キク（Chrysanthemum morifolium）の生育における制御機構の解明に
Contents
1. 42. 15C ACC
3. 2006 LAL 1 m ATE 94 4008 T
4. 1 F
5. Schwabe 1950 T fmi
6. 15C 15C Suttle 1998 Ruonala et al 2006
7. 94 4008
8. ry mE Wn om 48 9
9. Ruonala et al 2006 ARE FOR
10. GA Cockshull and Horridge 1978 Kher et al 1974 1985 2007 1 Clk TEAL
11. c BET VM EK 9
12. 3 3 360 Sun Gro Horticulture Inc 128 7 5cm 1g 13N 16P 10K 1 70 10 12 4 5 12 25 20C 2015C 15 10C FL40SW PPFD 200umol m s
13. f qi 2 FLORICAULA LEAFY CmFL Antirrhinum majus L FLORICAULA FLO LEAFY LFY APETALAI AP1 FRUITFULL FUL 77O LFY FLO
14. Achard et al 2007 Betula pendula Roth Ruonala et al 2006 Solanum tuberosum L Suttle 1998 2 Lot KET
15. 2 3 Schwabe 1950 15C 1980 Schwabe 1955 Vegis 1964
16. TOR 3 m es L Suttle 1998 Ruonala et al 2006
17. 5 Ao 33 2007 7 9 128 7 30 7 5 cm 5 18C 25 4 5 8 7 8 2015C PPFD 200umol m s AT 100 1000 mg L 10
18. Hua and Meyerowitz 1998 OD Lot
19. 3 1975 1980 Schwabe 1950 10 10 15C 25 30 10 4 12 5 1000 mg L 7x vi amp ik 0 025 TritonX 100 0 025 TritonX 100 10
20. 11 9 9 1 7 31 7 28 2 35 4 19 3 HA 4 5 3 BR PGE E
21. 2 Narumi et al 20053 Hua and Meyerowitz 1998
22. Ek 1970 1975 1980 HH 1959 1985 1974 1975 2007 1980 1984 5 2008
23. No 33 No 10 No 19 No 27 No 33 No 45 No 33 15C
24. 43 94 4008 Tit Horvath et al 2003 Ruonala et al 2006 Vegis 1964 94 4008
25. ELT m Kk 2 463E4HUB E OSH OTI LL LC Ze ZED 7 SED F HOR 10 94 4008 9 4 5 HE 94 4008 fy W
26. APETALAI FRUITFULL CmAFLI LEAFY FLORICAULA LEAFY CmFL Cy7 ERORE L CHE
27. STS STS 8 27 9 17 2 R STS STS F 3 6 25 STS IX STS 85 7 9 17 STS 42 9 STS 64 3 STS STS
28. 4 5 8 24 ix 8 H 24 15 10C 3 84M 1 3 15 10C 21 25 20C
29. 18 p x M 1 1
30. do HE 6 ent 120 ent GA
31. iX 10C Schwabe 1950 12C 10C CORD 3 BSS BAEC ih 3
32. 3 X 1 Lang 1957 Pharis and King 1985
33. nt Chrysanthemum morifolium 49 EFR Rod W King Abeles F B P W Morgan and M E Saltveit 1992 Ethylene in plant biology 2nd ed Academic Press San Diego Achard P M Baghour A Chapple P Hedden D V D Straeten P Genschik T Moritz and N P Harberd 2007 The plant stress hormone ethylene controls floral transition via DELLA dependent regulation of floral meristem identity genes Proc Nat
34. Suttle 1998 ACC BIR 69M STS ELE 1 FEON Reagan 2006 11 1 2007 4 5 360 128 4 26 HE 50 cm x 33 cm x S 14 cm 5 PAP Wr 15C 25C
35. En ES Water El Ethephon 2 100 100 80 80 S 60 60 Sh g 40 40 8 8 20 20 0 1 1 J 0 1 1 1 15 10C 20 15 C 25 20 C 15 10 C 20 15 C 25 20 C m C Azuma started on Apr 5 D Azuma started on Aug 24 g 8 z 100 r 100 80 F 80 F S 60 60 Sh g 40 Fr 40 8 8 20 r 20 e 0 1 L J 0 1 1 1 15 10C 20 15C 25 20 C 15 10C 20 15 C 25 20 C ED E Reagan started on Apr 5 F Reagan started on Aug 24 E 100 100 3 L L 80 F 80 F ua o 60 r 60 Sh 8 40r 40 8 g 20 F 20 r Aa 0 1 1 J 0 1 1 J 15 10 C 20 15 C 25 20 C 15 10 C 20 15 C 25 20 C Growing temperature light dark Fig 2 Effect of ethephon temperature and season on percentage of flowering plants in chrysanthemum Percentage of flowering plants of control plants open bars and ethephon treated plants gray bars When plants were transferred to SD phytotrons one spray treatment of ethephon 0 or 200 mg L was applied to plants Data were collected 6 weeks after transferring to phytotron n 10 A Sei marine started on April 5 B Sei marine started on August 24 C Azuma started on April 5 D Azuma started on August 24 E Reagan started on April 5 F Reagan started on A
36. Harada and Nitsch 1959 TT T 1 Reagan 94 4008 2006 9 4 360 128 7 5 cm
37. 1 ACC X 1985 Wi 1974 1975
38. 2007 7 10 17 hk iX 9
39. TER Chrysanthemum morifolium 27 3 Azuma Line 94 4008 E 22 bn 5 o 1 s L 0 E Sei marine Seiko kogyoku E amp 2 E 2 E o I 0 Ham E 3 Jimba Reagan X 2 5 3 g 1 E 0 3 Seiko no iori Seiko shin nen E S Ei 2 3 g 1 o E 0 LT HT E LT E 3 _ Shin midori E Ez Por E 1 E HT LT HITE LT E Fig 8 Effect of ethephon and cold pre treatment on internode length in chrysanthemum Internode length cm between the fourth and fifth leaves above the leaf that was the topmost expanded leaf at the beginning of treatment Cold pre treatment was given to the plants at 3 C for 30 days When SD started one spray treatment of ethephon 1000 mg L was applied to plants HT unchilled plants without ethephon LT chilled plants with ethephon HT E unchilled plants with ethephon LT E chilled plants with ethephon 9 HT HT E LTLT E LT LT I Seiko shin nen 4 re uy Fig 9 Nine cultivars at the end of experiment E shows ethephon treated plants HT un
40. 9 FOH Ti STS EL mo m n RE Hw amp WE EE HT ex tH 20C
41. DTE CK Reagan 2004 11 H 1 Sea 50 cm x 33 cm x 14cm 3 2005 2 14 5 15C 25C 3 mos 0 025 TritonX 100
42. 3 10 11M 9 17 Ava rey lin A Reagan on Jun 25 B Reagan on Sep 17 15 r Flowering plants iie 8 Bl Non flowering plants S8 I I I 10 rt 10 F E Ga o H 3 E 5r 5 2 z 0 0 Cont SIS Cont STS C Shuho no chikara on Jun 25 D Shuho no chikara on Sep 17 30 r 30 r o gt S 20r 20 r ua o n 3 E 10 10 s z 0 0 Cont STS Cont STS Fig 10 Effect of STS and season on increased number of leaves after transfer into SD phytotron in chrysanthemum Data Were collected 8 weeks after transfer into SD phytotron A Reagan started on June 25 B Reagan started on September 17 C Shuho no chikara started on June 25 D Shuho no chikara started on September 17 Values are means SE n 14 Significant differences between control and STS ANOVA P 0 01 0 05 BROW
43. 4 5 8 24 ZMR 5 2 3 4 Biddle et al 1976 Prunus cerasus L Olien and Bukobac 1978 1 W
44. 17 7 H 13 3 4 5 RCE US T 4 5 3E HAEN 2 4 5 fb
45. 6 25 HHO STS STS 10 9 17 STS 15 3 STS 12 2 STS STS 6 25 STS tH EX STS 10 9H 17 STS 8 8 STS 10 4 STS FFOR STS
46. 1985 2007 Battey 2000 2002 1980 Schwabe 1950 Vegis 1964
47. Arabidopsis thaliana L Heynh t Ei b 3 In 3 S B LAL T
48. v Harada 1959 Kohl and Kofranek 1957 iX Pharis and King 1985 22 v GA 94 4008 T GA 20 Tompsett and Schwabe 1974 GA Hordeum vulgare L
49. E 1 b Kawata and 1 2 2003 2000 LAL
50. Fragaria x ananassa Duchesne S nsteby and Heide 2006 30 Vegis 1964 15C 1 3 2002 1980 Populus tremula L x P tremuloides Michx CO CONSTANS FT FLOWERING LOCUS T
51. Suttle 1998 3 Table 3 Effect of STS and season on percentage of flowering plants in chrysanthemum Date of transfer into SD phytotron Jun 25 Sep 17 Treatment Cont STS Cont STS Reagan 100 100 100 100 Shuho no chikara 85 7 85 7 42 9 64 3 Sampled 8 weeks after transfer into SD phytotron n 14 A Reagan on Jun 25 B Reagan on Sep 17 Flowering plants F 25 Bl Non flowering plants 35 L 5 I 20 5 r 20 r E T amp 15r 15 F E 2 g 10 10 2 Sr SF 0 0 Cont STS Cont STS jsos C Shuho no chikara on Jun 25 15 r D Shuho no chikara on Sep 17 E 10 F 10 E xo S E 5 S jt 0 0 Cont STS Cont STS Fig 11 Effect of STS and season on stem length of chrysanthemum Data were collected 8 weeks after transfer into SD phytotron A Reagan started on June 25 B Reagan started on September 17 C Shuho no chikara started on June 25 D Shuho no chikara started
52. Hanks 1982 Hazebroek et al 1993 Hisamatsu et al 2004 Hisamatsu and Koshioka 2000 Metzger 1985 Nakayama et al 1995 Nishijima et al 1997 Nishijima et al 1998 Zanewich and Rood 1995 Harada and Nitsch 1959 3 Chrysanthemum morifolium 47 GA GA
53. No 33 081258 23 Aida et al 2008 GUS GUS A GUS GUS
54. K Smr Lm zu na gt nd nN Yum ux 46 9 1 1 3 Tu
55. Vegis 1964 H 2 t H Toyoda 1982 L Cockshull 1976
56. 2006 6 1 L 5 18C 25C 10 26 V 360 128 7 5 cm 4 5 11 17 11 20C 17 5C 15C 3 8 10 PPFD 200umol m s 9 dE
57. N Table 2 Effects of ACC on flowering and internode length of chrysanthemum Sei marine When plants were transferred into a growth chamber controlled at 20 15 C light dark with an 8 h photoperiod 10uL of ACC 0 10 or 50uguL was applied to the shoot tips Total ACC dose ug plant Percentage of flowering plants Internode length mm 0 61 5 10 1 0 6 100 15 4 2 8 0 4 500 0 1 1 0 1 Data were collected 9 weeks after ACC treatment Values are means SE n 13 Significant differences between effects of ACC treatments on internode length ANOVA P 0 01 Length between eighth and ninth leaves above the leaf that was the topmost expanded leaf at the beginning of treatment Chrysanthemum morifolium 31 2 STS 2 5
58. RNeasy Plant Mini Kit RNase free DNase total RNA Transcriptor First Strand cDNA Synthesis Kit 500 ng total RNA Table 4 PCR primers and their sequences used to detect DG ERSI mDG ERS1 etr1 4 mDG ERS1 Nr and CmACTIN Gene name Primer Sequence 5 gt 3 DG ERS1 Forward ACTAATTCAACACCGACAGC Reverse CTCAATCAGATGTATGTGCCA mDG ERSI etr1 4 Forward CCATCAAGGCAGTGGTGAAC and mDG ERSI Nr Reverse TTGAACGATCGGGGAAATTC CmACTIN Forward GATGACGCAGATCATGTTCG Reverse AGCATGTGGAAGTGCATACC cDNA cDNA DNaseFree 7K 5 SYBR Premix Ex Taq 15L 5uL cDNA th PCR CmACTIN GenBank accession no AB205087
59. 3 15
60. CHE CH Tompsett and Schwabe 1974 GAS F CmFL 94 4008 ld Bl zquez et al 1998 CmFL
61. T 1 Reagan 94 4008 2007 7 H 17 D 360 128 7 5 cm 5 15C 25C 1g 13N 16P 10K 10 50mgL UCZ 10 mL BEE 25 mgL UCZ 1 3 12 4 PPFD70umolm s 8 25 mgL o UCZ 12 20 17 5C PPFD 200umol m s HATE 2 4 6 GA 1
62. Lietal 2009 214M 0 7 14 21 28 4 5mm RNeasy Plant Mini Kit RNase free DNase total RNA 500 ng total RNA Transcriptor First Strand cDNA Synthesis Kit cDNA cDNA DNaseFree 5 5uL cDNA SYBR Premix Ex Taq 15uL Fig 21 CmFL and CmAFLI induce early flowering in Arabidopsis thaliana grown under 9 h SD photoperiod at 20 C A Wild type
63. 6 14 3 6 20C 15A 16A BE 17 5C 7596 A BI5 C B175 C 020 C 100 B 5 80r G 5 gt 60 bn S g 3 5 40 F Ay 20 F 0 1 L L L L WT 10 19 33 45 27 27 Line B m15 C B175 C 020 C 20 F I E 8 g o E ob g io 10 2 g o a 0 wT 10 19 33 45 221 27 Line Fig 15 Effects of temperature on flowering and stem elongation of wild type and transgenic chrysanthemum Sei marine A Percentage of flowering plants and B stem elongation at 15 17 5 or 20 C under 11 h photoperiod Data were collected 9 weeks after ethephon treatment All values are means SE n 8 10 Asterisks indicate
64. 1 HTE 94 4008 MEE 5 2005 7 19 8 18 360 128 2 9cm 7 19 8 18 3C ATARE 12 4 9 19 PPFD 70umolm s 9 9 19 6 cm 3
65. 50 a City B js Chilled 8 Bl Unchilled amp 30 S cS o 20 g L di 0 ae 1 1 No chemicals GA 0 GA 0 1 GA 1 GA 10 UCZ application 40 Reagan A 2 30 F S iS amp SD 20 S o B io E 1 BENT 1 1 9 50 F h Line 94 4008 40 f 30 r 20 r 10 r 0 LLL E L 1 No chemicals GA 0 GA 0 1 GA 1 GA 10 UCZ application 40 Nagano queen 30 r 20 r 10 r L 1 1 1 0 No chemicals GA 0 GA 0 1 GA 1 GA 10 UCZ application 0 No chemicals GA 0 GA 0 1 GA 1 GA 10 UCZ application Fig 18 Effect of GA and chilling on stem elongation in chrysanthemum City line 94 4008 Reagan and Nagano queen Shaded bars represent unchilled plants open bars represent 8 week chilled plants Error bars represent SE n 14 GA 0 0 1 1 or 10ug per plant in total was applied over 6 d after UCZ application No chemicals non UCZ and non GA treated plants 94 4008 GA 1ug 10ug VFA 94 4008 GA 18 M
66. mDG ERS1 etrl 4 mDG ERSI Nr d 0 150 d 10 amp E d 18 100 a m 3 E j E g B so o iS 0 WT 10 19 33 45 21 27 Fig 13 Changes in leaf colour of wild type and transgenic chrysanthemum Sei marine on days 0 10 and 18 The value ofL Xx b a shows the degree of yellowing Stems were exposed to ethylene luL L for 48 h starting on day 10 at 23 C All values are means SE n 6 Average daily air temperature C Jun Jul Aug Sep Oct Month Fig 14 Average daily air temperatures in a closed glasshouse where stock plants of wild type and transgenic chrysanthemum Sei marine were grown during summer 3
67. MALY bic 2 Narumi et aL 2005a
68. Narumi et al 2005a ew1 4 Chang et al 1993 Solanum lycopersium Nr Wilkinson et al 1995 DG ERSI GenBank accession no AF547624 Narumi et al 2005b cDNA ZN mDG ERSI erl 4 33 X 0 mDG ERSI Nr No 10 No 19 No 33 Ao 45 mDG ERSI etr1 4 Wo 27 Ao 2Z mDG ERS1 Nr 2 PCR BE 5 15C 25C
69. 94 4008 9 94 4008 L EE
70. Koorneef et al 1985 Wilson et al 1992 Jacobsen and Olszewski 1993 Thlaspi ravens L Hazebroek et al 1993 Eustoma grandiflorum Raf Shinn Hisamatsu et al 2004 Raphanus sativus L Nishijima et al 1998 Brassica napus L Zanewich and Rood 1995 Ek Tulipa t Chrysanthemum morifolium 39 gesneriana L Hanks 1982 Matthiola incana L R Br Hisamatsu and Koshioka 2000 Metzger 1985 Nakayama et al 1995 Nishijima
71. 2000 Tjia et al 1969 Warner and H 1975 2002 1980 2002
72. 200 mg L 10 ARE 0 02596 TritonX 100 10 1 2005 6 18 128 EWR 2005 7 13 1 3 1 0 1 3 7 14 21 1 MOU CRE L 30 mL 23C PPFD200umol m s 1
73. B hlenius et al 2006 Olsen et al 1997 Horvath et al 2003 XE Ruonala et al 2006 Suttle 1998 1 1 ACC EL ACC
74. mm Kawata and Toyoda 1982 16 1997 HE 1984 1987 BO N
75. Wo 33 15C Ao 33 4 m NI 3 38 9 Sh pH 4
76. 14 81M AFE 4 5 2015C 8 24 20715C 50 40 8 24 15710C 2 8 24 4 5 4 5 3 4 5 4 5 4 5 8 24 4 5 20 15C 4 5 5 3 mm 8 H 24 20 15C 10 1 mm 4 5 8 24 4 5
77. 4 Wo 33 BOR 1000 mg L Fig 16 Effects of temperature on flowering and stem elongation of wild type and transgenic chrysanthemum Sei marine Representative A wild type and B transgenic line No 33 plants 9 weeks after growth at 15 17 5 and 20 C under 11 h photoperiod BIT 17 No 33 No 33 100 Table 5 Effects of ethephon on flowering and stem elongation of wild type and transgenic line No 33 of chrysanthemum Sei marine When plants were transferred to a growth chamber controlled at 20 15 C light dark with an 8 h photoperiod one spray treatment of ethephon 0 100 or 1000 mg L was applied
78. 19 20 Duffet 1957 1930 Poesch 1931 1932 1936 Post 1931 1934 1950
79. 16 178 182 1985 17 227 232 Hanks G R 1982 The response of tulips to gibberellins following different durations of cold storage J Hort Sci 57 109 119 Harada H and J P Nitsch 1959 Flower induction in Japanese chrysanthemums with gibberellic acid Science 129 777 778 Hazebroek J P J D Metzger and E R Mansager 1993 Thermoinductive regulation of gibberellin metabolism in Thlaspi arvense L II Cold induction of enzymes in gibberellin biosynthesis Plant Physiol 102 547 552 PERS 1974 AKA 7 STH OM KURVE B 6 62 67 50 9 Hisamatsu T and M Koshioka 2000 Cold treatments enhance responsiveness to gibberellin in stock Matthiola incana L R Br J Hort Sci Biotech 75 672 678 2002 71 2 431 Hisamatsu T M Koshioka and L N Mander 2004 Regulation of xn gibberellin biosynthesis and stem elong
80. 1 ACC STS B XT 5 2 B3 E 7 XT 3 1 ER 2 ZLORICAULA LEAFY CmFL i Dill Chrysanthemum morifolium Ramat 2006 20 3 1000 9
81. 8 24 4 5 STE 24 Zz JB C 2
82. 4 5 8 24 A Sei marine started on Jul 13 B Sei marine started on Aug 24 NBz NBNB 40 Water 40 Ethephon 30 30 20 20 Days to visible flower buds 10 10 0 L L J 0 1 1 J 15 10C 20 15 C 25 20 C 15 10C 20 15 C 25 20 C C Azuma started on Jul 13 D Azuma started on Aug 24 NB NB NB B 40 40 5 E 30 X 30 2 20 20 2 10 10 S S A o 0 15 10C 20 15 C 25 20 C 15 10C 20 15 C 25 20 C Growing temperature light dark Fig 6 Effect of ethephon temperature and season on days to visible flower buds in chrysanthemum Days to visible flower buds of control plants open bars and ethephon treated plants gray bars after transfer into SD phytotron When plants were transferred to phytotrons one spray treatment of ethephon 0 or 200 mg L was applied to plants A Sei marine started on July 13 B Sei marine started on August 24 C Azuma started on July 13 D Azuma start
83. ce nil 1 5 15C 25C 360 128 7 5 cm PREY 1g OR 13N 16P 10K 4 5 8 20 15C mos PPFD 200umolm s 10 50uguL ACC 0 02596 TritonX 100 10gL ACC NEN 100 500ug
84. lt 7 26 128 8 24 12 25 20C 20715C 15 10C 6 4 5 4 5 25 20C 2
85. 6 J 10 cm 200 mL 300 ML OAT ABH 23 C 70 12 O PPFD 10umolm s 2 T 34 9 10 50L ULL 48 23C 70 12 CM 2600d 0 10 18 L a b L b a L x b a Doi et al 2004 4
86. 2 3 1 1R 15 10C 30 40 2BD AFE 15 10C 4 5 25 20C 8 24 25 20C N 5 5 STE 10
87. 7 SED STE BELO 94 4008 koc 9 80 2096 L 9 2 SEL EK
88. 5 15 25C 1g 13N 16P 10K 10 Rademacher 2000 UCZ P 50mgL 10 mL UCZ 0 5 mg 25 mg L 1 12 20 15C PPFD 200umol m s 25 mgL UCZ 2 4 6 GA 1 0 0 025 0 25 2 5ug GA 10 0 025 TritonX 100 104L GA
89. p 8 Wn KE fci of ethylene evolution from ethephon and from ethephon treated leaves of sour cherry J Amer Soc Hort Sci 103 199 202 Olsen J E O Junttila J Nilsen M E Eriksson I Martinussen O Olsson G Sandberg and T Moritz 1997 Ectopic expression of oat phytochrome A in hybrid aspen changes critical daylength for growth and prevents cold acclimatization Plant J 12 1339 1350 Pharis R P and R W King 1985 Gibberellins and reproductive development in seed plants Annu Rev Plant Physiol 36 517 568 Poesch G H 1931 Studies of photoperiodism of the chrysanthemum Proc Amer Soc Hort Sci 28 389 392 Poesch G H 1932 Further studies of photoperiodism of the chrysanthemum Proc Amer Soc Hort Sci 29 540 543 Poesch G H 1936 Prolonging the flowering period of chrysanthemums with the use of supplementary illumination Proc Amer Soc Hort Sci 34 624 626 Post K 1931 Reducing the daylength of chrysanthemums for the production of early blooms by the use of black sateen cloth Proc Amer Soc Hort Sci 28 382 388 Post K 1934 Production of early blooms of chrysanthemums by the use of black cloth to reduce the length of day Cornell Univ Agr Exp Sta Bull 594 3 30 Rademacher W 2000 Growth retardants effects on gibberellin biosynthesis and other metaboli
90. STS STS 6 25 9 17 HHO 811M 6 25 9 17 STS FFON 6 25 STS STS 9 17 STS STS 32 9 17 2 cm 3 B STS BO
91. 0 2 5ug B GA 10 0 025 TritonX 100 GA 104L HEY OHM GA 0 10ug UCZ GA 12 FR DER S eA ea EEL 4 GA D CmFL CmAFLI CmFL 413 Dendranthema lavandulifolium Fisch ex Trautv Kitam FLO LFY DFL Maetal 2008 97 Li et al 2009 CmAFLI 236 7 API FUL CDMS Shchennikova et al 2004 69 Ti et al 2009
92. 0 02596 TritonX 100 0 025 TritonX 100 16 6 OAM MEL ATMA 2 R 1 DG ERS1 mDG ERS7 etr1 4 mDG ERS1 Nr 12 Ag79 No33 BLEU No45 No 10 No21 Ao2Z A 0 8 F Bl mpG ERSI etr1 4 mDG ER
93. 4 5 BE Oe 8 24 4 5 8 24 4 5 fifi Feld 3 5 mm 4 5 4 5 8 24 15710C Chrysanthemum morifolium 21 A Sei marine started on Apr 5 B Sei marine started on Aug 24 O Water E amp 20 F BEthephon F S I 50 xb S 2 o 10 H E B R 0 1 J 1 J 15 10 C 20 15 C 15 10
94. WHE LOCH v7 Af DG ERSI mDG ERSI etr1 4 mDG ERSI Nr CmACTIN iX 4 DG ERSI 3 DG ERSI 3 xS JEBISR mDG ERSI etr1 4 B k U mDG ERSI Nr 3 NOS PCR 95C 20 95C 5 60C 20 72C 15 40 DG ERSI mDG ERS1 etrl 4 mDG ERS1 Nr CmACTIN 3 Doi et al 2003 5 mA Wr 18C 25 BR 30 cm
95. 0 0 1 1 10ug 3 12 4 8 PPFD 70umol m s 25 mg L O UCZ KW GA UCZ GA 14 56 AIL
96. mt P uv HE BE Tr 1987 COL
97. Chrysanthemum morifolium 17 BL Leopold 1969 Cockshull and Horridge 1978 Kher et al 1974 1
98. 12 24 4 5 4 5 2 4 R 1 HTE 94 4008 K 7 4 5 BIST 5mm GF 8 9 TEE CB Ae m qur 4 5 BOIS SL 6 7 4 v
99. X Cockshull and Horridge 1978 Kher et al 1974 1985 ACC ACC 2X 6
100. 0 025 TritonX 100 13 9 L 8 9 E 8 9 2 ACC 61 5 8 9 10 1 mm 2 ACC 100ug ACC 15 496 8 9 2 8 mm ACC 500ug ACC 8 9 1 1 mm koc ACC
101. 8 7 ESN 1974 TEMPO OME LIGA W
102. Bull Natl Inst Flor Sci 9 13 52 2009 13 Chrysanthemum morifolium 21 5 7 21 10 6 An Approach to Revealing Regulatory Growth Mechanisms in Chrysanthemum morifolium Ethylene and Gibberellin as a Signaling Factor in Growth Regulation Katsuhiko SUMITOMO Summary The plant hormone ethylene suppresses flower initiation and internode elongation in chrysanthemum Chrysanthemum morifolium Ramat as does the application of ethephon which is hydrolyzed in plant tissue and releases ethylene The effects of ethephon are unstable and vary with cultivar and time season and method of application We describe the variation in response to ethephon due to temperature season and cultivar The seasonality of extension growth and flowering capacity growing temperatures and genetic background of chrysanthemum made the effects of ethephon unstable and variable Lower temperatures enhanced the suppression of internode elongation and flowering by ethephon as confirmed by the consistently higher rate of ethylene release and greater slowing of plant extension growth and flowering at lower temperatures After the summer plant growth it became more difficult for ethephon spra
103. Triticum aestivum L FLOWERING LOCUS C FLC VERNALIZATION2 Cockram et al 2007 Dennis and Peacock 2007 Michaels and Amasino 1999 Trevaskis et al 2003 FLC 42 9 City Line 94 4008 on B 100 1 chilled 100 gt 77 Unchilled g 75 r 75 Gey o D 50 50 8 5 o 25 25 D 0 0 1 i No chemicals GA 0 GA 0 1 GA 1 GA 10 No chemicals GA 0 GA 0 1 GA 1 GA 10 UCZ application UCZ application Reagan Nagano queen 2 100 e 100 Fe D E 75 r 75 F Q o D 50 F 50 F 8 5 P 25 F 25 r Or Or No chemicals GA4 0 GA 0 1 GA4 1 GA 10 UCZ application Fig 20 Effect of GA and chilling on flowering in chrysanthemum 1 No chemicals GA 0 GA 0 1 GA4 1 GA 10 UCZ application City line 94 400
104. STS 10 Lk STS STS STS SEL Suttle 1998 7992037 u 3 6 25 STS 814 81 2 2002 1980 2
105. 1 mL GC 14B 3 7 Chrysanthemum morifolium 19 A Sei marine started on Apr 5 B Sei marine started on Aug 24 NB NB NB 5 Wat 40 Bae 40 5 Ethephon 2 30 30 2 2 20 20 u 8 10 10 a 0 L 1 1 0 L 1 1 15 10 20 15 C 25 200C 15 10C 20 15 C 25 200C C Azuma started on Apr 5 D oa starica 40 40 30 30 20 20 10 10 0 0 15 10C 20 15 C 25 200C 7 10C 20 15 C 25 20 C Ton Aug 24 Days to visible flower buds E Reagan started on Apr 5 F Reagan started on Aug 24 NB B o H 40 F E li 15 10 C 20 15 C 23 20C 15 10 C 20 15 C 25 20 C Growing temperature light dark o Days to visible flower buds N Fig 1 Effect of ethephon temperature and season on days to visible flower buds in chrysanthemum Days to visible f
106. 7 0 2 mM STS 1m 3L 6 4 360 128 7 5 cm 1g 14 1 6 H25 6 cm 12 HAR 20 150 PPFD 200umol m s amp RA EF CHE 3 8
107. 1991 L SS 1 1 zx Yang and Hoffman 1984 Abeles et al 1992 N Harada and Nitsch 1959 Tjia et al 1969 GA LOL
108. MME Cit 70 1 Lot T 15C 1980 3 1975
109. 2 UCZ GA UCZ GAX 94 4008 3 5 6 8 18 UCZ Zheng etal 2004 UCZ 18 19 GA GA tH 40
110. UCZ UCZ UCZ GA UCZ GA X CmAFLI 14 zz UCZ UCZ GA CmAFLI 1 94 4008 CmAFLI UCZ GA 1 UCZ 2 UCZ UCZ GA CmAFLI CmAFLI
111. YTA 94 4008 2 WT 20 UCZ GA YFA 94 4008 UCZ GA GA ATUS 94 4008 OF uv GA 10ug 7 19633 X 21 4 GA 10ug 94 4008 fiL GA DIAL E Wed r4 P E 2 UCZ 18
112. Coen et al 1990 Weigel et al 1992 4P77 Chrysanthemum morifolium 43 FUL IX API Ferrandiz et al 2000 LFY LFY Bl zquez et al 1998 Lolium temulentum L FLOWERING LOCUS T King et al 2006 King and Evans 2003 Li et al 2009 ZLO LFY CmFL GenBank accession no AB451217 API FUL CmAFL1 GenBank accession no AB451218
113. 20 15C 21 22 5 15 10 C light dark Water 20 15 C Water o 25 20 C Water A Sei marine on Jul 13 oo 60 40 20 80 C Azuma on Jul 13 60 40 20 e 0 5 10 15 20 Ethylene release rate nL g FW hr Ethylene release rate nL g FW hr Days after treatment BIT amp 15 10 C Ethephon m 20 15 C Ethephon e 25 20 C Ethephon 80 B Sei marine on Aug 24 80 D Azuma on Aug 24 0 5 10 15 20 25 Days after treatment Fig 4 Effects of temperature and season on ethylene production in shoot tips of chrysanthemum A Sei marine after treatment started on July 13 B Sei marine after treatment started on August 24 C Azuma after treatment started on July 13 D Azuma after treatment started on August 24 When plants were transferred to SD phytotrons one spray treatment of ethephon 0 or 200 mg L was applied to plants Values are means SE n 3
114. B 35S CmFL transformant The terminal flower arrow is visible C Left wild type Middle and right 35S CmAFL1 transformants 44 9 PCR CmACTIN GenBank accession no AB205087 KET CmFL CmAFLI B X U CmACTIN 6 PCR 95C 20 95C 5 60C 20 gt 72C 15 40 CmFL CmAFL1 CmACTIN PCR Table 6 PCR primers and their sequences used to detect CmFL CmAFL1and CmACTIN Gene name Primer Sequence 53 CmFL Forward CATTGATGCCATATTTAACTC Reverse ACACGGATCATTCATTGTATA CmAFL1 Forward CAAGCTCAACCATCAATAGTC Reverse TGCAGCACATGAACGAGTAG CmACTIN Forward GATGACGCAGATCATGTTCG Reverse AGCATGTGGAAGTGCATACC Reagan A CmFL No chemicals A UCZ O UCZ GA 0 8 0 6 Relative expression level Relative expression level 0 T 14 21 28 Days after treatment started
115. Ethephon content mg L No 33 Wild type Percentage of flowering plants 0 100 100 100 31 3 100 1000 0 100 Stem elongation cm 0 21 5 0 3 22 6 0 3 100 11 4 0 8 20 6 0 8 1000 6 6 0 2 15 5 0 9 Data were collected 6 weeks after ethephon treatment Values are means SE n 16 Significant differences between wild type and No 33 at the same rate of ethephon ANOVA P lt 0 01 P Ethephon 100 mg L Ethephon 1000 mg L WT 9 Ethephon 100 mg L Ethephon 1000 mg L7 No 33 Fig 17 Representative A wild type and B transgenic line No 33 plants of chrysanthemum Sei marine 6 weeks after transfer into a growth chamber at 20 15 C light dark with an 8 h photoperiod and treatment with an ethephon spray 0 100 or 1000 mg L Water Chrysanthemum morifolium 37 1000 mg L SE 3 amp 2002 1980
116. Suzuki S Kishimoto A Ohmiya and S Satoh 2005b Cloning of a cDNA encoding an ethylene receptor DG ERS1 from chrysanthemum and comparison of its mRNA level in ethylene sensitive and insensitive Chrysanthemum morifolium 51 cultivars Postharvest Biol Technol 36 21 30 Nishijima T N Katsura M Koshioka H Yamazaki and L N Mander 1997 Effects of uniconazole and GA on cold induced stem elongation an flowering of Raphanus sativus L Plant Growth Regul 21 207 214 Nishijima T N Katsura M Koshioka H Yamazaki M Nakayama H Yamane I Yamaguchi T Yokota N Murofushi N Takahashi M Nonaka and L N Mander 1998 Role of endogenous gibberellins in cold induced stem elongation and flowering of Japanese radish Raphanus sativus L J Japan Soc Hort Sci 67 319 324 2008 18 1984 1 16 162 172 1959 29 209 220 Olien C W and M J Bukobac 1978 The effect of temperature on rate
117. 10nLg FW hr 1 5 6 7 13 8 24 3 B Cockshull and Horridge 1978 Kher et al 1974 1985 6 Ww
118. 12 No chemicals non UCZ and non GA treated plants UCZ an application to soil 0 5 mg per pot and spray treatments of UCZ 25 mg L UCZ GA GA 10ug per plant in total was applied over 6 d after UCZ application NB No visible flower buds UCZ GA UCZ GA CmFL UCZ GA Lo 77Y Bl zquez et al 1998 Oz UCZ 7 CmFL UCZ UCZ GA UCZ UCZ GA UCZ GA 18 6 15 3 LEH L 7c UCZ 27 8 15 8 Lk
119. 39 Lang A 1957 The effect of gibberellin upon flower formation Proc Natl Acad Sci USA 43 709 717 Li T T Niki T Nishijima M Douzono M Koshioka and T Hisamatsu 2009 Role of CmFL CmAFL1 and CmSOC1 in the transition from vegetative to reproductive growth in Chrysanthemum morifolium Ramat J Hort Sci Biotech 84 447 453 Ma Y P X H Fang E Chen and S L Dai 2008 DFL a FLORICAULA LEAFY homologue gene from Dendranthema lavandulifolium is expressed both in the vegetative and reproductive tissues Plant Cell Rep 27 647 654 Metzger J D 1985 Role of gibberellins in the environment control of stem growth in Thlaspi arvense L Plant Physiol 78 8 13 Michaels S D and R M Amasino 1999 FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a repressor of flowering Plant Cell 11 949 956 Nakayama M H Yamane H Nojiri T Yokota I Yamaguchi N Murofushi N Takahashi T Nishijima M Koshioka N Katsura and M Nonaka 1995 Qualitative and quantitative analysis of endogenous gibberellins in Raphanus sativus L during cold treatment and the subsequent growth Biosci Biotech Biochem 59 1121 1125 Narumi T R Aida A Ohmiya and S Satoh 2005a Transformation of chrysanthemum with mutated ethylene receptor genes mDG ERSI transgenes conferring reduced ethylene sensitivity and characterization of the transformants Postharvest Biol Technol 37 101 110 Narumi T Y Kanno M
120. C 20 15 C C Azuma started on Apr 5 D Azuma started on Aug 24 20 r E amp 5 So I 5 10 F o E 9 E 0 1 J 1 J 15 10 C 20 15 C 15 10 C 20 15 C E Reagan started on Apr 5 F Reagan started on Aug 24 30 r r g E s 20 f F bo T X 10r E 0 1 i 1 1 15 10 C 20 15 C 15 10 C 20 15 C Growing temperature light dark Fig 3 Effect of ethephon temperature and season on internode length in chrysanthemum Internode length mm between the fourth and fifth leaves above the leaf that was the topmost expanded leaf at the beginning of treatment of control plants open bars and ethephon treated plants gray bars When plants were transferred to SD phytotrons one spray treatment of ethephon 0 or 200 mg L was applied to plants A Sei marine started on April 5 B Sei marine started on August 24 C Azuma started on April 5 D Azuma started on August 24 E Reagan started on April 5 F Reagan started on August 24 Values are means SE n 10 2 4 5 25 20C
121. ER ys 2000 55 3 130 133 Tjia B O S M N Rogers and D E Hartley 1969 Effects of ethylene on morphology and flowering of Chrysanthemum morifolium Ramat J Amer Soc Hort Sci 94 35 39 Tompsett P B and W W Schwabe 1974 Growth hormone changes in chrysanthemum moliforium Effects of environmental factors controlling flowering Ann Bot 38 269 285 Trevaskis B D J Bagnall M H Ellis W J Peacock and E S Dennis 2003 MADS box genes control vernalization induced flowering in cereals Proc Natl Acad Sci USA 100 13099 13104 Vegis A 1964 Dormancy in higher plants Annu Rev Plant Physiol 15 185 224 Warner H L and A C Leopold 1969 Ethylene evolution from 2 chloroethylphosphonic acid Plant Physiol 44 156 158 Weigel D J Alvarez D R Smyth M F Yanofsky and E M Meyerowitz 1992 LEAFY controls floral meristem identity in Arabidopsis Cell 69 843 859 Wilkinson J Q M B Lanahan H C Yen J J Giovannoni and H J Klee 1995 An ethylene inducible component of signal transduction encoded by Never ripe Science 270 1807 1809 Wilson R N J W Heckman and C R Somerville 1992 Gibberellin is required for flowering in Arabidopsis thaliana under short days Plant Physiol 100 403 408 Yang S F and N E Hoffman 1984 Ethylene biosynthesis and its regulation in higher plants A
122. dark Flowering Non flowering Flowering Non flowering Sei marine 15 10 C Water 21 9 0 6 28 0 0 6 Ethephon 31 8 0 7 35 5 0 4 31 9 0 4 20 15 C Water 20 5 0 5 19 4 0 7 37 0 Ethephon 26 4 0 8 41 6 2 0 42 8 1 1 25 20 C Water 22 1 0 5 19 8 0 3 Ethephon 25 1 0 6 30 1 0 7 Azuma 15 10 C Water 24 1 0 3 22 3 0 2 Ethephon 34 2 1 4 36 5 1 5 35 8 0 4 20 15 C Water 26 7 0 7 21 3 0 4 Ethephon 33 7 1 3 44 6 1 8 48 0 1 7 25 20 C Water 25 2 0 5 22 5 0 3 Ethephon 27 9 0 3 35 4 0 6 Reagan 15 10 C Water 19 1 0 3 22 8 0 2 Ethephon 20 9 0 2 32 9 0 2 20 15 C Water 18 8 0 3 19 6 0 4 Ethephon 19 5 0 3 25 7 0 2 25 20 C Water 20 1 0 4 20 8 0 3 Ethephon 22 6 0 4 26 32 0 3 When plants were tarnsferred into SD phytotrons one spray treatment of ethephon 0 or 200 mg L was applied to plants Values are means SE n 10 Sampled 6 weeks after treatment started D 8 H 24 8 24
123. days J Hort Sci 51 441 450 Cockshull K E and J S Horridge 1978 2 Chloroethylphosphonic acid and flower initiation by Chrysanthemum morifolium Ramat in short days and in long days J Hort Sci 53 85 90 Coen E S J M Romero S Doyle R Elliott G Murphy and R Carpenter 1990 floricaula A homeotic gene required for flower development in antirrhinum majus Cell 63 1311 1322 Dennis E S and W J Peacock 2007 Epigenetic regulation of flowering Curr Opin Plant Biol 10 520 527 Doi M Y Nakagawa S Watabe K Aoe K Inamoto and H Imanishi 2003 Ethylene induced leaf yellowing in cut chrysanthemums Dendranthema grandiflora Kitamura J Japan Soc Hort Sci 72 533 535 Doi M S Watabe K Aoe K Inamoto and H Imanishi 2004 Leaf yellowing of cut chrysanthemum Dendranthema grandiflora Kitamura Shuho no chikara induced by ethylene and the postharvest increase in ethylene sensitivity J Japan Soc Hort Sci 73 229 234 Duffet W E 1957 The impact of year round flowering on commercial chrysanthemum breeding p 68 72 In E L Scott ed The Breeder s Handbook The National Chrysanthemum Soc Inc Bogota Ferr ndiz C Q Gu R Martienssen and M E Yanofsky 2000 Redundant regulation of meristem identity and plant architecture by FRUITFULL APETALA1 and CAULIFLOWER Development 127 725 734 1984 7 9
124. et al 1997 1 STE 94 4008 7 8R Kohl and Kofranek 1957 SOO
125. growth and flower formation in pot chrysanthemums J Japan Soc Hort Sci 43 91 96 King R W and L T Evans 2003 Gibberellins and flowering of grasses and cereals prizing open the lid of the florigen black box Annu Rev Plant Biol 54 307 328 King R W T Moritz L T Evans J Martin C H Andersen C Blundell I Kardailsky and P M Chandler 2006 Regulation of flowering in the long day grass Lolium temulentum by gibberellins and the FLOWERING LOCUS T gene Plant Physiol 141 498 507 Kohl H C and A M Kofranek 1957 Gibberellin on flower crops Calif Agr 11 5 9 1970 p 257 275 7 1975 44 286 293 1980 107 113 1985 54 87 93 Koornneef M A Elgersma C J Hanhart E P Van Loenen Martinet 49 fci L Van Rijn and J A D Zeevaart 1985 A gibberellin insensitive mutant of Arabidopsis thaliana Physiol Plant 65 33
126. significant differences between wild type and transgenic lines at the same temperature ANOVA P 0 01 36 15C 6 17 5C 15C No 79 10 No 10 10096 No 33 20C No 10 5 15B 16A BI No 7 15C 4 cm 17 5C Ay 6 15C No 10 No 19 No 27 Ao25 No 21 Ao33
127. 1 iE LZ 2 UCZ GA MH 18 6 CmFL CmAFL1 E UCZ GAK 94 4008 23 8 H THE LETER i 4 Li et al 2009 AT 22 X UCZ 14 UCZ HE GA CmFL 7 94 4008 UCZ CmFL 94 4008 UCZ GA WH Line 94 B CmFL 4008 E UCZ GA 0 7 14 21 Days after treatment started 28 Fig 22 Effect of GA on the expression of CmFL and CmAFLI in chrysanthemum A CmFL in Reag
128. 15 10C 8 24 8 24 4 5 3 4 5 4 5 20 15C 4 5 1X 1 2 2015C 9096 18 4 mm 8 24 20 15C 15 1 mm 4 5 15710C 0 100 15 10C 25 20C 20 15C 2 3 8 H 24
129. 3 E 1 194 4008 UCZ GA HR 18 c Chrysanthemum morifolium 4l GA 0 1 No chemicals GA 0 G
130. 8 Reagan and Nagano queen Percentage of flowering plants of unchilled amp broken line or 8 week chilled plants solid line Data were collected 56 days after transfer into the SD growth chamber Error bars represent SE n 14 GA 0 0 1 1 or 10ug per plant in total was applied over 6 d after UCZ applications No chemicals non UCZ and non GA treated plants Sheldon et al 2000 94 4008 GA GAS
131. A 1 GA 10 UCZ application Fig 19 Plants grown in SD with or without the application of GA A Unchilled line 94 4008 B Chilled line 94 4008 C Unchilled Reagan D Chilled Reagan GA 0 0 1 1 or 10ug per plant in total was applied over 6 d after UCZ application No chemicals non UCZ and non GA treated plants Tompsett and Schwabe 1974 GA 730 nm GA Hisamatsu et al 2008 20 0 2002 94 4008
132. M Heide 2006 Dormancy relations and flowering of the strawberry cultivars Korona and Elsanta as influenced by photoperiod and temperature Sci Hort 110 57 67 IRA WEHABOR 2003 2 319 324 2007 7 1 7 HII AIR 2008 8 1 7 Suttle J C 1998 Involvement of ethylene in potato microtuber H n d Do m E dormancy Plant Physiol 118 843 848 2006 1 5 17 31 i 4 52
133. SI Nr 0 6 r Relative expression level 02 F WT 10 19 33 45 DG ERSI 0 1 F I p5 HH Relative expression level 0 1 WT 10 19 33 45 21 27 Fig 12 Q PCR analysis of mRNA of A mDG ERSI etr1 4 and mDG ERS1 Nr and B endogenous DG ERS1 in shoot tips of wild type and transgenic chrysanthemum Sei marine Transcript levels were compared directly after normalization against a CmACTIN loading standard All values are means SE n 3 Chrysanthemum morifolium 35 Ao2Z 21 2 0 10 18 L x b a 13 L x b a 10 10 48 OL x b a L x b a
134. T 1 WT 1 S15 3 2 Chrysanthemum morifolium 23 A Sei marine started on Jul 13 B Sei marine started on Aug 24 2 Water El Ethephon 8 100 f 100 f E E 80 F 80 r 60 60 F Sp 8 407 40 5 2 20 r 20 r amp 0 0 1 15 10C 20 15 C 25 20 C 15 10C 20 15C 25 20 C C Azuma started on Jul 13 D Azuma started on Aug 24 E g 5 100 F 100 F S amp sor 80 S 6r 60 F Sb S 407 40 F 5 9 20r 20 amp 0 z 0 15 10 C 20 15 C 25 20 C 15 10C 20 15 C 25 20 C Growing temperature light dark Fig 5 Effect of ethephon temperature and season on percentage of flowering plants in chrysanthemum Percentage of flowering plants of control plants open bars and ethephon treated plants gray bars When plants were transferred to SD phytotrons one spray treatment of ethephon 0 or 200 mg L was applied to plants Data were collected 6 weeks after transferring to SD phytotron n 10 A Sei marine started on July 13 B Sei marine started on August 24 C Azuma started on Jul
135. UBER D HALE AE Chrysanthemum morifolium 25 196 flowering E Days to visible flower buds Azuma g Line 94 4008 NB NB NB z NB NB NB E 175 a 175 L 8 g L 5 100 lt E00 P 9 so Z 8 EN Uu j 50 S 80 E j 50 5 9 GH L i 60 F im o 60 r zh bn E o Z 40 125 8 40 125 D a 2 20r z 8 20 F g D 5 5 4 0 L L L 0 un Ay 0 1 1 1 0 y y Sei marine 4 75 ep Seiko kogyoku 4 75 5 100 f 8 6 100 F 8 3 I S 2 ES T lt J LE d un 80 A 50 amp amp 80 i 50 amp GH e Cc 5 op E a 8 60 7 a 5b Q 60 S 40r 4125 S 40H J25 B 5 B 8 20 E z gor z e 0 1 1 1 0 2 Ay 0 1 1 1 0 gt g J oh Jimba 175 amp Rea
136. an B CmFL in line 94 4008 C CmAFL1 in Reagan D CmAFLI in line 94 4008 Changes in the gene expression are shown as calculated value relative to the maximum value in the same Q PCR assay Error bars represent SE n 4 No chemicals 8 non UCZ and non GA treated plants UCZ A an application to soil 0 5 mg per pot and spray treatments of UCZ 25 mg L UCZ GA O GA 10ug per plant in total was applied over 6 d after UCZ application Chrysanthemum morifolium 45 Table 7 Effect of GA on flowering and extension growth in chrysanthemum line 94 4008 and Reagan Treatments No chemicals UCZ UCZ GA UCZ GA Line and cultivar Days to visible flower buds 94 4008 23 8 0 7 a NB gt 90 22 3 0 6a Reagan 18 6 0 1a 27 8 0O 1c 201 03b Percentage of flowering plants 94 4008 100 0 100 Reagan 100 100 100 Increased number of leaves after transfer into SD phytotron 94 4008 19 6 0 5a 20 3 0 5a 23 6 0 9b Reagan 15 3 0 2a 158 02a 16 8 0 3b Stem elongation cm 94 4008 26 7 1 8 b 0 6 0 la 31 0 0 6 b Reagan 23 4 1 4b 0 7 0 1a 27 9 0 7 c Significant differences determined at P lt 0 01 using Tukey s test are indicated by different letters in each line Values are mean SE n
137. ation by low temperature in Eustoma grandiflorum J Hort Sci Biotech 79 354 359 Hisamatsu T K Sumitomo and H Shimizu 2008 End of day far red treatment enhances responsiveness to gibberellins and promotes stem extension in chrysanthemum J Hort Sci Biotech 83 695 700 Horvath D P J V Anderson W S Chao and M E Foley 2003 Knowing when to grow signals regulating bud dormancy Trends Plant Sci 8 534 540 Hua J and E M Meyerowitz 1998 Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana Cell 94 261 271 Jacobsen S E and N E Olszewski 1993 Mutations at the SPINDLY locus of Arabidopsis alter gibberellin signal transduction Plant Cell 5 887 896 p 63 81 CE 1991 Kawata J and T Toyoda 1982 The responses to photoperiod and temperature in Japanese July to September flowering chrysanthemums Acta Hort 125 93 99 JHR BA Z FHS h 1987 A1 182 222 Kher M A M Yokoi and K Kosugi 1974 Effect of Ethrel on the
138. c pathways Annu Rev Plant Physiol Plant Mol Biol 51 501 531 Ruonala R P L H Rinne M Baghour T Moritz H Tuominen and J Kangasj rvi 2006 Transitions in the functioning of the shoot apical meristem in birch Betula pendula involve ethylene Plant J 46 628 640 2007 6 411 416 Schwabe W W 1950 Factors controlling flowering of the chrysanthemum I The effects of photoperiod and chilling J Exp Bot 1 329 343 Schwabe W W 1955 Factors controlling flowering of the chrysanthemum V De vernalization in relation to high temperature and low light intensity treatments J Exp Bot 6 435 450 Shchennikova A V O A Shulga R Immink K G Skryabin and G C Angenent 2004 Identification and characterization of four chrysanthemum MADS Box genes belonging to the APETALAI FRUITFULL and SEPALLATAS subfamilies Plant physiol 134 1632 1641 Sheldon C C D T Rouse E J Finnegan W J Peacock and E S Dennis 2000 The molecular basis of vernalization The central role of FLOWERING LOCUS C FLC Proc Natl Acad Sci USA 97 3753 3758 1997 12 1 71 Sgnsteby A and O
139. chilled plants without ethephon LT chilled plants with ethephon HT E unchilled plants with ethephon LT E chilled plants with ethephon When SD started one spray treatment of ethephon 1000 mg L was applied to plants Chrysanthemum morifolium 29 4 SE 94 4008 Doi et al 2003
140. ed on August 24 Values are means SE n 10 NB no visible flower buds during experimental period 4 5 8 24 2002 Lk 4 5 1510C 8 24 15 10C WT hd Wm 2 3 RI Z Vegis 1964
141. ent The transgenic lines showed reduced ethylene sensitivity ethylene caused leaf yellowing in wild type chrysanthemums but the leaves remained green in the transgenic lines Extension growth and flowering of wild type and transgenic lines varied between temperatures at 20 C the transgenic lines showed the same stem elongation and flowering as the wild type At cooler temperatures the wild type formed rosettes with an inability to flower and entered dormancy but some transgenic lines continued to elongate and flower This supports the involvement of the ethylene response pathway in the temperature induced dormancy of chrysanthemum At the highest dosage of ethylene releasing ethephon wild type plants formed rosettes with an inability to flower and became dormant but one transgenic line did not This confirms that dormancy is induced via the ethylene response pathway The plant hormone gibberellin GA induces flower formation in several long day plants and exogenous GA can partly substitute for chilling treatment in cold dependent plants Both chilling and GA are required to promote flowering of the short day chrysanthemum as observed in many plants Chilling and GA requirements for the flowering of 4 cultivars were examined and their genetic variation was shown those that required GA also required chilling for flowering but those that did not require GA showed no chilling requirement GA had little effect on the increase in expression of CmAFL1 a
142. gan 3 35 amp e g 100 F S E100 Fr S 80 80 7 50 2 9g 150 amp 9 60 F fy S 60r E D 3 o X B 8 40r 195 d m 240 125 3 5 B o 20 F c 8 20 Fr c 5 z7 B S o 0 8 amp 9 MES Seiko no iori EE Seiko shin nen 775 X H 2 E 5 100 8 8lO 8 E t 5 E 80 F ch 50 amp e 80 r 150 amp 8 60 60 6 8 oo ch S 40 J25 2 40t qus 8 5 g S o 20 F o D 20 r E 5 S o 0g amp 0 i i 0 amp HT LT HT E LTTE Bb Shin midori 4j 75 J E 100 E L gt 8 L J lt a 80 50 f S 60r z n 8S 40r 1258 D 20 F 8 z an 0 1 1 1 0 B HT LT HT E LT E Fig 7 Effect of chilling pre treatment and ethephon on percent of flowering plants open bars and days to visible flower buds gray bars in chrysanthemum Chilling pre treatment 3 C for 30 days One spray treatment of ethephon 1000 mg L was applied to plants at transfer into SD HT unchilled plants without ethephon LT chilled plants with ethephon HT E unchilled plants with ethephon LT E chilled plants with ethephon NB no visible flower buds during experimental period 26 9
143. l Acad Sci USA 104 6484 6489 Aida R T Narumi N Ohtsubo H Yamaguchi K Kato A Shinmyo and M Shibata 2008 Improved translation efficiency in chrysanthemum and torenia with a translational enhancer derived from the tobacco alcohol dehydrogenase gene Plant Biotech 25 69 75 Battey N H 2000 Aspects of seasonality J Exp Bot 51 1769 1780 Biddle E D G S Kerfoot Y H Kho and K E Russell 1976 Kinetic studies of the thermal decomposition of 2 chloroethylphosphonic acid in aqueous solution Plant Physiol 58 700 702 Bl zquez M A R Green O Nilsson M R Sussman and D Weigel 1998 Gibberellins promote flowering of Arabidopsis by activating the LEAFY promoter Plant Cell 10 791 800 B hlenius H T Huang L Charbonnel Campaa A M Brunner S Jansson S H Strauss and O Nilsson 2006 CO FT regulatory module controls timing of flowering and seasonal growth cessation in trees Science 312 1040 1043 Chang C S E Kwok A B Bleecker and E M Meyerowitz 1993 Arabidopsis ethylene response gene ETRI similarity of product to two component regulators Science 262 539 544 Cockram J H Jones E J Leigh D O Sullivan W Powell D A Laurie and A J Greenland 2007 Control of flowering time in temperate cereals genes domestication and sustainable productivity J Exp Bot 58 1231 1244 Cockshull K E 1976 Flower and leaf initiation by Chrysanthemum morifolium Ramat in long
144. lower buds of control plants open bars and ethephon treated plants gray bars after transfer into SD phytotron When plants were transferred to phytotrons one spray treatment of ethephon 0 or 200 mg L was applied to plants A Sei marine started on April 5 B Sei marine started on August 24 C Azuma started on April 5 D Azuma started on August 24 E Reagan started on April 5 F Reagan started on August 24 Values are means SE n 10 NB no visible flower buds during experimental period 26 8H 24 7 14 10 6 1 le 2 R 1 4 5 A Sei marine started on Apr 5 B Sei marine started on Aug 24
145. n APETALA1 FRUITFULL homologous gene from chrysanthemum under short day conditions With regard to LEAFY in Arabidopsis thaliana GA promoted the expression of CmFL a FLORICAULA LEAFY homologous gene from chrysanthemum and the upregulation of CmFL required GA in cultivars with a chilling requirement Therefore this GA requirement can be attributed mainly to the chilling requirement for flowering Key Words Chrysanthemum morifolium ethylene gibberellin flowering rosette chilling requirement dormancy Chrysanthemum morifolium 15 f Ill 1 1 2 Tt f 2 2008
146. nnu Rev Plant Physiol 35 155 189 Zanewich K P and S B Rood 1995 Vernalization and gibberellin physiology of winter canola Endogenous gibberellin GA content and metabolism of H GA and H GA Plant Physiol 108 615 621 Zheng C G Jin H Ohno T Hara and S Matsui 2004 Ethylene production and endogenous gibberellin content in chrysanthemum plants as affected by uniconazole blushing and aminoethoxyvinylglycine treatments J Japan Soc Hort Sci 73 568 573 Ah 9 cok
147. on September 17 Values are means SE n 14 Significant differences between control and STS ANOVA P 0 01 Chrysanthemum morifolium 33 Ruonala et al 2006 WLR FEL 1 1 mDG ERS1 etr1 4 mDG ERSI Nr
148. ugust 24 HT 4 5 1 2 dd RUM C M 20 22 FE 24 264 18 20 BLE CEDAR 1 4 5 20 9 Table 1 Effect of ethephon temperature and season on increased number of leaves after transfer into SD phytotrons in chrysanthemum Growing Increased number of leaves after transfer into SD phytotrons temperature Treatment Apr 5 Aug 24 light
149. y 13 D Azuma started on August 24 2002 1980 3 Schwabe 1950 15C 1980 Schwabe 1955 1980 1984
150. yed plants to elongate and flower because they were in a low capacity state Cultivars that easily form rosettes and show suppression of flowering arehighly sensitive to ethephon In such cultivars ethephon induced the formation of rosettes and completely prevented flowering Since rosette formation and suppression of flowering could be linked to dormancy in chrysanthemum this indicates that ethylene might be involved in the induction of dormancy in chrysanthemum Temperature plays a significant role in the annual cycle between growth and dormancy of the herbaceous perennial chrysanthemum After exposure to high summer temperatures cool temperatures lt 15 C triggers dormancy Cessation of flowering and formation of rosettes by cessation of elongation are characteristic of dormant plants and can be stimulated by exogenous ethylene of ethephon The Journal of Horticultural Science amp Biotechnology 83 809 815 Journal of Experimental Botany 59 4075 4082 Plant Science 176 643 649 14 9 and 1 aminocyclopropane 1 carboxylic acid Thus the ethylene response pathway might be involved in the temperature induced dormancy of chrysanthemum We used transgenic chrysanthemums expressing a mutated ethylene receptor gene to assess this involvem
Download Pdf Manuals
Related Search