2004年第5版 - IEC活動推進会議
Contents
1. 000000 O20 200400 D 00 JTC1 ISO IEC Joint Technical Committee for ISO IEC 1 Information technology JWG Joint Working Group MB Member Body ISO MCR Maintenance Cycle Report MOD modified MT Maintenance Team MTG Meeting Document NC National Committee IEC NCC National Committee Comment C SMB only C SMB NCP National Committee Proposal NP New Work Item Proposal OIML Internatinal Organization of Legal Metrology PAS Publicly Available Specification Project Team PW Programme of Work PWI Preliminary Work Item Q Questionnaire QP Question of Principle SMB only SMB R Report RSMB Report to Standardization Management Board SMB RM Report on Meeting RQ Report on Questionnaire RV Report of Voting C SMB only C SMB RVC Report of Voting on CDV CDV RVD Report of Voting on FDIS or PAS FDIS PAS RVN Report of Voting on NWP NWP RVP Rep of Voting on dr2. 0 1 0 TSO PASO 1 1 622 D000 1 7 0 Fi r3 orga El HE E 0 ooo 0 oo0CgA Coco E 0 9 0 o0o0 C pp ot o00 C pp OOO m Oo ot m 00 m i D Du D O0 o nu 0 o 0 nu Sel ee EE EES EE EXE nu EB CH Du a EJ ca Du ca 0 0 amp 2 ca ca LH oO Hm CH Dip CH Dp Hm ca Oo El Bu ca CH Erd o 0p o 0p E o Um o 0p E rn ca ca o El CH m m oo o Pp oo m EE o Pp oo oC m CH CH GE o Pp oo I 3 CH CH AS o CH a Zeen m CH Elder eer oF Ooo O CES ow on Sea See 6 H gan ET um 599 ug On GSS mm Oo 605 ag Os Mon oS aa CDD p mes pan mg 00 pon gan ag mm poo Do Se oo Es oo Orr O O oo Boo gi oc ooo oo oo ooo oo b 19 9 1 11 O20 200400
3. should not itis not recommended that ought not to devrait 1 7 65 1 1 O20 200400 0 1000010000 1 DUU 1 10 0 O 1 6 6 1 3 is permitted TY is allowed 0000000 is permissible TEE D UU need not itis not required that no is required 0000000 000000 possible impossible 0 00000 000000 may 00000 ean 000000 001 may 0000000000000 cr 18077 1 1 008000870 002 DDD pouvoir 11 70 0 4 0 1 08 0000000000 0000000070 0 O 4 10 0 0 10 000 00100002007 6 6 1 3 1 O can beableto there is a possibility of 0000 itis possible to 00000 000000 00000 cannot be unable to there is no possiblity of 0000 it is not possible to 0 1 000000 00000 UD 0H 3000 1002000 66 D D a b 0 0 O ISO EC 1 1 1 O20 200400 umm 100 0 50 1060 1 1 1 70 1 0 7 00 70 0 00808000 0310 0101000000000000 10 31 0 19920 110 60 I Ii i i 5 08 I
4. 1 0 662 011 O 710 6621 0 1 ul O pog00000000000000000000000000 ISO 1 000 ISO o o o o A G622 0 1 1 708 00000000 0 Oo 6623 DOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 6624 QOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO oOo 663 G631 10 712 00 0073708 6632 100 1 1 16 0 1 1 7 68 0 0 0 088888888808 8 8 3 6 3 3 1 776 0 1 1 8 0 0 1 0 00 1 9 6 7 61 9 1 11 O20 10 6633 00 0000 0 1 1 4
5. El Er E Ooo Oooo Oooo Oooo E E E E Oooo EY Ooo O UDUODUUDUODUUDUODUUDUUDUUDDUUDUDUDDUUDUUDDUUDU 000000000000 7 70 0000 1 4 0 634 1 0 08 1 8 8 00 5 000 770 635 10 6 3 5 1 00 OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOAO oOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 1 1 08 1 1 080 1 1 0 111 DO 0000000006 3 52000 0006353000 1 1 DO Qo uo S o 21 9 1 1 1 O20 200400 8 1 0 1 9 0 6 0000 0 8000 70 E 0 60 777340 000 1 O 0 El El r3 o No EN 0 0 0 0 0 O O O O O O O O o O O o El
6. 0 08 1 0 8 1 7 0 0 00000 0 0 0 0 623 0 0 0 0000000 8 G3 000000 631 0000 u 800 108 4 0 Uu n annu u uueennn gt 00 70 0 710 000000000663000 0 0 00 180000000 00800 0 41 70 632 0 1 0 0 1 1 7 68 0 G4 00000 641 00 642 000 00 000100000 4 1 76 0 708 000 1 0 643 G44 7 1 7 10 0000 x 0000 G45 00 1 7 000000 1 4 60 9 1 1 1 O20 200400 G5 1 0000000000000 1 4 4 697 1 70 1 1 1 70 0000 070 G6 000000 661 Dn 0 1 1 68 00000 U 8000000 SO 100 00000000 500000 D 0 00000000 0 0 1 1 1 00 0 0008 8 8 8
7. 1 080 Dad OOO 1 1 1 1 OOO OOOOOOOOOOOOOOOOOOOOOOOAO u dada 1 u 0 010 02 D O Coffee grinders D O Coffee grinders Terminology symbols material dimensions mechanical properties rated values test methods packaging 26110000 56 1 1 O20 200400 E2 0 0 1 1 1 0 0 0 8 4 0 8 U ZUUUUU UUUUUUUUUUUUUUUUUUUUUUUUUUUUUU 1100 60 E3 71 UDUUDDUUDUDUDDUUDUDUDUUDUDUDUODUDUDUODUDUDUODUUDUOD 0 8 O O O O 0 0000000000 DADA 000 000 000000000000 000 DO 4 00 0 0 U ISO TSO PASO 1100000 1 U 0000000 0 0 000TR 00000000000000 57 1 1 1 O20 200400 0 E Ds oO
8. 1 760 oer 0300000000000 0 0 0 0 1 1 1 1 0000 1 1 06 0 0 88 1 CDO 6 6 5 10 0 6 6 D I 000000000 1 08 0 103 207 80 0 0 8 80100000 8 58 0000000000 a DO 30370 O OO O El El LI OO r3 O OO 0 3 0 E 0 0 70 0 66 00000000 661 0000000000000 6611 1000 000000008 4 1 0 0 0 00800080 0 1 7 0 1 1 0 70 087 10001100000 6 612 6613 100 1100000000 0000 0 20 1 1 1 1 1 0 360 26 9 1 1 1 O20 200400 662 00 0 0 8 8 00100 08 1 4 7 0 0 0 8 88 8 8 8 0 0 1100 00 gt 8 O The Shorter Oxford English Dictionary The Conc
9. 0000000000 1 0000000 0 8 1 1 0 9 000000 O20 200400 HUU G 0 00 1 170 oog Ooo O 0 O Ooo Ooo Onn Lom E UDDUDD O O 760 1 10000000 770 00000000 00000 10 O00 1 1 0 0 000000000 4 0 00 1 00 1 1 1 DUU 0 0 0000 0000 0000 OO ET ET ELE E L3 L3 00 000000000 1 0 0 000000000 8 13 0 621 pop00000000000000000000000000000000000000000000 0 1 1 1 7 0 0 0 6 0 1 1 0 0 1 1 7 4 0 1 0 000 000 4 8 622 0 a OOO 0 0 0 0 U 00 0 30 00 100730 0 030 7 0 000000000 000000000 000000000 70 59 0 0 000000 0 00 52 000 1 1 0 0 0 42200 1 1 1 O20 200400 b 1 c 800 080008808000 0088 7086 0 1 0 00 4 1 0 OO 0 0 0 DD 1 08008
10. 1 810 1 1 1 pa gg ag go 9 dd 00000000000 70 0 0 524 00 0000 0 9 1 11 O20 200400 000000 087807608 0 0 10 5 20 5 1 1 1 1 0 8 88 88880 75 0 1 8 10 520 0 000 1 6_ D D 5 00 5 00 0000 51 00 00000 a A ng A IS ad Pa YM ooooononoooooonooooooononon 2E EE 5 1 XXXXXXXXXXX 0 0 1 0 U U 0000000800080888 87070 53 EE 5 2 XXXXXXXXXXX 00008080000000 5 pagado go ooo 000000000 0000000000000 0 0 0800000000000 00000000 1 000000000000 00 1 700 0
11. 66732 pgodo0000000000000000000000000000000000000000 ISO IEC 15888 1996 3 10 200 0000000000000000 6 6 7 4 000000 D 0 60 0008080 D O03000 D O20000000 D 0 6 6 75 000000 6 6 7 5 1 DO 000 0 0 0 1 1 1 008114 00 a 0 0 1 8 0000000 0 b 00000000 0 00 0870810 00000001 0 128 200 ISO D ISO 600279 0 66753 0 000 1 a 0000000000 b 7 0 1 1 1 8 16 0 OO 1 4 730 0 1 1 1 35 1 1 1 O20 200400 0000000 U 0 IEC 60068 1 1988 1 00000000000000000000000000 U ISO 1234 0 03 00000 80000000000000000000000 Q lEC4321 41996 0 1 0 DD uU 0 6 6 7 3 27 1 10 6 68 000000000 6681 10000 1 DUHH 6682 0 70 001 6 683 100040 00 000 10781180 0 1997 000000000 67 2 345 6 2 345 2 345 345 2 23456 QD0O000000000000000000000000000000x0000000 6684 HU 1 8x10 00 00 1 8 10 0 10708 0 088 8 8 1 8 O U ISO 310 ISO 1000 Y IEC 6002700000000 70 669
12. 0000 00000000000000000 6372 110110 0 80 D 0 8 00 0 888 8 0 0 0 1 1 8 8 8 8 D 8 000 DOO 0 00 8 8 000000 0 D 0 0000 7000877070702070 OOO 1 1 1 0 000000 0 24 9 1 1 1 O20 200400 00 0 0880 8 90 1 1 1 1 4 1760 0 0 008 500 1 1 6373 1 70 0 1 1 000 88 1 0 0 1 1 01 1 0 613550 1 1 1 1 1 0 ICSI Y 01 140 300 1 01 10 0 760 638 0 1 1 1 7 0 7380 6 0000 1 4 64 000000 641 00000 6411 1
13. 1 0000 0 0 0 1 1 6 30 777730 000000 1 0 6412 10 1 1 1 1 1 1 1 1 10 642 DOGG ISOD 0 Eco UD UI I Uu 1D 622 I DU 8 0 0 0 600 80 0 1 1 1 1 0 1 7 68 0 1 0 0 0888 8 8 8 DU ISO 690 2 O00 O http www abc def directory filename new htm 0000 643 DD 0 1 8 0 0 08 1 1 80 650 0000000000 00 0 70 65 651 0 1 1 1 4 0 1 1 0 1 25 1 1 1 O20 200400 00000 U 000000000000000000000000000000000000000000000000 0000 000 0 1 760 OO 00000 08000 7 M0000000000000000000000000000 03 12 10 0 0 0 1 1 1 000000 0 0 10 0 0 001r 88 20 ods 70 0
14. 000 hm UU 01 2 000 000 000000 1 Hull DDUDISO3IIJUUDDDDUDDUDDUDUDUUDUGDUUUUNITUIDUDUUBHDUDEUDSGDUUUDUUDUuD 600270 00000000 00 BADO O 00 bttp 01 81 11 8 1 710 vari ug 580 310 0 00 0 1 1 0 0 OOO 00000000000000 UU U 0 U kilometres per hour O LI km h OOO OOO km per hour kilometreshour 0000000000 fivem 0 5 meters J sm ugggggguguguguguguse cCDDDDDDDDDDDDDDDDDDDDDDDDDD 1 1 1 1 80 5 1 sec U min 000000 mas mp 1 1000 h 000000 hrs 1 0 cm 000 UDD 1 P O00000 II 8 lt lt 60 01000000000000 rmi 000000 rpm 1 1 08 1 1 1 1 7 0 0 710 Umax 500 V NOOO U 500 Vmax O00000 a mass fraction of 5 OOOO 5 m m 710 a
15. O 000000 000000000000 00 000 1 1 0 000 0 1 1 1 1 0000 1 00 70777 0 O L O 0000000000000000 0 ISO 78 20 000000080 78 20 1710 0 0 0 1 0 1 2 0000000000000000 U ISO IEC Guide 510 1 O D B 19D D TH 00000000 0 0 1 00 0 070 0 107710 O El O LI El O O El O O O El UDUUDDUUDUDUDDUUDUDUDUODUUDUODUDUDUOD 0 70 O O O O O O O o O podd0 000000000000 170 70 0 1 0000 7 0000 O O O O O o O 0000000000 0000000000 000000000000 00 007730 O O E 000 4 3 O O oO O 1 o EJ 0 00000 El O O LI O O O O O EJ O O
16. 00 00000000000 5 39 0 0000 1 030 1 3 2 OO0 U 2030080000 1 4 5 0o00 UDUODUUDUODUUDUODUUDUODUUDU OO 000 60 5 3 8 00 00 000000000 0 18808088 0 0000 5 6 JUD base 708 55 1 1 1 O20 200400 E1 72 E11 310 0 008888888808 8888880000 3833 076 g 1 D O Fork lift trucks Hook on type fork arms Vocabulary DO Hook on type fork arms Vocabulary 00 0 0 0 1 10 02 u 1l Sodium perborates for industrial use Determination of bulk density D l Chemicals Sodium perborates for industrial use Determination of bulk density E12 11 0 7 0 E13 1 1 1 00000000000 000000000 OOOO 1 1 1 70 1 IEC 60747 1 Semiconductor Device Discrete device Part 1 General IEC 60747 2 Semiconductor Device Discrete device Part 2 Rectifier diodes 1 08
17. 7 0 0000 4 230 11 50 V 230 VJOO00 5 0230 5 0 3 1 8 log DDDDDD Ig In IC 000 log 0000 ISO 31 11000000000000000000000000 tan 00000 te 68 ISO IEC OO IDDU 0 20 200400 00 AC Administrative Circular BIPM International Bureau of Weights and Measures BP Business Plan CA Committee of Action IEC CAB Conformity Assessment Board IEC CASCO Committee on Conformity Assessment ISO CB Council Board IEC CB Certification Body CC Compilation of Comments on CD CD CD Committee Draft for Comments CD Committee draft CDV
18. 8 5 8 00 310 000000 IEC 600270 0 08 888 3100110110 8 0 1 0 0 888 0 0 1 000000000000 0 1 1 1 2 00 0 MD 0000000000860 000 O O O O O O 00 1 6 610 0 66101 1 661011 1 170 0 32 20 111000801181160 0 70 36 ISO EC 1 11 O20 200400 380 0 20000000000 00000 1 000000000 12 v286x4 t 0000 v 8 000000 t 0 1 1 1 0 lt 3 600 1 1 Bru Bru Bru Bru Bru Sa oOo oOo EES oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo EE oOo pibe oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo 03 0 LEG 0000000000 mass density volume 04 dim E dim F x dim 1 0000 E 0000000 F 000 goood 0 0 dim energy dim force x length u dim
19. 0 1 0 1 008 0 6 6 3 4 000000000000 00 OOO0000000 1 UD IU O0O0000000 6635 00 1 UD O 1 500 x 1 000 0 12000000 80 800000000 0 0 1 1 O O 1 500 1 000 15 AT 1 500 2 000 x 20 DD Dr 6636 10 1 1 0000000 00000 0 G7 D 67 1 0 26 6568 s8 Ctos c0p000000000000000000 O 00 860 87 0 0 8 EC 0 0 2 0000 0 2 C 1 58 08 0000000 58 82 UD 50 656 10 0 0 EC 0000000000 G72 50 000000000000000 60000000000 165 mm0 D 8 000 U 0 8 1 88 IU 8 I 1 ISO 18320 00140 1 I I UU DU 71 0000 880 8 000000000 ISO 883 TPGN160308 EN P20 00000 0 gt T 00000000 0 0000000000 14 0000000 G OOOO G00000000 00 U 0 025 mm 00000 0 13 mmp N 1 0 0 00000000 16 16 5 03 HO000 3 18 mm 08 UUUUUUDDDDDDU 0 8 mm E OoOoOoOOOD N 1 P20 1
20. 0 080 817 2 1 p0000000000000 00000008 00000000 Oooo Ooo DU 0 DU 0 EJ Ec EE EE EN EI 0 O 0 O EL E EI E EE EE Ooo Ooo Ooo 00000 30 ISOMECOOOOUO00 O20 200400 0 0 66510 17 0 6 5 20 11 1 1 1 0 0 77070 0 a 1100000 1 0 6 00707 0 1 1 769 0 08 7 27 6 6 5 11 0D 6 6 5 11 1 Dn 0 1 1 1 1 0 00 00 ISO 128 34 128 300150 ISO 128 440 O 128 400 665112 000000000 uggagggt imuguggaguggaauaudaduleetrlueatttlt ututul aim PU 1 000000000000000 41 0 1 20 1 10 1 20 00000000 0 0 0 0 0 8 1 7 7 0 0 1 1 1 1 1 708 0 01000 000 DU al 000000 bo 000000 D 1000 0000 00 0000 31 ISOMECOOOOUO00 O20 200400 0
21. 1 d D D 08000 D 0 0 1 OON DD 6 4 20 17 63 1 1 000000 6 3 1 1 1 113068 0 07 000 08 0 1 1 2 0 632 000000 000 0 1 0 A A U D 000000 0 D 2000000000000004 a 8 5000 D 1 tb Ll B b C Cm Ca c d dex diw 41 0 U D D za e B B 0 000000000 20 9 1 11 O20 200400 77 000 7 46 o 0 0 Dir Opn Dir Ono Dir Ono Dir Ono Opn Ono Dir 0 8 0001000 0000000000 1 4 1 0 oOo oOo 0 0 0 r3 00000000 0 08 0000000000000 000000000000000000000000000 6 3 5 oOo 786 0000800 70 0 00000000 4 1 0000000000 02 7 000 4 000000000 O O O O O o O O O LI
22. d 000000000000 070 0 768 00000 0 00 0 1 0 0 0 1 08 D OU E EL TEX E O 0 0 0 0 g 0 0 0 0 1 780787876 0 1 1 O20 200400 English term French term Example of numbering Part Partie ULU 9999 1 Clause Article UD 1 Subclause Paragraphe 000000 1 1 Subclause Paragraphe 00008 1 1 1 Paragraph Alin a DO Annex Annexe 000 A 512 088802102 0 0 8 UDUODUUDUODUUDUODUUDUODUUDUODUUDUOD 1 UUU UUU 4002000 OF 4003000 LU 17 2 100100 10020000 10038000000 0 0000000000000 00000000 1 80 00000000 1 03 6 ULULU 7 LU 7 U LUUD AU UU 7 107 04 00 00000 0 UUU UUUUUDUU 17 77 2117111 ULL 2000700007000 0 0 0000007070000 237 00 100000000 05 1 0 7 UU U U UU UU UL U U UU UC 100220 00000000 10023 LCDIE AAR b 0 0000000000000000 000 00 000 0800 D nb D bd b 6 6 7 5 30 0 0 0 1 po0000000000000006 6 75 000000000000000000000000000 0 870 009 00000000000 1 1 O20 200400
23. 0 0 0888 8 0 IU 1 1 1 760 000080 1 gt 513 0 1 a 000000070 110070 1000 0 tL 0 00 003 92000 b 0000000000 3 100 70881 1 210 1 20 1 1 1 0000000000000 000000000000 02 7800 0 0 0 00 UN UU 1000 D O00000612000 1000 UU D 00000 00 UU UU 0 D 00 00 0000 0 DO 0000 0000 1 00 00 0000 00 00 0000 00 000000 1 0000 0 1 0 D 00000 0 UU 0 0000 00000 0 00 00 00 D 0000 00000 D 00 00 DUUU 0000 0000 00 UU 0000006438701 0000 000000000 00000 77007 0000 1 0 1 DO DO daa 1 1 1 1 1 100 000000000000 6 6 5 9 6 6 5 10 6 6 6 6 1 6 6 6 71 0 TI 1 1 1 O20 200400 1 _ 1 0 52 DDDDDDDDDDDDDDDDDDU 521 10 1 5211 9999 1 9999 20 1 O 1 1 1 2 4 1 000000001 5212 00 8
24. 1 027 62 G73 ISO15800 000000 MSOOOOO 20 1 80 1100 888708 00000 pog000000000 ISO 1580 M5 20 4 8 D D oOo UD ISO 1580 0 oo 8 000000000000 ISO ISO 965 2000 0 6100000 10 6 000 D 0 707 Oo 0 0 00000 ISO 51010101010000 Ms 00 0 000000000 286 10 000 OOOUU000 DO ISO 1580 0 70 ISU ISO 4759 1000 I D D D ISO 965 39 10 I 011101 00000000 0 0000 000000000000 0 L3 o O LI ISO 6 0 O0 ISO 000 48 0 000000000 si ISO 898 100 IS 65080 0 0 0 0 D ISO 0 1 0 Bu LJ n Bu oo oo oo oo EE oo D D UDUDDUUSUDUDDDDDUUDDDUUUDDUUUDDDUDUDDDDDUUDDDUDUUDDUU 674 0 0 08 80 8 ISO 1875 A cs 000000000 G 8 1 EE UDIUUDUDDDDUUDUDDDUUDDUUDODUUDUDOUUDUUDUUDDUDUDUOUD 00 70 00000000000 000000000000 ISO 1580 M5 x 20 4 8 1 0 0 4183 0 000000000000 ISO 14808 12 po0000000000 4183 ISO 1580 M5 x 20 4 8 000000 OENORM ISO 1580 0000000000000 10001008 Flackopfschraube mit Schlitz OENORM ISO 1580 M5 x 20 4 8 0 0100
25. 0000 16 5 0 00 00 h b d2 70 01 0000 02 0000 OOOO 0 0000 e ve BET r3 Ci 33 9 1 1 1 O20 200400 6 6 6 7 117 0 6 5 20 11100000 4 0 D B D U D 6666900000 1 1 HOD O 0 6 6 7 00 6 6 7 1 00 UUDDUDDDDDDDDDDDDDDBDDDUUDDDUDUDDDUDUDUDUDUDDBDDUDUDDUDUDDBDBDDDUDDUDU 0 1 1 08 0000 1 0 U U 6672806675 111 0077730 6 672 00 Du 0 D 6 2 20 1 0 0 000000 06310000 00000000000000000 F 3 0 0 0000000 00 Is 0 p000000000 0 0 0 O ISO TSI PASO 1 10 0 80 0 ogo ISO IIEC 2382000 00 00000000000 U IEC 60335 0000000000000 UDIUUUDDOUDIDUUDUUDUDUDUDUDOIIOUUOUDDOUUOUDUDDUODUDDULU 6 6 7 5 2 000 6 673 66731 0 1 00 SDD 34bDDDDDDDD 31100000000 UDDBDD B20000000 0200000 EH EL EL EL EL ER EI 34 1 1 1 O20 200400 66300200 O 0
26. 0 0 D I Industrial systems 7 installations and equipment and industrial products Structuring principles and reference designations IEC 61355 Classification and designation of documents for plants systems and equipment ISO IEC Directives Parti 2004 Procedures for the technical work IEC Supplement to the ISO IEC Directives ISO Supplement to the ISO IEC Directives ISO eServices Guide ISOQ lt http www iso org ISOeServicesGuide gt LI 0 O O ISO Template 7 ISO lt http www iso org sdis templates gt 0 Ll O O IECStd Template IEC http www iec ch tiss templates htm Ll O O Quality management systems Guidance and criteria for the development of documents to meet needs of specific product and industry economic sectors ISO TC 176 http www iso org sdis directives gt OO O O 000000 3 CD t onar UDDIUDDDDDUDDUDDUDDUDDUDDUDDUDDUDDUUDDUDDUDDUDDUDD UDDIUDDDDDUDDUDDUDDODUDDUODUDDDUDDUDDUUDDUDUDDUDDDUD OO 0000000000000000000000000000000000000000000000000000000 ISO IEC Guide 2 2004 3 2 3 2 70 1 0000 ISO IEC Guide 2 2004 D 3 2 1 1 3 3 IS 000000000 6 DUU 34 00000 TS 00 0 0 90 8188888 100000 00 6 1 U 0 0000000000000 D
27. 1 11880 6 0000 A S P 27 6 8 5 2 5 DUT 000000000001000M00000000000000000000000200000000000 0000000000 0300000000000000000000000000000 D0000000000000000 00000000000000000000000000000000 00000000000000000000000000000000000000000000000000 D0000000000000000001000 01 000000000000 3 21 a 0000000000000000 9 00000000000000000 2 121 b 0000000000000000000000000000000000000000000000000000000 000000000 c 000000 Oasen 22300 000000000000000000000000 0000000000000 001 8 02 0000000000000000000000000 0000000000000010W00000 00000000000002000000000000000050W00000 8 03 000000000000000000000 n 00000000 0 000000000 0 00000000 0000000 8 16 1 11 O20 200400 0 1 0 0 3 1 1 1 1 1 4 0 0 0 1 UU 5 2 3 D EI EL 5 2 6 000000000200 0 00 6 3 80 0 6 410 000000 0 3 1 8 8 8 000 0000000 0 A 0 0000000000000 1 08080880000000 0 0 0 8 0 8 70 0 0 0 4 708 0 7 O 0 0 888 A2 AS 00000000000 527 0000
28. 1 4 1 000 1 4 6 6 6 6 6 6 1 10 1 1 1 1 7 1 028 0000080 00000000 6 662 10 0 7 10 1 1 0000 0 010000 00000 6 663 1888070070030 0 8 gt 00 00000 0 8 000 6664 00D 0 1 1 1 1 0000000 66 10 1 29 00 1 un uu 00 u kg m mm mm 0 1 1 1 70 02 UDUUUDUUD 000 UU UU O0 32 9 1 1 I DU O20 200400 0 30 10000 1 7 D3 D E B C UU g4 00 UNU B 0 6665 0000 0 20 1 1 0088000007 0000050 0 0 0 000001 4 1 6 6 6 6 0000 Ooo ooo E L3 L3 Ooo O 0 O 0 Ooo Ooo Oooo ooo Ooo Ooo ELI EE E ET E El O O O O O 1 o O O 0 6 110000 77 0 1 1 1 0000000000 800 20 0039s 70 000000000 000000 1 0
29. 1 6420000000 5 28 DO 1 1 0000 e 61 6 1 1 00 001 0 0 1 0 0000 1 380 0 1 1608 0 0 0 0 Oo Ooo 00 0 8 70 00 0 8 a 0 707777777160 0000000000 b 1 8 c pad doo 080000000 008070 0 08808 00 0000 0 UD 000 9 650 O 1 so csg 0 U 1111001 0 20000000000 9 1 1 1 O20 200400 612 DD 00 000000000 ODO 1118 160 07 1 0 1 11 1 1808130 uggaguguuggagagguggugagaagguuug 000000 1 11 OOO 1 1 1 0
30. ISO IEC Directives Part 2 ISO IEC 1 H 20 Rules for the structure and drafting of International Standards EET AA 0 0 0 5 2004 rue de Varemb 1 Case postale 56 CH 1211 Geneva 20 ood 41 22 749 0111 000 41 22 733 3430 E mail central iso org 000000 http www iso org O ISO IEC 2004 000 ISODD 710 0000 70 0 8 8 000000 rue de Varemb 3 Case postale 131 CH 1211 Geneva 20 Doo 41 22 919 0211 D00000 41 22 919 0300 E mail inmail iec ch 0000000 http www iec ch 9 1 1 O20 200400 OO AOR Bese aS totam 5 A eR ET 6 EK RR EG GYN eee de ON 7 7 WY FR 8 E ECKE 10 SS S 10 enn eee ee be 10 So ensem EE MIR IM Mei MI IMS 10 AA e Ae T EEN 11 5 AB PU Ged ELE Bl eege EE geet q Q Du a 11 6 gt REP HOT ET OR hse A SRC allaapa ka ayay aqi 12 A7 mt Sale Ren Ae Se EE 12 5 DD N CN O TS 12 e e FERRE RR nanan aan a ane ii RENTUR 12 O EET 15 nas ese ee rr eee Ne E E T 17 6 EE NR Ne ee a 17 CES NH D RR A A 19 es MA NN 20 EE ee ee ee 25 a A ORE rae 0 EE Ac 25 A SSE O
31. 0 D 86 D 000000 00 0000000000000 00000000000000 ISO 64330 11000000 UU 0 650 1010000000 1 02 0 0 0 0 0 00 8 8 88 8 8 01508 0000000000 0115 6 specification for the preparation and exchange of graphics 000000 0 170 1 O 00 06 6 65 6 1 1 000 SOU 008 80 0000000000 O O UJ ITSIG specification for the preparation and exchange of graphics 0000000000000 O IEC 604170 O ISO7000 000 29 ISO EC 1 1 1 O20 200400 665 7 000 1 1 08 1 1 1 668082 0000000000000000 00000000000 IEC 606170 0 ISO 146170 ll 1 ga B HE D U U U IEC 61346 IEC 611750 0 0 0 I I IECO O J Il I I OO J 1 UU 000000000 0 I gau 0 0 0 C1 00 C 0 5 uF L N 0 C2 QQ C 0 5nF Ki DUU Qi 00000RCCB Ri O00000 0 5pH R2 R 2 5Q R3 QQ R 25O S1 00000000 2 OOOO 0080806 1 1 0 0 807878770 6 65 8 1 0 81 80 0 0 7247 0 0 0 0 0 1 70 6 6 5 9 1 06517 1110100 70 0 0 1 DUT
32. 1 660 000 0 1 7 1 000000000000000 O 0 6 50600 O U 80 D D D J U D D 00 0 6 l 0000000000 70 0 O 80 II 1 1 6 0 1 77770 0 COD O 0 O 0 O 0 O a 6 00 OO ISO IEC Guide 2 19960 0 0 0 0 000000 OO ISO IEC 170000000000000 68 000070 6 8 1 00 000000 DISO TC 69 JISO TC 1760 Y IEC TC 560 1 1 000000000000000 0000000000000000 00 IEC Guide 10270000000 UDUIDDUDDODDUDDUDUDODUGUDDUUUDOOUUUDODUDUDDUDUUUDDUUUDDODODDISO 9 0 708 682 1 1 ISOD 0 0 1 DU 1 80 00000 1 306 a ISO 9001 2000 000000000000 00 ISO 9001 20000 0 16 OO O ISO 9001 2000 00 0000000000000000 00 0 t SO 9001 2000 000000000 40 1 1 O20 200400 0 00 0 0 b ISO 9001 20000 000 0000 000000000 1 1 0 000 c 909001200 00 00000000000000000000000000000000000000 0 d ISO TC 1769 0 0 O Quality management systems Guidance and criteria for the development of documents to meet needs of specific product and industry economic sectors 0 1 0 0000070 000000000000 0 0 ISO 9001 20009 0000000000000000 U ISO TC 1760 000
33. 10 7 0 1 0 11011000 1 1 4 762 710 ISO web DOO http www iso org sdis templates DO 00 IECH web 0 0 0 http www iec ch tiss templates htm 41 1 000000 O20 200400 D un lt C L3 g g L3 Dn OOOO A 1 00000 098 A2 10 0 81010000 0000 A 2 1 e o slo sss ess ees E E 242 Ss ooo ooo 5 ou ooo alla ooo Ooo Oooo 9 c3 ea ooo Ooo Ooo 9 alla ooo Hoo Ooo CH rmn ooo 0 ooo a alna ooo 0 ooo Oo Se ooo Ooo ooo r3 r3 o alfa ooo 0 ooo c3 c3 o GOHA ooo Ooo ooo c3 Oo ou ooo Ooo oon oo a BEG ooo Ooo oon H c3 oo on oo Ooo ooo oo oo o ala ooo 200 ooo oo ca oo o alma ooo 200 ooo oo oo o alna ooo 200 ooo oo ea da E ala ooo 000 ooo oo oo a alna ooo 200 ooo oo e oo o alna ooo Foo ooo oo e EXE oo aa ooo Hoo 2o00 oo o oo a ala ooo Foo 2o00 oo 0 o E ri ooo 0o00 00 oo e mm a aHa ooo soo 2o00 oo DO rn Of 0 eae BRO oo 0 SE ooo eps BRO oo r3 Ur O 0570 noo gan oon oo r3 Ur n dan E EE 3 oon oo r3 Ro n dan ooo gan oon oo 0 oo 0 ooo
34. 10 111000887770 0 1 0 0 0 000 0 5213 QO000000000000000000000001000000061320000000000000 UDUUDDUUDUDUDDUUDUUDDUUDUDUDDUUDUDUDDUODUDUDDUODUDUDUODUDUDUOD 00 1 4 08 4 1 00 70 70 0000807008778 010 00 O00 5 2 69 0 LL O 1 LI o O UDUUDDUUDUUDUOD oO 10 523 1 0 11 0000 0 0 20 111 0 1 10 5 1 1 1 30 OO0000000 5 1 1 1 1 10 5 1 1 1 1 0 1 10 1 1 00 0 08808 108 10200000 0 0 100 00 101000000000 10 0 00 08000000000 000000000000 1 DD 0 1 1 da 1 gg 1 HOOD W200000000000000000000000000000000000000000000 1 1 pa gg ag Dg
35. 613 OOOO 0 1 1 1 08 gt 3 0 0 1 8 0 0 8 08 0000000000000 50 O O 0 0 00000 8 a 708 b 70 0 50 1600 11010000 1 0 11 0 0 0 1 1 1 00000000 d 8 1 0 5 2 1 0 0 nu U U JU D EC 000 20040 00040000 80 0 1 6 14 Dn 1 1 1 0 0 70 00000808 gt 0 O O O 0 00000000000000000000000 0 0 6 40 111 1110 800000 000 7250 O ae CH oO O ae CH o O pod 0000000000000 00000000000000000000000000000 0 0 10 0 20 001000 881 049 0 El 1 1 1 O20 200400 62 1 00 6 1 0 0 08 000000 1 0 0 88 4 4 4 4 4 4 30 70 00000000 70 000000 1 70 DDISODU 7 Ez ET E 7 Oooo oom 00000 000 77
36. energy dim force x dim ength 05 37 1 1 1 O20 200400 MSE ON MSR 0000 5 0 710 MSE 0 4000000 MSR 0 0 40000000000 6 6 10 1 2 0 9 m EM km h m 1 0000 O O 0000 km h m DO s 6 6 10 2 00 0000000000 U ISO eServices Guide IEC IT Tools Guide Guide on the use of information technology tools in the IEC Y n n i i i ui i i 7 0 1 100 0 808 8 1 00000000 4 4 00 O1 DAD 00 Di as 10 o 2 000000700 000000 03 0 ag 0 Jl 3 J sin 2 00000 sin N 1 p 2 sin Ng 2 sin g 2 70 0000 4 aw d OW Ox dr OX a grad V a Vxrot a 0000 E 0000000 2 0000 0000000 gt bs H L LII Et EI EISE EI Oooo Ooo CH 38 1 1 1 O20 200400 OS du e 2 00500 v ee ee ee du T 2 TI Coser ran 0000 x UDA amp 000000 7 DOOD w 00 8 a 6 r 000003 141 592 6 De 00000000000880 _ mp ms w x100 ms OOO
37. 0 1 1 0 731820 0 5 2 40 101000000 DU E O O O 22 9 1 1 1 O20 200400 0 880 00000808000 0 0 U 5 2 30 DI 0 70 0 0 888 8 8 db ISO 78 2 1999 A10 1 0 10 4 72 0 10000 1 4 1 708 0 000 08 0 1 1 0 710 3 0 000000000000000000000000000000000000000 31 8 63 5 3 00 ODO0O0000000000000000000000000000000C OO 0 1 OO000000000 000000000000 O0 6 3 5 20 1 0000000000 DOpa daga gd on TE HITE EEE 0000000000 00000000000 000000000000 1 1 00000000000 000000000000 7 6 3 5 4 1 1 odo 11 00000000000 000000000000 1 1 7 0000000000 000
38. 0 0 oO 0 0 ong ES O EE 0 0 Ek 0 oo 0 0 0 Oo 0 0 oF 0 oon PE 0 El o on 0 0 0 oF 0 EG 0 0 El oF 0 Er El oF on g d Eie gt 3 g E gl ET Ee ees 0 o5 0 0 0 mo Li Ei ES Se 0 0 0 OG 0 ga 0 0 0 D oc 0 ou E 3 E OG oo 0 0 0 mum E E 0 OG 0 oo 0 0 0 0 mum 0 0 0 OG 0 oo El 0 El fe 0 0 0 OG 0 EE 0 0 0 0 EE El 0 0 OG El ER 0 0 0 D oc 0 oo 0 0 0 OG 0 SE 0 O 0 D 0 EE 0 oo 0 OG 0 a i E oo ES D oo 0 oo 0 OG 0 oo 0 oo 0 0 0 ou oop o oi m pp 0 oo oF oo E oo 0 oF a oo 0 oF 0 oo 0 oo 0 oF 0 oo E EE E a 0 oOo 0 oo 0 o5 0 E E 0 oo 0 ow 0 oo ae E Or 0 rg Y N e LL LL LL 00 00 58 ODO L3 L3 rr ET EL EI L3 L3 LU L3 L3 L3 L3 ET EE ELLE El EXE ESSE EI L3 L3 L3 r3 r3 c3 70 0 70 OO L3 OO Ooo 10 0 0 G2 000 O 0 O Ein II O 0 0 O 0 O EZ EL EL ET ELE 000 0000 0 0 0 0
39. 10800000000 1 1 1 O20 200400 D 0080008070 0 3 4 760 001 10 7108 002 0 0 70 0880 003 0 07 0 10000 1 18990 004 3 5 00 0 TR 0 0 0 50 08 8 0 1 0 0 0 10 001 00 1 1 1 0 0 0000000000 1 0 002 19990 0 00 70 3 6 OOO Guide 0 08 80 08 1 1 0 DD 0 70 0 0000000000000000 1110 0000000000000000 aj 6 10 bo 0 1 10 0 001 0 Is 0000000000000 002 575 0 3 8 0000 3 12 39 0 000000 1 09 0000 0 0 oo Oe none one wd o 000 1008000 9 1 000000 O20 200400 0000000 UDUODUUDUODUUDUUDUUDDUUDUUDDUUDUUDDUUDUUD 0 730 00000 6 4 000 0000070 0 1 0 00 ISOD 0 1 1 1 0 1 gt 7 0 1 1 7 0 O 0 O 0 O DU OO 0A100000000000000000000 OO 0 3 12 00 3 12 1 OOOO 3 12 3 OOOO ISO IEC Guide 2 2004 DD 1 4 4 0000 4 1 42 0000
40. 6 6 7 5 30 07 51 9 1 1 1 O20 200400 3 2 11 000000 IRHD 1 8 1 8 8 DD SO 1382 1982 000000 1 1 2 3 DOOD UDUODUUDUODUUDUODUUDUODUUDUODUUDUODUUDUODUU UD ISO IEC 2382 7 1989 0 00 0 1 008000000000 1 0 gt 000000 0 D145 0 D151 000000000000 ISO 102410000000 D 1 5 2 0000000000000000 1 4 68 0 1 5 3 11 1 1 00 8 0 1 18 88080 00 D154 0000000000000000 0 4 0 0 7 CO O p 3 60 17 D2 10 821 DD 0 0000000000 L3 L3 L3 oOo OO L3 oOo LE LE L3 e ET E TELE r3 L3 OO EIE EZ OO r3 L3 OO L3 L3 ORA LI O O 0 0 0 0 L3 L3 ET EF ESI ESI E L3 ELE EI ES r3 L3 L3 L3 ESI E EL E E EI E 3 r3 L3 r3
41. Committee Draft for Vote CEO Chief Exective Officer CIE International Commission on lllumination CL Circular Letter CO Central Office IEC CS Central Secretariat ISO DA Draft Agenda DC Document for Comments DIS Draft International Standard DL Decision List DV Draft for Voting C SMB only C SMB FDIS Final Draft International Standard FMV Draft for Voting IECQ CMC only 4 IECO CMC IEC International Electrotechnical Commission IEC Systm for Conformity Testing to EGEE Sard for Safty of Electrical EY IECEE CMC IECEE Certification Management Committee IECEE IECEE CTL IECEE Committee of Testing Laboratories IECEE IEV International Electrotechnical Vocabulary IFCC International Federation of Clinical Chemistry andLaboratory Medicine INF Four Months Vote IECG CMC only IS International Standards ISH Interpretation Sheet ISO International Organization for Standardization ITSIG Information Technology Strategies Implementation Group ISO ITU International Telecommunication Union IUPAC International Union of Pure and Applied Chemistry IUPAP International Union of Pure and Applied Physics 000 10 JCG Joint Coordination Group JTAB Joint Technical Advisory Board ISO IEC JTC Joint Technical Committee 69
42. ISO 128 Technical drawings General principles of presentation ISO 129 0 0 0 LI Technical drawings Indication of dimensioning and tolerances ISO 406 Technical drawings Tolerancing of linear and angular dimensions ISO 3098 Technical product documentation Lettering ISO 6433 D 0 O O U Technical drawings Item references IEC 61082 ng n dad UI UU WU UU UU UU U ER IEC 61175 Designations for signals and connections IEC 61346 0 0 O LL Industrial systems installations and equipment and industrial products Structuring principles and reference designations ISO eServices Guidel ISOQ O lt http www lSO org ISOeServicesGuide gt 0 0 O O IT Tools Guide Guide on the use of information technology tools in the IEC 7 EC lt http www IEC ch tiss it it tools 2001 pdf gt 00000 B9 1 IEC 61355 Classification and designation of documents for plants systems and equipment IEC 61360 0 0 O I Standard data element types with associated classification scheme for electric components Gono ISO TC and industry 1 1 1 1 1 1 00000000 01140 30 Documents in administration commerce 8 109 OOO ISO 70000 7 7 7 UU UU UU U U U U LU U ISO 14617 0 O LL Graphical symbols for diagrams IEC 60417 7 UU UU U IEC 60617 1 IEC 80416 10 7 7 7 UU UU UU UU UU UI 7 ISO 81714 1 Design of graphical symbols
43. L3 L3 L3 E EEE r3 L3 L3 EF EE 0 1 1 7060 0 1 0 1 1 4 7 0 0 1 70 70 00 1 70 O O O O O O O oO O D22 0 0 08 88 0000 000000000000000000 52 1 1 1 O20 200400 OO 0 00 00 0 0 3 lt 1 1 07707170 0 0 8 88 8 1 90 000 00 0008 0 000000000006 670 00000 1s0 1024119927 10000101010 00 006 0 3 2 1 0 0 0 08 0 0 00 0 000000 1 0 2 4 1 00000070 000 D33 000 1 11 1 00000000000 11 4 6 000000 1 0 000 00000 088 0 0 0 008 000 ISO 3
44. for use in the technical docmentation of products Part 1 Basic rules IEC 81714 2 Design of graphical symbols for use in the technical documentation of products Part 2 Specification for graphical symbols in a computer sensible form including graphical symbols for a reference library and requirements for their interchange 47 1 1 1 O20 200400 81 0000000000000000 ISO TC 2130 1100 8 0 812 000 ISO 3 Preferred numbers Series of preferred numbers ISO 17 Guide to the use of preferred numbers and series of preferred numbers ISO 497 Guide to the choice of series of preferred numbers and of series containing more rounded values of preferred numbers IEC 60063 Preferred number series for resistors and capacitors IEC Guide 103 Guide on dimensional coodination B13 00000 ISO 3534 0 0 0 O LU Statistics Vocabulary and symbols IEC TC 560 1 1 0 0 I EC I U 1 9 80 0000000000 00 1 100 Guide to the expression of uncertainty in measurement BIPM IEC IFCC ISO IUPAC IUPAP OIML 814 ISO 554 7 70 UU U LU UU UU UU UU 17 ISO 558 Conditioning and testing Standard atmospheres Definitions ISO 3205 Preferred test temperatures ISO 4677 1 Atmospheres for conditioning and testing Determination of relative humidity Part 1 Aspirated psychorometer method ISO 4677 2 Atmospheres for con
45. i i i I i i 11 1 1i u au ui nu 80 0 0 8 DO U U web 0 O U htip www iso org D O IECH web O O O http www iec ch 0000000 1 11 O20 200400 00 DISOIECI 0000000200 8 8 OO DO ODO OD DO DD DDD 00 0 0 9 1 1 O20 200400 ISOIEC I d d d 20 Ss 710 1 0000 OO 1 20 OO ISO SOOO 0 1111 340 0 0 1 1 1 1 7508 00000 0 0 000000 00 1 1 1 1 7 gt 00 00 0 000 070 0 1 7 8 00 2 0000 UDIUDDUOUDUDUUOUDUDUUOUDUODUOUDUOUUOUDOUOUUDODUODDODUUUOD 0 0000 71450 0 70 ISO 310 0 00 0 O Quantities and units ISO 78 2 Chemistry Layouts for standard Part 2 Method of chemical analysis 1SO 128 30 2001 Technical drawings General principles of presentation Part 30 Basic conventions for views ISO 128 34 2001 Technical drawings General principles of presentation Part 34 Views on mechanical engineering drawings ISO 128 40 2001 Technical drawings General principles of presentation Part 4
46. oo n DD inn ao A3 1 OO420000000000000000000000000000000000000000000 po000000000000000 UD 43 1 1 1 O20 200400 00 1 A4 70 70 1 7 1 1 6 6 11 EMEL EU ESI EVE EI A S 00000 30 1 1 00000 1 A52 000 ooo ooo r3 ooo ooo ooo CH ooo ooo coa CH ooo ooo ooo r3 ooo ooo ooo r3 ooo ooo ooo r3 ooo ooo ooo 0 Ooo ooo ooo 5 Ong ooo ooo CH Ong ooo ooo 5 Bou 0 ooo CH Ong ooo ooo r3 0 ooo ooo ca Ooo ooo ooo CH 000p ooo ooo ca Oooo ooo ooo ca Onn ooo ooo o Ong ooo ooo OH Aa Boo 0 RO 6 0 rug cO ogo cma ose oo ou oron 6 Ou ago 2900 Bo 9 Oo 05920 onur Oo gan Ogjoo Ono Bou ooo o On Ooo On ono onla Opr oa Mam 2 Ooo oa am BOOS Ooo On Do 520 Ooo On soo Om OO ono ao BE p20 po E1 ELE L3 r3 gan 0400024 Ooo Do gan L3 LET alee 00 Onno L3 r3 ooo Oooo mmm oo opt Oonoon Dor Oo onan El ENE nooo BORG ooo Oo DD Oooo ooo oOo onar COD DD 5 5 CDD DD LES Baha BOBO dana oo DD Sepa dana BD Soe Ss noon dana oo DD nooo DD mnm DD Beane GOOO 06 05
47. ooo gan ooo oo 50 050 ooo EYE ooo 50 ooo ooo gan ooo ou 50 Go ooo ooo oo ea mm ooo ooo e Sa ear oo 50 Go ooo aan ooo oo e 50 Go ooo o ooo Qu 50 3 ooo o ENE NE mn oon A e CO Go ooo o FE 0 m on ooo ooo j eI GE GAH oo oo O 050 ooo ooo gana Boon Hu 50 oo O Go ooo ooo gana Go Pou o ogo ooo COD moon ooog Sehl Ek Gk ooo conn gana aga 70 Url oo mn 03400 Bom COD 4945050025 ooog 50 oo D Broo coo COD po ooo Pou oo aga o alan Dona cooo poo Hg oo Bo D 005050 ooo nana gana poo Hu oo ga D 005050 cooo 05000 DD OOOO go E EEE BEREAN ee a e li AEE Nr CO D dada dada dada 05000 oooo o 42 El oo oo o oo oo ea Q e E oo e CH oo oo r3 oo oo r3 S8 r3 E Bo d oo oo E oo T e EE e 8 o oo oo c3 a E oo 0 9 a EXE El N oo oo c3 r3 Et El 5 mo Y oo oo o or EXE r3 c3 r3 c3 Eu cs E oo ETE oH oOo r3 r3 005 0 oo ui oo r3 r3 LI DO Oo ea ot oo Es EE E CH Ono oo r3 Oo r3 O r3 na BOG E oO oo oo CH oo r3 0 r3 og Ong r3 oo oo oo O a 0 Ee Sa
48. rE 26 X A nnn m 9 0 40 es BH U TBS in TN BBEBTDDD d 40 Z EROR RT RN Pia e e e A RR HS m 41 e aa a aul a n nan ga CEDE O 42 A CHT TA el oes ori a Sanitas Meu 42 A 9 A ssn Beis eee wR oe 7 42 AS Dn A E Sa RSE A HRN RR 43 A TR E O EE 44 A B TE b AS 44 Mn a HA Were 45 A TMA AS eS A EA 45 TEBA E EE O II A aN 46 M KH 46 46 A MM A e A e OE ER 46 P RR il A A 46 a Render nanan Beane ore ee ee 46 Ce D EE 46 67 O 47 E vr Pec A ER 47 0 00 47 BAD EE 47 Bai AA MA OTT ATA TE Hessen See 48 1 1 1 O20 10 50 E Eer 48 BT ER EH E RE 48 A aR aS 48 BES RUM TD II i e f o Ty 48 OI 48 B17 EMO REPE nner ee ee ee 49 B187 m E D a ere RP 49 B10 a ee nN 49 B20 00010 0101000000 0 49 AAG ISO TACO IP E zb rn ke Be PET ve D EE 50 IIR NO EI EA me ey te ee e Me e SS 51 et IET MEME 51 PL Gate as nc EOD AM e 52 END A A DEED E O OD O NA 53 AT ER e cee coterie me botte RAS 56 ET uP TH PN AAA re A 56 Ea E ehr BE ez 57 0 A 57 BR OW ED FEN a SOP NY NEF Yy 58 oN 80 Hn ln OOD OO OO 59 8 8 8 8 Great cem n um I Mu ne WRN 59 AS 59 0 00 Gon ee ika za LARA er lan e 00
49. 0 II I 90 I 00 0 00000000 27 ISOMECOOOOUO00 O20 200400 0 1 1 0800 4 4 76 0 8 10000 8 03 1 1 08 80 0 6 0 10 500 110 6 64 OOO 0 0 0888 8 0 So IECU 1 1 0010010 4 0 0 21440000 6 6 5 6 6 5 1 DD 0 1 08818488895849 DU 6 6 5 2 00 0 1 1 ISO CSH 0 000000000000 SO eServices Guide IT Tools Guide Guide on the use of information technology tools in the IEC 111 1 1 1 0 1 000000000000 66 53 OO D 1 1 1 1 0 1 000000 0 7 5 2 60 11 1 000 6 654 0 8 1010000 7 00 00000 00 1 4 6 655 007000 10 0 1 0 1 8 31 10 1 70 A 5 10 7 10 28 ISO EC 1 1 O20 200400 0000000 iso 3098 10 07360 D
50. 0 EE 0 1 000008007 00 118000 0 1 0 70 EE EE E EEE 10 43 000 9 1 1 1 O20 200400 oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo EREI oOo oOo oOo oOo oOo oOo oOo oOo oOo 710 1 70 71 0 0 OOOO D D 0 O 0 O oOo oOo T oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo oOo 44 0 ISOD 0 1 1 0 O IEC 000000000 1 8 2 o oou L3 L3 ee L3 L3 c c LL Ooo 0 1 8 0 3 0 1 Sop 1 160 0 0 0 00 0100000 u 0000 00000000 u ME a o 5 OOO uat B 3 EE oo L3 L3 UDUUDUUDUDDUUDUBUUDU 45 UDDIUDD
51. 0 Basic conventions for cuts and sections ISO 128 44 2001 Technical drawings General principles of presentation Part 44 Sections on mechanical engineering drawings ISO 639 1 Codes for the representation of names of languages Part 1 Alpha 2 code ISO 6909 0 0 0 O Information and Documentation Bibliographic references ISO 704 Terminology work Principles and methods ISO 1000 Sl units and recommendations for the use of their multiples and of certain other units ISO 3098 2 Technical product documentation Lettering Part 2 Latin alphabet numerals and marks ISO 3166 1 Codes for the representation of names of countries and their subdivisions Part 1 Country codes ISO 6433 Technical drawings Item references ISO 7000 Graphical symbols for use on equipment Index and synopsis ISO 10241 1992 International teminology standards Preparation and layout ISO 14617 0 0 0 0 LL Graphical symbols for diagrams ISO Standards Handbook Quantities and units O O O O O D ISOMECOOOOUO00 O20 200400 ISO IEC 17000 Conformity assessment Vocabulary and general principles IEC 600270 0 0 O O T Letter symbols to be used in electrical technology IEC 60417 Graphical symbols for use on equipment IEC 60617 Graphical symbols for diagrams IEC 610820 0 0 O O I Preparation of documents used in electrotechnology IEC 61175 Designations for signals and connections IEC 61346
52. 000000 OO 0000000 8 6355 0000000000000 6 3 5 5 D 000000 0 0 1 4 76 1 0 6 3 5 5 2 1001000 1 1 6356 00 1 0 0 0 1 7 0000 0 20 1 1 1000 1 08777000 0 0 0 1 0 1 1 08 23 ISO EC 1 1 O20 200400 00000000 1 70 0000000 70 OO DO 00 D Ooo 710 636 0 1 1 00000 8080008000 0 0 1 6 0 702 0 1 1 1 1 7 0 8 1 1 9 DU 0 637 70 6 3 7 1 DD 0 1 1 1 760 00 0 0 1 4 6 9400708 0000000000000000 ISOEC Guide 230 0 1 1 60 000000000 ISO IEC 17050 10 0 ISO IEC 17050 2000 17 pog00000000000 000000000000 ISO EC Guide 00000000
53. 000000000 00 D1 1 D11 707001 0 0 8008 8 7040 0 1 1 1 76 0000000000000 ISO 1024119920 10001 707 0 00 1 0150 160 0 0 0 0 0 O DIECO 0 O 4 D 12 0 0 1 1 7710 0 87 00000000000 D13 710 0 1 1 1 000000 0 0 1 O 000 000000 0 0 0 3 7 8 8 8 D U 0 D ID 0 08080000706 0 00000000 7 70 0 1 0 0 O LI D14 00 1 80 8 0 000000 000000 000000 4 408 O po00000000000 0 1 17010 O o o Ez O O O O O O E o 0 08 3 8 8 OD U
54. 008700787776 683 0 1 0 1 1 1 0 1 1 O20 200400 00 0 08 0 8 1 0 0 00 340 ISO IEC Guide 210 O0 DD OG 1 0 0 64 1 11 O20 200400 L3 L3 L3 L3 J L3 L3 r3 OO OO pA1000000000000000000000000000000000000000000000000 H 1 0 D 6 6 1 3 O O shall is to is required to L itis required that OOO has to Doo only is permitted it is necessary shall not it is not allowed permitted acceptable permissible is required to be not ED U LI U is required that be not is not to be shal 10000 mus 101010000 77770 000 00000006 shall not 00000 may not 0000000000 0 0 00000 0000000 0 007 2 1 080000800000 000000000000 0000000000 000000000000 1 08 0000000000 00000000000 00000000000 1 1 1 pH2 0000 00000 000000 0 D 6 6 1 3 Y O should itis recommended that ought to
55. 0508 nooo aaa oo DD CDD DD mnm DD 44 ISOAMECOOOOUO00 O20 200400 A53 18001270 o m c3 c3 c3 c3 Oo c3 c3 c3 c3 c3 c3 c3 c3 c3 Oo c3 c3 c3 Oo o c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 Oo c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 c3 Oo c3 c3 og a o Em oO BH mum m c3 EXER ie E c3 E Ede E On Opn On ae On Bou oF me Op m nl mn gm O oF ap um Y nl mn aa m oF apn tm nl o Bo m oF aa of unu oF ar oo y oF ap oo y oF ar oop O oF ap aa oF oo mm oO oF po oo uu oF oo oo o oF po an m Da oo oO Ha El of DD m of oo m of DD O of DD m Ee Be E ES EE El 05 20 Ba om ca oo DD D o8 mmn oo oo CD DD 00 oo A6 70 Sees m 0 CH 0 CH m ooo El El ooo CH r3 el E ooo r3 oO r3 oO r3 CH CH ma ooo r3 CH ca ooo 0 e o ooo 0 e ooo 0 e 0 ra ooo 0 0 a ooo m 0 a ooo a a ooo 0 r3 a O a COD El r3 a CH oon C3 r3 COD 0 0 CH 0 0 3 oO r3 a El r3 oao a oO Eb 3 oO r3 na
56. 10 O IEC 600270 0 0 0 0 O O OSO 31 00 1780 00 0 oOo O El oOo oOo oOo EE OO 0000000 000 080770 53 200400 0 000000 1 9 2 1 DU R ISO IEC gt 0 lt 1 0 OO 30 0 1 1 1 4 1 0000 0 0 0 0 0 3 D 34 10 000000000000 1 1 1 76 D35 7 0 0 0 1 10000 0 oOo oOo oOo oOo oOo Oo 1 4 6 1 4 6 shee programmatique f discipline traitant de l tude et de la Od conception des m thodes de programmation et des langages de programmation des calculateurs ooo Oooo Oooo D36 00000 0 1 1 7 1 0 O 0000 1 0 oOo oOo 0 0000 0 oOo oOo 00 1 10001 0 0000 54 ISOMECOOOOUO000 O20 200400 D 3 7 0 0101000 0 080 000 uu 0 00 0 0 DUU 0000 DO 3 4 3 4 OOO de Gewinde n 00 0 00000000 fi ruuvikierre 00 0 00000000 it filetto m filettatura f p 28 00 0 1 1 00 7 1
57. 7 SS RRE DER 61 EE 61 Ch HEEN ne 62 ld ESER Fes PN EG NR EE NER EEN 63 RAD IG naan Nan Hyny aM GIO KIM BRIE 65 YY A ETE BY ale ie fs eee ee rr ba O ad 67 ae sa eee ee ee ee TT 68 O ENS 13 E NR Fly p EET EPOR D EP ERE ured E Ke aa aaa n NND asua 14 na MM cece nU gl kani Oe E A la ed E 65 Eus EE L 65 Ky mr GA er A 66 ak Senn m EET el sect Erie eti tip GY AND us aa letus 66 1 1 1 O20 200400 Uu 80 0 70 U U UUU 50 0 1 1 1 1 1 1 1 8 8 8 390 11 1 111 40 0000000078800 DDISOIECI UU 20 50 0000020000000 000000 0000000000000 0 1 1 U 000000000000036000 U 0 U 0 0 60 10000 U 1 41 1 0 uu etu 00 20050 1010000000000000000000 20050 1 D UO i i iu 708 FDIS UU DU ISOD O I 1 U ISO IEC 1 uu
58. B3 1080 ISO IEC 23820 0 0 0 O LL Information technology Vocabulary IEC 600500 0 0 00 WH QO IEC Multilingual Dictionary Electricty 7 Electronics and Telecommunications CD ROM http domino iec ch iev 0 ISO IEC Guide 20 7 7 WW JU UU U U U UU ISO IEC 17000 Conformity assessment Vocabulary and general principles OOO 50 1 0000000000 01 040 I i I 2000000000 International vocabulary of basic and general terms in metrology BIPM IEC IFCC ISO IUPAC IUPAP OIML 84 000000000000 ISO 704 Terminology work Principles and methods ISO 10241 International terminology standards Preparation and layout 85 ISO 31 0 0000 D Quantities and units ISO 1000 S units and recommendations for the use of their multiples and of certain other units IEC 60027 0 00000 ZU TUI UU UU UU U UU 46 1 1 1 O20 200400 B 6 00 ISO 639 Y 0 0 0 O LI Code for the representation of names of languages ISO 1951 Lexicographical symbols and typographical conventions for use in terminolography ISO 3166 I 0 O O LI Codes for the representation of names of countries and their subdivisions B7 OOOO ISO 690 Documentation Bibliographic references Content form and structure ISO 690 2 Information and documentation Bibliographic references Part 2 Electronic documents or parts thereof B 8 00
59. DDUDDUUDUDDUUDDUODDUDDUDDUDDUDDUDD 9 1 1 1 O20 200400 46 6 ISOD 0 1 7 0 1 73 0 47 OOOO 00 3 1200 1 1 20040 00 100 2 34000000000000 1 08 0000000000 1 1 0 887730 1 1 08 ga ga 0000000000000 1 00 U 1 UU 0 0 1 1 8 0 5 n 81000210 511 DD 0 1 0 1 7 09 1 000 a 07777730 b 1000778730 c
60. EXE E r3 El oo dH COD a r3 O ooo EE xm oo A Eu e oo m z Yi ma iu oo oo Ei ooo oo E o oo BH ooo oo oo Ei ooo oo a o Og O oo a i Ely 1 ooo oo On E n oo 2 Oo m ooo E yg E Eo oO COD EEN A r3 m EE Sirk Ze E Op m OOO no Bru OL oo EJ Oy Oo HS ga CH Ee E ee ga CH Co COD Ek m Da E ooo E Da mH ga Y Da E E EYE sae ded m Da mH ooo ga Da E o Bl Da mH eee so 20 Y Da E nooo Fo Pa H Da E nooo CH r3 CH r3 nooo So So on onu o A7 0000000 000 0 0 1 oo 1 1 0 A 7 1 DU A72 001 100000000000 0000000 08 A73 10 00000000 6 6 45 1 11 O20 200400 0 00B 0 0 10 B1 OO 0 0 1 6 6 20 100 880408760 0 1 80 8 8 8 0 011 111 J U D D IEC 0 1 80 8 90 01 11 1 10 000000 1 4 7 08 B2 710 The Shorter Oxford English Dictionary The Concise Oxford Dictionary The Collins Concise English Dictionary Webster s New World College Dictionary Chambers Concise Dictionary Dictionnaire Robert Dictionnaire Larousse Dictionnaire des difficult s de la langue francaise V Thomas Larousse
61. O 6 6 10 3 0 80008080800870 0000 0 OOO uuu Xy gt lt O 10 20 0000 4 1 0000000 0 6611 0 000000000000 070 O0 1 80 mm 25 mm x 50 mm J 80x 25 x 50 1 d 2 80yF 2uFN O O O 80 20 uF 3 80 10 4 80mm 32 um 05 10kPato 12 kPa 10 to 12 kPaj 0 0O 10 12 kPa 00000 g6 061096 O to 1 C O 10 C 00000 DO pad o ad a ag da ag oo dog gd 0000 00000000000 000000000000 07 00000000 6 0 1 67 0000 08 U65 20 0000 65 2 70 1 0 177 15000017258 0000 39 9 1 1 O20 200400 1 107 0000 1 67 0 O 0 000 0 000 1 1 4 4 0 0 O DU 0 D D UO D DM 000 O o 0000 0000 0 70 0000000000 0 0 O O 0000 0000 00000000000 4 70 1 I O UU LI I 7 6 D O O FU C CABO D D D 000 Ooo O Ooo O 0 1 1 0 0 1 1 0 OO so cascog I 80 11010101000 11 CON IECCAB 1 1 1 1 ee ODC UDUUDDUUDUUDDUUDUDUDUODUDUDUODUDUDDUODUDUDUODUUDUOD 0000000000 SOEC Guide 20 1 1110
62. aS oO oo et oo 0 Pe Y oo em oo 0 E OD EJ CH Oo Oo 0 Ds Oo m E og BEG c3 o o Q 0 oo O Pu E os o E eo EX C m Hon BO r3 ag oa O Ep Ss 6 oo 0800p rn Oo Oo o s Sie eS er 2 Dan Po mu Oo a 9 a gm Dana Po Oo vox S EE ue See 000o On a 25 Om Ou Son r3 On Ei 0 0 Sos Seq Go oS Ya B Po oe BI A EX xp SHH og pns gr ea As e Bo EE C Dona 805 Do oz c3 Da Fo da Foo y Fon oo un nO OC e Up Up op See e ria Aba De HO o Da Po Pon y Oop mg 2 o Da Po Bo Hpo g ria Qoo OC o Po Hg Pon y Ed tr AONB 10 19 SC O As Ue Bb Bso rj Dan ada Do oo oo a 0o Ho oo Hoo p oo ada oo gl oo Da Po Bo Hpo y Ung marin AF oo a 0o Eig oo Hoo y Goo ada oo op oo e Ma Do oo Dono o SOc ada da oO oo ca Fo Ba da Foo y Doo ana DB mua Ba Fo oo Dono o OG ada da ala o po Fo oo Poo m Don ada da ala ooo oo Po Bo Poo a 2050 aaa da ala aaa D ga Fo oo Poo op 200 ana oo oo ooo mnm Fo oo Poo mu Foon ana Do ngu ooo oo ga o na Foo an HEE EEE BE TEEN e e Eer GE Se selen STEN E Coo ana Do otoa ooo ao ga o aa Foo oo Sa dak da B20 coo da pe Ha ma San eo aaa oo gen ooo o ga Po aa Foo mu HEHE Ob el eo DE o ua Hoa 3 eo CIE oof GA BOO ooo 00 DD go 00 yoo DG don AAD Gon miri a s Go NOO oo Poo ooo o alnan ooo oo
63. aft provisional specification SC Subcommittee SMB Standardization Management Board SPS Strategic Policy Statement IEC TAG Technical Advisory Group ISO TC Technical Committee TMB Technical Management Board amp ISO TR Technical Report TS Technical Specification UIC International Union of Railways VT Validation team WD Working Draft WD Working Document SB only SB WG Working Group WG Working Group Membership List also for MT PT MTM PT 70 ISO IEC OO 0002 2004 0 0 0 07646 08027 200 Approved for 2nd Committee Draft ACDV Draft approved for Committee Draft with Vote ADIS Approved for DIS circulation ADISSB FDIS manuscript subcontracted to CO AMW Approved Maintenance Work ANW Approved New Work APUB Draft approved for publication APUBSB PUB manuscript subcontracted to CO BPUB Publication being printed BWG Draft returned to Working Group CAN Draft cancelled CCDV Draft circulated as Committee Draft with Vote CDIS Draft circulated as DIS CDM Committee Draft to be discussed at meeting CDPAS Circulated Draft for Publicly Available Specification CDVM CDV to be discussed at meeting DEC Draft at editing check DEL Deleted items DELPUB D
64. ditioning and testing Determination of relative humidity Part 2 Whirling psychorometer method ISO Guid 640 JJ UU U U U UU UU U UU 1 IEC Guide 106 Guide for specifying environmental conditions for equipment performance rating IEC Guide 1090 F777 IEC TC 104 Environmental conditions classification and method 070 B 15 OOO ISO IEC Guide 500 7 OO UU UU UU UUU UU UU UU ISO IEC Guide 510 SJ J U UU UUU UU 00000 IEC Guide 1040 JA UU UU UU UU UUUU UU UUUU UU UUU UU UU I I B 16 00 ISO 78 2 Chemistry Layouts for standards Part 2 Methods of chemical analysis B 17 EMC D UU E utl IEC Guide 107 Electromagnetic compatibility 7 7 7 7 O O EMCO JJ JU UL UL EO 7 ULL OL U U 17 48 ISO EC 1 11 O20 200400 B18 1 ISO 90000 7 UU JU JU UU UU UJ UU HU LU U ISO 90010 VOL UU UU UU UU U ISO 9004 Quality management and quality system elements Guidelines ISO 17050 1 Conformity assessment Supplier s declaration of conformity Part 1 7 General requirements ISO 17050 2 Conformity assessment Supplier s declaration of conformity Part 2 7 Supporting documentation ISO IEC Guide 230 JJ JJ UU UU HU UU IEC Guide 1020 7 7 JO 110000000 UI UL UI UU UI UL U U LU U U B 19 17 ISO IEC Guide 15 SO IEC code of principles on reference to standards ISO IEC Guide 21 Adoption of Internatio
65. eleted Publication DREJ Draft rejected NADIS Draft not approved under Committee Draft with vote NCD Draft returned to TC SC after FDIS PNW Proposed New Work PPUB Publication issued RDIS Text for DIS received and Registered WPUB Publication withdrawn 71
66. ise Oxford Dictionary The Collins Concise 000000 English Dictionary Webster s New World College Dictionary 7 Chambers Concise Dictionary U O000000 Dictionnaire Robert 7 Dictionnaire Larousse 7 7 Dictionnaire des Difficult s de la langue fran aise 7 V Thomas Larousse 0 1 1 7608 0 0 6 3 20 1 1 7 08 000 1 1 1 70 O O E o O O 0 0000000000000 000000000 70 0 DD 80 0008730 612930 I AC230V D I Oo ofoo O O E O O 0 1 1 08 00000000000000 Ac 00000000 0 O o O O ES O 6 63 000000 0000 0 0 0 1 1 1 0 30 0 1 0 00000 00000 00 00000000 0 0000000000 000810 160 Teflon amp 0 O O O U polytetrafluoroethylene PTFE T O O O 0 6080 00000000 1 U2 1 000000000 M000000000000000000000000000000000000000 0000000
67. nal Standards as regional or national standards B20 ISO 140400 Environmental management Life cycle assessment Principles and framework ISO 14041 Environmental management Life cycle assessment Goal and scope definition and inventory analysis ISO 14042 Environmental management Life cycle assessment Life cycle impact assessment ISO 14043 Environmental management Life cycle assessment Life cycle interpretation B21 00 ISOOOO00TCOOOUOOG000000 IS00 0000000 O 55 Packaging and distribution of goods 0 0 0 0 10 ECU 1 00 ECQ 0000000 U 55 Packaging and distribution of goods OOO UU 10 49 9 1 1 O20 200400 00 00000000 001 co DHS O ee t NN ON SE NE NE XO O O O O O O KO O CO O 0 O O O NO ss e O O O O OO 12 1 12 2 12 2 12 12 12 12 12 12 12 NN x 12 1 d d du Al U Or E CM e ee E v v e c oco oc mmmmmam mm mmm CN OO 60000000000000000 500000000000 oo 50 1 1 1 O20 200400 UD 0
68. volume fraction of 796 D I 7 0 BU B DU D 0 0 010 0 9eo 0 0010 I 00 000 00000000000 11 1 1 11 1 1 UU U U U the water content is 20 ml kg 1 D 0000 U 20 ml H20 kg J OO 20 ml of water kg 000000 ppm T pphm T ppb 000000 0 1 1 0 100 the mass fracion is 4 2 ug g the mass fraction is 4 2 x 10 UNUN the mass fraction is 4 2 ppm 00000 the relative uncertainty is 6 7 x 10 j 0 O 0 the relative uncertainty is 6 7 ppb 00000 1 808 606 0 1 1 00 0 1 UU 1 kgg DUDU 1 unt U mass per length UU lineic mass 0000000 mass per unit length O00000 67 ml n o pO 0 1 Ii 1 1 O20 200400 00000 10 0 0012 0 10310 10mm to 12 mm 0000 10to 12mm 000 10 12mm D0000 0 C to 10 C DD Oto 10 C 000 0 10 C 00000 24 mm 36 mm 0 00 22x36 mm 000 24 x 36 mm 00000 00000 2 28 0000 290 23 2 C 23965 D D 0 60 3 OOOO 60 3 FOO 60 3 00000 0
Download Pdf Manuals
Related Search