Home

pET System Manual

image

Contents

1. D DI 0 ompT pelBQ 5 0 00000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000 OO Wickner et al 1991 000000 0000000000000000000000000 00000000000000000000000000000 5 0 0000000000000 0000000000000 Ausubel et al 1989 2 000000000000000 0 0000 55 000000000 000000000 0 000000000000000000000000000000000000 1 000 000000 000000 20000000 00 30 30 mM Tris HCl 8 20 0000000000000000 05 EDTA pH 800001 00000000000000000000000 1900000000000 2 4q 10000 x 91 00 0000000000000000000000 3 00005mM 9504 30 OOOOOOO0O0000 OOO00D0000000000 10 4 4q 10000 x ol 10 00 0 00000 1 000000000000000000000000000000000 000000000000000 5 00000000000 00000000 00000000000000000000 0 00000000000000000000000000000000000 6 000000 0000030000000
2. 000000 00000000 00 0000 1 0 00000000000000000000000000000008000000000000 0 0000000000000000000000000000000000 0000000000 0 000000000000000000000000000000000000000000000 0 000000000000000000 6 0000000000000000000000 0 000000000000000000000000000000000000000000000 0000000000000000000000000000000008570000000000 0 0000000 000000000000000000000000000000000000 00 20000000000 0 000000000000000000000 kan pETOO 000000 000000000000000000000000000 000000000 000000 00017000000000000000000 717 000000000000 00000000000000000000000000000 0000008 7000000000017 0000000000000000000 0 00000000000000 7000000000 1 00 0000000000000000000000000 700 0000000 7 0000000 0 000 00000008 000000 0 000000000000000008590000000000000000000000000 OOO 43 1 00 440 000008 DO0000000000000
3. Novagen X pET System Manual 00000000 7 0000000000 lt 00000000000 DES 000000000000000000 Grossman e al 1998 00000000 00000000 05 1 00000000000000000000000000 1200000000 0 0000000000000000 0000000000 0 000000000000000000000000000000000000000000000 0000000000 00000000 000000 plyssg 0000000000 000000 pLyssh 00000 0 0000000 50 0 00000000000 000000000 000000000000000001 60 00000000000000 30 0000000 0 0000000 7 24 0000000000000000000000001 60 0000000 00 0 00000000000000000000001 60 00000000 0000000 00000000000000000000000000000000000 0000000000000 98900000000000000000000000000000000 000000000000000 2 300000000000000000000000
4. GO Op O G1 2 Co Co oaoa D Oo p pH ou o H oo oo oo vc L3 mao ax L3 E3 E3 EJ woo L3 EJ p r3 pr DE 2 Oo Oo zT d 1 e BOOOOOO000000000000 116 kDa ga 00000000 0000 00000000000 000000000000000000000000000000000000000 0000000000000000000000000000000000 0 000000000000000000000000000000 spose 0000000000000000000000000000000000 00000 0000000000000000000 000000000 oO Co Co Co Co o0 9 C3 C3 C3 460 000000000000000 49 000000000000 00000000000000000000000000000000000000000 00000000000000000000000000000000000000000 00000000000000000000000000000000000000000 0 0000000000000000000 00000000000 BetaRedB Galactosi
5. 00000000000 5 0 00000000000000000000000000000000 FRETWorks SQ 0 50 Tag Rapid Assay Kt 000000000000000 Novagen pET System Manual IN 0 00 10000000000 EcoPro 00 0 0 O RNase 92100000000000000000 Mobius 1000 Plasmid Kit 000000 708533 00 0000000000000 RNase 0006 00000000000000000000 0000000000000000 RNase CAAQ 1 1 240 0 1 0000000000000000 0000000000 00 01000 3M 0 0 0 Co d Ooo Noga L3 LI 000000 20000000000000000000 200 30 00000 12000 90 5 0000000000000 70000000 DNAQ 30 2u Pellet Paint Pellet Paint NF 00000000 00000000000000 Pellet 0 0000000 20 91 00000000000000000000 E UED EIE E E E 0 Novagen Mobius UltraMobius Plasmid kit J 1 O 0000 RNase
6. oop GIVES EES 20 Oo L EJ Oo Co Oo 2 Oo L 2 Co Oo o Ct ColiRollers Plating Beads CaliRollers 00 00000000 100 2 0000000000000000000000000 0000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000 00 CaliRallers 000 0 0000000 120000001 LT Novagen X L1 00 oO 3 3 FET 9 oOo og BRET E E Co So 0 00000000000000000000 0 000000 000000000000000000000
7. GST Tag pET 41 42a c Nus T ag pET 43 1a c 44a c I0 O 0 0 Factor Xag Ps 1000 5 2000 0 000000000000000000000000000000000000000000000 Factor 00000000000000000000 0 000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 0 0000 20 9 00000000000000000000 Chang 1985 Le Bonniec 1991 Le Bonniec 1996 Facior Xa Blunt Cloning Site Factor jm sector Insert vector p mm Blunt Cloning Site Pha GAC GAC GAC AAG AGT Coo I b a Fri seta GAT GAC RA A a 5 A Sma Blunt Cloning Site Sima GTC CCC 220 F E J Thrombin 1 Smal voor CTG GTC CUGA XXX L V P R Thromten Ligation independent Cloning Ligation independ
8. 4 0000000000000000000000000000 1200 0000000000 O30 0000100000002 000000000 0000000000000 0 00000000000000000000000000000 50 19400000000 00000 00 00000 000 00 0 0 00 00 0 0 00 00 00 0000 000 0000000000000000000000000000000000000 5 50 52 15 0 95 000 00000000000000000000 2u IO Pellet Paint 000 0 0 690493 0 0 0 Pellet Paint NF 0 0 0 0 0 70748 3 O O 0 000 Pellet Paint EcoPro T 7 00000000000000000000000 14000 g 9 00000000000 000000000 00000 100 000000000000000000000 0000000000000000 504 0 000000 000 0 000 20 4 000000 Novagen pET System Manual IN OOOPCROOOOOMO000000000000D 1 2004 00000000000000000000000000000000000000 110 0 000000000000000000000000000000000000 0 0000000000000000000000000000000000000000 00 20 2 Sou 00000000 05 0 000000000000000000000000000 3 00000000000 99 00000000 5100000000000 DNase 0 0 OOO 4 12 000 ol 10 00000000000000 5 104 0 PCRO 0 000 05 0 0000000000000000
9. A 100000000 00000 A 2 00 000000000000000000000000000000000 500 00000000000 101 0 1 9 00000 2600000000000 000000000000000000000000000000000000 2200000000 00000000000000000000000000 00000000 70000000000000 000000000000000000 04 mma 1 0 00000000000 7 00000 000000000000000000000001 12 60 000000000000000 0000000 190000000000000000000000000000000000000 0000000 0 00000000000000000000000 420000 0000 00000000000000000 1260 000000000000000000 0000000000000000 Rosetta DE3 0 0 Tuner DE3 Origami B DE3 O lacY 1 0000000000 ad 000000000000000000000000000000000 000000000000000000000000000000012 6 0000000000 000000000000000000000012 60 0 0 1 m 000001 60 000000000000000000000000000000000000000000000 100000 00000000000000000000000000 250 m Erlenmeyer 00 00000000 00000080 0 50 000000 000000000000000000000000 2d 00000 0000000000000000000000000000000 0000000000000 00000000000 000000000018002 000000 37 oD 060 1000 00000 0000 000 COCCOMOCUCU 00000049 00000000000 00000390 000000000000000000 221 00000 02000000000 50 0 00000000 0000000000600 80000000000 0000000000
10. BL21 DE3 0 D D HMS174DE3 0000000000000000000000000000000000000 m Dubendorff and Studier 1991 50 n 000000000000000000000000000 1200000000000000000 Control of the Tac Promoter pLyss0 0 0 pLysED 0 0 0 7 Moffatt and Studier 1987 Studier 1991 2 Inouye e al 1973 0 T7 RNAD 0 000000000000000 Zhang and Studier 1997 Huang et al 19991 0 0000000 O 184 Chang and Cohen 1978 00 0 00 0 00000 0 10 6650 11296 T7 DNA Dunn and Studier 1983 7 38000000 0 00000000000000000000000000 O 184 20 000000000000000000000000000000000000000000 000 550 0000000000000000000000000000000 8 0 00000000000000000000 55 1 00000000000000 0 00000000000000000000000000000000000 00000
11. 5 OO xO 7F Oo 0000000 26100 0000000000 000000000 00000000 0050 11000000 0 eLyssr 00000 0 000000000000000000000000 0 000000000000000000000 plysso U D Novy and Morris 2001 8 5 O Grossman et al 1 00000000 Oo Oo Cl Eo Cl Coy BT um 0 00 00000000 Oo Oo L3 L3 p L3 r3 H oO zl Se Se eS 2 ELE EES 2 a o 9 L3 moo L3 r4 L3 L3 lt E3 C3 C3 EDS E3 C3 F3 L3 p4 L3 F3 E3 r3 L3 L3 p4 Novagen pET System Manual IN 000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000 0000000 00000000000000000000000000017100000000000 00000000 pLacI 0 0 0000000 placlQOO0000 000000000
12. System 0000000000000000000000000000000000000 00000 7 7 0 000000000000000000000000000000000000000000000 0000000000000000000000000000000000 50 000000000 0 000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 na agpiunpngununuuapnannunnunuuapanpnnnunuauapapnpngununaddur7 0000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000 001 00000000000000000000000000000000000 CE6 A p0 7 5 7 00000000000000000000000000000000001 60 000 0000000000000000000000000 200077 000000000000000 0000000000000000000000000000000000000 0 00000000000000000000002 00000000000000000 000000000000000000000000000000000000000000000 00000000000000 T7 00000000000000000000000000000 171000000 0 0000000000000000000000000000000000000000000000 0000 64 000000000000000000000000000000000000000 00
13. 0000 0 0 000000000000000000000000000000000 000000000000000000000000000000000000000000000 000000000 1 00000000 1min 0000 020 0 0 1004 10 0 Popcuture 0 000000 2 00000 1510 0 0 4000 50000 1 0 0 rLysozyme Solutiong 00000000000 000000000 550 0 0 5 0 00000 rLysozymeq 0000000000 00000 17710 O 1u 0 2540 J Benzonase Nuclease 0 0 0 0 DNAD OO RNATI OOO 00000000000 0 rlysozymey 0 0 Benzonase 0 0 0 0 0 PopCulture 00000 00 0 200 150000 0000000000000000000000000000 000000000 505 00000000000000004 SDS Sample Buffer 0000000 70607 30 000000000000000000000000000000 0000 060 30 00000000000000000 9900000000000 00000000000000000000000000000000000000000 FRETWorks 50 Tag Assay 50 Tag Rapid Assay GST T ag 0 00 J O O 0000000000 00000000000000000000000000000000000000000 00000000000000000000000 0 00000000000 000000000000000000000000000000 14000x 90 1000000 000000000000000000000000000000000 55 0 0 0 000000000000000000000000000000000070 550 mp 0 00000000000000000000000000000000000000000 0000000000000 0000 SDSPAGEG 0 00 0000 0 50 Tag Rapid Assay J 0 D FRET Works 0 Tag Assay 0 00000000000000 0 0 0000 100000 Total Cell Protein 00000000 Total Cell
14. 0000000 00 58 00000000000000 000 0000000000000000000000000 000000000000000 0 00 0000000000 Novy and Morris 20011 0000 0 000000000000000000000000000 71000000000000000 0000000000000000000000000000000000000 0 00000000000000000000000000000000000000000 55 0 00000000000000000000000 7 00000000000000000000000000000000 Novagen pET System Manual 0000000000 pLysS 5 000000000000000000000 5 0000000000000000000000000000000000000000000000 7 0 0000000000000 21550 0000000000000 pLyss 00000000 50 mM Tris HCl 2 mM EDTA pH 8000000000000 0 000000000000000000
15. Co 00000000000000000000000000000050000000000000 7 0000000000000000000000000000000000000000 254 dNTPs 000 D 2598 50 0 0 1 9 00000 0 0 0 0 00 0003 000 000000000000000000 Pst 10 Kpn iQ Sac Sac BstX Apa D D D Aat II O U PCR I D D U ug ggnunanPemuunun ugnunaungagggnagaggggaanagagaadT uuggnanugngagnggaggananuagnggagaanaaggagxumnasna rauugnaagu 7 U U O pETUpstream 30000000000 000000000000000000000000000000000000000000000 000000 qgagmn yuunanganuagngnangaggnagnggagngagagagnaaadu 0071 000000000000000000000000000000000003 0
16. 3m 000000000000000 2 051000000 37 250 QO 0000000 0 9050000003 00000000000000 100m 1800000000 3 100 00 0000000000 U 051 1000000 37 co 20 3ii DD DD 0 0000000000000000000095 0000000 4 000000000 100 0000 50 20000001724 0000000000 00000000000 SOMO 000 12 000019 0 0000000000 00 0 7 00000000000000000000004 0 00000 IPT 00 00000000000000000000000000000000000000000 16000 0 000000 0000000000000000000000000000000000 0000000900 0 1 0 0000000000000000000000000000000000000000 0000000 0 57 17000000 2 0000 90 1 000000000000000000000000 90 1 0000 010 0 0 0 0 0 0000000000000000000000000000 000 00 500 190000000000 0000000000000000000 00000000000000000 3 0000 90 1 000000000000 600 000000 Novagen pET System Manual IN A 00 00 00000 PopCulturer 1 B1 0000000600
17. 0 00000000 Origami O Rosetta gami 0 Rosetta gamiB trxB 000000000000000000 0000000000000000000000000000000000000000000000 0000 O0 00000000000000000000000000000000 000000000000000 000000000 32 lt 0 0000 0 D trxB 0000000000000000000000000000000000000000000000 O Stewart 19981 155 0000000000000000 0 000000000000000000 Tuner 000000000 Origami O Rosetta Rosetta gamiB 9 9 BL219 acY 1 0000 0 00000000000000000000000000000 0000000000000000000000000000000000000000000000 0000 00000000 000 0000000000000000000000000000000000000000000000 O 000 CGA Ne AVAQ Leull O d O CUAD O 0 O Prog OOO tRNAD OOO 00000000000000000000000000000 00000000000000000000000000000 tRNAD 00000000000 0 0000000000000000000000000000000000 84 00000000 000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000
18. 00 DNAD 0 in vitra 000000 in 00000000000000 Mobius Kit O UltraMobius Kit O ODO UO O O O 0 0 0 5 0000000 SpinPrep Plasmid Kit O O O U RNase 00000000 2990000000000 00000000 0 10000 20600 0000000000000 00004000 0 ES ESI E o pBR322 0000000 oo ond ET L3 L3 L3 L3 LE g 8 oO 2 gt 6 Sine Zrxn lp Cat No 70854 1 TON EJ TOR HI Yield gt 1 mg high cogy SHEL mg Coil emp Plasmid Preparation Kit TOU Plasmid Kit Soale 10 ml u ml 1 5 liter midaxgm THH TOM 10 rxn TOME 25 rxn gt high copy mg mi copy 100 mi high ropy 1 2541 1 adag LitraMaobius LOO Plasmid Kit B m culture pug Clever copi TOWER Mt ran Mobius 500 pET Plasmid 2O0 Plasmid Kit 35 culture gt ihe TOTOE EN Chigh copy mid cap gt UltzaMaolius 21K Plasmid Kit mi culture pp hiogy T1000 25 fhigh popy mid ci gt Spi
19. 0 00000 0000 0000000000000000000000000000000000 000000000 00000 000000000 pET Blue System Manual TB249 TriEx System Manual 250 0 000000000 00000 0 000 00 0 0 0 00000 000 0 00000000000 100000 200 0 500 0000000000000 00000 0 1 400 000000 000000000000000 QHOOOO00000000000O PTGQQOOOOOD Sektas and Szybalski 20021 000000000 339 00000000 000000000 7 RNA 000000000000000000000000000000000000000000000 0 000
20. L3 ITI 08 EE LL 2 go r3 c Hu C4 Onooond LZ E L TI T TITIETX I IET UM ZEE LI 1234 oo oo Oo Co Oo Co j oO Lat Co 1 Ls Co 9 1 Co Co Ll Co Co Ld Co LI 2 mm Co Co Ll ONE Co Co L3 Oo poo od Se ee EE SET Eee Co Be eee oe a EE LI GL LII C3 p4 p3 E3 Ed ric E 2 C3 C3 20 0 000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 00000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 000000000000
21. o f C3 C3 E3 r3 p pr C C c C3 EJ 2 gt 2 2 2 2 21 Q Oo EJ wooo nono Ao Epit Grossman 0 UO U U 0000000 0000000 0000000 DED 10 00000 0 1999 000000000000000000000 000000000000000000000 AMPO 10000000 5 000000000000000 lad Eron Crothers 19841 7 OT7000000 0 000000000000000000000 Grossman et al 1998 Malcom 2000 Novy and Morris 20001 0 0 00 0 00000000000000000 000000000000000 000000 Grossman et al 1998 Pan and Malcom 2000 Novy and Morris 2001 oOo aum nooo w L3 r3 r3 r3 gt ET EE Se EE E mn EL Seo gt Ei a E E Ett Oooo 5 UN 2 Im gt m N r an r3 r3 r3 8 lt 5 1 U 2 a
22. 0000000000000000000000 in pET System Manual 00 00000000000000000000000000000000000000000 00000 190000000000000000000000000000000000 0000000000000000000000000000 0000000000000 0000000000 1800000000000000000000000000000 0000000000 00000000000000000000000 00000000000000000000000000000000000000000 00000000000000000000000000000000000000000 00000000000000000000000000000000000000000 00000000000000000000000000000000000000000 00000000000000000000 15900000000 37 00000000 00000000000000000000000000000000000000000 000 0000 7000000000 00000 0000000000000 150 189 0000000000000000 000000000 0200 0000000000000000000 erm 39 00 00000000000000000000 000000000 00000000000 00000000000000000000000 000000000000000000 2000 0000000000000000000000000 0 00000000000000000000 2000 0000000000000000000000000 vitro 000000000000000000000000000000000000000 0000000000000000000000000000000000 0000 00000 00000000000 00000 00000000000000000000000000 00000000000000000000000010 5 14 10000000000 00000 10 5 01
23. 0 00000000000000000000000000000000000000 0000000000000000000000000000000000000000 10000001 x ESI 000000 50 000000000 651000000000000000000000 0000000000000000000000000000000000000000 41 lt 0 00 000000 Factor Xal 000 00 GSTQ 0 0 2 Oo 4 E E 28 OO 00000000000000000000000000 amp 80 0000000000 0000000000 eS 51 56 Ea 0000000000000000000 0 000000000 Tagi La Vallie et al 1993 Novy et al 1995 000000 0000000000000000000000000 0 000 Stewart 19981 32a c 0 0 0 Too P m m 3 O 2 Q 9 3 wee oo oog q x oo B pm gm 00000000000 0 trxB 0 0 0 Origami Origami Rosetta 000000000000000000 pET 43 1a c 0 O PET 90 Tah 000000 00000 Tah 00000000000000000000000000000000000 000000 Davis et al 1999 Harrison 20000 40 000 0
24. 5 7 m ex i Tz z u lt 55 2 w W 9 I Ul 9 9 9
25. LI LE LI LI EL Cel EEL LT FLT FLT BEL 6r 9 f CI oO oO oO oO oO oO Il Oo Eo LI Co Ez Co Co Co 70 20 4 oO ooog 8 H r3 Co Oo Oo Oo A oo L3 L3 r3 r3 0 r3 L3 r3 oo w Too Ed E3 Ed r3 E3 amn L3 r3 ETF EDET G So oe eo 2 pcnc ogo Q O Jo ooo oo oon looong rrr woo 2 EJ oO oO oO oO oO Co Co iz Co LJ Co Oo Co Co Oo L 0 Q 2 lo ot Co Co Co Co Co EJ Co oo oo Oo oO Oo Oo Oo Oo Lr Lr 129 Lr LE D m Novagen pET System Ma
26. B834 BL23 BLR Origami Rosetta HOST CELL for Expression Tuner OOOO 8000 d d O Grodberg and Dunn 19880 0 0 O00 0000000000000000000 0000000000000000000 81 210 00000000000 Rosetta gamiB Novagen OO U BL210 000 00 0000 00 000 0000000000000 Origami 00000000 pET System Manual IN Tuner 0 00000 0 Origami Rosetta Rosetta gamiB 8 21 0000000000 gunagngnagnagagnagaagaanaggugd edna nmnau ung evYzinn natatatdbgg iPrmcun 000000000000000000000000000000000000000 0 Lr E Ooo Oo LE oO Oo Oo oO oO Co oO oO oO 00000000 00000000 00000000 00000000 0 0 0000000 0000000 gorl rigami Origami B Rosetta t tH oS oc cl oo
27. 0 0000000000000 850 00000000000 Harrison 20000 43 1a c 0 44 0 00 00000 00 00000 00000 0000 0 0 0000 txB 90 000 Origami Origami Rosetta gamiB 000 0000 Oo 000 0 000000000000000000000000000000000000000 origami Origami Rosetta gami Rosetta gamiB 04947 0 0 0 2 000000000000000000000000000000000000000000000 0 000000000000004 054940 21 00000000000000000 Novagen X pET System Manual
28. TOL32 4 phot CEND EeadEun Columns TOMA pagel THIRD Cap riiy is H ng per cobamn 701244 GST purificatiom Cat Size Technical Bulletin and Features GST Bind Resin 70641 3 l m TREE Capacity 5 5 mgm settled resin 7064 1 4 ml Buffer Kit 7064 3 TRE All buffers for ten 2 5 ml columns Mag T1084 3 TRE Magnetic aarmer beads Capacity up io 2 TIDE Dm settled vobame CEST Purification T TU4 3 TEES CSTs Resin Buffer Bughluster Benzonsse and Chromatography Colui Palme GST hie Purification Kil TESS Process dI i ml purifying up tio LPO pa peer 9 euius GETeMag Purification TB327 Purify ta 4 mg peer walls Mis Tag purification Cat Na Size Technical Bulletin No Cnpacity and Features Ni NTA Eire Bind Resin TOS TH27T3 Capacity is 5 10 mg ml settle resin 25 ml TEES 100 mii Saper law THEE I dmi TEH273 Capacity is 5 10 mgm resin b gh flow Than l 35 ml rates and pressures TRAI 100 Ni NTA Baller TORTS TH2TS All haera purification using Novagen Hist and Ni NTA Sugserfli pET System Manual IN Resin Hise BulTer Kit His Bird Columns His Quick Columns H
29. Fraction DU TED i Rampes Feri lamih mulak Lits suem Fraction Q 00000000000000 0 0000000000000000 5 5 000 00 0 0 0 0 00 0 0 0 0 00 00000 0 00000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000 0 00000000000000000000000000000000000000000000 000 00000000000000000000 430000 E ETE A 505 0000000 OD JOOOOOOOOO0O0O000O0000000000000000000000000 0000000000000000000000000000000000000 Perfect Markers 0 O 0000 69149 31 O O 690793 Trail Mix Markers 0 O 0 0 0 O 70980 30 0 00000000000000 10 225 00000 0 00000 0000 00000 Er 2 ir 000000 0000000 U 00 00 Dilution Factor OD of diluted DD al harresi OF Sample DF x DD of diluted sample Lidice Lure Uninduced Culture 000000 2 0000 19100000 BI 0 0 505 000000000000000000000000000000000000000000000 0000 0 0000000000000000 100 000 00000000000 10000000 000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000 Volume to Lead 15 well mini pel 1 well mini pel Sample conc D at leone Factor x 180 ul
30. 00000 Origami Origami Rosetta gami 0 Rosetta gami 00000000000 50000 000 00000 0 5010000000000000000000000000000800000000000000 0 00000000000000000000000000000000000000000 5000 0000000000000000000000000 Factor 0000 0 0 0 000 00000 0000000000000 2 000000000000000000000000000000000000000 Fusian Tags Available for pET Constructs KC Terminal Tag or internal i Sine aa Basis Deigctssn and or Purilication PET Weclor 527168 Ti Tag 11 2680 maneckenal intu AP IF IP WB 3 5 8 11 T7 17x 21 23 24 28 33 15 Sprotin 10483 atliniby AP DA WE 29 30 32 34 37 33 44 HissTag amp B nr 1l metal chelation chromatography native AP IF MB 14 16 18 44 denaturng monoclonal antibody HSV Tag LH 11 antibady IF Wa 25 7 43 1 44 etii ompT N 202 potential periplasmic localization PE 12 20 22 25 26 27 125 highly pressed domain FP 31 4 104 promeses disullide bond DB SP 12 formation especially in ind and frat gor hosts site 5 kinaes A racognitien site 33 CRD N 1
31. 00000000 Expression Systems OOOOOOOU00000000000000000000000000 e 10u 9 Oo e 0000 BL21Q 210 3 BL214DE3pLyss nnunnu unnunuunuunnunpnaan Peptide Expression System 319 0 0 BL210 0 000000 BLRO BLR DE3 pLysS m 320 2 00000 0 000 000 000 000 199000 000000 0000000000000 NovaBlue BL21 DE3 0 2 50 ion m gt CASES i x nO c D Uu lt oa N 3 Ep r3 Novagen pET System Manual IN D pET Studier Studier and Moffatt 1986 Rosenberg et al 1987 Studier et al 1990 0 000000000000000000000000000000000000000 0 0 000000000000000000000000000 e 000002 0
32. 67 68 68 Copyright 1992 2002 by Novagen Inc All rights reserved patent pending BetaRed BugBuster CBDoTag ColiRollers Clonables DsboTag EcoPro EKapture EXlox FRETWorks GSToBind GSToMag GSToTag HisoBind HisoMag HisoTag HSVoTag LumiBlot Mobius NovaTaq NovaTope NusoTag Origami Pellet Paint Perfect DNA Perfect Protein pETBlue pETcoco PopCulture pSCREEN RoboPop Rosetta RosettaBlue Rosetta gami SoTag Single Tube Protein Singles SpinPrep STP3 Strandase T7oTag Trail Mix TriEx TrxoTag Tuner UltraM obius Xarrest the Novagen name and logo are trademarks and registered trademarks of Novagen Inc Superflow is a trademark of Sterogene Bioseparations Inc Fractogel and Benzonase are trademarks of Merck KGaA Darmstadt Germany MagPrep is a trademark of EM Industries Inc CBIND is a trademark of CBD Technologies Inc Triton is a trade mark of Rohm and Haas Co Bacto is a trademark of Difco Inc The pET system is covered by U S Patent no 4 952 496 A non distribution agreement accompanies the products Commercial customers must obtain a license agree ment from Brookhaven Science Associates before purchase The pET 32 vectors are sold under patent license from Genetics Institute Inc For research use only Licenses for commercial manufacture or use may be obtained directly from Genetics Institute Inc 87 Cambridge Park Drive Cambridge M
33. 12 1 4 Novy and Morris B 2001 inMewations 15 3 160 Novy R Taeger and Miller S A HEAT T 1 7 Pan 5 and Malcom B A 2000 1221 1238 Novagen Ed X pET System Manual Preibisch G Ishihara H Tripier D and Leineweber M 1988 Gene T2 170 186 Prinz W A Aslund F Holmgren and Beckwith 1007 Biol Chers 272 15081 15567 Raina 5 and Misatakas D 1587 Anan Bi 179 202 Rietsch A Belin D Martin and Beckwith J 15849 Pro Natl Acad Sei B3 1038 1306 Ritz Dk Lim J Reynolds C M Poobe and Beckwith J 20011 tence 2894 158 1040 Rosenberg AHL Goldman E Dunn J J Stadier FW and Zubay G 19080 J Bacteriol 175 716 722 Rosenberg Lade B N Chui D S Lin SW Dunn JJ and Studier FW 1887 eroe B 135 135 Rudolph R and Lilie 1969 FASER J 10 40 56 Sambrook J Fritsch EF and Maniatis T 1989 Mafeeudar Cloning Laboratary Manual Cold Spring Harbor Laboratory Press Cold Spring Harbor New York Schein and MLM 1989 Aix Technology T 1141 1148 Schenker E T and Mierendorf 1085 Nucleic Acids Res 13 Schenk F M Baumann S Mattes and Steinbiss 1905 Biotechniques 18 198 200 Seidel HM 0 1 and Knowles AT Biochemistry 31 23508 2508 Sektas M and Sz
34. 5 CCATGGTATATCTCCTTCTT 3 000000000000000 0 0 0 0 0 0 0 0 000 00000000000000000000000000000 in vitrd 0000 0000000000 0 Novagen 000000000000000000000000 00000000 2870 0000 Novagen A pET System Manual I 00000000000000000000000000000007 000000000000 000000000000000000000000000000000000000000000 0000000000000000 Studie et al 1990 0000000000 amp 0000000 bla 000000 mRNA 0 D 000000000000000 10 1 HH B D HO 00000 U mRNA D B HO D 0000000000 00000 000000000000 0 0000000000000000 8 21 0 ong 00000000 emper 0000000000000000000000000000000000
35. 25 hls TREE HSV Tng detection HEV Tag Monoclonal Antibody 1171 8 WE 00171 4 300 Tag detection assay Tag Antibody THIS WA 111274 250 ug S Tag detection nssay AP Conjugate ist Sl THET WH HEP Conjugate Spl WE Biotinylated 69216 3 250p WE FITC Con Ju pire Spl TERIH IF Tag AP Western Blot Kit Bret TEZ colorimetric iol on He Tag AP LumiElor Kit 25 chemiluminescent detection EL HEP Kit PaRI 25 bhks TRIB debatos Tie Tag detection Tr Tag Antibids i223 IP WB EM ng Biotinylated TT Tag Antibody TRIOS WE T Tag Antibody HEP maga in WE Tie Tag Antibody AP Conjugate ES TRI WE TzwTag AP Lisi Kit TUEN S 2h blots THZI2 chemiluminescent detection T74Tag 1 0218 1 25 blos TH chemiluminescent detection IF tmmasofluorescener IF immmunoprecipitacn QA squantsistiye assay WE s Wester blotting Novagen pET System Manual IN QuantiLarivs Cat Nn Size Technical Bulletin FRETWarke S Tag Asaay Kit TUT24 3 anys TESS asy Linde 1 Trucs pee OUI ness Tag Rapid Assay Kit 00212 3 100 sens TERIS Limit fered iT Tag Assay
36. 0 Plasmid 00000000000000000000000 000000000000 00000000 0000000000000000000000000000000 15 00000000 00000000000000000000000 20 5000000000000 2 0 0000000000000000000012000000000000000 3 OOOOH i ff fp Singles 0000000 0000000000000000 0 000000000000000 0000000 20 00000 Step40 00 51 000 4 00 0000000000000000 0 0 18 00 000000000000 000 0000000000000000 Test Plamid 60 00000000000 00000 5 1 0 00000000000000000000000000000000000000000 6 0000000050000 7 00000 42 000000000 300 000000000000000000000000 8 0000000200000 9 OOO MH i ff fh Singles 0000000 000 50 0 0 u 000000 509 0 SOL 000000 0000000000000000 0000000000000000 00000000 00000000 10 00000000000000000000000000000000000000000 00000000000000000000000000000000000000000 000000 50000600 Novagen pET System Manual 00 ColiRollers Plating Beads 00000 NovaBlul 000 000 9000000000000 00000 00000 aC IRE IS 0000 19 0000000000000000000 37 C 250 300 000000000000000000000000 NovaBlue 000 0000000 37 250 rpm 000000000000000 000 OOO0O0O0O0O0000O0OO0OOOOOOOOOOOOOOOOOOOOOOOOOOOO
37. F 000000000000000000000000000000000000000000000 0000000000000000000000000 000 0 0 0000000 000000000000000000000000000000000000000000000 00000000000000000000000000000000000000000 Harlow Lane 1988 00 0000 0 00 000 00 0 0 00 00 000 00 0 0000 0 00 0 000 000000000000000000000000000000000000000000000 0000000000000000 BugBuster 00000000 1 0 BugBuster Benzonase Nuclease BugBuste 0 0000000000000000000000000000000 00000000000000000000000000000000000000000 00000000000000000000000000000000000000000 0000000000 2 0000 2006 9 0 00000000000000 000000 10 mg mtn 0 D 0000000 1500 000 000000000000000000 5000000000 3 19 0000 O 000000 000000000000000 000100000 4 4 16000 9 50 00000000000000000000000000 5 0000000000000 02100 1000000 0000000000 570000000000000000000000200000 6 0 0 505 0 00000000000000000010 SDS Sample Buffer 1510 0 000000000000000000000000000000 0000000000000000000 190000000 100 000000 0000 4X SDS Sample Buffer 0 0 0 O 70607 3 1004 00 0000000 85d 3000 0000 000 00000 00 505 O 208 b 0000000000000000000000000000000000000 0 0000000000 Novagen Protein Refording Kit 0 0 0 000 1X Solubilization Buffer O O O O O U U U 220 0000000000000000000000000 00000000000
38. PopCulture Reagent O O UO O O U PopCulture Reagent 00000000 Grabski e al 2001 Grabski et al 2002 100 150 PopCulture Reagent O O O U O O 00000 0000 FRET Works Tag Assay Kt OOOOOOO000000 0 GSTQ Magi Hist His Tago 0 0 GSTO T agni 000000 0000000 RoboPop Purification Kit 0000000000 327 0 rLysozymel O D D 0 0 Benzonase Nuclease 0 0 0 Tag Assay 50 Tag Rapid Assay Kit e 1 000000000000000000000 00 0 0000000000000 9100 PopCulture Reagent O O O O O O O we Co ag 1 ieee Mise eden 0000000000 1mI 0 0 4000 7500 000 10 0 rLysozyme Solution 50 0 00000 0 00000000 0 0 0 Orlysozyme 0000000 Oo 0 170 00 10 10 2500 0 Benzonase Nuclease 0 0 0 0 enzonasd 00000 000 0 00 49 00000000000000 000000000000 191 50 00000 000 St WEED Q
39. 3000 U 0 21 24 Q 23 0 e 00000000 0 000000000000000000000000000000000 0 0 00000000000000000000000000000000000000 6 000000000000000000 000000 00000 GGA Co Oo 00 00000 00000000 0 oo LE L3 r3 ET E EP p oo Oo E oO oo LI L3 2 Co gt O e oO oO oO oO r3 00000000 000000000000000 4 OO Poon EI oO L I I LI oO 00000000000 2 00000000000300000000 EX Bears 0000000 0000000 0000000 0000000 001000000 00000000 00000000 LI LJ 2 pe LA CIAM JI r c CY ES LL
40. Bind Resin BufTers and Chr liy Columns TH2TS 10 onl Ni NTA Hire ir Resin Bugluster anil Chromatography ol ree THOM U m l HiseHind Resin and Hafer anid Chromatography Columnas THOM Process x oa caltanes purifying up bo 315 ug per 4 ml culture THE Purify bo 12 mg peer H wells Technical Na A Capacity and Features TRIST TRIGG Purify up to 1 gg per Z mil settled resin THET Purify aged cleave up L mg target probin per kx 2 ml sect pein Purity and cleave upto mg target probran per kit 2 ml settled resin ___________ Techical HBulletim No amd Featores THEI 2P minimum jig FT Tag iod settled May vay target proteina THI285 minismim HW TTT quer mil settled resin May vary between target proteina Chie ml of Iuffers oles urificatlon Proteases Chea Capture Kita Bine Technical Bulletis Mos Deseription Thrombin Eestriction Grade Biotinylated Thrombin Thrombin Cleavage Capture Kit Recombinant Enterokinase Enterokinase Cleavage Capture Kit Factor Xa Restriction Grade Factor Xa Cleavage eng La KO U Ta d Bn T 65022 3 5500605 3 Bn TI Bo007 3 AD TT TEXXET 2 TEIR TRISH fl U Biceinylabed Thromlsis Stregiavidir Agarose for Bintiny lated Thrcanhin renea TBI
41. E LE gt LT ea DGG oe Oo zz A pET System Manual Aral Lys Phe Leu 2 0 000000000000000000000000000000000000000 1990000 000000000000000000 2000000 000000000000000000 0000000000000 2000 0 Met 000000000000000000000000 0000000000000000 Nae
42. IN Novagen System Manual YVINOBRRY AT AB10hk AAR The Gold Standard for Protein Expression Advancing your life science discoveries A S pET System Manual 00 1 du 0000000600 4 A 4 B 00000 00 00 0 0 U 00 0 4 00000000 4 b pET 000000 5 uai uu 5 000000000 6 0000 6 000000 8 0000000000 000000 9 0 000000000000000 9 0 0000000000000000000000000 10 LICO LIGATION INDEPENDENT CLONING 000000 10 11 T7lac 000000 11 pLysS 0 pLysEl D 11 0 00000000000000000000000 12 000000000 12 13 00 0 13 000000000 13 H 00000 14 000000000 14 0 0000000000000000 15 uui 15 0000000000000 15 0 000000 15 16 000000 18 J 000000000 CE6 18 000000000 19 20 00 0000 20 0000 21 00001 22 D 0000000 23 E 00000000 24 25 0000000 25 0000 25 000000000 26 00 26 uuu 27 C 28 EcoPro 28 00000000000 29 29 30 30 00000000000 32 00000 00000000000 32 Novagen X pET Sys
43. Novagen pET System Manual IN b 0000001 000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 00000000000000000000000000002000000000000 0000000000000000000000000000000000000000 OOO 100 00000000000000090000000000000000000 0000000000000000000000000000000000000000 OO 100 00000000000000000000000000000000000 00000000000000000000000000000000000000200 0 0000000000000000000000000000000000 0000 0 00000 gt 5 00 0 0 0 0 00 00 EK LIC O O Xa LIC Vector Kits O 00 O00000000000000 O LIC Vector Kitg 0 0 000 000 000 00000 0000 Seen D ma 20000000000000000000000000000000020000000 00000000000000000000000000000000000000000 0000000000000000000000000000000000000000
44. 5 1 750 u 20 mM pH 75 000000000 10000 x gf 50 000000000000000000000000 2 0000000000000 15 1 5058 0000000000000000000 00000000000 000000000 100 0000 00000 0 3 1004 0000000000 1004 2 5808 00000 70 00000000000 00000 0 505 000000 20 000000000000000 1 00000000000000000000000000 16m0 000 40mt 000000 2 00000000000000000000000 244000000 3 5 000 90 151 0000000000000000 000000000000000 20m0 000 400 0 0 000 00 0 0000 31 00000000000000000000000000000000000000000 5 0000000000000000000000000000000000 50 00000 Novagen X pET System Manual 0000000000000000000000000000000000000000 00000 Novageng Protein Refording Kit 000000 1X Solubilization Buffer 0 O 00 2349 0000000000000000000000000 6 0000000000000000 ost 0 50 0000000000000000 1601 081100000000 0000 0 0000000000000000000000000000000000 23410 00 000000010000000000000000000000000000
45. 8 x a 10 El 3 Es v 5 500 0 EJ EE Oo 1 LI FH O L1 L oo oO mi oO Co Co Og Co L3 cg 000000 UJ r3 p r3 L3 c Ngo D D 000000 00 000 000000 000000 0 0 pH N ooo EDs yay ES Ll 000000001000000 000000000000000 00000000000000 000 Mego 00000000000000000000002000 0000000000 Hirel et al 1989 00000000 Ging Glug Phe Lys Trp A 000000000000000000000000000000 Co LI Co Co OO Oo Oo r 8 Q 3 8 as 00000 00000 16 9724 000 Tobias et al 1991 000000000000000000000000000000000 Novagen E 0 0 0 0 0 0 EE T Eats T DIE
46. 8 00000 00 00000 000 0 505 20 9 0 0 00000000000000000000000000000000000000000 000000000000000000000 20 lt 00000 Novagen kA X pET System Manual 10000 L a 0000000000 10000x 90 101 00000 0000 20mM TrisHCl pH 75 00000000000 10x 000000 4mQ00000000000000000000 ee E 3 5 0000 0 00400000000000004 0 0000 00000 10x 000 40 0 00000004710 Ono 3 os zb I N 50 r3 C rn 0 BWHBWBBDBOBOUOUUOUOUOUUUUOUUgUOUgBWuiBibmpggdgudi iiltisli d ad lbdiulbijttduuttu OSM 0 OOOOOCOOOOCOOOOCOCOCOOOOOOOOOOOOOOOO 00000 10 mM CHAPS HUGOUSOUUUUDUUOUUUBuuuluiutiutiiliititutututu 2 00000000000000000000000 French Press b 00 400 5094 8 8 5 0000000000000 00000 4 50000 i Noo 2 m ooo noo oo oo oo m ooOo n Ga bea VEI n r3 B 5 E g r3 BE
47. outoframe 000000000 000000000000000000000000000000000000000000000 0 00000000000000000000000 0 0 0 0 Novagen El IN pET System Manual V 0000000 L3 L3 0 0000000000000000000000000000000000000 0 0000000000000400000000000000000000000 0 0000000000000000000000000000001000000 0 0000000000000000000000000000000000000 0 000000000000000010000000000000000000 UO U PopcuttureQ 0000000000 quick screen OO 000000000 00000000 rr L3 r3 rr Ooo amp See ooo r3 r3 ood ood ood 505 0 000000000000000000000000000000000000000000000 0 00000000200000000000000000 51000 00000000000000 0 000000000000000000000000000000000000000000000 0000 00 00000000000000000000000000000000000000 0000000000000000000000000000000 0000000 1 0 000 000 000 000 000 00 0 000 00000
48. 000000000000000020000001 00000000000000000 0000000000000000 Neco 00000000000000001 000000000 0000000000000 20000000 600000000000000 0000000000000000000000000000000000000000000000 2 00000000000000000000000 Preibisch et al 1988 Halling and Smith 1985 6000000 AUG 00000 00 0 0 0 0 0 0 000 00 00000000000000 00 050 300 0000 00 00000 0 0000 0000000000000000000000000000000000000000 nnninnnnnnnnnnnnnnnn 000000000000000000000000000000 OOO 50 Tag GSTQ Tag His 0000000000000000 7 Tagg 0 O Sprotei Kim and Raines 1993 1994 GST Bind CB DO 000 0 0 Bind 000000000 0 000000000000000000000000000000000000000000 O U 00000 Tessier et al 1984 Looman et al 1986 Lee et al 1987 rbs Ndel Ncol 5 A A GA A GGA GA UA UA CA UA UG 3 5 AA GA A GGA GA UA UA CCA UGG 3 000000000000000000000000000 SCATATGTATATCTCCTTCTT 3
49. ET ELE EI E oo oo LJ G Doo Eee E 2o00 5 e ct oO ao ilizati in Brennan and Lin 1996 0 0 0 00000000000000000000000000000000000000000 00000000000002 000000000000000 0000000000000 0 000000000000000000000000000000000000000 uciease 000000000000000000000000 2611 000000 00000000000 LI m N o 2 D 2 0000 000000000000000000000000000000000 Rietsch et al 1996 Raina Missiakas 1997 Sone et al 1997 120 00 20 22 Novagen C3 EJ o Co Ej Ll A S pET System Manual 25 26 27 36 37 38 39 CBDcenA 0000000000000 Novy et al 1997 0000000 00000000 Snyder and Silhavy 1 0000000 00000000 Kajava e al 395 0 O O pET 40b OOO Oso 0000000 un et al
50. Sere Use at prs 34 mem in ethanal Store at HU Use m 50 mgm in adleionixed warer Boone t AFT Use ni HW pel far cells containing kan pleads aml 15 for cells with pere liri Origami Origami B 126 Store ar Use at 125 LO ig iad lm IN Use at 200 pg ml within 5 days Protect iroa light Calbiochem SMELL biechemi METS biochem 40 Glucose PIER D glucose solution in na Bore serbe salutbosn at reca glucose to LB ngar with antibiotics to a final conceniratiom of 1 5 sae page 12 100 mM FTE amp oltion C D uu 00000000000000000000000000000000000000 gt 10 O0000000000000000000000000000000000 000000 1 000000000000000000000 50m0 000 250 10 000000000 2 061 08100000037 3 090 0000000000000000 80 00000000000 4 000000 70 0000000000000000000000000000000000000000000000 0 000000000000000000000000000000000 34000000000 0000000000000 00000000000000 1 0000000000000000000000000 000000 0 2 000000000000000000000000000000000000 3 0000000000000 70
51. high siringency expressinn host E met labeling B F hands r m gat dem cuntral non expressiun hoes none LL B bais r x J gan dow DET general purpose expression host none _ BLADES plas B ampt dads ir m ga dow DET bagb astrimgency expression heat Chloramphenicol 34 nemi LZ rr DEJ B ompT hed y pal dom expression allows 615 Ble ere DEF ples B recA expression hosi DES empf may div CDES poss Cm ompT had m 1 pal dein i sri recA uro qe ompl hz v m gal dom A sri rec tM Turc are 7 DES F T hak amp hed re my gal dem F recA elle Bye ma RQ DES F rel REM DES ples owl ha TY ape Di 7 ren FARE dae Fj prod Tne disulfide bond formation in E cui bigh etringeo nep pesce o host alles disubfide bond formation in E eoi eytaplnsm nee nom expression bost recommended for use with Eamdem recommended fur use with tandem repeals recA expresion hiphestringency host recomenencded for use wills landem ion exprnisssica host tered expan hoal aed K 12 high asiringnenie y Fxpressbon East non xpressinn host gerieral purpose cloning plasmid preps
52. CO 30700 000000000 6 0000000000000 054 14100 000000 050 10 0000000000000000000000 0000000000000000000000000000000000 000000000000000 2 0000000000000000 000000 000000000 0 002 000000000000000000000000000000000 Oo Ez T c lt ro Bo OO ppp D D SpinPrep Ge DNA Kit 0 0 0000 00003041000 DNAD 50 NO000000 000000 50 000000000000 9 0 20 0 OODOOOO0OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 3000 TEHUIUUUUUU XII UUUUUU CIAA 11 00 000 1 0 2400000 1000 3 2400 10000 00000 00000 0 12000 x 90 070000000000 704 0 0 0 0 Oo Oo Lt B oo na pe BE Oo Ono Lr Oo Ooo Oona Ono e H m e Oo 3 ooo tT CFE EE ooo EI oo Oo Gti 5 Oooo oo Ex ey L3 r3 5 5 DIE LL L3 3 r3 r3 r3 r3 r3 r3 r3 8
53. Enhances ar Tha thal ml TIMA rure used lm E end ACHI ACGA ALUA m l 71054 4 ULLA COLD RGA Allows bond formation in the citi cytoplasm Turer Enables adjpustzhle levels of expresan im alll Dimi elis due to the mutation lower levels mil may enhance sibility ami activity of the target prubein Novagen IN pET System Manual pET Host Strain Competent Cell Sets The competent cell sets are for optimizing vector bost strain combinations Com t Cell Saf Size Cat DES Competent Cell Set Xmbesch TUBES AMADES BE21DE3 BLALIDEFNTER BLRIPEFY HMS THOEN Origami DEST Origen i DES Tuner TET DES Competent Cell Set zmbeseh ADHSHCDESIpLgs8 BL2T7 DESI ORE ee Bip Layee BLE DE AMS DES pled Origami DE pea BOE lass Roe DES Lys Tinen DES i Ly ATEM Competent Cell Bea D2mlench 70091 3 ATI CHEE paras BL2 Compter Cell Bet each THIS BLI BLZICDES ELE FEA BLE Competent Cell Sel m l each TES ELR BLEUE BLE TREE HMSIT Congwtent Cell Set Smbeach 5174 HMI TRDE AMS TES Origami Competent Cell Set ml ach TETA Origami Origami DES Origsmi Origami Compeberd Cell et MA ml 700113 Origami B
54. Fasuan F A Modiann G and Luzzatto L LOTT J Hem Genet ZB 11 16 Calderone T L Stevens and Gas TG 18961 7 Mal Biol 242 407 412 Chang ACY amd Cohen S N Bacterial 134 1141 Chang J Y 1985 Eur J Biochem 151 217 224 Chen G F and Inouye Mul Acids Res 18 1455 1473 Collins Racie LA J M Grant EL DiBlista Smith E A MeCoy J M and LaVallie 1885 Hiotecfenalagg N Y 13 882 967 Davis G D Eliseg C Newham D M imd Harrison RG 10608 Bioeng 65 32 388 Del Tito BJ Jr Ward J M Hodgson J Gerslater CJ Edwards EL Wysocki L A Watson F A Sathe and Kane 1906 J Bacteriol 177 7088 7091 Doherty AJ Ashford SR Brannigan J A and Wigley D B 1005 Acida Res 274 2075 Dnibencdorff LW and Studier F W 1991 Mol Fin 218 45 58 Dunn JJ and Stustier F W 19831 Mot Hiat 168 377 15 Eron L and Block R 1971 Proc Acad Sei S 1828 1832 Fourrter E and Hayes 5 2001 8 9 Frankel 5 4 and Leinwand L A 198 OCS patent a 230 558 Fried M G and Crothers 1983 J Mol Bin 172 241 382 Grabski A Drott D Handley ML Mehler M and Novy E 2001 Morations 18 1 41 Grabeki A McCormick M and Mierendorf R 199 da L0 17 19 A Mehler M Droit D
55. Novagen 000000000000 00000000000 Pellet Pellet Paint NF Co precipi ang E E L U LU LU LU 000000000000 000000000000 Applied Biosystems 000000000 Pallet Paint NF E B E LU 70748 30 Cy50 HU UULUUULUEULULU Pallet Paing 69049 37 0000000 0000 N pET System Manual 0000000000 00000 Novagen 000000000 vitro D O J 69337 3 0000000 7geneld 0 0 UU pET 43 1a c 0 0 0 pET 44ac 0 0TA000000000 0 00000 708430000000000 0000000 1004 000000000000000000000000000000 000000 5 10 00000000000000 00000000 14 00000000 Perfect DNA Markers 0 0 0 05p g ml O O L 000000 00000010 25u 0000000 0 0 00000 0 00000000000 69348 0 T 000000000000000000 La I ead 1 Oo LI pET 17xb pSCREEN 1b 9 0 0 0 pEX ox 0 00000069313 000 Nus T ag OOO OOO 000 000 000 8 Oo Oooo w Oooo rr Gouaguanao 0000000
56. TIA lO assays TEH colorimetric assay Limit pmol Technical Bulletin Western Blot Protein Markers Car Mir Rize Stee Standards _ Perfect Protein Western Markers HEA lanes CTBRIO 15 25 0 75 LOO and 150 Trail Mix Westem Markers TIRES Silanes TEANA 15 25 FH 00 TS LUC and L55 kn and Jf 16 100 kika pestis markers vi 0000000000 000000000000000000 0000000000000 10000000000000000000000 0 2 00000000 0 0 0 pET System 00000000 00000000 Ere Ey oO Oo Oo Oo Co ET Oo Co 0 0 0 0 Oo NJ L3 Df Co oo Ono oO ooo ED EA ood Oooo oo Co LI Ll unge r3 Co r3 il oO Lngd 00000000060000000000000 000000000000000 0 390000000000000000000000 00000000 00000000000000000000000000000000000000000 00000000606060000000000000000 Facto 00000000000 0000000006000000000000060000000000000000 420 500 00000000006000000000000000000000006 Novagen N pET System Manual 00000 0000000000000000000000000
57. TRIS HI U Recombinant Enterokinase and EKapture Agape for enterakinase TRA THA HMI 17 Factor amd Xarrest mmml Novagen X pET System Manual B u 000 0 refolding O 0000000000000000000000000 Leinwand 1996 Mukh hyay 1997 Kurucz et al 1995 Rudolph and and Hartley 1990 O O 0000000 000000 000 0000 0 0 00000000 00000 0000000000 0 0 Oo Oo Oo gt oO Cl Cl Cl D H 8 3 C 2 Hg ie 1996 Marst Ea ot Hm Oo Oo Oo 00000000 000000000 000000000 0000000000000 00000 00000000 0 00000000000000000000 00000 Oo EJ L3 r4 L3 r3 EE Oo eh OOo Ooo LE c 000 Protein Refolding O 00000 00000000000 O U TB2341 000 Oo 1 Co Oo EI Co 9 5
58. alkaline phosphatase 24 24 amino terminus 40 umpicillin 19 22 47 umpicillim resistance 18 resistance 13 aaay products table 52 strains 14 16 36 HESA 13 15 1 54 63 67 haeteriophage CBG 4 13 18 20 64 67 68 basal expression 4 11 12 39 65 Benzonase Nuclease 43 46 50 54 55 BetaRed Assay 57 BL21 14 15 16 19 22 25 36 64 1 22 ALB 14 16 19 64 BugBaster Protein Extraction Reagent 12 34 43 46 44 cAMP 11 12 38 CAPS 46 carbenicillin 18 19 22 47 28 40 52 56 CBDacssTas 7 19 3 3 18 20 64 67 68 chloramphenicol 11 17 19 22 25 cloning hosts 13 codon usage rure 14 36 27 colony PCR 31 32 copy number 13 37 coupled trunscription translution 28 cyleplasmac dh Ivysogen 14 dephospharylate 23 detection produces lable 52 detergent 11 34 difficult target proteins 40 bond formation 16 17 35 36 disulfide bond reomerization 35 DNA Ligation 24 DNA purification 32 19 35 45 Dip 35 EcoPro M 28 29 gus 13 16 17 66 expression hoas 14 65 fl origin 8 13 32 40 French Press 45 FRETWorks Assay 6 30h 51 54 fusion tags 9 53 57 Fusion tags table 18 fusion tags detection 57 galactesidase 10 43 50 57 genotypes 1
59. oO Op 1 Oooo 1 5 oO 2 v 00000 Rosetta gami lacY 1 Oo ME Co 3 N L3 r3 LXI EL LH Oop O Ooo L1 0000 r3 5 o e LJ r3 0 tRNA oO 3 2 Bete ma L3 r3 r3 ooo ooo ELO E Oo Ong ct z gt A ro Co E3 F3 C3 LE Oo 0 0 0 E 0 r3 LJ EJ p E O gt gt gt gt gt gt C pr33 rmn 0 OO 0 0 OO 0 0 OO 0 0 0 Oo E Oo oOo L3 g L3 r3 ri 5 o 2 Co HG Co 8 0 p3 r3 gom LIJ LI LELEILILLPLJIZTJZIl sj LE III oO mann et al 1989 tRNAQ 0000 OO 0 Brinkmann et al 1989 Seidel et al CCC D H B D tRNA D C 00000
60. 0 0 0 000 00 0 19 0000000 0000000000 000 01 16 0 000 00000 2010 0000 00 00000 000 0000000000 0 Noaue 0 0 0 reAQOOOOOOOOT7 0000000000000000000000000000000000000000000600 000000000000000000000000000000000000000000000 00000000000000000000000000000000 PETODOO0O000000000000000000000000000000000000000 1 211 1190 00000000 0000000000000000000000 0 0000000000000000000002 0 00 0 0 Novagen 00000000000 00000000000000000000 00000 200 00014 000000000000 0000000000000 000000000000000000000000000000000 000000000000000 00000000000000000000000000000 0000000000000000000000000000000000000000 00000 10mM Tris HCl pH 80 1 mM 0000000000000000 Novagen 000000002 0 00000000000000000000 206 00000 0000000000 1990000000000000000000000 Singles 00000000 Novagen pET System Manual 554 000000000000000000000000000000000000000000 0 0000000000000000 Sin
61. 00000 80540 000000000 00000000000 50 Tagh 0000000000002 00000000 81600 0 0 0000000000000 GSTQ Tag Tag T70 Tag 1 0 00000 Co Oo Oo Oo oO oO oO oO Co oO Q g gama Aa oO Too UJ Oo BL ms Co Co Co oO Co r3 B gH am E3 C3 r3 L3 E3 C3 r3 oo EN Orooooo Wn e on 8 02 OOO qc co Novagen pET System Manual IN XOOOOO000 B 900000000001 0 00000000000 HOOBDO000000 0000000000000 00000000000 0 00000000000000000 000000000000000000 000000000000000000 r3 L3 E E E E Ed E ESTE 10 L3 L3 L3 r3 IZ ER L3 L3 r3 L3 EE Itl Co ERG Co I Co Co II IJ Co oO Co Oo LI r3 r3 r3 r3 Ono oo r3 r3 r3 r3 I3 r3 oO oo S oo r3 oo oo r3 oo m B o rrgcourt vong on Oo Co Co Oo 2
62. 000000000000000000000000000000 1 0000000000000000000000000000000000000000 00000000 10000 90 10 00000000000000000000000000 2 0000000 000000 00000005000000 2q 70 000 3 0000000000000000000000000000000000000000 0 50 Tris HCI 0 0 pH 7141 500000 50mM 000000000 19000 70 000000000 0 00000000000000000000000000 OO 00000000000000 rLyseym 0000 DI LLL L 00000 L 0 0 00 0000 0000 rLysezyma 0000000000000 00000000000000 OOO0OO0OO0OO0OO0OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOODO 4 0000000 img 000 75 00 rLysozyme n 0000000000 190 D 0 450 60K 5 00000000000000000000 0 O 1u 0 250 0 0 0 0 0 Benzonase Nuclease 00 0000000000000 00 0000000000000 Benzonase Nuclease 000000000000000000000 Burgess 1991 00000 706643000 amp J0000000000000000000000000000000 101 20900000 0000000000 DO0000000000000000040000000000000000000000 0000000000000 000000000 7 4q 16000 20 00000000000000000000 49 000000 000 8 0000000000000000000000000000004 SDS 0 00000 70607 30 00000 SDSPAGED 000 000 9
63. 1 OD 040 1 06 0000 0 30 0 00 0000 0 37 00000000 01000000000 000000000000 0 7 4 0000000000000000000000000000000000000 0 5 1 0 000000 00 60 00000 04 779 00000000 000 0000000 0 000000 100mm 000000 20 3900000000 0000000000 0000000050000 4q 5000 90 9 0000000000000000000 D000000000000000000000000V0000000000000 00 Hu 4 000000020000000 20 TrisHC 80 000000000000000 5 00000000000000000000000 000000 000000000 0000000 Inclusion body O 000000000000 0 0 plyssoo 1 5 Novagen 4 pET System Manual v 000000 0000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 000000 gt L3 0 00000000000000000000000000000002 0000000000000 0000000000000000000000000000000000000000000000 00000000000000000000000000000000000000000000000 0000000000000000000000
64. 3 ZF ren Rooela gamni DES 12 ml Enhances expression of proteins that contain 4 mil TIE codons rarely used in E ceci AGA AUA 10 ml CUA CEC A Allows disulfide bond Eoswtta gami DE pl ys 2 ml formation in the E sold 1 4 TIT 1 mi FL Tak 02 TIWHA Enhancers expression of proteins conin 1 4 TOs cexxlona rarely In AC AGA ALA Lal CEUC GUAJ and la a bigh stringency hast FesettaBlue DES 1 2 ml T1068 3 with rec and mutations 1 4 inl TIS Ll ml _ Tuner 0 2 ml 70612 3 Enables level af expressian ir all ml 70623 3 oak diese bo e FT lower 1 0 ml 23d levels may enhance seduhiliry and actbeiry af che Tuner DE3 pLyes 0 2 ml TOG LE target 54 24 1 ml TOGHA 4 Novagen pET System Manual IN isogenic Host Strains far Initial Cloning Controls and Expression These host strains are isogenic with the ADES yeogens used for protein expression but lack a source of TT polymerase These strains can be used for TT based expression by infection with A CEG or for expression from E cali promoters Only the Novalilue strain is recommended for initial cloning Competent Cella Glycerol Stock Strain Size Cai Cat ication ADS 2 mil HRI Allows bond formation in coti
65. BLE BLA LEST B BLRI DEIpLyss HIMS1IT4 K 12 1 K 12 HMSITH DEJ pae K 12 NovaBlue K 12 omar Pes mi JsupEx niis ema K 12 fool expression gurA5 retell hosi recommended for use with F lac 2 AMES Thi Tc DES NovaTope System Origami H Origami BE DES B ks rs J diem TIU dee kan F asp ket m gal dem tae Tc irer kan DE Novagen contra non expressian host general hoal contains Tuner das permesse mutation sav tier mutations Tor cyteplasmic disulfide bond formation Kunamycin 15 gil Tetracycline 125 pg ml Tetracycline H pgm Tetracycline 125 Rifumpicin 200 y m Hifampirin200 jeg _ 54 Hifamplein 200 Tetracycline 12 5 Tetracycline 12 5 pein Tetracycline 12 5 pg ml Karamycin 15 ptm Tetracyeline 12 5 paimi 1h pET System Manual IN Strain erin Genotype Description Application Antibielit Ragislance Origami B oripT Amir m geb den ire kp high stringency expression lest Tetracyeline 12 5 ppm general expression host contains Hanasyein L5 pgm piant grids Tedd Te rz Bz
66. HEINAR 70923 4 500ml 1 00000000000000000000000000 0 10 000x 90 INQ 00000000000000000000000000 0000 00000000000000000000 0000 000000 0 0 0 2 000000 00000005 0000000000000 0 0 E 0 0 0 00000000 90 0 0 0000000000000000 00000000 U O 50770 0 0 2m0 O 00000 000 250 uster Reagant 1ml O 1 rLysozyme Solution 0 00 0 0 5SKU g 0000 0 550 0000 0000 0000 0001 0000 w Q 00000 BugBuster 1ml 1 10 250 00000 Benzonase Nuclease ysozyme Benzonase PopCulture OOO 4 000000000 Eng oon rn E Ss 0000000000000000 0 000000000000000000000000000 191 2100000 000 90 200 00000000000000000000 490000000 000 U 00000000000000 gt 5 r3 R m Novagen pET System Manual IN 6 00000000000000000000000004 SDS Sample Buffer 00000 7060731 0000000000000000000000000000000 7 85 33 00000000000000005 65 00 0 0 20 00000 rLysozyme Solution 000000000 50 000000 7111030 000000000000 0 00000000000000000000000000000 eLyssu
67. K 12 NovaBlue O Origami 0000000000 0 0 000000 0000000 hResetagamt 00000 150 00000000 000000000000000000000000000000000000000000000 Novy 20017 Novagen A pET System Manual 0000000000000000 00000 pBR220 00000000 000000 000000000000000000 0000000006000000000000060000000000000600000000 0000000006000000000000060000000000600600000000 0000000000000000 pETcoco System 0 pETcoco 0 0000000001000 00190000
68. M 40 restriction enzyme 23 retention of plasmid 37 ribosome binding site 40 41 rifampicin 22 rLysozyme M Solution 43 46 47 48 50 54 57 RNase 32 15 17 36 64 Rosetita gami M 15 17 35 64 Rosetta 15 17 44 Soon 18 SDS PAGE analysis 51 selenomethiony labeling 15 signal sequence 12 45 single szramded plasmid DNA 13 Singles 24 36 Sma 1 100 solubility 6 7 15 33 14 35 36 43 48 53 solubilization 56 soluble cytoplasmic fraction 44 48 spin filler concentration 44 SpinPrep 32 S protein 40 52 56 slar activity 23 sock solutions table 22 stop codons 41 sirain derivation 16 T7 lysozyme 11 45 T promoter 20 33 pET System Manual IN T promater primer 32 TT RNA polymerase 29 64 T7 termanaler 15 TT terminator primer 32 T7 Tag 19 40 52 56 T Tag antibody 40 Ther promoter 11 12 33 langel detection 51 target protein purification 54 target protein quantifying 51 largel protein affinity purification 53 TCA precipitation 44 TCP 44 Test Plasmid 26 tetracveline 22 total cell protein 43 aie genes 18 17 38 enes and plasmid instability 37 toxic toxic genes induction of 39 Trail Mix Markers 41 Trail Mix Western Markers 52 iranscripiion terminator 41 transcription veckors 26 20 lransformation 25 26 transf
69. Novy e al 000000000000000 00 pLysS Rosetta a 00TA 0000000000000000000000000 Rosetta 0 J 21 acY 10 Tuner 0 O 0 RosettaBlue osetta gami 0 0 0 0 NovaBluel O Origami 00 0000000000000000 gt x 8 D L3 2 O Sooo Es Seidel et al 1 amp D 2 LE Qn gt Co Hoe oo oO 28 gt r3 r3 CoO oO LI C3 r3 C3 C3 C3 C3 E 000 LJ H ELE L3 r3 No 8 L3 CJ L3 C3 C3 C3 ogo E e a o LJ AUA A GG 00000 0 N EL aoe 2 2 Co 2 cl Co LJ Oo oO r 0 0 Co Ey Co Oo 2 oo eg gt ct zc Co 0000000000 00000000000 8210 000000 0000000000000 50000 00000000000000000000000000000 Wood 1966 Leahy et al 19921 00000000000000 8 20 DEH 0 0 B834 00000 0 000 00 0 00000 000000000000000000
70. V5 control I is therefore seated to expresan from TT promoters High stringency wana that iho scade earries Hs x FET pail plasmid that peadaces TT Isozymve therehliy redoing basal expression of piri hosts prove even greaber stringency these are separabely glycerd stocks The rra double mutant SS pesquimed reducing agent in thee medium bo supper mmal growah rales The Origen a derivative FATIES of Use strain Chel can vids allows normal growth rates i abesencc of suppoliental agoni Hie zb ul Rie a al HARE ond pLysssltARE encode the genes argil one ideX wot proh moet T erT toe arl The rare codorna AGG ATA ALA CEC and GGA are supplemented ory e al 20011
71. amd Van Dinther J 2002 14 2 5 Grodberg and Dunn J J 1888 170 1245 1253 Grossman T H Kawasaki E S Punreddy SR and Osburne M S M08 Gene 208 85 101 Novagen pET System Manual IN Halling S M and Smith 5 1985 Bie Technology 715 124 Harlow E and Lane D 1088 A Gold Spring Harbor Laboratory Cold Spring Harbor New York Harrison Bo 11 1 7 Haun R S Serventi LM and Moss J 11832 Hioterfeniques 13 515 518 Hirel P EL Sehrnitier MJ Dessen P Payal G and 9 Proc Nerf Aca Sri U 5 Z Wang H Chen D Chen Y and Zhu D 1034 Biochem Mol Hiat fet 537 543 Huang J Villemain J Padilla anal Sousa R 190805 J Mat 457 175 Inouye M Arnheim and Sherine E ITI A Cherm 248 7247 Joly LE and Swarz J ET Fincfecaistri BB 18067 LOTS Kajava AV S N Kalinin A E Nesmeyaneova 20009 a 182 pum J F IEF Cra Opin Hinehina 8 403 3 Kelley KEC Huestis KA Austen D A Sanderson Donoghur Stickel 5 Kawasaki ES and MLS 1588 Geer 150 Kurland C Gallien J Corr Opi T Kurucz E Titus JA and Segal D M
72. 0 000000000003000000000000000000000000000000000 0000000000000 110000000000000000000000 5900000000 GST OD 0000000 0 N utilization substance 2000000000000 0000000000000000000 200 30 00000000000000000 0000000000000000000000000000000000000000000000 txeu 0 0 99 00015100000 0000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 DsbAQ 0 0 2660 pET 39b 9 406 00000000000000000000000000000000000 DsbAQ Dsbcg 0 0 8000000000 0000000000000000000 inclusion 0000000000000000000000000000000000010000000000 0000000000000000000000000000000 200000000000000 0000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 in 0000000000 000000 00000000000000000000000 0000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 000000000000000000000000000000000000 pET 17xb0 0 0000000000 2200 0 00 7 1 OOO 316 0 000000000000000000000000000000000000 00000000000000000000000 0000 0000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 000000000000000000000000 50 T70 G
73. 0 8300 2 0000000 00000000 00000 0 000000000000000000000000000000000000000000000 0 LICI Ligation independent cloning 0000000 00000000000 Factor 0000000000000000000000000000 00 pa O Ono CES Co 2 Novagen X pET System Manual 0000000000
74. 0 01 Triton x 100 0000000 plyssg PopCulture BugBuster Protein Extraction Reagent 10000000000 0000000000000000000000 plysso 0000 0 50 p 000000000000000000000000000000000000000000 urmaggaagggaggpngaanaganggudaeatueadtbaatdnbn t Ooo Ooo Ooo doo ooo ooo aod lt Co Co Co Co OO LI 0000000000 0000000000 7 0000000000 T7 pLysSD 0000000 cAllister et al 00000000 000 plyssQ plyssoodg 00000000000 gt 25 Ex oo di EI ES E Ed 50 5 0 0 0 0 ep ior LE LI LJ L3 ri LET Ea Clow LT See L3 E r3 7 00000 55 2 0 O Mierendorf 0 19940 0000000000 L5 Oo Co LI LE Co 1 LI Oo LI Poo Oo Oo Oo Ll mea zi Q oO oO oO oO oO oO LI Co E Co EI
75. 0 100000000000000 87 000000000000000000000000000000000000000000 Novagen pET System Manual IN 100000000000000 00000 100000 000000000000000000000000000000000000000000000 0 000000000000000 000000000000 1 000000000000000 50 9 0000000000 2m 800000000 000000000000000000 2 0000000000000000000000000000000000000 3 00000000000 00037 50 000000 2m LB 0000000 05 00000000000 0009000000000000000000000 14 0000000001800000000000 0 0000000000000000000000000 4 000 09 80 000001 0 00 70 0000 640 10 0 22 NovagenJ 0000000000000000000000000000000000000 000000000000000002000000 0000000000 1 200u g O O O 37 Q 00 unu 0000 00000 2m TBI oO 00000000000 OD 0 29 061000 8 000000000000000000 20 000000 00000 m TBO O O O 00 021 0610 8 c 3 Co Co Co Co Co 37 C 000
76. 00 6 0 0000000000000000000000 10001 31750 OOD lp dNTP mix dATP dCTP dGTP dT T P 10mM lu pET upstream primer 5 pmol u lu downstream primer 5 pmol 5u 10X 0000 0 02551 1250 NovaT aq DNA Polymerase 4 000000000 000000000000000000 50 000000000000 000000000 7 0 00000000000000404000000000000000000020 00 00000000000000 00 00000 0 OOO00000000000000000000000000 000 0 0 800 00000000 hot start 0000000000 8 0000000000000000000 35000000 94 q 0000000000000 0000000000000 559 0 7200 20 0 Oo72 q 600 0000 9 000000000000000000000000000 1004 00000000000 30 00000 11000000 24 000000000 0000000000000 000 00000000000000000000000000050 1940000000000 000 320 00000000000000 000 0 10 00000000 0 50 52 254 10 95 000000000000 2p IO Pele 0 000 0 69049 30 Pellet Paint NF Co Precipitant 000 0 0 7048 30 OO 0 0 0 Pellet Paint EcoPro T 71 000000000000000 14000x 91 5 00000000000 70 000000 00000000 1001 000000000000000000000000000000 0000000 50 00000000000 70 000 20 4 000000
77. 000 00000000000000000000 Sorensen et al 1989 Zhang al 1993 0000000 0000000000000000000000000000000000000000000000 Chen and Inouye 19900 0 00 0 00 0 0 0 0 0000000000 0000000000000000000000000000000000000000000 00 Brinkmann et al 1989 Hua et al 1994 Schenk et al 1995 Calderone et al 1996 Zhan 1996 00 0 0 0 0 0 U 0000000000000000000000000 Brinkmann et al 1989 Seidel et al 1992 Rosenberg et al 19931 0 O D 0 000000000000000000000000000000000000000001900 0000000 Brinkmann et al 19990 CUAQ Kane 1995 Rosetta 0 00000000 Aro AGG Ile 000 Leul O CUAD Prog U 0 O 0 pLyssh Rosetta 70000000000000000 Rosettan 0 tong 0 0 OO 0 J RosettaBlue 0 O Rosetta gami O
78. 0000 viro 00000000000 0000 5 00000 3 000002 pET series pET Upstream Primer T7 Terminator Primer pET LIC Vectors pET Upstream Primer T7 Terminator Primer 1 1700 20690 23090 2334 0 200000003 000000000000000000000000000 NovaT aqDNA Upstream 7 0 0 Tagi ODO OOOO OO PCR amp 1101 Novagen pET System Manual 1 00000000000000000 0000000000 O 0 O TA 0 0000000000000000000000 0 000000000000000000000000000000000000000000000 00000 1 lul Ligation O O 0 TEO OO O O 10mM Tris HCI pH80 1mM EDTA 110 000 00 025 05ng 000 5 10 0 D 00 lu pET upstream primer 5 pmol lu Downstream primer 5 pmol ly 10mM dNTP Mix 0251 1250 NovaT aq DNA Polymerase 0 000000000000000 50u 000000000 2 000000 0061000000000 20 00000000000 000000000 sq 000000000000000000000 3 0000000000000000000 00 0 q 11 000000000000 000000000000000 5 gt og 10 07294 20 0 72q 000000
79. 0000 00 0000000000000000000000000000000000 0 00000000000000000000000000000000000000000000 0000000000 0 00000000000000000 00000 00000000000000000000000000000000000 0000000000000 000 0000000000000000000 500 00000000000000000000000000000000000000000 0000000000000000000000000 00000000000000000000 00000 Neo 0 7 0000 00000004 960 0000000000000 Neo 00000000000 0000000000000 BspH TCATGA BspLU11I ACATGT O ill ACRY GT 0 Sty Neo 00000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 000000000000000000020000000000000000000000000 0 00000000000000000000000000000000000000000000 00000000000 OO 000000000000000000000000000000 0 00000000000000000000000000000 Enzyme isaschizomers Recognition and cleavage site Dwerhangs generated His pt Lapis Fre Hee ffeil D Hem Esp b 1 0000000000000000000000000000000000000 PERI U 000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000 0000000000000000040000000000000000000000000000 Novagen pET System Manual
80. 0000 0 pET System 0 000000000000000 MS 97 terrific broth 0000000 0000000000000000000000000 E 12600 Per liber Per liter Per liter 10 g Bacio reyptane BO ml 20X salts 10 g N Z amine A Questi g Teal exiret 2X m 20 glucose NaCl g lL ml 1 M Autoclave ool Adjust pH te 7 5 with 05 g Natl Add 100 ml 10X LM WHI ml vate salts ml Autoclave deinnizerl mo 10 ml 4086 glucose from autoclaved stocks _ Per liter 1O g NH CL 30 80 HPO THO Autoclave Per liter Per liter 20 g NH CI 23 1 60 g 125 4 g Lag HPO THO Autoclave ae Sambrook et al Per liter 200 ml debonized water 12 g Bacto tryptone 34 g Yeast extract 3 ml glycerol Autoclave con to 070 Add 1X1 ml sterile phos Novagen Ed X N pET System Manual Preparation Egi Na 150 mM FTG isoprap F D 2 38 FTE im deionized water TURT wet Filter spiri and spore at nrbenicilim sodium salt 5 mgm in deion water 3 at ApC at salt 35 mg ml in dexanized water 171254 Chlaramphen leal line Vsfumpicin
81. 00000 0 00000000000000000000000040000000000000000000 0 0000000000000000 00000 UU 0000 00000000 00000000 0000000000000 00000000 imM 000000 0000000 2 000000 000000 000 00000000 00000 10 101 LI LI 1 n 4 100 000 1mM IPTGO 00 00000000000000 0 DNA 00000000000 000000000000000000 U 000000 pLyss DOO D D 5 lt 0 0000000000 00 39100 40000000000000000 Co ol ol oO oOo Zn r3 NO r3 000000000 0 0 OO 0 0000000 2 000000000000 0000 001 00000000000000000000000000000000012 60000000000 0000000000000000000000000000000000000000000000 00000000000000000000000002 4 000000000000000000 0 000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 000000000000000000000000000000
82. 00000000000 2000000000000000 DOSOOO03Z00000000000000000000TNMOOOOOOOOO0 000000 69348 3 0 0000 000 0000 000000 693373 0000 000 00 0 0 0000 21 NovaT aqDNA LH 00000 0 0 pET 00 Tag LOO OO 719700 0000 0000 00 00 00 00 0 0 00000 O Tagi 00000 ODO0DODOO0OOOOOOOOOOOOOOOOOOOOOOOOO EcoPro PET 1 B0 B B D D Ld EcoPro T7 Coupled Transcription T ranslation System 0 O 0000 708763 0000000000 0000000000 Din 00000000 0000 vird McCormick and Ambuel 20000
83. 000000000000000 000000000000000000 0x00 0 7 000 4X SDS Sample Buffer 707913 00000 0000 000 00000 0 SDS 29000 000 0 OOO0OO0OO0OOO0OO0OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO as OOO00000000000000000000000000000000000 60 000000 OOO0O000000000000000000000000Q0 O0 Battituzzi et al 1977 0 II U OOO0O0OO0O0O0O0O0O0O0OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOD 000 2 00 000000000 amp 0 000000000000 Lavalle et al 1993 00 0000 1 0000000 0000 2000000 25mM EDTA 20 mM Tris HCl pH 80 5 OD units 0 0 0000000000000 19 0000 2 15 000 x g0 300 00 000 000000000000000 0 25 mM EDTA 20 mM Tris HCl pH 800 0000 000 000 000 00 107 0000 EDTAD Bind Resing U 00000000000 3 15000 x ol 10 000000000000000000000000000000 SDS PAGEQ OO000 Novagen Ed X pET System Manual E OO 000 0 000000000000000000000000000 BugBuster Protein Extraction Regant 0000000000000000000000000000000000000000000000 000000000000000000000 BugBuster Benzonase Nuclease BugBuster Protein Extraction Regant 0000 00000 Grabski et al 1999 T 00000000000 0000 0000000000 00000000000 Oot oot o EJ E a ao L3 r3 E3 F3 EE E EC Eee tI
84. 00000000000000000000 Doherty 1995 1 Novagen 000000000 N pET System Manual 00000 0 0000000000000000000000000000000000000000000 er 0 61 Strain Deri Genetype DescriplionApplitalion Antibiatic Resistance ADS K 12 darmi Moci Spiel piak 3 hast alis Kanamyrcin 15 Ani disulfide bond formation in Fl foe pro kan cytoplasm ADS DES 1 darote Te AN dphodPjue pho ial expression host allows 15 mmi bond formation in F ire foe pro tei kant DES roli cytoplasm DES ip Last K 12 Jord dew Pend poi high stringency expresskin 15 host allows bord Chiorsmplienical H E ne Case prm fe B kei DES plans lonmation in E colt eyboplaam BJ ARS F ompr rym gel met met auxciropl parent of 81 21 control hosi AEDES H had n m pal dem zumal Dem met auxeerophi parent of HL2T mane general expression host Smet labeling DER Lae H mpy kadi r2 mi gal dem mot DEI met auxciriph parent of BLZ1 Chloramphenicol 24 ply
85. 000000000000000000000 U O www novagencom 00 000000000000000000000000 Exec nhs Cat Fise Technical Bulletin and Features BugEuster Protein Extraction Reagent TOOGRA 3 IM ml TEMS Use 5 mlg wet cell paste Tris bufferedl Thee SH ml HT Protein Extraction Reagent TOGQ3 3 IM ml TEAS Use 5 ml g wet cell paste Tris buffered asl TEI SHm preise with Bentone Mileage LEX Probeis Extraction Reagent TOS 4 Ibm TEAS tis LX with of buffer arid ie 5 TEEI B ml mlg wet cell pasie TELS primary amine free Exbraction Reagent TORIS I ml TRZ Dee wet cell PIPPS hutTereil ml PopOalbare Reagent THESE Wd THES Use 0 1 volun per md of culture TER TG mi TEES 2 T11160 3 TOO TETH TERI Use 40 U per I of culture T1110 1200 KU volume with Reagent amd KU per 1ml 71110 5 OO KU _ EugBuster nt Muelense Purity gt HEE TUTAGHE MMED TED 257 Lise LI per original culbure TUT 25001 volume with Culture anid ier He CHi purification Cot Size Technical Bulletin No Capncity and Features CB 100 Resin Bp Capacity is 4 mgg resin 2140 Resim 70121 3 25 Capacity is 5 meg resin CBrsD HW Cartridges T0L24 3 lO TELEF Pre packed Capacity is 15 mg cartrlge TUL24 4 phot CBD 500 Cartel pens 70132 3 peel TRUBS Pre pscked is 4 5
86. 000000000000000000000000 0000000 0000000 00 000 1 0 000 100 11000 100 TCA w v 15 00000000 b OOO 15100000 14000 x g0 100 000000 d 1006 000000000000 50000 44000x 900000 0 000200000000000000000000000000000000 0 00000000000000 000000000000000000000 000000 600 0000000 Speed Vac Savant f 1004 10 1X PBS 0 000 10 0 100410 2X 5 9 30 0000 00000 000 000 0 0 505 0 0 20 C 10 0 000000000000000000 5004 504 000 000 000 000 00 0 0 0 10x0 0 00 b 000000000000000000000000000000000000 0 000000000000000000 00000000000000000000 gt 9 2x 5800 00000 0 00000000000000002 8 00000000000000000 d 70 505 0000 000 20 000 0 O0O00000000000000000000000 600000000000000000000 000000000000 Battisuzzi et al 1977 000 00 0000 0 0 0000 00 0000 OO0O00O0000O0O0OO0OOOO0OOOOOOOOO OOO Novagen A pET System Manual
87. 0000000000000000000000000 37 C 00000000000000000 0000000000000000000000 000000000 Schein and Noteborn 19890 0 0 0 0000000000000000000000 5q 0 30 0000000000000 000000 15 20 000000000000000000000000000000 0 Ooo EA LI Lr Oo oO oo Boon 1 oo Q ooo woo vp Fy Passos gs g Co IJ Co oO Opn L3 oO Oo oog 000 Bind Binding uffer 500 0 0 0000000000000 000000000 0000 mM OOO00 BugBuster Protein xtraction Q L3 r4 O 50 o O cr c ooo nooo oo oo ow L Ec og lt 3 oo V4 ood c rt o 2 LX Xd Iw L o aol c H EES 5 lt LIII D So oO Co on On LJ r4 Oo oO oO Oo oO oO w wn moo 3assan 2 2 2 ooo PAO 8 8 9 5 9 LI I II r3 oO co EEE Eo q I Oo ooo 2 2 yoo lt 5
88. 00000000000000000000000000000000 00000000 7 7 lt 0 000000 50 0 000000000000000 000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000 T7lad 00 Roo OOOO 0O01000000T72000000000000000000000000 em Studier et al 1990 Dubendorff and Studier 1991 81 000000 000000000000 7 dion 000000000 00000000000000000000000000000 29000 iit 000000 i 20 00000000 C CT 0000 7 0000000000 7 7
89. 00000000000000000000000000000000000000 0000000000000000000000000000000 3330 0 0 00000000000000000000000000006000000000000 0000000006000000000000060000000000600000000000 0000000006000000000000060000000000600600000000 0000000006000000000000060000000000600600000000 00000060606000000000000000000000000 100000000 00000000000000000000600000000000000000008 0000 0000000000000000000000000000000000000000000000 00000000060000000000000600000000006060000000000 00000000000000000000000000000000000000000000 e O0000000000000000000000000000000000000000000 000000000000000000000000000000000000001 m0 00 506 9 000000000000000000000 2883220 00000000000000000000 0000000 10000 100 0006000000000 1 00 0 200090 00000000 00000000000000000000600000000000000008 5000000 p000000000000000000 95 202 7102 T DT 000000000008000000000 00000000000000000000 0000000000000 1 2000 10000 00000000 00000000000000 0000000000000008900000000000006000000000000080 000000000000000000000000000000000000000000000 00000060606000000000000000000000 O00000000000000000000000000000000000000000000 0000000000000000 000000 Novagen 00000000000000000 000000000600000000000006000000000060000000000 00000000000000 000000 00 000000000000000000 0000000000000000000000000000000000 000pET000000 000000000600000000000006000000000000000 169 0000 00000000060000000000000600000000006060060000000 000000000606000000 289 0000000000000000000
90. 0000T7 RNADOO CO COCOCO COCCO0OC0O0C00600000000000000000000000 0 000000 Js 0 0000000000000000000000000 7 0000000000000 6 0000 00020000000000000000000 067 0000000000 SMA 00000 0000000 Studier and Moffatt 19861 7 U U DNA 0 000000000000000000000000000000000000 30 0000000 0 000000000000000000000000000000000000000000000 7 000000000 CEG Novagen 007 0 0 000 Novagen pET System Manual IN 000000000 0 000000000000000000000000000000000000000 0 00000000000000000000000000000000000000000000 0 00000000000000000000000000000000800000000000 000000000000 Controls 0 LO 0000 00 0 00 0 0 0 00 00 000 0 000000000000000000000000000000000000000000 0000000000000 2 0000000000008000000000000000 000000571 00000000000000000000000 Waclor Host strain Selectio
91. 000171 0000000000000000000 2 0000000000 000000008 000000000000000000000000000000000 7 00000000000000000000000 000000000000000000000000000000000000000000000 000000000000000000000000000000 000000000000000000000000000000000000000000000 00000000000000000 12 109 0000000 0 recA ed 000000000000000000000000000000000000000000000 NoveBludi 0000000000000 NovaBlue 00000 2400000000000 HOST CELL uggnnaayunaauagggaaggagagnaduaieerugua dtdlezedta gsua adgnau for Cloning ugagannaagaugnaguggaad dgnm pnpErBludin 00 0000000000000 249 00 00000 00000 0000000000000000000 1891000000 0000000 0000000000 Novagen L3 L3 Q lt 4 e OOOOOOO EJ Gea e
92. 1 Novagen SpinPrep Gel DNA 00000000000000002 00000000 ea Co a LI Co Co icf a 1 000000000000000 pET vector wong 6 00 Hg 10x 000000000 10200 0 00000000000000000000000000000000000 00000000000000 10 000000000000 1 9 000 0 85 0000000 000000000 0 37 OO NO 400000000000 Perfect DNA ES w Toon L3 E3 E3 E3 r3 ler qp E CS SE r3 oO Co N L3 E3 E3 E3 E3 r3 e cr Er bp G i c Ofte 3 r3 L3 r3 r3 pr pr r3 L3 E3 r3 L3 E3 E3 E3 E3 r3 zz 12 L3 L3 L3 E3 C3 C3 C3 E3 C3 E3 C3 9 r3 r3 rc r3 oog 2 5 LC r3 Leo a LU UL LI Lr Ol r3 LI Co Et OO Oooo UJ 3 r3 ctr oo mM is HCl pH9 Novagen X pET System Manual 5 37
93. 195 Hol Sonal 32 1445 1452 Lathrop B K Burack W R Rihanen BLL and Rule 5 102 Protein Erga Pur 512 517 LaVallie ER DiBlasic ELA Kovacic S Grunt Kle Schendel EF and Meloy J M IOS BioTechnology 11 187 193 Le Bonniec B F MacGillivray ET and Eaman C T 1991 Bic Chem 26 370i 13 BIET Le Bonniec BF Myles T Johnsen T Knight CoG Tapparello C and Stone 5 R Biochem 35 7114 7122 Leahy DAH W A Aukhil L and Erickson 19502 Science 258 087 001 Lee Zhang 8 Q Cozxitorto J Vang J 3 and Testa D 13587 Gene 58 77 06 Looman AC Bocdlaender J de Gruyter M Vogelaar A and van Knippenberg 1986 Nucl Acids Res 14 4 497 Marston F A and Hartley D L 1583 Mek 182 264 276 MeAllisier W T Morris Rosenberg A H amd Studier F W 3 Meg Hil 153 MeCormiek M Yaeger K Nowy R and Van Gosbree T IRM inNam iens 2 7 McCormick M R amd Ariel Y 2000 11 8 11 Mierendorf Yaeger K and Novy R IM 1 1 3 Missiakaa D Georgopoulos C and Raina S 19604 EMBO 14 3013 203 and Studier FW 1987 Cal 49 221 Mukhopadhyay A Ade Biochem Eng Biotechnol 56 01 109 RL Berg J Yaeger and Mierendorf Et 3 7 9 RL Droit D Yaeger K and Mierendorf
94. 1995 000000 0000000 0 L3 r4 c C So a 0 oO oO oO LH Oo 3 671 Missiakis et al 1994 0000000000 0000000000 00000000000 00000000 in vitr 00000000000 O pET 4 00 OO Dsbco D D U D 00000000000 mM 000000000 Ni NTA His Bing 0090000000000 0 0 EDTA 0 20a 000000 00000000 Collins Racie et al 199 0000000000000 Joly and Swartz Bind Ni NTA 0000000000 000000000 00 0000 DsbAD 0 25560 000 10 mM DTT N 5 Ong Oo Oo LJ L3 O ga Ea LE HET t On OOD 1 oo get EJ H m LI zl Oo Oo Oo Oo Oo ee 10000 Tag 0 00 0 0000000000000000000000000
95. 56 polyclonal anthony callulcse binding IP AP WE 34 35 114 polyclonal antibody calulose binding IF AP WE 35 37 damaid peeipi rsm media CAD sus Tag E 107 amtieady Binding IP AP PE WE 38 domain sh Tag 208 potential penplasmic OB DI PE SP 35 40 235 220 inanaelonal antibody enzymalic AP IF IP QA WH 41 42 glutathione affinity MussTag 495 promotes solu bul SP WB 43 1 44 AP affinity purilication DE disulfide Bind Di bend isomerization IF iereunalluceescence monochonal antibody IP immunapracpiatian protain export FF small production PS io vitro phosphorylation DA quantitative assay SP soluble pentrin WE Westen Novagen N pET System Manual 0000 00000000 1 0190 00000000000000000000000000 100000 02 00000000 T7 Tag CBD Tag HSV Tag MugeTag signal Vector amp Hig Tag GST Tap protease peres JP peris fe I peu Ii 1T __
96. 6 glucose 12 33 39 glucase amp plisghate dehydrogenase 44 glycerol stocks 4 L6 22 65 gar 7 15 16 17 35 36 GST Tag 7 0 19 45 4 54 7 helper phage 15 14 32 HiseTag 7 15 19 40 52 5174 11 16 64 65 67 68 host strain catalog numbers table host strain genotypes 16 host strain selecting 14 host sirain storage 22 hosts for cloning 13 HSV Tag 19 52 in virretrranscriptionftrans ation 28 inclusion bodies 6 33 34 56 Inclusion bodies purification 44 induction control 19 37 induction control table 19 induction of DES lysogens 33 induction low ternperabure 34 toxic gene 19 insoluble fraction 34 48 IPTG 14 22 44 strains 13 6 kanamycin 15 14 19 22 37 41 EOD HiFi DNA Polymerase 30 EOD Hot Start DAA Polymerase 30 XL Polymerase 30 iaci 14 15 17 fac 36 lactamase 1H 37 12 14 Novagen IN pET System Manual LIC 24 ligation 24 25 29 ligation PCR 30 liguticn independent cloning 5 8 9 10 23 protease 14 LunmiBlor 2 Lysogenization Kit 14 68 32 medium fraction methionine auxcirophs 15 methrnyl aminopeptidase 40 Mobius M 29 32 mutations dT minimizing 24 Mew 1 V rube 40 N lauroylsarcosine 54 Non Disiribution Agreement 64 Normalized SDS PAGE 51 1
97. 6 17 25 64 Mova 30 31 Mova Tope 16 66 Mus 7 8 10 19 14 1 17 45 optical density analysis 42 51 optimi eta Expression 40 Origami 5 17 36 64 68 Origami B 14 15 16 35 36 64 66 osmotic shock 45 outer membrane protease 14 PAC WTR 11 pBR322 37 24 29 30 31 32 pellit 45 Pellet Paint Co Precipitant 24 29 30 Pellet Paint NF Co Precipitant 29 30 Perfect Protein M Markers 51 Perfect Protein Western Markers 52 periplusm 35 45 periplasmic fraction 45 PET host sirain characteristics table 16 pETBlue 13 14 37 Miva 39 32 19 13 plasmid purification 32 plasmid stability test 38 pLysE 11 12 33 45 64 pLysS 1 12 15 16 19 33 45 64 68 Pogiculturet s 12 34 42 44 50 54 Novagen primers 29 32 protease cleuvage 10 57 proleolyhe degradation 40 pSCREEN 18 24 1 10 14 purification under fully denaturing conditions 56 purification under native conditions 56 purification under partially denaturing conditions 56 purification insoluble cytoplsmic fraction 49 purification mediam fraction 44 purification periplasmic fraction 45 purification soluble cytoplasmic fraction 46 quick screen 43 408 32 reading frame 7 recA 13 14 25 Refolding Kit 56 resin CHIMDPM 40 resin G5 T Bind
98. A 02140 The CBD Tag technology is covered under U S Patent nos 5 496 934 5 202 247 5 340 731 and 5 137 819 Use of this technology for commercial purposes requires a license from CBD Technologies Inc Ni NTA HisoBind Resins are manufactured by QIAGEN GmbH HisoTag Monoclonal Antibody is covered under German Patent No DE 19 507 166 and international patent applications are filed under W09626963 and is provided only for use in research Information about licenses for commercial use is avail able from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany The GST Tag technology is covered under U S Patent 5 654 176 European Patent No 293 249B1 and Australian Patent No 607 511 Vectors containing the HisoTag sequence are licensed under U S Patent Nos 5 310 663 5 284 933 and European Patent No 282 042 issued to Hoffmann La Roche Inc Nutley NJ and or Hoffmann La Roche Ltd Basel Switzerland and are provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany The HisoTag Antibody is covered by patent DE 195 07 166 and international patent applications are filed under W09626963 and is provided only for use in research Information about licenses for com mercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany NovaTag and KOD DNA Polymerases are sold under licensing arrangements with F Hoffmann La Roche Ltd Roch
99. DS BLI Leet Origami or Origami B Rosetta and Rosetta gani host attains for the cloning arid expression of genes The intent of this licere is not to limit the research use of these materials but to protect apaired uriabhargeed comercial distribution of the strains by third parties I The ADAM Origami Origami B Rosetta Esetta purni host strains or any derivative therefrom is pod to be offered for resale or distributes outside your laboratory 2 Gene clones and libraries in the ADM BLED ted Origami Origami B Rosetta RosettaBboe and Eosetta pani host Birina may be distributed Bor research qurpeeses only provided that the recipient r knowledge the Foregoing The initial purchaser may refuse to accept the above conditions by returning the kit unopened and the enclosed materiale LIne By or using Che Kit or materials you agree to be bound by the foregoing condi Novagen pET System Manual IN XV Appendix pET System Hast Strains and Lambda Phages DES Lysagens for Protein Expression The pET expression hosts are lysogens of bacteriophage ADES as indicated by the DEST in their rames and are suitable for production of protein from target genes cloned in pET vectors The plyss and pLysE designalbon is given hosta carrying pET compatible plasmid that encodes TT lysozyme which is a natural inhibitor of TT RNA polymerase These girain
100. EF pRARE aaa provides rare codon ARMAS K 12 dph cAPval phoR high sringeney expression host Tetrucycline 12 5 DES aruD139 ahpC gall gal wis nations in cytoplasmic Kanamyrin 15 reduction pathway Chloramphenicol 24 pein Fae geret enhance disulfide bond formation ez B kan DES pLysSiRARE in coti cytoplasm provides rare codon ENAS _ Tuner B F own T doni Er gui denm control nan expresssan hosi mone Taner DES B FO ThE I dem dark general expression host lnc none mad gat permigae mutation allows contral of expression bevel d Tuner DES B F comp has n ag gad dem lnc high stringency expression Mee DE geet oe ei foc permease maion Chieramphienicil H control of expression level Novagen bo IN pET System Manual The appropetabe drag select for ihe target plasmid musi abo be added In this context non expresstean means that the strain does not contain the gene for TT polymerase and therefore wall not express rom target genes under tbe control of a T7 promoter These strains pay be suited for expression from E e promoters seh ios fuc dar fir and Prge oF fes infecti by ACER fes RET Expression means that the strain is ADEA angen Le it carries the gene for T7 RSA polymerase ursder mc
101. L3 r3 EJ Eu ee L3 E3 5 C3 E Ww ESE 3 cD aan Ez Ex c rt o 2 Oo oO oO oO oO C mn oO oO oO oO EI LL LI nl Co LI Co Oo 0000000000 0000000000 uster 2611 Benzonasg 0000000 00000000 0000000000 Cae ES oa ea 2 2 2 wool m1 N o 8 2 0 noo ooo oo oo oo EE oo oo 1 E oo oo oo rc EE oo E E33 oo Ad oa ee Ee 4 o feo rs Ear ES et ol UJ c Q UJ BugBuster Reagent HE AIUD tea HE BugBuster Protein Extraction Reagent RU ANY 7 7 TCHREIX CSSS 705843 100ml 70584 4 500ml BugBuster HT Protein Extraction Reagent bY A23 7 y CURHEIXUC BEAR 70922 3 100ml U7zBugBusterd3 k U Benzonase 70922 4 500ml NucleaseeO FU 3 70922 5 1L BugBuster 10X Protein Extraction Reagent 7273 7 y CIXAZAS AA 70921 3 10ml 70921 4 50ml 70921 5 100ml BugBuster MT 3 v 5 7 77 70923 3 100ml Extraction Reagent
102. O St ES O00 595 SDS Sample Buffer 00000000 0000000000000000000 9600 0 104 000000000000000 0 0 000000000000000000 ssay 50 Tag Rapid Assay GST T ag ssay 31 Co oO Ec Ooo 000 9 000 Works 2 4 OW Lr c 25 000000000000000000000000000000 00000000000 00000000000 oO Po Foo Oooo T ris OBindgoooodoodgdo 0000000000000 00000000 Tris Binal 0 oboPop His Tag GSTO 0000000000000000000000 PopCulture 000 000 0000000000000000000000 e ET r3 L3 E3 be eo doo oo Iu Uu L3 r3 L3 r3 L3 r3 r3 Ao 200 gp 1 Co UJ N N Q H Novagen pET System Manual IN 0000000000000 Media Periplasmic yioplasemii
103. OOOOO 000 13 mm x 100 0000 000 000 000 000 000 0 000 000 00 ODO0OO0OO0OOO0OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO OOO00O00000000000000000 OCOOCOOOOOOOOOOOO 0 000 00 37 OO0O00000000000000000000000000000000000000000 0000 400000000000000000000000000000000000000 OO0O00000000003PQ0O0O000000000000000020000000000 1L 0 5051000000000 Test Plasmid OO 0 Su 00LB0000000000000 000 1610000 25 00000000000 00000000000 500 000 0000 00 0 0 59 0000000000000000000000000000000 OOO0O0O0O0O0O00O0O0OO0OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO OO 00000 4x 10 900000000000000 NovaBlud 00000 000 X 28 000 0 00 00 000 0000 00 0 0 00000 00 1 10 transformants u 9 plasmid 000000000000100 Test Plasmid 50 00soco00005uQ0000000000000017x 109 00000 0000056 10 NoveBlud 1 00 0000 00000 000 O Tet Plasmid 0 0000000000000 12 0000000000000000000000000000000000000 370 0 00000000000 0000 5 5 5 5 5 0 25 0 Bsa Sam Foo noe ooo Qu 28 u SOC 000000000000
104. Protein 0 505 000000000000000000000000000000000000000 18 0000000000000000017100000 10000 90 00 000000000 00000000000000000000000000000000000000000 0000000000000000 2 10 1 10 1 2 SDS Sample Buffer 000000 PBs 100 10000000000000 125 mM Tris HCI pH 68 4x SDS Sample Buffer 0 0 0000 706073 1000 00000000000000000 4 505 5 2 150 000203000000 200 30 0 80 100 0000000000 Branson Sonifier 450 0 mM DTT 20 0 0 O O 0 000000000000000 00000000000 27 0000000000000 0 0198 OO 0000 00000000 0000 4 70 C UOOOOOOOOOOOOOO0OG 525 00000 20 Novagen pET System Manual 0000 0000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 00000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000 Stader and Silhavy 1990 l 40 mI 0 4 10000 x 90 10 0000000000 2 0000001710 000000000000000000000000000000000 0 0000000000000000000000000000 000000000000 0000000000000000000000 3 0000000
105. S ao mtr p4 E3 pum Ed Ed L3 E3 E3 NET tere Wao L3 E3 L3 r L3 r3 r3 zT c x w fa te EE ea Gal ti oy PED mg Co oo zz LJ CO pus eo 3 oO 1trxB gt o 0000000 Aslund et al 199 rigami Ori 000 gor 0000000 00000 Origami DE 000000 Prinz 000000000000000000000 00000 Origami BO 0000 0 0 O O 0 00000000000000000000 Oo O N gt 5 N Q DE3Q 0 trxB i DE3 0 000 00000000000 trxeg 0000000 0 O Bessette et al 19990 000000000 1 ro m r3 Ez Ey U r3 N T x UJ oo 3 ne gt ggo oO E EE oo e oo oO oO oO yoo Q S a CO CO CO ooo 8 RP
106. STQ Tag His Tag 000 HSVQ Tag 000000000000000000000000000000000000000000 50 GSTQ Tag 50 Tag TZ Tah 00000000000000000000000000 50 Tag Assay GSTQ Tag Assay 000 0000000000000000000 0000000000 Works 50 Tag Assay Kit J O O U O D 0000000000 00000000000000000 0 His Tal 0 0000000000000000000000000000000000000 0 000 Co LJ Oo Oo E E4 0000000000000000000000000000000000000000000000 000000000000000000 0 00000000000000000000000000000000000 El Novagen pET System Manual IN Tag 346 pET 35b 47 00 00000000000000000000 CBD 000000000000000000000000000000000000000000000 00000 0000000000000000000000000000000000 000000000000000 Nus Tag TrxQ Tag 0 0000000000000000000000000000 00000000 00 000000
107. Z 70 ul Z tartar harresi E NEM BD Novagen El X N pET System Manual B 0000000000000000 000000000 0 Novagen 0 000000000000000000000 0000 DO00000000000000000000000000000000000 0 Perfect Protein Western Blot Markers 0 0000 0 69959 30 0 0 0 Trail Mix Western Markers O O O O 71047 3 7104831 50 Hisp Tagh 000 00000 S protein Conjugate McCormick et al 19949 O 0 His Tag Monoclonal Antibody Fourrier and Hayes 20017 00000 0 000 00000 Western Blotting Cat Tachnical Bullatin Apglieatine CBDTagz detection CBD Antibody 7011953 Polyclonal WE Tag Antibody Polyclonal WB CBD Antibody OLAS BOD l Polyelonal WE GST Tng detection FETA Tag Juni boty Spe TEES IF IF QA WE 3540 Hie Tag detection Hiss Tag Monodora Arai lady TOTH dug TEH IF IP WB TOTIS 100 ug His Tag Western Reagents TOT 3 3 35hhus TRJ colarimetric detection Hist AP Lamiblet Reagents 25 bows TES chemiluminescent debectian Cis Taz HEP LumiBlce Reagents
108. ____ pem 713 1 ewe IL ern e Lr ip p eroe Jw pp edn je w _ f D e c _ _ pee j persa 1 j LI e ij pro muc joe p Mj grito _ 1 I pe IW jw P Mj prse jw eus 1 sg T T TW erm je p WW pee j persa ne wp de f j grs jw jw jp p pi p puru w erue e t L j v pora e _ I l5 1 Vector kan Trae ag Sea HS Tag Nuselag signa amg HigsT amp g TisTag TrzsTag KSI GST Tag ge lease H
109. a gt ot oO L3 L3 qc Q D H m 2 pET System Manual Oo Co Coy Co LI il LI oO N 5 LI LI LI Soo oo o H Oo J aci 0000 0n O0AQ0000 U Studier and Moffat 1996 00000000000000001 00000000 00000000000000 IPTG Induction E pripnanme gue TF 1 r3 EJ r3 r3 O 0 Doo EEE 5 L Onoooo gobo O gi a nao O N z EJ EJ Ed rj Aoo U gt r lt 8 N a S o See co r3 r3 rr gm rm 0000 00000000000 0000000000017 00001 00000000 20 00000000 000000 0 0 77 RNAD 0 0 nO OOOoOT7 00000 J 00000000000 00000000000000 000000000 000 000000000000 lad 00 gt ing epaper E cali
110. dase Assay Kit 00000 7097830 000000000008000000 00000000000000000000000 rLysozume Solution Benzonase Nuclease 00000 BugBuster Reagent PopCulture Reagent 7 5 0 0 Tris 0000000000 0 00000000000000000000000000 BetaRed 0 D D D 000 00010 000000 1290 00000000000000000000000000000 sexi 000000000 Novagen E IN pET System Manual X Acknowledgments Novagen gratefully acknowledges Bill Studier Alan Rosenberg and John Dunn of Brookhaven National Laboratories for many helpful discussions and for their permission bo print portions of the sections About Hae System and Optimising Erpression References Ashanidia C and de Jong P I 1990 Neck Acids Res 18 GOGB GUTA Aslund F Bessette F H Georgiou G and Beckwith J 1595 10 11 12 F M Brent R Kingston R E Moore D D Seidman J Smith J A and 1888 in Current Protocols in Molecular Biology John Wiley amp Sons New York Bessette PEL Aslund F Beckwith J and Georgiou G 1998 Proc Natl Acad Sci B 170 Brennan and Lin S H 1096 ta Strategies for Protein Purification and Characterization A laboratory Manual Cold Spring Harbor Laboratory Press Brinkmann U Mattes RE and Buckel P 1980 Gene 109 114 Burgess LR 1991 Meth Ensymol 208 3 10 Burgess LR 158986 Meth Enzymol 278 146 149 Buttistuzzi Esan GLP
111. e Molecular Systems Inc and PE Corporation KOD DNA Polymerases are manufactured by TOYOBO and distributed by Novagen Inc KOD products are not available through Novagen in Japan KOD XL DNA Polymerase is licensed under U S Patent No 5 436 149 owned by Takara Shuzo Co Ltd Purchase of or NovaTaq DNA Polymerases is accompanied by a limited license to use it in the Polymerase Chain Reaction PCR process in con junction with a thermal cycler whose use in the automated performance of the PCR process is covered by the up front license fee either by payment to Applied Biosystems or as purchased i e an authorized thermal cycler Novagen is a brand of CN Biosciences Inc an affiliate of Merck KGaA Darmstadt Germany All Novagen products are sold for research use only Novagen pET System Manual gt 1 L
112. ent Cloning 0 Aslandis and de Jong 1990 Haun et al 19921 12 50 000000000000000000000000000000000000 00000000000000000050000000000000000014 DNAQOO 00003 gt 5000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 lt 0000000000000000000 0000000000000000000000 Factor 00000 0000 00 00 00000 0000000000000000000000046000000000000000000000 00000 163000 2059 000000000 Novagen A pET System Manual F 00000000002 DEX 0 0 0 0000000077 0 00 0000 000000000000000000000000000000000000000000000 00000000000000000000000000000000000 000000 000000000000000000000000000000000000000000000 00000000000000000000000000000000 DEM 000000 00000000000000000 pET00O0000000000 000000 T7T7ad 000 JOO plysso 00000000000000000000000000000000 0000000000000
113. g ml DES pLysSRARE Cm dl xpresssan jewel provides rare codan Rilis Rasen K 12 LLI xe conbral non expressian hoes Tetracycline 12 5 recAI gyrADS ret lac F pee IU Chlorcamphenicuil H pein cl Z AMES pERARE Cm i Blur DEJ von Fry my thi d rec eA K 12 foc general Tebracycline 126 recAl gurAS rll dac F prot E expression hast provides rare Chloranplienbeil 13 pgm To Tn AX Tey DES pRARE IRM AS 1 SLAT iad Tr spia eed recA K 12 iwer high Tetracycline ml plas FECAT FANG rol prot E stringency expression host Chi CH uml 7 Tc 1 provides rare codon 3 u Bieetia gami K 13 darau pho control bert Tetracycline 12 5 gall gati 1 logs Chlesanpihiesien gil pro gor 22 Tn 0 Ted arikan pRARE Roseita gumi DEY K 13 daroia TEET phot general expression host two Tetracycline 125 piod REK im cytoplzemic disulfide Kanamycin 15 pid apis uh gt A reduction enhance 24 gor Tard disulfide bond formation in E coli kon D
114. gles 000000000000000000000000 DO O U O Novagen NovaBlug 2 000000000 96 0 0000000000000000000000 991 00000000000000000000 000 31330 0 1 0 0000000000000000000000000000000000000000 0 0 00000 70 coo 0 0000000000000000000000000000000000000000 2 0 0000000000000000000000000000000000000000 3 31 4 02 000000000000000000000000000000000000000 00000 70 lt 0000000000 Singles 0000000000000000 50 00000000000000 0000 000000000000000000 0 02 000000000000000000000000000000000000000 002 0000000000000000000000000 20 0000 0 000000000000000000000000 15 00000 EE ES 0 RE 1 000000000000000000000000000000 000000 Test
115. ise ak S00 Cartridges Hise Bine Gick DO Cartridges Hist Mg Agarose Beads His Bind Huffer Lis Bind Purification Kit BugBuster Purification Kil BugBluster Eres Hinc Purification Kit PapiCultune Purificariors HissMa Purification Sv Tung purification Aparis Tarama Purification Kir S Tag TER T wTug purification T Tag Aparia T Tag Affinity Purification Eit 671 1 hil ml ferried MEF isk pigs ETE pkgzs TOE PETZ 11554 THE 70155 4 pkgit TUR pkgmi THES THRHR 10 mal THA TOES 70751 3 7OTU 3 TLEH Cat No Size 8 ml 7044 4 hx EEE Cat Sine 2 dd HME THOM Capacity is H mgd setrled resin TPOS buffers for naive purificati om using His Biri irsin TRY prepacked pre chanted Capacity is 10 ng per column pre packed pee charged requires vacuum Capacity i Dmg per colin THOM pre packed pre charge Capacity is OL mg cartridge THM pre packed pre charged Capacity ls 2 mg per cartridge magnetic agarose beads pre choreed Capacity is 5 mg per settled bends all buffers for native purification using His Bind Quick Columra Cartridges aml Agarcee Deads No charge budfer included TES 10 mil
116. kan DIES plas Taner permease mutation amd Chlaramphenicokt 1 pmi Cm mutations for eviaplasmic dissulficle bond formation Origami 12 Jarata AAPA phaR control non expression host Tetracycline 12 5 ape gal gal Kanay F ise lnc pee gor Tni Tei Eri kan Origami 12 T AR general expression host bun Tetracycline 12 5 alg RE dix navigation in cytoplasmic Kansmycim 15 reduction FIRE jian 90018 Fe dissul bond Formalios E tcl kan DES Origuma TES Lys K 13 Aad dad phot h ghestrngeney expression host Tetracycline 126 pimal en arabs pu gu A Ramee SD m 8 Flac loch pro gorse endunce disulfide tre kan plays Ci in E cyioplasm B F ompT my gal dem control non expression host Chbaraemphenical 34 pRARE Cm s DES E F T halls dem for Y general expression hos lec Chlorsmphenicol 4 pain Eon Eas hn Cr s quermeasee akwa coniro 2583 af expression level provides rare CHAS Base DES plays I ompT kads ir m gal dem high stringency expression host Chioramphenicol 34 n
117. kanamycin cam chloramphenicol tat ietracycline T X Factor Xa E anterokinase Induction conira O 708 33 3 haa identical characteristics 0 1 with the exception that pET 430 wes provided Novagen IN pET System Manual 00000000 Digest with restriction enzymes and dephosphorylate or use LIC vector Prepare pET Vector pu ZL Gel purify or use LIC vector L Plasmid prep and or PCR 2 Restriction digest or generate LIC Prepare Insert DNA overhang amp Gel purify 1 Ligate or anneal insert with pET West bor 3 lransforem into mon expresslorn host inte pel vertar 3 ldent by positive clones cany PER prepare plasmid DNA verify reading rame sequencing or i5 tiir transcription translation 1 Transform host carrying TT polymerase gene ADES lysogen or non DES host compatible with CEG infection Transform into Expression Host Op nnal best the plasmid stability 2 Debermine time course temparature far espressi in tob Induce and Optimize Expression and sulellular fractions analyze of Target Protein solubility and activity X Detect target protein by SDS PAGE Western blot quantitative assay 1 Seale up culture Scale op 2 Prepare extrect 8 Affinity purify 4 Cleave tags and remove protease if Target Protein icm Novagen pET System Manual IN B 0000 0
118. ml fo XE E INT ak BE OF nal frases Protects tanpet protein Irem don arl cmpT 043 pal poies I moll 19 1 ng 0 2 mil 01297 3 Selenometheanine and met labeling BLH 0 2 ml A rec derivative thal mag 0 4 EXT Lange plaamikla containing repeti rive J wl tl HM TTA 112 pal BIET ERE A rec K 12 airain thal may Igel 114 paamlda contalning repels Bape 1 ml lips X ml WEL High stringency host with the ree codec 114 ml maahansa 1 mil HEY ml 71910 3 Allows disulfide bowel formation in E eo 1 4 ml TUGONG 2E eybop lam 1 m l TII Origami 12 ml TOSS Allows disulfide bowel formation in E eol 0 4 ml TURO 3 ami protects large progeins from deoa 1 ml TOR wed and caupl proteases A derivative of Tuner eck enabling bow levels expression in all cells for solubility activity enhancement Reset 1 2 ml THES Enimie expression of proteins thal contain colons rarely in E coli AG ATA inl FIRS CUA COD GA A derivati of Che VF enaldisu leek expresion im all elles for sutiviry Hariini 11 Eahaners cx pression of paobeita that contain IKA ml TUH rarely wael ln E 672 AC ml CHA CCU GOGA amil is a high stringency hoal With nel erm asl lauf miaii Emachin gnmi IKZ ml
119. n Prometer Fasion tags Pretease insert Included wilh Cat Ha sibe protein wechor saries A pET 1415 BLIDENpLyss amp His Tag T pET 3 5 12 14h OPA qum li amp kDm 17 175 30b X1 E pET 15hb BLS LEA pla sam Tihw T 11 21 1181 n x C pET 165 BL21 DED amp Thu X PET Hh iTS nm 113k p plas amp Tagr i ga pET 1ith EL un cam _ _ kDa pET 29h GLE 1 DEEL kan Tac Tag T pET 0 24 BEIRA Ti Tag NEM 27h 25 F pET 2h 3 BLZ LH TE liaec Tug T E gal pET 28 G 3 BLE LES Trine B gnl uns Fe LIK H 3 BLW DET amp Time KSI cre Gu cam bet 14 8 1 BELDE amp TrxsTag pene PETE AEN Hira Tag IEE SeTag _ k FETHI kan Titer Tag Bard pETzHb 3515 10125 Tug D3BkTka bs 38h L BILZInDE Leste mane 40 TH Hiss Tag Wikia M kan Ta T Bld PRA site TTT H BL21 DE kan Titer pET 4H 42 IEEE HiseTag KL pET E amp Bb BLAU DEJ Tac none pET E 1 44 His Tag 6 ESV Tag Abbreviations amp ampicillin or carbenicillin kan
120. nPrep Plasmid Kit 1 53 ml HIN pa FONTS H U21 ug Lmid copy o 1 5 JAN The Kit dees described are for the LOO ml high copy or ml mikd copy preparalborms Additional buffers are required for gt 254 ml mid cap scale Technics Balletin 2701 00000000 0 000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 www novagen com 0000000 Strandase kit 000000 69202 31 0000 00000000000000000000000 1700000000 2 00000000 0 0 0 000000000 0 000000000000000000000000000000000 84080 000 13 1 00000000 60 000000000000000000000000000000 NoveBlud 0000 000000000000000000000000 L3 AOE Novagen pET System Manual IN 00000000
121. nual IN 0000 000 00000000000000000000000000000 0000000000000000000000000000000000 Novagen 000000 702563 00000000000000000000000000 000000 000000000000000 0000000000000000 0 00000000000000000000000000000 18233 Clonables 0 0000000000000000000000000000000000000 L1 oo m o 5 8 A oA rrr EME Se LI oo LE oo LJ Log ooo ooo A 10000 00000000000000000000000000000000000000000 1 24900000000002 0000000000000000000 50100 ng 0 015 Q 0 03 pmol 02 O O 000 500 620 000000 50ng Q 20u 0 000000000000000 15 0 000000 0000000 O DNA Ligation 000000 6983831 000000000 0000000000000 2ul 10X 0 0 200mM Tris HCl pH7 6 100mM M gCI 250 O O BSA 2ul 100mM DTT lul 10mM 2yul 50ng u lu T4 DNA ligase 02 04 Weiss units 1 Xu 0000000000000000 02 Yul 000000000000000000 209 000000000 2 16 000 0 0
122. oles T7 Tag 11 aa fusion T7 260 aa fusion tay se signal sequence for potential peri pis mig Inzalization imema tag N terminal ig C aptional C terminal tag protease cleavage shes T thrombin anterokin aca K Factor LIC ligatian independent cloning El Novagen pET System Manual IN 000000000000000000000000000000000000000000 LIC Ligationdndependent Cloning 00000000000000004 lt 000000000 0000000000000000004 lt 46000000000000000004 lt 0000000 wwwnovagenconr 0100000000000 000000 70000000000000000000000000000 000000000000000000000000000000000000000000000 0 000000000000000002 00000000000000000000000 00000008 0000000000000000000000000000000000000 7 00000000000000000 read through transcription 00 0000000000000001 60 0008000000 315 000000000 00000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000 000
123. ooo ooo ooo ooo ooo ooo ooo ooo ooo ooo A c e Oo oo oo 25 3 000 00000 000 0000000000 30 15 00000000000000000 0000000000000000000 15 0 0 SDS PA GEQ 00 000 0 14 000x all 100 00000 On 5 rn lt mo E Lr gt pgo og Lys 1 02 OD rm oo Go 4 Mi5mMiQ 0000000000000 100 00 00000 OO OO D D 70607 30 1000 00 0000000000 OOOOO00 05 0 000000 20400000 02 No wn 3 o UJ 6 0 0000000000000000000000000000000 7 000000000000000000000000000000000000 Novagen pET System Manual IN
124. ormation of expression host 33 vectors 5 truncated expression products 40 TrxsTag M 7 19 fecal Fusion protein extraction 45 16 22 36 64 Tuner M I7 64 UltraMobiust M 32 Western blotting 51 52 ederergent 34 48 Novagen IN pET System Manual Academic and Non profit Laboratory Assurance Letter The T7 expression system is based on technology developed at Brookhaven National Laboratory under contract with the U S Department of Energy and is the subject of patent applications assigned to Brookhaven Science Assoriabes ESA This technology inchwling bacteria phages and plasmids thet carry the gene for TT ENA polymerase is mace available on the following conditions IL The TT expression system is bo be used for noncommercial research purposes only A license i required for any commercial use including use of the T7 system for research purposes or for production gurpeeses by amy cammerrial entity Information about commercial leepers may be obtained from the Patent OMice Brookhaven Laboratory Upton Mew York 11974 Telephone 631 344 7124 Contact Christine Brakel No materials that contain the cloned gene for TT RNA polymerase may be alistribustesd further to third parties outside af your laboratory unless the recipient receives copy of this assurance letter and agrees to be bound by its terms This limitation applies to any of ihe following materials ihal a
125. ral sup E Deas Connie repetitive 10 mal GET EESES E144 DES pees O12 HHS TELLS Epa u 0 2 ml 60111 2 Novagen IN pET System Manual Competent Celia Glycerol Stock Strain Size Cat Ma Cnt ication Noa DEJI d ml Gish High stringency host with rec Lo ml rations use wih thue Mane i T Fs bes Origami DE 2 ml THATS Allows disulfide bond farmatsan in E eli LA ml THT cytoplasm L ml Origami DE Singles 11 rxn THEMES 22 rxn THA DES pl 0 2 ml TOBLB 0 4 ml TIMIZS 3 10 ml 70025 4 Origami DEA mly Singles Ll rxn TO 22 THA Origami HADEN hi Allows digalfide bond formation im nofi tha ml cytoplasm protects target probeim from ml Tea and omp proteases A derivative of Tumer Origami DES Lass ik ml enabling low levels expression in all ikd ml TI cells for solubility and acy enhancement L ml TOEI 0 2 ml PIR Enhances expressin of proteins that contain 0 4 TO004 3 podons rurely used im coti AG AGA AUA Li mi 10064 4 CUA COC GGA A derivative af Tuner Rossia DE 33 Singles 1L ex Iae F2 enabling low levels expresson in all H rmi cells for solubility ond activity enhancement DES Lysis OD md 7050513 0 4 md TUSCE 1 0 nal Rosetta DES Singles Hmm 71100
126. re imcloded in this kit and to any derivatives you may make of them coli ADMIN DEES E coti Origami culi ADH DEH plas E coti Origami E cu BHUAIDET E enti Origami BEDES 1 E culi DES E Origami BIDE pact E exl BLADEN Rosetta DES E cwi BLEU DEH plans Rosetta DES Lass E colt BLST DEF piLysE E mti Bosetta DES E culi BLH DEH pL E E m hora DEI E ooi EIL in DEY E coti Resetta gana DE ply E culi Blin roli Hearn DES placi E DES E culi BLADES Lys E coli Roe DED E HIMSTTACDE3 coli RnsettaBlue DES enl EDHSTTACDES pil coli Tuner DES culi HMSITR DES E rali Tuneri pls E DES E enli Tuner DESHpLael E DEA u Bactenophage Origami DES p Lye Eacpersapnliage CRG The initial purchaser may refuse to accept the abre conditions by returning the unopened and the enclosed materials uruscd By accepting or using the kit or the echoed materials wou wines to be laurel by the foregoing XIV Bacterial Strain Non Distribution Agreement purchase of the AHAA BLZ tent Origami Origami B Rosetta or host strains and nceeprance af the following terms Novagen grants a lenited loense bo use ihe A
127. s are usel to supress basal expression of TT polymerase prior to induction and thus pET recombinamnits encoding target proteins that affect cell growth and viability Competent Calls Glycaerol Stock Strain Sine Cat Cat Ha ication _ 0 2 nd EHTEL Allows disulfide home in E coli 0 4 mil EMILY cytoplasm 1 0 ligi ADA DES pola Z ml GHIZI ml E Lo ml MIA HSE OEH 3 ml PUO RR 3 Belesyomethicsd ne al mei labeling 1 4 mil Bp04 1 3 L ml BAH ESE 12 ml 1 4 mil OH Lal mil GH mE i2 ml qmm Protects target protein from iwa ond 0 4 ml 4151 2 probis LU ml G4 50 4 p2 14 CHEF TIOLZ 3 1 plates 7100124 21 plates TIOL2 5 BLADET Singles can TEHT TE BLA plas 02 imal GUSH 4 mil 51 5 1 0 pal FIL Singles 11 rxn 22 Fen TUS 354 BELL DES ML gs E 12 mil _ nasp a BLS tere DET D mil TAHL Allows disulfide bond lormatsan im E enl TA ml THES cytaplasm and protects target protein from fos 10 ml THR ard omp proienses Birr DED Less 0 2 ml TOUT AE Ta ml TUI ml _ BEI EET 2 ml SIRT A vec derivative of AL ihai may stabilize i d mi target pli containing repetitine sequences 1 0 ml ARIA BALE DET 1 2 mi Lire ren Od oui 1 0 mesg C nal ads 12 recA strain that sinlilize target 4
128. tem Manual IV 00000000 33 A 0000000000 33 33 u uuu 33 33 V 000000 34 00000 0000 00 0000 00 34 00 34 0000000 34 35 00000 35 0000 36 B 0000000000000 36 000000000000000 37 000000000 37 uuu 38 38 amp 0000000000000 39 0000 0 00000000000 39 5 0000000000000 40 100000 40 uadit 40 mRNAD 0000 41 000000000 41 00000 41 00000 0000000000000 41 0000000000 42 5 5 42 0000000 42 000000 0090 42 000 000 00000 000000 PopCultureQ 0 0 43 B Total Cell Protein 43 C D HB U 44 5 00000000 45 00000000 46 0 Benzonase Nuclease 46 rLysozyme Solution 00000000 U 47 00000 48 00000 49 BugBustet 00000000 49 0000000000000 49 G PopCulture Reagent 50 Vi 0000000000000 51 A 05 00000000000 0000000 51 B 0000000000 000000 52 vi 0000000000 53 00000 54 B 000000000000 U UI 56 IX 00000000 8 000000000000 57 00000000000 57 X 58 Novagen pET System Manual IN X 0000 58 xi 61 00000 000 00 0 0 000 00 0 0 000 64 XV 00000000 64 XV 65 DE3 OU 65
129. ybalski W 2042 14 GE Snyder W B and Silhavy 1895 Bacteriol 177 063 043 Sone ML Akiyania Y and Dto 1997 4 Biol Chem 272 Sorensen MLA Kurland and Pedersen 5 1380 J Biel 207 385 377 Shader J A and Silhavy TJ 1589 Heth 185 100 167 Stewart Ed Ashai and Beckwith J 198 EMBO 17 Shier FW 19901 J Mol Hiat 219 37 44 Studier FEW and 19898 J Mot Aiat 188 113 1540 Buller F W Rosenberg A H Dunn JJ and J W 19040 Meh Enzym 185 1 6 Tessier LH Sondermeyer P Faure T Dreyer D Benavente A Villeval Da Courtney M and IP 19884 Nurleir Acids Res 12 764 7675 Tobias J W Shrader T E 5 and Varshavaky A 881 Science 254 1374 1377 Wickner W Driessen and Hartl PAU 1901 Araw Biochem 60 101 124 Wood W IIH Mol 16 118 5133 Zahn Heneri 178 Zapin A Missiakus D Raina 5 and Creighton TE 126 Biochemistry 34 dn zhang S F Zubay G and Goldman E 156 108 61 72 Zhang X ind Studier FW Mos Biol 268 10 27 Novagen pET System M anual IN Index B galactosidase asy oS Assurance Letter 64 Acknowledgements 55 ADB 16 22 36 64 affinity purification 40 irse gel 24
130. z Orgami Orgami BODES ply Cell 5wet mil AF THAT Inserta DES V ase tiae erm pete Sa ta each TINS DES BHesettaBlue DE33nLysis Compebent Cell Sent each TORS Rosetzn garlt DE Rosettn gnaml DES Cell Set ml each TOL Paner Tunen DEA Tuner ply System Lambda Phages Lambda Sine Cat ication Bacberiaphage i2 ml A recombinant phage used to provide n source of T7 RHA Polymerase l mil dice bo susspptiihile host cells carrying pET plsmids 10 ren TEM Designed for inbesabion of ADES prophage diio amp ewi hosi cell ADEA Lysogenization Kit 10 ren elircenascae such that the hosi can be to express plus plays amp pLysE targa pores cloned in nET vectors Novagen PT FERRE 0000 00000000000000 153 8927 1 8 1 3 5434 4722 Fax 03 5434 5076 0 541 0045 00000000 2 6 7 0000 6 6202 3459 Fax 06 6222 2487 Tel 0120 189 390 0120 189 350 E mail service merck co jp http www merck co jp 00 150 70 23000 000 0000000 05 Oz Ost 00 ii i ii e H jee N

Download Pdf Manuals

image

Related Search

Related Contents

IBM ES750-P-M  DynaScan DS72LT4  sc-akx90ph - Panasonic  08Lankofuge masse 322  Value line, 24 MHz STM8S 8-bit MCU, 64 Kbytes Flash  EA956FG-2,EA956FG-4(ワークベンチ(引出し付))取扱説明書  Nyon operating instructions  BLE - BLX VÁLVULA DE ESTRANGULACIÓN  National Instruments 320682C User's Manual  Brother NV6000D Sewing Machine User Manual  

Copyright © All rights reserved.
Failed to retrieve file