kai a ATP
15. ATP ADP KaiB 2 1 KaiB 1 2A
16. 2 circadian time Spoelstra et al 2004 2 4 S ORF t vs CO ws t t de x 24 vs mod24 t ws ADP Phase shift vs T Vscont T 8cont ADP 7 S ADP D 12
17. Kai 15 za7 45 AVE Ch Ishiura et al 1998 kai Kondo et al 1994 Kai Kai Kai Kai TAN ARIE
18. Kai b KaiB 20 7 10 13 30 52 2 92 2 2 Bd 7C Ed 9A
19. MEDHAR SB SS SOLERE KaiB Kai Ee 38 FREYA B2B yi v V 6i348 HH S v5 RR S ig UT AlbkAMRV BHBEIAWECRO4 0 U EKdBUOCECekTH 1 1 nM KaiB TAMRA KaiB Hise Kai Kai kaiAdag kaiB Hise
20. 1 Grobbelaar Mitsui Synechococcus 2 Grobbelaar et al 1986 Mitsui et al 1986 Synechococcus elongatus PCC 7942 Synechococcus elongatus PCC 7942 Golden et al 1997 Johnson et al 2011 1993 TI
21. 1 2 30 50 pl 15 10 18 6 MF20 1 2 gt GI 0 10 OERE OMEGA LICLS MSS
22. 7 20 28 7C E 20 2 28 2 12 16 28 f amp 24 32 7A4 B D F 8
23. 9 4 AD 2 2 2 2 HED BED Fe 1 6 Meseth ez al 1999 Stokes Einstein 3 2 4 1 SDS PAGE KaiB 25 kDa 500 kDa 7 lt Kageyama et al 2006 20 2 9 4
24. Panda et al 2002 3 Johnson et aZ 2004 1 2 8 4 3 1986
25. BRE SDS PAGE P KaiC RE SDS PAGE PPI RE BN PAGE SDS PAGE PPI RE IP SDS PAGE PPI RE EHE SAXS JRE X PPI JERE Trp KaiC GRRE ATP ADP ATPase RE HPLC 1 Kai Kai KaiC KaiC KaiC ATPase BN PAGE Native PAGE 1 amp IP SAXS X Trp
26. 34 V h us h A 19 6 68 0 7 9 ay panik B 19 9 77 3 9 0 12 ADP 16 2 80 0 3 0 16 ADP 15 9 69 0 3 9 20 ADP 16 0 71 7 4 7 24 ADP 16 8 78 6 8 7 28 ADP 16 6 82 4 1 7 32 ADP 16 2 88 5 0 1 2 ADP KaiB 12 ADP A B 35
27. Stoevesandt et al 2005 Hel oO ER fh 46 47 Abe T Goda K Futami K and Furuichi Y 2009 Detection of siRNA administered to cells and animals by using a fluorescence intensity distribution analysis polarization system Nucleic Acids Res 37 e56 Hagiwara S Goda K Matsuo I and Ito Y 2007 Analysis of ER associated glycoprotein degradation using synthetic glycopeptide probes Biochem Biophys Res Commun 360 3271 354 Hardtke C S Gohda K Osterlund M T Oyama T Okada K and Deng X W 2000 HY5 stability and activity in Arabidopsis is regula
28. Kageyama et g RO Kai Native PAGE 1 10 X Kai Akiyama et al 2008 Murayama et al 2011
29. Stokes Einstein 3 E Krouglova et al 2004 Watabe et 12 al 2011 X 2C XX Y XX
30. 1 nM TAMRA KaiB Hise 3 5 uM KaiB 30 ul 2 5 4A 450 us 510 us 1 nM TAMRA KaiB Hise 3 5 uM KaiB 3 5 uM KaiC 4C 24 575 7 11 6 us KaiB TAMRA KaiB Hise KaiC 7 5
31. gz KaiC ATPase ATP KaiA KaiB KaiC ATPase Kai KaiC ATPase KaiC 1 Kai Kait Kai
32. Nishiwaki et al 2007 Kai Kai Kai KaiC Nakajima et al 2005 KaiB KaiC KaiC GANA STE HR 4 I WwW pun
33. 1 DIA Yoshida et al 2009 x 8 x 14A 45 C 4 50 C 30
34. 1 nM TAMRA KaiB Hise 3500 KaiB KaiC 3C 1 nM TAMRA KaiB Hise Kai b KaiB Kai Kai KaiB KaiC 884 A MF20 TAMRA KaiB Hiss KaiB KaiC
35. 1 2 Chowdhury 20011 Hori et al 2003 1 le 0 7 r Po E 2 6 yt B i Pup a pest gu t i T e T free CT free T complex C T complex c 19 IDEST idak DA L1 Gy WENG RTH cO Td or x Tree omplex
36. KaiB KaiC DF KaiB 10 ATP 1 mM ATP 8 486 4 9 5 us 726 9 33 us 10A 24 48 570 ps KaiC KaiB 30 8 4 mM ATP 499 3 12 us 7 2
37. KIZ Kai TAMRA KaiB Hiss 500 us 2 55 900 us 22 D 4D KaiC 5 X 4E KaiB KaiB KaiC KaiA KaiB KaiC 25 KaiC 4 6 Kageyama et al 2006 KaiB
38. Kai KaiC ATPase 8 Kai KaiB KaiC Kai Native PAGE Kai T Kai
39. Kageyama et al 2006 KaiB KaiC Kageyama et al 2006 E 1 KaiB Kail KaiC KaiC KaiC Kageyama et al 2006 Ito et al 2007 Kai Kai 2006 Ito e aZ 2007 KaiC Kai
40. RTS 100 Z coli HY kit Roche diagnostics Kit 30 C 2 His Spin Trap Column GE Healthcare 16 KaiB 4 PD 10 GE Healthcare Tris 20 mM Tris HCl pH8 0 0 5 mM EDTA 100 mM NaCl KaiB Krichevsky and Bonnet 2002 3 SDS PAGE KaiB SDS PAGE 10 20 PAGEL NPG R1020L Atto TAMRA KaiB
41. X 2A NIL FA ap 1 nM 1 0 6 1 2B 2C
42. 18 4 mM ATP 20 1 8 mM ATP 13 8 ADP ATP b Kai ADP Kai ATP ADP KaiC Rust et al 2011 ATP ADP KaiB Kait 4 mM ATP ADP 4 m
43. KaiB Synechococcus elongatus PCC 7942 kaiB pROX FL Nadel Wo Ishiura et al 1998 Abe et al 2010 pROX FL In vitro Pin point Fluorescence Labeling Kit 543 N TAMRA X aminophenylalanine 4 6 tetramethylrhodamine 5 and 6 carboxamido hexanol amino phenyl alanimne C N ATGTCTAAACAAATCGAAGTAAACCGGGTCTAATGAG DNA Xi CGGG 4 TAMRA tRNA TAMRA X aminophenylalanyl tRNAccce CGGG CGG 3 TAMRA tRNA
44. X Y XY XX X XY Ald IH KHERDI ROR U lt Ule B UC VO S BOLD FICS SAIC EE LE 2C MF20 X 2D SNP genotyping
45. Kai 36 KaiB KaiC 1 KaiB Kail 1 Kai
46. PEHK ETE OH 12D E KaiB ADP 32 ADP 1 12F KaiB Kai ADP YS KaiB ATP ADP c ADP KaiB 33 ATP ADP KaiB
47. 10 Diff Time us D gt 0 24 72 s9 Q u Diff Time D e e 0 24 12 us Diff Time 0 24 48 Incubation time h 72 Diff Time us td 0 24 12 s u Diff Time o us xj Diff Time e aN 0 l 0 24 48 72 Incubation time h 12 Kai KaiB KaiC ADP Kai 12 A 16 B 20 C 24 D 28 E 32 F ADP ADP KaiB ADP ADP ST
48. TAMRA TYyphoon 9400 gel imaging system GE Healthcare 532 nm 580BP30 Prestained XL ladder Broad APRO KaiC SDS PAGE N N 0 67 11 Nishiwaki ez al 2007 EPL156DA Advantec NA 1012L Quick CBB PLUS GS 800 BioRad ImageJ 1 33v National Institute of Health 17 4 Kai KaiA KaiB KaiC
49. 23 2 Kai 27 3 Kai 30 36 E NE NE NAN EA E E IEEE EE TET 48 49 SUBE ae aps dati turbant bd hatten bassin tud 61 25 Synechococcus elongatus PCC 7942 kaiA kaiDB kaiC 0 3 KaiA KaiB KaiC BL ATP KaiC Kai
50. KaiB KaiC KaiB 2 D te LI BGK KaiB KaiC 5 Kai 1
51. KaiB 482 5 16 6 us 2 zomplex 1243 0 256 9 us T y 23 35 2 13 8 X 64 8 13 8 2 1243 0 us Stokes Einstein 1309 7 us i 2 3 KaiB Kageyama et al 2006 26 KaiB KaiB
52. 45 C 4 Yoshida ez al 2009 50 C 30 8 Circadian Time 16 KaiC B Kai KaiC KaiC KaiB
53. 753 5 20 5 us 24 24 4 650 us KaiC TAMRA KaiB Hiss 7 5 16 5 TAMRA KaiB Hiss KaiC KaiB KaiC Kageyama et al 2006 KaiA KaiB ali 4B TAMRA KaiB Hiss 7 KaiB KaiC
54. al KURENAI it i D D UO DL U LU UU Te Jooggogag Author s Citation Kyoto University 7 0 Issue Date 2015 03 23 URL http hdl handle net 2433 198932 THEJOURNAL OF BIOLOGICAL CHEMISTRYH D Bioscience Biotechnology and Biochemistry O hn DD a 20 d B ELE LU CL ELLE ET U O000000000 C Thisresearch was originally published in THE JOURNAL OF BIOLOGICAL CHEMISTRY Kazuhito Goda Hiroshi Ito Takao Kondo and Tokitaka Oyama Fluorescence correlation spectroscopy to monitor Kai protein based circadian oscillations in real time Right THE JOURNAL OF BIOLOGICAL CHEMISTRY 2012 287 3241 3248 c the American Society for Biochemistry and Molecular Biology Effects of adenylates on the circadian interaction of KaB with the KaiC complex in the reconstituted cyanobacterial Kai protein oscillator Kazuhito Goda Takao Kondo and Tokitaka Oyama Bioscience Biotechnology and Biochemistry 2014 78 1833 1838 http www tandfonline conydoi full 10 1080 09168451 2 014 940833 Type Thesis or Dissertation Textversion ETD Kyoto University Kai SUE obo t mn ix ai ed gu sa encased ade RNN 2 FEBR eo ned CN 4 AT E T Tm 16 PHP 23
55. ADP ADP Kai Kai 44 ADP KaiC 7 737 BO _ mt gt Seats Kai Kai 7
56. Kageyama et al 2006 KaiB Kai CHB ISTE bok IE CS KaiC 3C Kai Kai 3500 FO KaiB 2 Kai KaiB
57. KaiB Kai A B Sample 30ul Confocal volume Objective lens Ifl 40 x 1 15 i MP gt Dichroic Mirror Large molecules move slow 0008 Pinhole Digital Small molecules move fast Correlator C D GD v CD Autocorrelation Lag time 2 A MF20 543 nm He Ne 1f B C
58. ADP Kai 43 ATP ADP 11 ATP ADP KaiC Rust ez al 2011 Kai ADP 12 ADP ADP
59. KaiB KaiB KaiB 25 kDa 500 kDa Kageyama et al 2006 KaiB KaiB Kai 5 KaiB KaiB 1
60. KaiB 1 ce 4 3 0 3 Tree 482 5 16 6 us KIZ 2 romplex 1243 0 256 9 us 20 z piex 2 5B 7 rus 50 C 30 O I 8 50 mM ATP ADP 12
61. D 2 w 4D ew c Tp Gy D Stokes Einstein p T 6Z7 7 7 kg T n r 2 r 3 3 2 Kai 1 9 4 4D
62. kazPC 3 gz lshiura et g 1998 3 gz 6 gz4 za7 z7C 284 102 519 KaiA N RS 2 Ye ez al 2004 KaiB 2 4 Hitomi et al 2005 Iwase et al 2005 KaiC 6
63. 2 10 20 TAMRA Typhoon 9400 system GE Healthcare C KaiB Kai KaiC TAMRA KaiB His 30 C 60 4 SDS PAGE KaiC TAMRA KaiB His KaiC KaiC 120 120 Ss Ss Oo Oo o o N 5 Nd t t EE EE E E oO oO lt 5 d d H H lt lt N N o o c e o e e e e e e Ratio of phosphorylated KaiC D E GO E FQ si eun a A srl oun td Son ot A o o o o 3 2 d SS o o oo z E 7B s Ae d ES amp ag eo o RS Cae EE EE oo 8 oo 8 E 5 YS as o o N g g a H CN N D oS on o oF X S AQ E WE E lt q sU oun HIT O sn atun
64. 2 ATP Hayashi et al 2003 Mori et al 2002 Nishiwaki et al 2000 Xu et al 2003 KaiB KaiC KaiC Iwasaki et al 2002 Kitayama et al 2003 Xu et al 2000 X 1 KaiC Ser 481 Thr 482 2 Ala kaiPC Nishiwaki ez al 2004 KaiC Kail KaiA Iwasaki et al 2002 KaiB KaiA KaiC Iwas
65. KaiC Kai ATP ADP SasA CikA SasA RpaA RpaB LabA KaiC KaiB 15 Kai Kai KaiC Kai
66. KaiC ATPase ATP KaiB Kail 10 ADP Ed 11 ADP KaiC ATP ADP ATP ADP ADP ATP KaiC ADP KaiC ATP Egli et al 2012 Nishiwaki et al 2012 Nishiwaki Ohkawa et al 2014
67. psbAl Kondo et al 1993 ps 47 Kondo ez al 1993 5 3
68. Kai Mori etal 2007 Yoshida et al 2009 Johnson 40 et al 2004 Kai 7 Yoshida ez al 2009 KaiB Kail X 8 KaiC KaiC
69. Ed 15 By BB A eS Kai KaiB Kai Liu et al 1995 Nakahira et al 2004 SasA RpaA RpaB LabA Hanaoka et al 2012 Takai et al 2006 Taniguchi e al 2007 Kai 8 Kai ATP
70. KaiC KaiB KaiC KaiB 9 ATPase KaiC KaiB Kait KaiC Kai
71. Tomita et al 2005 kal KaiC KaiC KaiA KaiB KaiC 3 ATP KaiC Nakajima et al 2005 1 3 Kai Kai 8
72. Kai BR ATP ADP KaiB KaiC Kai Kai KaiC 15 1 KaiA KaiB KaiC KaiA KaiB KaiC Nakajima et al 2005 2 KaiB
73. 10 gt 800 Diff Time us e 0 24 48 72 Incubation time h Phase shift h owe O fF t w 0 6 12 18 24 Circadian time 13 ADP A 16 ADP KaiB 12B B ADP gt 4 is un d N Ke v A 6 12 18 0 6 12 Circadian Time KaiC KaiC KaiC KaiB 14 A Kai
74. 2 gt 2800 Qo E ij 600 400 0 24 48 72 96 Incubation time h B Diff Time us 16 20 24 28 Incubation time h 9 A 20 92 20 52 2 20 27 10 27 40 30 B A 22 A B d 5800 Qo Qo a 1 600 eH QG RE a a 400 0 24 48 72 0 24 48 72 Incubation time h Incubation time h C D d 5800
75. 4 TAMRA X aminophenylalanyl tRNA SDS PAGE TAMRA 15 kDa _ TAMRA KaiB Hise 15 8 kDa X 3B TAMRA KaiB Hise Kai 1 2 uM KaiA 23 3 5 uM KaiB 3 5 uM Kai 1 mM ATP 30 C 60 KaiC 22 3C AL Nakajima et al 2005 TAMRA KaiB Hise 1 nM
76. 11 12 2 Rust ATP ADP Kai ATP ADP Rust KaiC ATP Kai ADP
77. CT7 10 Kai CT7 10 14B Lin etal 1999 Yoshida et al 2009 Kai OCT7 10 KaiB KaiC 41 KaiC 1 14B KaiB KaiC KaiC
78. Nakajima et al 2005 MF20 2D 28 C 28 C 5 g WAN EC A F MF20 ER Bi PH 80 C 2D 543 nm He Ne 384 7 100 pW Bg 100 pm 2A 1 HQ 590 60 Chroma Technology
79. 1 2 1 mM ATP Kai Kai ATP KaiB 4 mM ATP 8 mM ATP ATP KaiB ADP 11 ATP ADP 3 3 ATP ADP 4 mM ATP 8 mM 3l ATP 4 mM ATP 4 mM ADP 4 mM ATP 4 mM ADP KaiB Kait
80. 28 C 10 JUS E ATP ADP ADP 4 mM 9 ATP ADP LL P d KaiB Diff Time yO Amplitude x sin 2n x t Q D y0 21 Origin 8J OriginLab
81. Kai Kai KaiC FF Bi 1
82. Kai KaiB ATP ADP Rust et al 2011 ATP ADP KaiB KaiB KaiB ATP ATP 1 mM 4 mM 8 mM 10 mM Kai MF20 1 72 KaiB 1
83. KaiC ATPase HE HPLC ADP Terauchi et al 2007 X 1 KaiC Murayama et al 2011 X 1 Kai Kai 9 Kai 8 Kai KaiC Kageyama et al 2003 Kageyama et al 2006 XI 1 KaiA 1 95 KaiA BE Kail eT Kait
84. KaiB K 2 ADP ADP 12 72 24 72 2 19 9 ADP 19 6 15 9 16 8 Time 0 24 12 ADP C
85. Comas etal 2006 KaiC ATP ADP Kai Rust ez al 2011 ATP ADP KaiB KaiC ATP KaiC
86. Qo Qo 2 z 1 600 A a 400 400 0 24 48 72 24 48 72 Incubation time h Incubation time h 10 ATP KaiB KaiC ATP Kai KaiB ATP A 1 mM B 4 mM C 8 mM D 10 mM 10 800 Diff Time us 0 24 48 72 Incubation time h 11 Kai KaiB KaiC ATP ADP ATP ADP Kai KaiB 4 mM ATP 8 mM ATP 4 mM ATP 4 mM ADP KaiB
87. SIRNA Abe et al 2009 Hagiwara et al 2007 Bannai et al 2004 Kobayashi et al 2008 Kai fig TAH AL KAB JENE MAUNE Kai 4 YANI EHE BERE BC Kai KaiB KaiC KaiB Kail 13 KaiC Kai KaiC KaiB
88. AT Kai 5 10 ATP ADP ADP x
89. 12 22 1 KaiB KaiC a KaiB KaiB Ed 3A Abe ez al 2010 Hohsaka et al 2002 Nakata et al 2009 1 KaiB DNA 5 4 5 CGGG 3 3 iss Abe et al 2010 KaiB TAMRA X aminophenylalanine
90. AD DEMIE P X 12 KaiB 12 ADP 22 12A 16 ADP 20 20 ADP j E LEE A x KaiC 737 PG Hom X 12B 1 12C 24 ADP 28 ADP
91. P KaiC KaiC PPI Kai 11 Krichevsky et al 2002 Piehler et al 2005 Yan et a1 2003 1 Fluorescence Correlation Spectroscopy FCS 2 Chowdhury 2011 Krichevsky et al 2002 10150
92. 1 4 4E Circadian Time CT16 KaiC X 14A ali aH 2004 Johnson et al AS
93. 50 interface for intermolecular interactions and its impact on the circadian rhythm J Biol Chem 280 19127 19135 Hohsaka T and Sisido M 2002 Incorporation of non natural amino acids into proteins Curr Opin Chem Biol 6 809 815 Hori K Shin W S Hemmi C Toyo oka T and Makino T 2003 High fidelity SNP genotyping using sequence specific primer elongation and fluorescence correlation spectroscopy Curr Pharm Biotechnol 4 477 484 Ishiura M Kutsuna S Aoki S Iwasaki H Andersson C R Tanabe A Golden S S Johnson C H and Kondo T 1998 Expression of a gene cluster kaiA BC as a circadian feedback process in cyanobacteria Science 281 1519 1523 Ito H Kageyama H Mutsuda M Nakajima M Oyama T and Kondo T 2007 Autonomous synchronization of the circadian KaiC phosphorylation rhythm Nat Struct Mol Biol 14 1084 1088 Ivleva N B Gao T LiWang A C and Golden S S 2006 Quinone sensing by the circadian input kinase of the cyanobacterial circadian clock Proc Natl Acad Sci U S A 103 17468 17473 Iwasaki H Nishiwaki T Kitayama Y Nakajima M and Kondo T 51 2002 KaiA stimulated KaiC phosphorylation in circadian timing loops in cyanobacteria Proc Natl Acad Sci U S A 99 15788 15793 Iwasaki H Williams S B Kitayama Y Ishiura M Golden S S and Kondo T 2000 A KaiC interacting sensory histidine kinase SasA
94. 746 8 19 7 us 24 10B 8 mM ATP 10C 4 mM 10 mM ATP 6 531 12 2 us 792 9 20 7 us 10D 14 58 670 us 1mM ATP 1 mM ATP 2 ATP KaiB KaiC
95. Beersma D G M Spoelstra K and Daan S 2006 Phase and period responses of the circadian system of mice Mus Musculus to light stimuli of different duration J Biol Rhythms 21 362 372 Egli M Mori T Pattanayek R Xu Y Qin X and Johnson C H 2012 49 Dephosphorylation of the core clock protein KaiC in the cyanobacterial KaiABC circadian oscillator proceeds via an ATP synthase mechanism Biochemistry 51 1547 1558 Golden S S Ishiura M Johnson C H and Kondo T 1997 Cyanobacterial circadian rhythms Annu Rev Plant Physiol Plant Mol Biol 48 327 354 Grobbelaar N Huang T C Lin H Y and Chow T J 1986 Dinitrogen fixing endogenous rhythm in Synechococcus RF 1 FEMS Microbiol Lett 37 173 177 Hanaoka M Takai N Hosokawa N Fujiwara M Akimoto Y Kobori N Iwasaki H Kondo T and Tanaka K 2012 RpaB another response regulator operating circadian clock dependent transcriptional regulation in Synechococcus elongatus PCC 7942 J Biol Chem 287 26321 26327 Hayashi F Suzuki H Iwase R Uzumaki T Miyake A Shen J R Imada K Furukawa Y Yonekura K Namba K and Ishiura M 2003 ATP induced hexameric ring structure of the cyanobacterial circadian clock protein KaiC Genes Cells 8 287 296 Hitomi K Oyama T Han S Arvai A S and Getzoff E D 2005 Tetrameric architecture of the circadian clock protein KaiB A novel
96. 1999 Priority of light dark entrainment over temperature in setting the circadian rhythms of the prokaryote Synechococcus RF 1 Planta 209 202 206 Liu Y Tsinoremas N F Johnson C H Lebedeva N V Golden S S Ishiura M and Kondo T 1995 Circadian orchestration of gene expression in cyanobacteria Genes Dev 9 1469 1478 54 Meseth U Wohland T Rigler R and Vogel H 1999 Resolution of fluorescence correlation measurements Biophys J 16 1619 1631 Millar A J Short S R Chua N H and Kay S A 1992 A novel circadian phenotype based on firefly luciferase expression in transgenic plants Plant Cell 4 1075 1087 Mitsui A Kumazawa S Takahashi A Ikemoto H Cao S and Arai T 1986 Strategy by which nitrogen fixing unicellular cyanobacteria grow photoautotrophically Nature 323 720 722 Mon T Saveliev S V Xu Y Stafford W F Cox M M Inman R B and Johnson C H 2002 Circadian clock protein KaiC forms ATP dependent hexameric rings and binds DNA Proc Natl Acad Sci USA 99 17203 17208 Mori T Williams D R Byrne M O Qin X Egli M Mchaourab H S Stewart P L and Johnson C H 2007 Elucidating the ticking of an in vitro circadian clockwork PLoS Biol 5 e93 Murayama Y Mukaiyama A Imai K Onoue Y Tsunoda A Nohara A Ishida T Maeda Y Terauchi K Kondo T and Akiyama S 2011 Tracking and visualizin
97. 4D A B 1 1000 o 800 E E E td 600 a 400 0 24 48 72 96 0 24 48 72 96 Incubation time Incubation time h C h D 1000 1000 Qo B 800 E 800 5 E t 600 id 600 a 1 a 8 400 400 0 24 48 72 96 0 24 48 72 96 Incubation time h Incubation time h E h 1000 ud o 800 E td 600 a 400 0 24 46 72 96 Incubation time h 6 TAMRA KaiB His Kai 2 4 15 5 A 15 10 B 15 20 C 15 50 D 15 100 E A B E E oO 4 g800 4 2800 E ve A600 6001 400 T 0 24 48 72 96 Incubation time h Incubation time h D Diff Time us Oo Diff Time 600 60014 400 400 24 48 72 0 24 48 72 96 Incubation time h Incubation time h E F LS 2800 2800 ed 3 F600 600 4
98. 6 2 Kai a Kai Golden et al 1997 27 Johnson et al 2004 Mori et al 2007 Rensing et al 2002 Yoshida et al 2009 Kai KaiB
99. ECS UE 2 KaiB Tfree Tcomplex LORI 60 10 Bd 5B 15 10 15 100 92 18
100. necessary to sustain robust circadian oscillation in cyanobacteria Ce 101 223 233 Iwase R Imada K Hayashi F Uzumaki T Morishita M Onai K Furukawa Y Namba K and Ishiura M 2005 Functionally important substructures of circadian clock protein KaiB in a unique tetramer complex J Biol Chem 280 43141 43149 Johnson C H Elliott J Foster R Honma K and Kronauer R 2004 Fundamental properties of circadian rhythms in Biological Timekeeping Dunlap J C Loros J J and DeCoursey P J eds pp 67 105 Sinauer Associates Sunderland MA Johnson C H Stewart P L and Egli M 2011 The cyanobacterial circadian system from biophysics to bioevolution Annu Rev Biophys 40 143 167 Kageyama H Kondo T and Iwasaki H 2003 Circadian formation of clock protein complexes by KaiA KaiB KaiC and SasA in cyanobacteria J 52 Biol Chem 218 2388 2395 Kageyama H Nishiwaki T Nakajima M Iwasaki H Oyama T and Kondo T 2006 Cyanobacterial circadian pacemaker Kai protein complex dynamics in the KaiC phosphorylation cycle in vitro Mol Cell 23 161 171 Kato H Watanabe S Nimura Matsune K Chibazakura T Tozawa Y and Yoshikawa H 2012 Exploration of a possible partnership among orphan two component system proteins in cyanobacterium Synechococcus elongatus PCC 7942 Biosci Biotechnol Biochem 76 1484 1491 Kim Y I Vinyard D J Anan
101. 00 400 0 24 48 72 96 0 24 48 72 96 Incubation time h Incubation time h 7 Kai 50 C 30 12 A 16 B 20 C 24 D 28 E 32 F 10 A B C D E F Phase shift h N 12 20 28 36 Incubation time h 8 Kai 20 28 2
102. C 6 37 5 10 9 3 2 KaB KaiC 5B 60 2 3
103. Hid FA er oun Ja 4 Kai A D 5 TAMRA KaiB His A TAMRA KaiB His 3 5 uM KaiB B TAMRA KaiB His 1 2 uM KaiA 3 5 nM KaiB C TAMRA KaiB His 3 5 uM KaiB 3 5 uM KaiC D TAMRA KaiB His 1 2 uM KaiA 3 5 uM KaiB 3 5 uM KaiC E TAMRA KaiB His KaiC KaiC Kai TAMRA KaiB His 2 2 10 soil GB Lesen cena 10 10 10 1 10 10 10 time msg cJ o o o bo AN Ratio of the complex 24 48 72 96 120 Incubatio
104. M 12 16 20 24 28 32 12 RE 12 32 KaiB 1 12 32 KaiB Kait 16 20 KaiB KaiC 32 24 28 KaiB 27778 E Kail
105. Opin Chem Biol 7 635 640 Ye S Vakonakis I Ioerger T R LiWang A C and Sacchettini J C 2004 Crystal structure of circadian clock protein KaiA from Synechococcus elongatus J Biol Chem 279 20511 20518 59 Yoshida T Murayama Y Ito H Kageyama H and Kondo T 2009 Nonparametric entrainment of the zn vi ro circadian phosphorylation rhythm of cyanobacterial KaiC by temperature cycle Proc Natl Acad Sci U S A 106 1648 1653 Watabe S Sakamoto Y Morikawa M Okada R Miura T and Ito E 2011 Highly sensitive determination of hydrogen peroxide and glucose by fluorescence correlation spectroscopy PLoS ONE 6 e22955 60 18
106. aki et al 2002 Kitayama et al 2003 KaiC Kai Kageyama et al 2003 1 amp 400 600 kDa KaiC Kai Nishiwaki et al 2004 1 3 Kai KaiC 2 2005 KaiC
107. echnology and 7oe ez7275 2 This research was originally published in THE JOURNAL OF BIOLOGICAL CHEMISTRY Kazuhito Goda Hiroshi Ito Takao Kondo and Tokitaka Oyama Fluorescence correlation spectroscopy to monitor Kai protein based circadian oscillations in real time THE JOURNAL OF BIOLOGICAL CHEMISTRY 2012 287 3241 3248 the American Society for Biochemistry and Molecular Biology Effects of adenylates on the circadian interaction of KaiB with the KaiC complex in the reconstituted cyanobacterial Kai protein oscillator Kazuhito Goda Takao Kondo and Tokitaka Oyama Bioscience Biotechnology and Biochemistry 2014 78 1833 1838 http www tandfonline com doi full 10 1080 09168451 2014 94 0833 63 KaiC KaiC KaiC KaiB 1 Kai Kai Kai KaiC KaiC KaiC
108. g the circadian ticking of the cyanobacterial clock 55 protein KaiC in solution EMBO J 30 68 78 Nakahira Y Katayama M Miyashita H Kutsuna S Iwasaki H Oyama T and Kondo T 2004 Global gene repression by KaiC as a master process of prokaryotic circadian system Proc Natl Acad Sci U S A 101 881 885 Nakajima M Imai K Ito H Nishiwaki T Murayama Y Iwasaki H Oyama T and Kondo T 2005 Reconstitution of circadian oscillation of cyanobacterial KaiC phosphorylation in vitro Science 308 414 415 Nakata H Ohtsuki T and Sisido M 2009 A protease inhibitor discovery method using fluorescence correlation spectroscopy with position specific labeled protein substrates Anal Biochem 390 121 125 Nishiwaki T Iwasaki H Ishiura M and Kondo T 2000 Nucleotide binding and autophosphorylation of the clock protein KaiC as a circadian timing process of cyanobacteria Proc Natl Acad Sci US A 97 495 499 Nishiwaki T Satomi Y Nakajima M Lee C Kiyohara R Kageyama H Kitayama Y Teramoto M Yamaguchi A Hijikata A Go M Iwasaki H Takao T and Kondo T 2004 Role of KaiC phosphorylation in the circadian clock system of Synechococcus elongatus PCC 7942 Proc Natl Acad Sci U S A 101 13927 13932 56 Nishiwaki T Satomi Y Kitayama Y Terauchi K Kiyohara R Takao T and Kondo T 2007 A sequential program of dual phosphorylation
109. ircadian ADP ay ho RKO mC ADP y ADP 18B 0 ADP 2 12 ADP 3 ADP 2 3 0 2 12 32 KaiB MO KaiC
110. ischer R Johnson I C and Brock R 2005 One step analysis of protein complexes in microliters of cell lysate Nat Methods 2 833 835 Takai N Nakajima M Oyama T Kito R Sugita C Sugita M Kondo T and Iwasaki H 2006 A KaiC associating SasA RpaA two component regulatory system as a major circadian timing mediator in cyanobacteria Proc Natl Acad Sci U S A 103 12109 12114 Taniguchi Y Katayama M Ito R Takai N Kondo T and Oyama T 2007 JabA a novel gene required for negative feedback regulation of the cyanobacterial circadian clock protein KaiC Genes Dev 21 60 70 58 Terauchi K Kitayama Y Nishiwaki T Miwa K Murayama Y Oyama T and Kondo T 2007 ATPase activity of KaiC determines the basic timing for circadian clock of cyanobacteria Proc Natl Acad Sci U S A 104 16377 16381 Tomita J Nakajima M Kondo T and Iwasaki H 2005 No transcription translation feedback in circadian rhythm of KaiC phosphorylation Science 307 251 254 Xu Y Mori T and Johnson C H 2000 Circadian clock protein expression in cyanobacteria rhythms and phase setting EMBO J 19 3349 3357 Xu Y Mori T and Johnson C H 2003 Cyanobacterial circadian clockwork roles of KaiA KaiB and the kaiBC promoter in regulating KaiC EMBO J 22 2117 2126 Yan Y and Marriott G 2003 Analysis of protein interactions using fluorescence technologies Curr
111. n time h 5 2 KaiC KaiB A 9 4 TAMRA KaiB His Kai TAMRA KaiB His KaiB 4A TAMRA KaiB His Kai 4D TAMRA KaiB His KaiB 1 482 5 16 6 ns TAMRA KaiB His 2 KaiC KaiB 4 482 5 us B KaiC KaiB
112. of KaiC as a basis for circadian rhythm in cyanobacteria EMBO J 26 4029 4037 Nishiwaki T and Kondo T 2012 Circadian autodephosphorylation of cyanobacterial clock protein KaiC occurs via formation of ATP as intermediate J Biol Chem 287 18030 18035 Nishiwaki Ohkawa T Kitayama Y Ochiai E and Kondo T 2014 Exchange of ADP with ATP in the CII ATPase domain promotes autophosphorylation of cyanobacterial clock protein KaiC Proc Natl Acad Sci U S A 111 4455 4460 Panda S Hogenesch J B and Kay S A 2002 Circadian rhythms from flies to human Nature 417 329 335 Piehler J 2005 New methodologies for measuring protein interactions in vivo and in vitro Curr Opin Struct Biol 15 4 14 Rensing L and Ruoff P 2002 Temperature effect on entrainment phase shifting and amplitude of circadian clocks and its molecular bases Chronobiol Int 19 807 864 57 Rust M J Golden S S and O Shea E K 2011 Light driven changes in energy metabolism directly entrain the cyanobacterial circadian oscillator Science 331 220 223 Schmid J A and Neumeier H 2005 Evolutions in science triggered by green fluorescent protein GFP Chembiochem 6 1149 1156 Spoelstra K Albrecht U van der Horst G T Brauer V and Daan S 2004 Phase responses to light pulses in mice lacking functional per or cry genes J Biol Rhythms 19 518 529 Stoevesandt O Kohler K F
113. ted by phosphorylation in its COP1 binding domain EMBO J 19 4997 5006 Ichikawa T Nakazawa M Kawashima M Muto S Gohda K Suzuki K Ishikawa A Kobayashi H Yoshizumi T Tsumoto Y lizumi H Goto Y and Matsui M 2003 Sequence database of 1172 T DNA insertion sites in Arabidopsis activation tagging lines that showed phenotypes in T1 generation Plant J 36 421 429 Yamamoto Y Y Tsuhara Y Gohda K Suzuki K and Matsui M 2003 Gene trapping of the Arabidopsis genome with a firefly luciferase reporter Plant J 35 213 283 48 Abe R Shiraga K Ebisu S Takagi H and Hohsaka T 2010 Incorporation of fluorescent non natural amino acids into N terminal tag of proteins in cell free translation and its dependence on position and neighboring codons J Biosci Bioeng 110 32 38 Akiyama S Nohara A Ito K and Maeda Y 2008 Assembly and disassembly dynamics of the cyanobacterial periodsome Mol Cell 29 703 716 Bannai M Higuchi K Akesaka T Furukawa M Yamaoka M Sato K and Tokunaga K 2004 Single nucleotide polymorphism genotyping for whole genome amplified samples using automated fluorescence correlation spectroscopy Anal Biochem 327 215 221 Chowdhury P K 2011 Fluorescence correlation spectroscopy A brief review of techniques and applications to biomolecules and biosystems J Proteins Proteomics 2 145 169 Comas M
114. yev G M Didmukes G C and Golden S S 2012 Oxidized quinones signal onset of darkness directly to the cyanobacterial circadian oscillator Proc Natl Acad Sci U S A 109 17765 17769 Kitayama Y Iwasaki H Nishiwaki T and Kondo T 2003 KaiB functions as an attenuator of KaiC phosphorylation in the cyanobacterial circadian clock system EMBO J 22 2127 2134 Kobayashi T Kodani Y Nozawa A Endo Y and Sawasaki T 2008 DNA binding profiling of human hormone nuclear receptors via fluorescence correlation spectroscopy in a cell free system FEBS Lett 582 2737 2744 53 Kondo T Tsinoremas N F Golden S S Johnson C H Kutsuna S and Ishiura M 1994 Circadian clock mutants of cyanobacteria Science 266 1233 1236 Kondo T Strayer C A Kulkarni R D Taylor W Ishiura M Golden S S and Johnson C H 1993 Circadian rhythms in prokaryotes luciferase as a reporter of circadian gene expression in cyanobacteria Proc Natl Acad Sci U S A 90 5672 5676 Krichevsky O and Bonnet G 2002 Fluorescence correlation spectroscopy the technique and its applications Rep Prog Phys 65 251 297 Krouglova T Vercammen J and Engelborghs Y 2004 Correct diffusion coefficients of proteins in fluorescence correlation spectroscopy Application to tubulin oligomers induced by Mg and paclitaxel Biophys J 87 2635 2646 Lin R F Chou H M and Huang T C

Download Pdf Manuals

image

Related Search

Related Contents

VDPL170MH17  User manual – RDM Director r11 gb  NVD mini  Uso de Sound Forge Audio Studio LE  BOSTIK AGOPLAC DI LIQUIDE  EFG 316k/ 316/ 318k/ 318/ 320  HP UPC Unified Parallel C (UPC) Programmer`s Guide  Mai 2015 - Cité du Livre  hcc: A Handel  Sterilization Cases  

Copyright © All rights reserved.
Failed to retrieve file