Home

ポータブルミニディスク レコーダー

Contents

1. 109099 00 000 09000090000000000000000000 D OPENJODO 00000000 OOOO CDO ODM m 00 000000000000 000000 0000000 00 POC 15B0 0 000000000 000008500 0910000808 000 LINE IN OPT g 00000000 3 00 END oh PPPRP 2 90 00 90m SYNC RECO 0 0 3 0000000000 t SYNC ONT 0000 8000000 O 000 850000000000000 O RECO 0 O RECO 0 00000 RECO 0 0000000000 O 000000000000000 0009090098 0008000 0 0000 0m0 0 0 0 0000000000000 D OM SYNC OFF 0 00 Bg 0000000000000000000000000000000000000000000 0000
2. onoooooo a m oo C3 C3 C3 C3 C3 C3 4 4 BROOD ia oo Fo oooooo rom oooolo aoooofoon E oo 22 OO oo oo N oo iy os E3 c3 C3 EJ c3 C3 Epp oo ooo EJ oOo EJ oo Do ovo oOo mu of oOo a E SA ogg oo NOG B oo ooo za saa E303 r3 r3 ojaga 1 OOOO oo os 2nognHH 3 2 Bao Pau rem a SS oo LO Oo 0O ao m 11 oom ooo a L3 p E3 29 C3 Oop ol OO agfa tH Sono H oo0000 ma E oo 50000 Dcus ug 500660000 ooo noso oo 05500500 i ii Sq uad Boi 1021 oo OF pono 1 ooo 1 EXT oo neg gas 1 io ooo Boar oo o2 r3 3 22 DOS rr pa oe om ln 1 oo on Doan oo e Fon io 3 2 GOSCI oo E EU E 1 1353 ooo oo oHpogpo 1 00 ooo oo 1 o Ed oo 1 00 ooo oo oHpogo ya oo o0pogpo 1 000 0000 t oo mt 1 OO E oiga ou 1 OO Oooo Oo oo ricimprmn oo 1 JE OOo OOO oo 0000000 1 OO OOo
3. 000 bd Ee 002000 9 0000000 0000000000 0000000000 000000 1 0 00000 00000000 00000000000000 Tel 03 5353 03360 OTL TAN unamasa na nasa 11 L L LTD DO ODO UU DE L L O00 LU Ut L E E CD LUI LE UE LE 56 oo E U E U gt al El 2 52 22 2 2 c c Co ET L 4 nm Ou Psl PEI Sl ess E 666 ES
4. 0000100000 y SHU 000000000000000 PGM0000000000000 000 100000 000000 Normal 0 000000 4 2000000000000000 ALLRepeat cn 00000000 RPT ENTODOO oo gt y 1Track fnpnnug 100000 y 1 Repeat G 100000 10000 MAA 000 0 WB ge na 80 0 Shuffle SHUF00 00000010 000200000000000000 ol s 0000000 Shuf Rep c SHUR 00000 1 00000000000000000 000 000 0 0 00 00000000 00 y PGM PGM 0000000000 200000000000000000 00000 y PGMRepeat G PGM 00000000000000000 a 300200000000000000 BOM Ce o 009909000000 900000 4000000002000000 00000000000 100000 00000000000000000ON 00000000 OFFO0000000000000000 ugaggagaggaggagagaaa s dada 100000 00000000 tooo PLAYMODED 0000000 D EEE 2000000000000000 d RPT ENTD DD DD DD DD 0040000000 g Sa
5. noo 00 i ooog 0000000 DISPLAY 00000 AAA 200000000000 000000 00000 000000000000 00000 1 00 EA 0000000000000000 000000000000000000 00000000000000000 0 0000000000000 0000 000000000000000000 00000000000 000000000000000000 100000000000000000 8890888 9 100000000 1 GROUPD 20000000000 00000N aaa Eu 0000 00000000000000000 30000000000000000 0 960000200 4000000000000 EDITO 100000 30000 I 5000000000000 EEEE O gt 0 Erase00 00000000 ee DHT 00000 5000000000000 EDITOO 0000000000 0000000000000 O AllErase TT PushENTEROO O 10000 600000000000 60 5590 AN 00000000000000 0000000000000000 00000000000 GP Erase TOC Edit a 000000000 00000 PushENTERDO 0 0 D 0000000000000 BLANK 018 0 0 0 0 0 ic 00 0000 000000 70000000000000000 000000000000 0000 CANCELD0 DDD
6. DISPLAYO000200000000000 1 1 gt Name Bank 83 lt gt Uu lt gt Uu GP NameP gt lt Pr Name EDIT 000 0000000000 0 0 0 0 DISPLAYD 000 20 But OLINE OUPO 0 0 0 0 00000 0000000000000 194 10 ka 0000000 Degg 0000005mw 5mw 1690 DO 00000000000 NH 14WM A 1 2 V 1350 mAh MIN Ni MH 19 000000000300 10 00000000 DC 3V AC 100V 50 60H2 0 000 AC 100 240v 50 6002 000000000 11 1 1 1 000000000 68000000 1 1 1 78 9 x 72 0 x 17 1 000000 80 0 x 75 5 x 20 0 mm 00 00 0000 J 108000000 0135000000000 gogo000 00000 0000000000 0000 9 0 00 0 00000000000000000000 000000000000000 00000000000000000000 00000000000000000000 00 000000000 00000
7. TIME MARK Selecting the Auto Time Stamp setting page 98 MIC SENS Selecting the microphone sensitivity page 98 SEARCH Selecting the search mode Index search Time search page 100 AVLS Automatic Volume Limiter System Selecting AVLS ON or AVIS OFF BEEP Selecting BEEP ON or BEEP OFF for both MAIN UNIT or REMOTE for the recorder page 116 Selecting BEEP ON or BEEP OFF for the remote control REC Posi Selecting the start point when recording page 97 LPStamp Selecting Stamp ON or Stamp OFF page 96 CONTRAST Adjusting the contrast of the display CLOCK SET Setting the clock page 99 OPTION OPTION OPTION To check the menus and menu items that can be selected at each menu level see the following pages in Japanese text Menus while the recorder is stopped see pages 78 and 79 playing see page 80 recording see page 81 Menus while the remote control is stopped see page 82 playing or recording see page 83 RPPS List of menus Menu functions To use menu items on the recorder press the jog dial to enter the menu turn the dial to select the item and then press the dial again to confirm the menu To use menu items on the remote control press DISPLAY for 2 seconds or more turn the control repeatedly to
8. 00000000 EDIT g gt Name lt East lt E Release lt Name Bank lt gt BankErase E gt Erase lt gt E5 Erase V DISPLAY A V LapTime lt RecRemain lt gt GP Remain lt gt AllRemain lt gt Clock V PLAY MODE HR A Normal lt H gt AllRepeat lt gt 1Track lt gt 1Repeat gt 2 lt Shuffle 9 V PGMRepeat gt lt PGM lt Shuf Rep REC g A SP gt LP2 lt LP4 lt gt MONO V M TIMER A OFF lt gt ON TIMER 1 lt TIMER2 lt gt TIMER 3 V A HeadPhone lt 2 gt LINE OUT Y AAA SOUND 0 AL SOUND gt lt SOUND 1 gt lt SOUND 2 101000000000 lt 2900000000000 78 2900000000000 lt lt gt REC Posi lt 5 gt LP Stamp lt amp gt CONTRAST CLOCK SET From Here lt From End o gt lt REMOTE Stamp ON gt lt Stamp OFF i BEEP OFF BEEP ON gt lt BEEP OFF
9. o 67 a a a E E a BDDBHBBDDBBODDBHDDDHU utu ooo LP2 LP4 000000000000000 0000 0000 00000 03000 03800 04200 00000000000 10000 NH 14WM 000000000000 000 04400 05200 06200 0300000000 uug 07 908 0900 000000000000000000 00000 000000000000000000 0000 000000000000000000 200000000000000000 D0000000000 2000 00000001 LOW BATO00000000000000 E o Ooo 11148 00000000000000000 OOOOOOOOO 000000000000000000 7 0 JEITA ooo utat noon 2 4 ood 000 0000 ood Uu Uu 00000 0120 1700 02100 OOO00 2 OOOO 01200 01900 02300 00000 800 04300 05200 00000 m SM 000000000 NH 14WM A 0 1000 D 2 000000000 LR6 SG o pOoodoaoc onoooo 000000 LLL 69 H no no Dao 3
10. 000 640 Do DOOFFODODO ci Go a e Lj nooo Zr ouPg 200000000 0000 400 GROUP 3 0 0 D E 2002900003 36 gggggggggggoNgung k x 00000000 E E E E E E nnuununnunnunn nn 10000 0000000001000 1 Track 00000000 Shuffle 00000 poo0000000000000 000 PGMODODODODOODOD 0000 000000000000000 100000 880 00 00 De00000000000000 H 250000000000000000 00000000000000000 PLAYMODE 0000000000 RPT ENT T 1000000000 1000000 0000000 E se Va oon e C O0 20 Hs p0000000000 8400000000 00000 000000000 0000000 E s 1 0000000000000000 2000000000000 PLAY 111 1 0 0 0500 00000000000 100 250000000000000000 10000000000000000 a ooo 00059000000000000 001 0000000 37 000000000 3 0000000000000000 10000 PLAYMODEJ 000000 go 00000000000000000 000 000000000000000 0000000000000000 00000000 o00000
11. 00 800 00 0 000 000 000 d OUTO D0000000000000000000000000 EDIT A a d Name lt o gt NameP GC Name lt 5 gt Name Bank V DISPLAY A LapTime lt gt RecRemain lt gt Clock V RecVolume A Auto REC gt lt ManualREC V REC q A sp lt gt m l rim lt mono V AUDIO OUT A LINE OUT lt gt HeadPhone V SOUND A soup OFF lt gt SOUND 1 gt lt SOUND 2 O V TIME MARK OFF gt lt 5 min ON lt gt 10 min gt lt 15 min ON V SYNC REC A A YNC OFF gt lt SYNC ON V MIC A HIGH gt lt SENS LOW V CEDON J00000000000 AVLS lt 2000000000000 AVLS OFF gt lt AVLS ON 00000000 0N000000000000 5 0000000000000000 9 AINE OUT DO000000000000000000000000 CANCeL000000000000 81 BankErase
12. a aos o 2 3 2 00 pH ET 2 0 nooo 0 O Ooo 2 gt E ono 3 Pp q 0o00 0000000 2 oo BARRO 6 6 2 Too 00 1110101000 00 000 000000000 0000000000 000000000 000000000 00000 00000 00 Donos 4 2 Et 72 Eo lu BO 3 TYPE RODO DSP Digital Signal 0 MD El El noo 2 00 00 TYPE RO O O 0 0000 DD n E O amo 5 e o lt gt eo U
13. 1 1 CT EET IPE S D I 000 5 goog oon oo oon oon oon oon aa oon oo oo oo oo oo oo E E poo OOO TESTES beu son 0680000000 LJ rm re saen Qf ra 1 ro Ed Ed Ed EH Ed Ed Ed r3 r3 r3 O EE EE TESI r3 m EEE r3 r3 r3 r3 L3 r3 r3 r3 EE ono EE oo 600 2 L3 Ed F3 L3 Ed F3 L3 Ed EE E EJEg EI Toopypooo 123 1 t AC co EL CT r3 F3 E3 Si Ban i ces ES CA ES ES ES ETE ET ET e Ge 4211 48 E 8 ID ID 7
14. PERSONAL A Entry lt gt Erase V SYNC REC A SYNC OFF le SYNC ON V MIC SENS A SENS HIGH lt gt SENS LOW V OPTION A AVLS lt gt BEEP AVLS OFF gt lt AVLS ON MAIN UNIT BEEP ON gt lt 2 5 O LINE OUT 2 80 0 000000 79 d d Name lt gt E Name lt H gt Name Bank lt gt a d Move lt E Move 0 DISPLAY d Erase A LapTime lt gt 1Remain lt gt GP Remain lt AllRemain lt gt RecDate V PLAY A Normal gt lt AllRepeat lt gt 1Track lt gt 1Repeat lt gt Shuffle PGMRepeat lt gt PGM lt Shuf Rep V M TIMER A 2 OFF y V TIMER 1 lt 2 gt TIMER gt lt TIMER3 AUDIO OUT LINE OUT lt gt HeadPhone SOUND OFF gt lt SOUND 1 gt lt SOUND 2 PERSONAL A Entry lt gt Erase V 000000000000 OPTION lt 0000000000 4018 lt q y AVLS OFF gt AVLS ON MAIN UNIT lt gt REMOTE y BEEP ON le BEEP OFF BEEP ON lt BEEP OFF
15. DO am r3 L1 ND E SEARCH 00000 OOO 00000 O A O 50 a 51 ANCEL D CANCEL PushENTEROO D D po000000000000000 O 00000000000 0000000 0000 0 OO ISPLAYO 20000000000 0 ong 1 51 4 00 000 000 MA DOO 000020000 o Uma 000460000000 EARCHO 00000000 e E ES 3 Oo to HO am 44 2 0000000000000 3 END SEARCHO 02000000 00000 000000000 049000000010200000000 20000000000000000000 3n0 0200000000000 O0U0000000 1 2000000000000 EDITO 0000000000000 3000000000000 Name Bankd0 00000000000 400000000000000000 000020000000
16. Moved O O DISPLAYS 20 00 EDITO del 00000 OOO 00000 000000 DUO OOOO OFF UD oo 000000 Om 000000 003 003 00000 00 0000000 Emp Oo 00 003 2 1000002 50000000 100000000 200000000 Nm o000000 10000000 300000001 000000 400000000 58000000 uan 0000000 0000 ONO 0000000 0000000 0000000 000000 000000000000 U 5 00 20 00 DISPLAY 00000 O EDITOO DD DUO 000 El ES O Lt m m 1 D wan Movenn 000 gt gt as 57 1000000000000000 1000000000000000 0000 00000000000 0000000000000 0000000000000 PAO 1 14 0 00000000000 12500008 O0 g 2 oo 020 U Ez gt lt YN E Co Dom O O DISPLAYO 20 ROUPOO OOO o 200 no Oo rar HEI sa E ELI On oOo On oo nooo EDIM000000 Dom Buu Buu Dom
17. 00000000000 34000 m 000000000005 0000000029000 00 EDITIO 1111 1 0 asen 00000000 his EEE Domo ES Erase OK PushENTERO y 40000000000000000 10000000000000000 00000000000001000 00000000 10000000000 DISPLAY 2000 EDITIO D 0 0 0 Sel Erase0000 au ushEnteQO OOOO IO aea GER a 1 po On oo 2 EA 4 2 CL m D 1 oO O gos oo n Oo La I r3 O 00000000 00000000 59 D D D OOO E I az JE Gan SS ban EIA t BE La El LJITCCIPEI 53 eL 5 9 NCELO ISPLAYO 200000000 o gt to 0 D ua NO am a E nooo 0 E p
18. 00000000000000000000 000000000000 gt gt 002000 2000000000000000000 000000000 000000000 0510000 00000001000 DISPLAYD ODO 00000000 000000000 DISPLAYO 20 0 0000 00000000000 PLAYMODEI 000 0 000000000000000000000 300000000000000000000000 000000000000 500000 60050000000000000 780 2000000000000 EE 49 0000000000000000 21000 047048000 0000204000000 0000000000000000 000 3000 048000000050 700000000 ood oO O NCELI 0000 ANCEL 000 PushENTEROO D DD DB LAYO 20000000000 0000200000000000 po000 O imn a Urrtr 000 000 000 ooo 000000 000000 ooo oof 7060 eo a E3 2 goog E3 C3 B3 r3 ma iu ia iu iu IS Ono L3 oo L3 va c3 E 4 2 OP oo o 5581 51 zaand Enn Doom 2 HO HO Hoo DO oS g 2
19. 000 0 0 LINE 0000000 1 1 1 1101 1 Nw 0000 0000000 0000000 LINE INg 0000000000 000000000000000 CDO00000 DYDO00 000000000000000 000CD0000000 000000000 000000000000000 000000000000000 0000000 D000000000000000 000000000000000 000000240000 000000170000 O00000 000000 00000000000 000000000000 000000000000000 00000000000 0 00000 20000000 8600000 0000000000 000 000000000000 000000000000 0 oo 00 CD0 0000002 0000000000000 86000000 0 00 0000000000000 000000000000010 0000000000000 030000000000000 00000000 00000000 0000000000 00000000000000 000000000000000 REcC0o00000000m00 0000000000 03000 UM 0000000000003000 Dm 00000000000000000000000 800 00 00 000 59000 au 0000000000000000000000000000000000000000000 000CDo0000000000000000000000000000000000 0000000 0000000000000000000000000000000000 868008000000000000000000 00 0000 c00 0 RECO 0 20000000000 Oo El Oo RECO 000000000
20. 11 1 11 1 11 1 111010101 0 300000000000 LINE 000000 doo YA O LINE OUTO DIT AUDIO OUTHO 00 LINE OUTOD 0 00000 OMLINEIND 0000000000000000000 000000 000000 oo 0000 0000000000000000000 OLINE OUTO AUDIO OUTO 00 LINE 0 0 0000000 500000000000000000000 30 O LINE OUTO AUDIO OUTHO 00 HeadPhonedg 0000000 EP 1000000000000000 000000 000012000000000 0 0000 0 17000 00 10000000 6000000000 8000 0000000000000000000 0000000000000000000 000000 7 PIRE pg00900000 5 10 000000000000 000000000000000000 I 00000000 TOC Editnn 0000 y 0000000000000000000 000000000000000000 fj 8 000 00 TOC Edit00 000 00000 FO C hs ol run xs SAS EA a VEhXEVIIFY V
21. GEE ESA EMA foxes mess 288 LILIEIx EE Eye Bonao Ooo oo A B fim 2 EFF EF ES SE 1 85 ens 5 O Oo L1 O O 11 L p4 EJ C3 C3 C3 UU TOC EDITOD O Table Of Contents OOO j O 0 ri 1 1 0 1 0 1 6 1 92 mar ice A sma QI 62 6 1 COCO O OOOO A E E 10 01 12 ESSES 6 2 0 Oo p 1 LE 51 5 A p 1 54 51 A o A p 1 54 51 A ES Co Co Co Co Co ZA Ed T CO Cd Ed Dd Ed C3 44 1 oon y 2 2 2 22 2 E3 E3 U gt C3 C3 C3 C3 C3 C3 o opooogo H OOOO ZL ses O ol 1 SE 1 1 BES
22. Oooo E r3 an C Doogo ooo noo ooo ES E O eH E 000000000 000000000000 go 100000000000 0 1 89 200000000000 000000000000 g 20000 000000 20000000 o 1 00 LE at poo DOU O ft LIC CIC EICI ono ono ono 0 o 11 D E EJ EE T 2 OO tL 000000 000 r3 000088 00000000080 0000LP20000000LP40 000000000000000 0000000 3500000000 0000000000000010 000000000000 6400 El E El EE E adia ese G en S ama ama ono ono 1 ES E E El am F TTE EEE am DT EE Do Do 0000000 O gt 0000000000 00000 OPENI 2000000 EEE es EE OO Ban es 00000000000 Cz E r3 2 r3
23. oo oo oO 00000 00000000 00000000 AUDIO OUTO uuu HeadPhone uuu 000 O aaa EE noo ooo ooo ado ado 53 ado DOU 000 O00 Oo Do HO F3 ENERO ETE C3 F3 YP ETIS OOOO 0000 15067 CTIO EE Iz EE 000 000200 0000000000 00000 0 yu ona J Pee O EE ar ojog 910 200 200 Do El ET L N O E 22 JL JL JL JL 23 HU UD BB U U U B U D 111111111111111111411111111111111 CD0O000000000000000000000000000000000 000 111 1 0000000 LINE IND 000000002000000 0000 D0O00C0000000000000000000000000000140000
24. ooo TII IL L LI L D 000000000000000000000000000000AC000000 oo0000000 4 6 C N 00000006000000 14 2000000000 Tu y g i d AS CHARGED 00000000000 DC IN 3V0 00000000 0000NH 14wwpgog0mo00000000000000000000000000 000000000 0cHARGBE 1 000000000000DmD0000000000000000mD 0000000000 0000000 AcC0D O0O00000000000000000000000AcC00000000000000 0000000000 90000 0000000 OLINE OUT 15 LP4 0000 02100 D 230 0 05200 LP4 1000 04200 a A Q oO ES r3 So HG gerona ooo 53 6 t L3 L3 ams 2 gt 2 wa J 20 3 ons fos G ra oOo oOo coo Au 3 3 2 apo 15 EEE 1 emm 1
25. VOLUME GROUP CANCEL 3000000000000 Editon DISPLAY 0000000000000 PLAYMODE 400000000000000000 000000000000 p 0 2 Named 000000000000 0 0 Namen 000000000000 e D 00000 0 2003 46 52810 000000010 VOLUME 0 00000000 0000000000000000000 NBCDEFGHI lic abcdefshi TMARKODOO 00000000 600o000000000000000 Fd aa MARK rri TUR ec 000000000 00000000000 00000000 1 U 888 9 H AL gt 000 ABCDEFGHI 2 Q000000000000000000000 E 00000000000000000000 50 abcdefshi E 9 Q000000000000000000000 OOOO 01 1 1 00 000 000 0 oo 0 00000000 8 0000000200000000 00000000 0000 00 10000000 0 10000000000000000 0000000000 0000900008 0000000020 0000000000000000000 00
26. aeee 65 2 00000000000000000 D oo 00000000 000000000200000000 I 300200000000000000 0000000000000 OOO 000000 0 gi s 4 2000000 00000000000100000 00000000 oy il 0000000 000000000000000000 SOUND e 0000000000000000 e 00000000000000 00000 00000000000 64000 m0 00000000000000000000 00000 E uggaggaaggamuuagautau oo000m35000000000000 aaa da e SOUND180 00 Bass 0 0 M0 10 Treble O 0 e SOUND20000 Bass 0 30 Treble 0 0000000 5000000000000 0000 080000000000 0000000000 2 0 4 0 3 000 40 3 0 20 30 8000 0090008000000 5 TOO B00 0000000 mD 0omo00 e SOUND inn SOUND 200 0 60000000000000000 000000000000000000 500 TODO 800000000 00000000000000 10000 80 0000000 D SOUND 100 n 00 SOUND 20 Dau SOUND1 2 SOUNDO 20 00000 O Bm 9 00000000 0000000 SOUNDO 20 O Tm Treblenooo D 0000 on 3 B 0 lt gt reza SOUND1 n DD D Bass 0 0 O B rTreblen 00 T TO B Bab tut 2000000000000 SOUNDO 00000000000000
27. Ong I ELE 2 Ba Gl aB ad c Lc e LL lu L Lc Lc 53 ru E oqo OOonoo oo0 o q4 2 2 025 2 aa O E36 aa 3 am ui 2 ga C3 90000 aa a s o aa a 0 aa S zZpuu 2070050 500 0 rou co oy 2 ong 00 Ong em J200 5 1 1 E Id 00 00 a EJEJ Coloo lt Los Coon E 5 r3 oo 53 El oO du uimag r3 53 E El oo E 53 3 ca 53 u 53 oo oo 5 alo o a a oo oo ao 3 alo a oo 3 3 3 oo oO 3 Du o 2 2 Do a oo 2 gt ti EJ DE E E Ho 2 Yu O ono El oo CIE ET EJ EE EE El EI El E CTE E O oo r3 Dodo adia gt El ono ono Do o El o oO ojo r3 co umugjyrc 28 gt am m BH om oo ola oOo Fo aa Or Oo m E oojo oo 929 202 r3 oOo Lc L E Lc L l3 Lc EI Lc l ooo oo Oga rinm unu 6 Er Esa rum oo algodao woo OL a oo
28. gt P repeatedly to move the cursor to the right of the phrase 3 Press END SEARCH for 2 seconds or more to store the phrase 108 Searching for a phrase by its first letter On the recorder Follow steps 1 to 5 of Labeling recordings pages 105 and 106 A track group or disc is ready to be labeled Turn the jog dial until the letter which the desired phrase begins with END SEARCH to search so that the phrase corresponding to the letter appears Press 88 to move the cursor from the letter input area to the character palette Turn the jog dial until the desired phrase flashes in the display and then press the jog dial The phrase is selected and lights up in the letter input area Press the jog dial for 2 seconds or more The selected phrase is retrieved If you continue labeling operation do steps 5 to 8 of Labeling recordings page 106 Follow steps 1 to 5 On the remote control in Labeling recordings pages 106 and 107 When labeling a track group or disc turn the control repeatedly until the letter which the desired phrase begins with flashes in the display Press 81 repeatedly to search so that the phrase corresponding to the letter appears When the letter appears turn the control towards B gt until the desired phrase appear one by one Press B while the phrase you want is shown in the display Press 88 for 2 seconds or more If you continue labeling operation do steps 5 t
29. 11 00 og OPEND 0 00000 e0000 00 OOO rex P 0 0 CHGHO od Wt D CO N ID Ol A IO N gt 12 00000 8 LP20 000 LPA 000000 0000 1 DISPLAYO OO 2 PLAY MODE OO 3 RPT ENT repeat OOO 8 000000 Vourn udada ente D D Mo 4 SOUNDI OO 9 D 5 0000 10 HOLDO OOO e 11 11 1 Fes m1 000000 7 111111 gt gt gt 1 00000 85 000000 2 0000000 6 000000 3 000000 7 OOOO 4 00000000000 8 000000 13
30. C3 C3 000000000000 LINE oo OUTO AUDIO OUT O DO HeadPhoned 0 00 220 000 og 00 OU 00 00 00 SORRY DO 00000000087 00300000 P400000000 0000 Om DO 39 00000064 0000 280000 Bp LP 0000 0000006700 000000330000 00000000000 m PLAYMODE 380 00M RPH 380 77 Ho ollon la loo 3 alfa la 121 aris EI m Ia m m O E 5 a 4100 0360 meo Vp EX EI 0 Ono lalala opo lalalo A O O BOSFJIPD0 gt 000 100 FE ria um LOCK SET 00000 00000000000 PLAY MODE RecVolume Og REC MODE DO M TIMER M TIMER DO AUDIO OUT OL SOUND SPEED GROUP PERSONAL PERSONAL SYNC REC TIMEMARK MIC SENS SEARCH OPTION OPTION 0 00 0 0 uuu 1 P v 00000 DISPLAY 320 430 00 OM SOUND 40000000000 AN o a B
31. CE cs AF on FF ices jh ve ooo Er oOo 1 5 3 noo rb L3 r3 Oo 2 52 2 4 O DB 000 000 000 000 000 c3 E 3 e ooo au El e O D D D 0 0 ExtuEr E cj OE 2 HO EJ EE BEI qp 1 Se d 1 Cl 1 o Cl HGE Oo O EL Es m Oc oo So DS E c mac 3850 EE gt p 22520 oo EE ES On 00000000 AcC0000000000000000000 000000000000000000000 0000000000000000000 D AY i Ni MH 00000000000 00000000000000000000 0000000000000000000 http www
32. E E d gees IES C ui EB oO a 53 EL ELE Ban Bo m aa 3 r3 3 c3 10322 oo L3 a ooo oto E pa Oooo E n o Oooo Ooo r3 r3 oo rnc E E O32 oOo rH a r3 rnc oOo 3 Oooo ri r3 ooo oOo OH nooo ooo ooo lt Oo ooo ao EXE quede Imc r3 ooo noo N o 1 Lla Lla O Oooo m T 0000000000000 00000000000 IP ARO LETHAL IO 000000000 00000000000 000000000050 000000000000 00000000 00000000000 000000000000AC0000000000 00000000000 0000000 NiMH 00000000000000000000000 0000 00000000000000000 10000000000000000000000 0000000 00000000000000000000000 0000000000000000000000 00000000000000000000000 10000000000000000000000 10000000000000000000000 AER 000000000 00000000000000000000000 0000000000000000000000
33. MDW 809 0 D 1600 3200 00 rpm CLV kHz 48 kHz TI a kHz 44 0000 DO 00000000 0000000 GaAlAsMQWI A 790nm OOOO DO DO 382 7 gt O a 0000 OOd LI OOO O AB 2 OG EEE A E 010 SEE El N 000000000 ATRAC3 LP2 LP4 0000 000000000000 OOOO ATRA 00 00000 EFM 200 20 000 Hz 3 dB 00000 000000 MICODOOOOOCODO 00000000 0 25 mv LINE 0000 000000 000000000000 49 mvg 0000000 84 0000000000 DOU 000 000000 NH 14WM NH 14WM 00000 0000000000000000000 000000 BC 9HM BC 9HM 0000000000000000000 000000 0000000 000000 0000000000000000000 00000 POC 5AB POC 15B 0000000000000000 0000 POC 10AB POC 15AB 00000000000000100000 POC 15AB a 2 POC 158 000000000000000 000000 ECM 717 ECM 717 MOOO AA DUDO OAD O ADUT tut ECMMS907 ECM MS907 m
34. L3 E3 E3 E3 E3 F3 F3 7g a naaao O VOC Cc P u 3 3 3 2 Oooo Zoo aen sma EJ CIE U 3 3 al coat o oo oan E 1 3 4 3 923252 1 oooooo ef 3 E Oo E CI ooo zu oo po oo ENE 280000202 Mou ono 0000 ram 1 en L3 r3 r C m do amo alo ELE omoaoaooo BD eo gt 222 5000300000 c D 0000000 E E EA lt o al O EI E E 55 3 E21 su 0 py 00 10 01 20 21 ooo 7 7 D 00 D 00000000 Y 00 0000 1 D 7 00000 5 OGE c Op lt ono o E oo 082 co 1 El oo y go20p o ao Lm Bolo 8059200 ona i E Og 00000000 noo noo
35. lt gt Name Bank TIMER 3 0000000000 gt lt BEEP ON lt H gt BEEP OFF Q00000000N00000m0000000000 DISPLAYODO lt gt lt gt GPReleasel TIMER 2 BEEP GP Set lt ON y TIMER 1 lt gt GROUP ON Erase Time AVLS ON lt gt lt gt lt gt lt lt gt KE lt gt OOOO Name V 4 OFF V GROUP d GROUP OFF PERSONAL A Entry SEARCH A Index AVLS OFF 000000000000 00 DISPLAYO OOO 200000000000 82 Erase es TIMER 1 TIMER2 lt gt TIMER3 SPEED A V GROUP y GRouP OFF lt gt GROUP ON V PERSONAL A 2 Entry gt lt Erase V SEARCH A Index Time E V u on lt 20000000000 4018 lt BEEP AVLS OFF gt lt AVLS ON BEEP ON gt lt BEEP OFF lt Name Bank lt a gt Je Move a GP MoveP GP NameP lt gt EDIT Pr Name M TIMER A A
36. op 1 oo oo oO FO LLI ozu oo u Zu Doo ja SAO Gos E 8 a 2 8 O 2 4 DOMDLPODOCO 000LP200000 0100000 0 oo og 000000 0000000 OOOO Uu 0000000000000 Uu DDD 00 BANK FULL BLANK DISC BUSY Data Save DISC FULL EMPTY INE INGO I um DOU 000 nooo 52655 tu I DUO 5 zoo Dol dn 3 E O 00000 00000000 Uu vo sas J esa za saa E3 esa E303 O E oo A 0 OOO oO gt nooo loo
37. 00000000000 Jeu O 0000000000 D moult 0 ANCELJ 00000 00000 ISPLAYO 200000000 3 Do lt D nooo Og m E El 3 1111 1 1 0 1 OU 00000 0000000 DISPLAY 0 00000 GROUPO 200000000000 1 D 1 2 3 ovep0 000000000 0000000000000000 000000000000 EDITOD 0000000000000 10000000000000 400000000000 SEE 500000000000000000 copa 000000000 1DISPLAYO 2000000 20000000000 GROUPQO 0 0 00000000 30 0 00 0 000 00 GROUP D 0008100000000 4DISPLAYO 20 00000 50000000000 0 0000 60000000000 GPO Mover O O 10 00800000000 7000000000000000000 0 00000000 0000 511 OOOO 000000 DISPLAY 200000000 0000000 DISPLAY 00000 E 1 erouPp 000200000000 0 0 0 0 0 S00000000000
38. On the recorder 1 Insert a disc and do the followings To label a track Start playing or recording the track you want to label and then label the track while the recorder is playing or recording To label a group Turn the group mode on page 97 and start playing or recording the track within the group you want to label and then label the group while the recorder is playing or recording To label a disc Label a disc while the recorder is stopped or recording If you label a disc with group settings turn the group mode on page 97 suononunsuj 6uneredo Continued 105 lt Editing recorded tracks You can edit your recordings by adding erasing track marks or labeling tracks and discs Premastered MDs cannot be edited Notes on editing You cannot edit tracks on an MD that is record protected Before editing tracks close the tab on the side of the MD Ifyou perform an editing operation while playing editing results will not be recorded until you stop the recorder and TOC Edit disappears in the display Do not move or jog the recorder while TOC Edit is flashing in the display The lid does not open until TOC Edit disappears in the display after editing When the group mode is on editing can be performed only for the tracks registered into the selected group TOC Table of Contents Labeling relabeling recordings See the illustrations in Japanese text
39. 000000 Operating Instructions E 1 1 LI 1 E 00000004000 000000000000 LI LI C 000 000 001 000 1 000 0000000 oOo 0 0 uuu ooo EJ a 5 r3 Ei 3 E3 Co E3 Co Co r3 a Co r3 Co r3 Co rd lt JOD IU goo000000000000000 0000 RE 9 0 ACO 1 Y 5 5 5 2 gi NA e PE Ny ooo ooo r3 rnc ooo r3 ooo noo o r3 r3 ooo EE A 3 r3 rnc BHO oO r3 rnc
40. 3 E Co Co Co ET o SI ES 1 EI EI EJ E 53 53 r3 53 53 ma r3 a CD BR 88 88 eave ierat ccrto cater 42 dad LINE OU TI u aa asa u as 44 r3 oo r3 r3 oo 1 3 oo r3 CD al ES r3 E E3 E3 E3 e PET 6 E El e e 6 E El r3 E r3 Dolo El E E oo oo El El r3 A un sos darian EFEEEF HE BD EBEPR TD T ue es 000000000 uu DO OOO OO OOO D 000000000000 0 000000000 DUDDDDDDDDDUDDDD uu DUDDDDDDDDDDDD seess I sc deam a p ia aat a ua saa gt 0000000 IE RE BND ets BBB ODO E iocis A iens DECO sas ette DEDE inori pata BE Bee ES 000000
41. 61 400000000000000000 000100090000 000000000000 Oo ODO 000 TIMER 1 J TIMER 2 0 TIMER3 8 Over the 00 0 DISPLAY 47 0000000000000 4 DTIME 0100 TIME 99 10 0 ee 0990 00000000010000 0000000 000000000000 119000000000000000 60000000000000000 00000000000 0000000000000000 2000000000007 Merimerg DOUDDOUDUDHOUDDOUD 00000000000000 DRE 3000000000000ON000 000000000 119000000000000000 DISPLAYO 2000000 2000000000 M TIMER 0 10008000000000 3000000000 0000 108000000000 9 000000000000000 62 ER a 0000 3TIMER 1 lt 000000000000 000000 E 000000 00000000 000000 400000000 0000000 000000000000 o o o E EZT EF ES 4 00000 TIME 010 99m 10 0 0 990 00 3 zT se 2 r3 so ooo ITI e DO 20000
42. Batteries Stereo NH 14WM A 12 nickel metal hydride rechargeable battery LR6 alkaline dry battery 12 19 23 NH 14WM A 30 43 52 nickel metal hydride rechargeable battery one LR6 Measured value by the standard of JEITA Japan Electronics and Information Technology Industries Association When using a 100 fully charged rechargeable battery 3 When using a Sony LR6 SG STAMINA alkaline dry battery produced in Japan To erase information On the recorder In step 3 turn the jog dial until Erase flashes in the display and then press to enter On the remote control In step 3 turn the control until Erase flashes in the display and then press M to enter Notes The settings for up to 20 discs can be stored Any settings stored afterwards will replace the settings for the least used disc among the 20 If you add tracks or perform an editing operation not including labeling to a disc whose settings have been stored on the recorder the disc will no longer be recognizable by the recorder and the stored information will become useless In this case store the settings again sssaih Turning off the beep sound See the illustrations in Japanese text page 66 Using the recorder you can turn off the beep sound on the recorder and the remote control Using the remote control you can turn off the beep sound on the remote control only To turn off the beep sound by using remo
43. Each time you press this button the play mode changes as follows none All the tracks are played once 1 A single track is played y SHUF After currently selected track finishes playing the remaining tracks are played in random order PGM Tracks are played in the order that you specified 2 If you want to repeat playback in the selected play mode press RPT ENT Cz appears in the display Creating a Program Program Play You can set the program with up to 20 tracks On the recorder 1 Press the jog dial while PGM flashes in the display at step 2 of Selecting a play mode 2 Turn the jog dial to select a track and then press to enter a track number 3 Repeat step 2 to program more tracks 4 Press the jog dial for 2 seconds or more On the remote control 1 While the recorder is playing press PLAYMODE repeatedly until PGM flashes in the display 2 Turn the control repeatedly to select a track and then press RPT ENT to enter a track number 3 Repeat step 2 to program more tracks 4 Press RPT ENT for 2 seconds or more Notes All program settings are lost when the lid of the recorder is opened If you turn group mode on or off during the setting of a program program setting mode will be canceled but the program contents up to that point will remain You cannot turn group mode on or off while programming tracks Changing a play mode
44. JC 3 m Moo BOO z MAA AS gn nnnnnoNannnnnnn 1 0 0 0 END SEARCHO D D D RECODO 000000000000 00000000 0000000000000 N po000000 111 27 1 111111111 11 1 00000000 ood ON OFF 0000 MDO 00000000000000000000 0800009000 00080 1000000000000000000 Group 00 D 000000000 1100000000000000010 000000450000 END SEARCH GROUP DISPLAY SS 00000 0000000 1000000000000000 000000000000 OPTIOND 10000000000000 300000000000 REC Posin 10000000000000 4000000000000 From 5 0000000000000000 Oo Oo Oo Oo oOo OD D D 4D 8 1 Tm O de T D Og Do
45. MDLP mode MDs recorded in monaural or MDLP mode can be played back only on MD components with monaural or MDLP mode 1 Press the jog dial 2 Turn the jog dial until REC MODE flashes in the display and then press to enter 3 Turn the jog dial to select the desired recording mode The recording mode can be selected from none standard stereo mode LP2 2 x normal recording mode LP4 4 x normal recording mode and MONO monaural 4 Press and slide REC to the right Recording starts 5 Start the sound source When you do not want LP added at the beginning of the track When recording in MDLP mode this recorder adds LP at the front of every track name automatically LP appears when you try to play or edit these tracks on a recorder or player that does not support MDLP mode but not on a recorder or player that supports MDLP mode If you change the recorder setting so that LP is not added you ll be able to enter longer track names by using the entire text string 1 While the recorder is stopped press the jog dial 2 Turn the jog dial until OPTION flashes in the display and then press to enter 3 Turn the jog dial util LP Stamp flashes in the display and then press to enter 4 Turn the jog dial until Stamp OFF flashes in the display and then press to enter If you want LP added select Stamp ON in this step and then press the j
46. You tried to erase data in the phrase bank but no data have been recorded Hi DC in The power supply is higher than required Use the recommended power sources HOLD You tried to operate the recorder with the HOLD switch slid in the direction of the arrow Slide back the switch LINE OUT You pressed VOL while the AUDIO OUT parameter is set to LINE OUT Use the jog dial to set the AUDIO OUT parameter to HeadPhone LOW BATT The rechargeable battery or dry battery is weak Charge the rechargeable battery or replace the dry battery MEM OVER You started recording with the recorder receiving continuous vibration Put the recorder on the stable place and start recording again 117 suononunsuj 6uneredo When playing J EITA Unit approx hours Batteries Stereo LP2 LP4 NH 14WM A 30 38 42 nickel metal hydride rechargeable battery LR6 alkaline dry battery 44 52 62 NH 14WM A 79 95 110 nickel metal hydride rechargeable battery one LR6 When to replace the batteries When the dry battery or rechargeable battery are weak flashing amp or LOW BATT appears in the display Replace the dry battery or charge the rechargeable battery The battery level indicator is approximate It may be more or less than the indication depending on the operating condition Note Stop the recorder before replacing battery READ ERR The recorder
47. 00000000 00000000 11 1 1 1 1 1 111 0000 0000 0 100000 0 RECO 10100 0 00 U 1800000000 000000 8 000000000000 200000000000 GQ RecVolume 1 00000000 0 O ManualRECOD 00000000 OFFOD 0300 0 DO DL ID III U OOO oO LJ 300000000000000000 0000000000000 2000000000000 0000 0000000 oo OFF 5min ON 10min ON 15min ON OO0d OOOO 0000 1 0000 unu OOO Od Oo Do ag On E Ho p ET wo 00000000 000000000 E 00000000 00000000 000 T0000 00000000 5 Se T NE E 0000000000000 DO0000000000000000 0000000 0000010000 000000000000000000 0000000000000000 000000000000000
48. 3000000000000 SOUND 100000 SOUND 2000000 1 50 0 0 0 0 0 00 00 D SOUND 100 n 00 SOUND 20 0000 O RR a B Bae ttl 000000000000000 2000000000000 SOUNDO 0000000000000 300000000000 SOUND 10 1 SOUND 200000000 D TO Treblegoo Bm Bassdo 00 48 0 0 0 0 0 0 00 00 Bo 00000000000000000 000000000 QT Trebleg BO Basso 0000000 I 41 un e O LINE OUTO nm AUDIO OUTHO D n m LINE OUTOO 000000000 LINE OUTO 00 HeadPhonenQ yoo 1400 01 COB EI O ous Bos ous los os RR os Rf os O Sooo oo amp E FA 8450000050500 mE C3 pb 0 F3 5 C3 E3 F3 F3 E3 000000007000 80 110 0 05 0 0000000000 DISPLAY 00000 10000 DISPLAY 2000000 20000000000 SPEEDOO 0 opo00om 00000000 0000000 3000000000800000T0 000000000 O Basso OO 0000000000 20000 SOUND1 000 40 3 0 0203080000 i BO D DO D OD 0 0 2030 0 0 SOUNDO 20 D 0000 SO
49. D00000000000000S000 000000 28 29 Dou 00000000000000000000 00000000000000000000 0000000 LINE IN OPT 0000 0000000000000000000 0000000000000000000 0000000000000000000 0000000000000000000 D000000000000000000 00000000000000000000 0000000000 ET 000000000 OOOOOOOO OOOOOOOOOO 100000000000000000 1111 1 ooo 2000000000000 TIME 00000000 000000 go 000000000000 850 000000000000000 OFFOO00000000 00000000000000000 2 85 000000000000000 10000000000000000 0000 17000000000000 RB o o o E E E DA 1 0000 200000000000 Mic SENSO 00000000000000 3000000000000 SENS HIGHOO D 00 SENS Lownn n 000000000000 n SENS HIGH 0 0 0 00 0 0000000000000 n SENSLOWD 00000000 ua DODODOTMARKO 00000000 0000000000000000000 20000000000000000000
50. El 000000000000 adt 00000000000000000 000000000000000000 000000000000000000 00000000000000000 00000000000000000 0000000000000000 gggatadta uuuuu B Bab tlt 1 00000000000 200000000000 p PERSONALDO 00000000 00000 Entry JUD 000 0 0 OOOO 000 4000000000000AVLS OO002000000000000000 n n 00020000000000000000 ONOOOOOOOOOOO0000 0000000000000000 00000000000000000000 000000000AvLS000000 0 0 1 2000000 20000000000 OPTIONDg 10008000000000 HUUU N 30000000000 0 1000000 AVLSO 00000000000 000000000000000000 40000000000 AVLS ONDO 000000000000000000 100008000000000 000000000000000000 11 1 1 400 AVLS OFFJO 00000 DISPLAY Bua bri 00000000000 2000000000000 OPTIONG 00000000000000 3000000000000 AVLSoo 00000
51. O 2 2 HO HO HO 4 1 L3 L3 L3 1 1 1 ao m p p p p p p p L3 aa RO M x E cm 0000 15 4UU00000000000 10000000 46047000000 01070000000000000 2 CANCELO 0 1000000000000000 ND SAECHO 020000000 000 Co LJ TI m 5 800 47000000050 Oo HO m m m 0000106000000 Ao No po oO On 00000n0020000 000000480000 noo oo oa EPE EIS nen oo m r3 r3 r3 L1 L1 L1 L1 L1 100000090 490000000 1020 0000000000000 000 510 Hp o Hal 229 ne Hannu A
52. OOO oo os os Bos os ee Bos 1 moo OOo OOO oo Doo oo 1060148 Ea Ea ma Du at oo coooHoo 1 3 3 2 ooo OOOO Bo ong 20001 Nu 1 oo ma arar Noo ooo On Ej oOo oog Oo O O ooo Ono DIE ELI O O So0D BGs E nox oo o O 232 oo oo oo eogo o50 H oo Ek lt ooo alo s oo 05080 co jo oo of o a aa oy ooojo a coto DES e oo a d osfo odo noo ooojo a mo Oy OOO oOo ood EEE Ooo O Dodo ooo oOo Ooo OOO Oooo OOD oOo Ooo oaao OOo DOODO 00000000000 20000000000 OOO 000 oO 53 oO oO E oO a oO E oO 53 53 a 53 lt a 53 tl Co 53 1 Co 53 oO 53 oO 53 Co CO EJ Co 72 0000000 00000000 DOU DODO O 300 0 0 O S000 0 0 0140000 DO Du DO 2000000000 Ac000000000000000 og OW BA 1 4 DCIN3v 000000
53. OOOO LIhOLIILELI El EPI MOP ooooH EAT SL dl al ES 4 1 E 1 E Ed 1 ooooo Oonoooooooogo 9 4 LI ES ES E FT LF TEL Ena E DS LI A ES ous 5 oo oo mum El Oo Oo 5 1 0000 0 000 1 0 e oo zi Opn 0000000000004 8mV Manual RECO Hn DH 0 0 0 0 1100000 0 0 0 0 OD 394B0 0000000000 HO 86 LLL 87 000 po000000000000000000 00000000000 p00000000000000000 p00000000000000000 p00000000000000000 p00000000000000000 p00000000000000000 OOOO 000000 0000 0000 DBB 0000 0000 0000 OOOO 010 010 Net MDO DODO 0000 0 uu du 1 uu OOOO 00mD00000000000000 sc
54. S000000000000M00000 UE LO T O 00000000000000480000 6000000000000M0 00000 006070000 00000000000000 480000 0005070000 0000800808000 11 a VEJ ro boooo000m 468047000000 01050000 0 200000000000000000 0001000000000 3 END SEARCH 0 000000 cepo NCEL TT PushENTERDO O ODO O gt 0000 ISPLAYO 20000000000 1 051 1 4 DIDI a CIC DIDI DIDI EE DIDI LL L1 L1 Co 1000 0000000 0000 0000000000000000 SE PEN gt D 0000 000 5605800 0 1 100000000000000000 P P ONG OFFO 0 0000 0 0 0 000 1 0 00 0 1 0000000 100000 0000000 0000000000 00000000FFL 00000 10000000000 100000000000 00 00000000 4 10300 1 980009 580 gt X 11213 4 15 6 7 8 19 Doo E cc 10 3020 4030 50 7040 80 90000 0000000 000000000000 0000000000 u 111000 00 0 00000 00 00000000000 53 1
55. message appears again a mechanical problem may be the cause In this case consult your nearest Sony dealer P B ONLY You tried to record or edit on a premastered MD P B stands for playback PROTECTED You tried to record or edit on an MD with its tab in the record protect position REC ERR The recording is not correctly done Place the recorder at no vibration and record again The disc is dirty with oil stain or finger prints scratched or out of standard Record again with another disc 118 0 2 ell 6 111 1 0 http www sony co jp c ORAE 00 HMB E VOC HAEARILAY PORWR y 8 VIAS 1 41 0001 6 7 35 9 54 t Ido ER CHO I A OLA 0570 00 3311 Goon SHETHS 66 98550166 5806 2000 e PHSTOTRIANE 03 5448 3311 gop 0466 31 2595 17 00 Printed in Japan
56. no r3 r3 hoo 01000000000 000 po000000000 po000000000000000000 00300 ON 00000000000 6810000000 0000000000000000500 0000000000000000 0000000000000000000 E a 000300000000000 CANCELD O O 200000 L a ao oo oo OO QOH 000900 0 11 0 ISPLAY 200000000 2 EZT EI Ga Gah Et 0000000000000000 Entry OKJ0 0000000000 000000000000000 BU gta btt 0000000000000000 DISPLAYO 2000000 0000000000 PERSONALO Entry 00000000 Entra dz e 000000000 Entry OKA 0000000000 000000000000000 00000000000000000 00000000 00002000000000000 00 Erased 0000000000 Erase OKQODO00000000 0000000000000000 000000 00000000000000000 00000000 00002000000000000 Erase 00 00 00 80 000 O 3 E
57. your taste The recorder can store two sets of treble bass adjustments which can then be selected later during playback The sound can be adjusted in 8 steps 4 3 0 2 3 Settings can be stored to the Personal Disc Memory Selecting the sound quality Factory settings of the Digital Sound Preset are as follows SOUND1 bass 1 treble 0 e SOUND2 bass 3 treble 0 On the recorder 1 Press the jog dial 2 Turn the jog dial until SOUND flashes in the display and then press to enter 3 Turn the jog dial until SOUND 1 or SOUND 2 flashes in the display and then press to enter On the remote control 1 Press SOUND on the remote control repeatedly to select SOUND 1 or SOUND 2 Adjusting the sound quality On the recorder 1 Press the jog dial 2 Turn the jog dial until SOUND flashes in the display and then press to enter 3 Turn the jog dial until SOUND 1 or SOUND 2 flashes in the display The display shows the currently selected T treble and B bass settings 4 Select T or B pressing B or II You can change the adjust of the item in which the cursor is flashing EEE Connecting to a stereo system LINE OUT See the illustration in Japanese text page 44 Connect the Q LINE OUT jack of the recorder to the LINE IN jacks of an amplifier or a tape recorder with a line cable RK G129 or RK G136 not supplied The output is analog The re
58. 1111001000 LINE IN 0000000 000000000 LINE 0 0000000 1 1 s S um 000 000000000000000000100 00000000000000000 m alo No 0000 H L1 L1 o A E LI p ILI EI LT Lulu LE I E LIES 1 1 PES Ga ps Y oes 11 AN oa ILI 1 LA TE LI 4 Co SE LA Edo Oo DOOOCOO OQ LINE OUTO unn mun 000000009 090006 00000000000 0 0000000000000000000 000000000000000000 0000000000000000000 00000000 24 JL JL JL JL 0 43 moro 00000000 000000 00890000808800 5900000090000000 LP2 0 D 040 LP4 0 D O 20 00000000 800000000000000 SPHOOOOOO
59. 2 oon j C3 ao 42 ooo 0 00000 000 00000000000000000000 10000 DISPLAYO 000 40000000000000000 oooO oc o0sp 00000000000 00000000300 LapTimenn 000000 FC B NN FC 00 0 0 I A es 000000 00000 0 0 9 1 1 I LapTime 0 O 0000 EP y m GP Remain 0000 0000000 000 00000 O 190009 0000000 y 000000 AlRemain OOOO 0000000 1 U RecDate 00000 000000002000000000000 000 0 0 00 ON OFFOOO0000000 00000000000000000000 00 000000000000000000 000000000 AC 11010 00000000000 03100 000000000000000000 43 mms 0 00 0 0 0 0 800000000000000000 O LINE OUTO 00 AUDIO LINE OUT 0000 d et 00000000000000000 100000000000 AUDIO 2000000000000 0 0000000000000
60. 2000000000000 EDITED 0000000000000 300000000000 O BankEraseno 000000000 400000000000000000 000000000000000 0 Erasel00 00000000000 OW Op Mu Bo ll re gt lt 2000000 BankErase 0 OO 00000000 00 N m o Co r3 Sie Lr E amn ee 524 5 O CELO DU NCEL TI PushENTEROO D Pog O gt DB LAYO 20000000000 2 28200 000 5 100000000000000000000 1 11 ERR 000 0000000000000000 000000000000 450000 o Da 10000008 0 0 00000 0000000 m DISPLAY n00000000D00UUUUF 7 s D 00000 ds 7000000000 0000000 0000000 460470 00000040 7000 1 GROUPO 200000000000 000000000 Ud D D 1LDISPLAY 2000000 2000000000000000 20000000000 GROUPO D 0 00M 00000000 3000000000000 EDITIO 30000000000 GROUPON nnnnnnnnnnnnEm sen 40000 DISPLAYD 20000
61. EE SE Setting the alarm Melody Timer See the illustrations in Japanese text pages 62 and 63 You can set the alarm to go off in 1 to 99 minutes The alarm sounds even while the recorder is stopped The following sounds can be selected TIMER 1 Classical music 1 TIMER 2 Classical music 2 TIMER 3 Beeps On the recorder 1 While the recorder is stopped playing or play paused press the jog dial 2 Turn the jog dial until M TIMER flashes in the display and press to enter 3 Turn the jog dial until ON flashes in the display and then press to enter e lights up in the display and the alarm sound can be selected 4 Turn the jog dial repeatedly to select the alarm sound and then press to enter The alarm sound is set 5 Turn the jog dial repeatedly to select the elapsed time One rotation of the control changes the elapsed time setting TIME by 1 minute within a range of 1 to 99 minutes To change the time quickly keep turning the jog dial On the remote control 1 While playing the track you want to erase press DISPLAY for 2 seconds or more 2 Turn the control repeatedly until EDIT flashes in the display and then press 88 to enter 3 Turn the control repeatedly until Je Erase flashes in the display and then press B to enter 4 Press B to enter To erase a part of a track Add track marks at the beginning and the end of the part you want to erase then er
62. El 00000000 Bopp REB 66 1 000000 v po 250000 U LAYO 2000000 0000000 SEARCHOO S L3 L3 r3 34 JL JL JL JL fi 11 1 LUU 0 2610000000 0000000 DISPLAY PLAYMODE 0 00000 MAA doo0000000000 i 1 1000000 UPO 20000000000 ONI 0 000000000000 s60 000000000 N LS LI LI LI LI EJEA 1 1 1 44 Ed 1 joss eet O O oo o o REB f o 00000000000000 00000000000000000 00000000 Time00 00000 1000080000 00000000000 2 1 00 gt 0000000000 0000000000000 380000000000000 0000000000000000 1000080000 00000000000 200000000000000000 00000000000 3N00000000000000 0000000000000000 eH
63. a HO E HO Oo ono 2 nodos ao I D El m ooo 0 r3 r3 oO o0 mang no DO Zod U 3 53 3 3 3 66 3 7 pu biu 53 3 O Dm r3 r3 3 ooo 23 2 2 2 5 oa Z ZO oon ES alo Be CS DE 1 73 S EE oO E op aaa El oo L3 El ons ooo EE oo 1 poeg000000000000000 00000000 From 0 0 0000000000000000000 00000000000000000 00000 OO GROUPODDODO peg0000000000000 D B ug rex 00 gt 00000 E ET Co N a a 2 8 e 9 po GQ LI om LI O a 000000000 2000000000 I m 3 oo I D so opa m r 1150 1 0 No
64. and MD step 3 of Recording an MD right away page 92 and select SYNC OFF in 2 Do steps 1 to 6 of manual recording procedure Then do the procedure of Record and MD step 3 of Recording an MD right away page 92 again Recording starts automatically whenever the source sound is played Searching for a specific track while monitoring track numbers or track names Index Search To do an index search set the search mode to Index in advance On the recorder 1 Turn the jog dial until the desired track appears in the display and then press the dial The selected track name appears in the display and the recorder starts playing by pressing the jog dial If the track has no name the track number appears in the display On the remote control 1 Press II while playing a disc 2 Turn and hold the control until the desired track number or track name appears in the display 3 Press to cancel the pause Playback starts from the selected track Searching for a specific point while monitoring the elapsed time Time Search To do a time search set the search mode to Time in advance On the recorder 1 Press II while playing a disc 2 Keep pressing or gt gt until the desired point appears in the display 3 Press to cancel the pause Playback starts from the selected point On the remote control 1 Press II while playing a disc 2 Turn and hold the con
65. cannot read the disc information correctly Reinsert the disc SORRY You tired to set Digital Sound Preset while the AUDIO OUT parameter is set to LINE OUT Use the jog dial to set the AUDIO OUT parameter to HeadPhone You tried to erase a track mark while playing the MD or at the beginning of the first track You tried to erase a track mark to combine tracks the recorder cannot combine a track recorded in different recording mode such as in LP2 and LP4 or a track recorded through analog connection and digital connection You tried to overwrite a track mark You tried to press 88 T MARK or REC MODE while synchro recording or the joint text function is active If you have recorded or erased many times on the same MD the data of a single track may be scattered throughout the MD When the data is scattered in groups of less than 12 seconds long the recorder will not be able to combine the tracks x TEMP OVER Heat has built up in the recorder Wait until the recorder cools down TOC Edit The MD recorder is recording information track start and end position from the memory to the disc Wait until this process is completed Do not expose the recorder to physical shock nor disrupt power supply TOC ERR The recorder cannot read the disc information correctly Insert another disc If it is no problem to erase all the contents of the disc erase all page 114 TR FULL Y
66. lt ON Y 3 243 699 01 1 e IIS L LEE LI L Operating Instructions AES M 900000000000000000 DUO0000000000000000000000000000 00000 We M MDLP WALKMAN 000000000000 00 MZ R910 2002 Sony Corporation As 00000 msn Y een fem ama E oo00 g Hae ES Sea E ooo EX E BAAR aaa gt nk r3 cca ca Bare SSeS res Soe See BIS El ooo Eli mz i jm j i em illa CETTE cm B jes x Peel al SS nan res e SSS esi y 60900000000000000000000000 1001t0004c00000000000000000 0000000000000000000000000
67. mn oo aa E 2 gmuu uuuo uocod oo BD Oa EE EE e gt J Do ooo oo lt eonun uuu conu r3 r3 r3 2o00 1 a El El LO rum TES r3 oO r3 1 2o00 oo 3 r3 ooo o oo r3 o00o 2000 Dojo E 3 ooo oo o 942 ouo 3 3 Dolo EI EI ago 2000 O O O Ea 52 O El O El 200 0 ET 1 EJ ceu Cn E ES 1 O O El Dolo O GEQ GADE og 00 LOW BATT MEM OVER 74 o joo O O 5 1 ao Sa SAR Po PES O N Bu oD a og im Do Da oo Bu oaa oo oon 2238 Do pa a E om ooo o82 Lo Los Bu nog oF oo oo oo oo uo L3 o2 O E Au E Er Ba F1 o2 275 on ou r3 o qo jo ate E oo oO lt oo r3 deu oo r3 OF mn
68. pages 45 to 48 You can name tracks groups and discs using the recorder s character palette Available characters e Katakana characters Japanese model only Capital and small letters of the English alphabet Numbers 0 to 9 8 60 gt lt 7 6 space Numbers of characters you can input Track group or disc name Approx 200 each all available characters are mixed Numbers of characters you can input in a disc e Alphanumeric characters symbols only Approx 120 titles of about 10 characters each a maximum of about 1 700 letters Japanese katakana characters Approx 60 titles of about 10 characters each a maximum of about 800 letters 2 While the recorder is stopped press the jog dial 3 Turn the jog dial until EDIT flashes in the display and then press to enter 4 Turn the dial until the following item appears in the display and then press to To display and Press T MARK 7 repeatedly at the input position in the letter input area To cancel labelingin Press CANCEL the letter input area D Functions of the buttons and control may differ depending on where the cursor is in the letter input area or the character palette If phrases are stored in the name bank the first phrase stored appears in the display page 107 7 Repeat step 6 and then enter all characters of the label name 8 Press down the jog dial for 2 seconds or more
69. s memory to appear one by one 4 Press MW slightly while the phrase you want is shown in the display 5 If you continue labeling operation do steps 6to 7 of On the remote control in Labeling recordings page 107 When group mode is OFF Several tracks are registered as one group The following section explains the operation when group mode is on On the recorder 1 Press GROUP for 2 seconds or more to turn the group mode on 2 While the recorder is stopped press the jog dial 3 Turn the jog dial until EDIT flashes in the display and then press to enter 4 Turn the jog dial until FT Set flashes in the display and then press to enter 5 Turn the jog dial until the number or name of the desired first track flashes in the display and then press to enter This selects the first track of the new group Even when the group mode is on track numbers appear according to their order on the disc not their order within the group 6 Turn the jog dial until the number or name of the desired last track flashes in the display and then press to enter This selects the last track of the new group 7 Follow steps 4 to 8 of Labeling recordings page 106 to label a group On the remote control 1 Follow the procedure of To activate the group mode page 97 to turn the group mode on 2 While the recorder is stopped press DISPLAY for 2 seconds or more 3 Turn the control repeatedly until EDIT f
70. select the item and then press M to confirm the menu menu ofthe functions recorder the remote control EDIT EDIT Selecting editing operations labeling tracks groups or discs erasing tracks groups or discs etc pages 106to 114 DISPLAY Displaying elapsed playing time remaining playing time etc PLAY MODE Selecting the play mode repeat play shuffle play etc page 102 RecVolume Selecting the automatic or manual recording level adjustment page 99 REC MODE Selecting the recording mode SP stereo LP2 stereo LP4 stereo or monaural page 96 M TIMER Setting the alarm Melody M TIMER timer page 114 AUDIO OUT Selecting LINE OUT jack output page 104 SOUND Selecting SOUNDI SOUND2 or SOUND OFF Digital Sound Preset page 103 SPEED Changing the playback speed during play page 104 GROUP Turning the group function on and off page 97 PERSONAL Entering or erasing the disc PERSONAL information in the Personal Disc Memory page 115 SYNC REC Selecting SYNC ON or SYNC OFF when synchro recording page 92 90 Notes The supplied battery charging stand can be used only with this recorder Any other models cannot be charged Do not use the supplied battery charging stand to charge any other battery besides the supplied one or the one
71. stored phrase You can retrieve a phrase by keyword and then use the phrase in a new label Storing phrases from a previously labeled track group or disc You can store an existing track group or disc name as a phrase Inputting and storing phrases You can store frequently used phrases in advance and then retrieve and use them when labeling a track group or disc Storing phrases while labeling a track or disc On the recorder 1 Follow steps 1 to 7 of Labeling recordings pages 105 and 106 to enter a phrase 2 After entering the phrase press CANCEL to remove the cursor from the character palette to the letter input area 3 Press END SEARCH for 2 seconds or more Entry appears in the display and the cursor flashes after the phrase you just stored 4 If you continue labeling operation do steps 5 to 8 of Labeling recordings page 106 On the remote control 1 Follow steps 1 to 6 of On the remote control pages 106 and 107 in Labeling recordings to enter a phrase 2 After entering the phrase press H for 2 seconds or more 3 If you continue labeling operation do steps 5 to 7 of On the remote control pages 106 and 107 in Labeling recordings Storing phrases from a previously labeled track group or disc On the recorder 1 Follow steps 1 and 2 of Relabeling recordings page 107 and display the track group or disc name that contains the phrase that you want to store 2 Press
72. the group has been labeled press PP to display the group name Press to return to the group number display 6 Turn the jog dial until the number of the destination track within the group flashes in the display and then press to enter The selected track number or name of the group that the selected track belongs flashes in the display If the track has been labeled press PP to make the track name appear in the display Press to display the track number again On the remote control 1 Follow the procedure of To activate the group mode page 97 to turn the group mode on 2 Press DISPLAY for 2 seconds or more while the track you want to move is playing 3 Turn the control repeatedly until EDIT flashes in the display and then press 88 4 Turn the control repeatedly until 22 Move flashes in the display and then press B to enter 5 Turn the control repeatedly until the destination group flashes in the display and then press 88 to enter 112 Press T MARK to erase the mark MARK OFF appears in the display The track mark is erased and the two tracks are combined 3 To cancel erasing Press CANCEL on the recorder Press DISPLAY for 2 seconds or more on the remote control Notes When you erase a track mark between the two consecutive tracks that are registered into different groups the second track is re registered into the group containing the first track In addition if y
73. tracks or groups as a new group Group Setting See the illustrations in Japanese text pages 53 and 54 Do the following procedure to register tracks or groups as a new group The tracks or groups must however be sequential If the desired tracks or groups are not consecutive you must move them to make them consecutive before you can register them Moving recorded tracks page 111 The operation of this function depends on whether group mode is on or off When group mode is ON Several groups are registered as one group A track without group setting can be registered to an existing group suorpnasu 6uneriedo 111 Moving recorded tracks See the illustrations in Japanese text page 56 You can change the order of the recorded tracks On the recorder 1 While playing the track you want to move press the jog dial 2 Turn the jog dial until EDIT flashes in the display and then press to enter 3 Turn thejog dial until Move flashes in the display and then press to enter The selected track number or name of the group that the selected track belongs flashes in the display If the track has been labeled press PI to make the track name appear in the display Press to display the track number again 4 Turn the jog dial until the destination track number flashes in the display 5 Press the jog dial to enter The track moves to the selected destination track On the remote co
74. turned on or off manually during synchro recording Press 8 to stop recording Do not switch the SYNC REC setting while recording Recording may not be done properly Even when there is no recorded sound on the sound source there may be cases when recording does not pause automatically during synchro recording due to the noise level emitted from the sound source If a silent portion is encountered for approximately 2 seconds during synchro recording from a sound source other than a CD or an MD a new track mark is automatically added at the point where the silent portion ends Synchro recording cannot be done if the connecting cord is not an optical cable or if the cable is connected to the MIC PLUG IN POWER jack Go forward Keep pressing PP Turn while playing and hold the control towards P on the remote control Pause Press M Press M on the remote control Press H again to resume play Remove the MD Press W Press M on the remote control Then press OPEN to open the lid P If you press twice continueously while playing the first track of the disc the recorder goes to the beginning of teh last track on the disc 2 If you press P during the last track of the disc the recorder goes to the beginning of the first track on the disc Once you open the lid the point to start play will change to the beginning of the first track except when the disc information has been stored in t
75. whenever the disc is inserted Do the following procedure to store the volume playback mode group mode playback playback order sound quality Digital Sound Preset and playback speed Speed control settings for a disc On the recorder 1 While the recorder is stopped playing or play paused press to enter 2 Turn the jog dial until PERSONAL flashes in the display and then press to enter Entry flashes in the display 3 Press the jog dial Entry OK appears in the display and the disc settings are stored in the recorder suorpnasu 6uneredo On the remote control 1 While the recorder is stopped playing or play paused press DISPLAY for 2 seconds or more 2 Turn the control repeatedly until PERSONAL flashes in the display and then press M to enter 3 Press B to enter 115 6 Press the jog dial Melody timer is set The time remaining until the alarm is shown in the display while the recorder is stopped or play paused To show the remaining time during play do steps 1 to 3 After verifying the time press CANCEL On the remote control 1 While the recorder is stopped playing or play paused press DISPLAY for 2 seconds or more 2 Turn the control repeatedly until M TIMER flashes in the display and then press B to enter 3 Turn the control repeatedly until ON flashes in the display and then press 88 to enter 4 Turn the control repeatedly to select the al
76. 0 000 0000000000000 00000000000 200000000000 0000000000000 00000000 0000000 1100010000 6 gt 000000000 e0000000 Battery NH 14WM A carrying case gt eAcopgoooo0 000000000000 11 e 00 Q amp A 2n ell OOO 2000000 0000 AC100 010 0 ACoooodd 00000 3 1 O m ei uu O O DU a AER E 10 40 00 MENU 0 00 0 ENTERIDO D 00000 00000 LINE IN OPT O 000 RECO DO MIC PLUG IN POWER Q D HOLDO 000000 O LINE OUTE O00 11 000000 OO MARKO 0000 END SEARCHO 0 O VOLUME 2 0 00 GROUP CANCEL O D 00000 DC IN 3V0 000
77. 0 EDITOO 21 ceo ara Est o lt 1 L3 000000 000000 0000 00000 00000 00000 3 3 23 03 17 DODGE GENEI L3 rrr L3 1 58 D 0001000 00000000 000000000 MOO 0000000 2 440 00000000 00 0000 0 20 3000008000 030000000000 MARKOO 2000000000 3 MARKO MARK OFFOO 00 00000 00000000000000 Y 0000000000000 200 10000 0000000 ES oO 59 OU 00000 2000000000 2000000000 000000000 4 0000000 00010000 100000000000000000 MARK
78. 00 OOO OOON OFFOQO n 0000000000 O O O now now 0000000420000000 000000000000000 ood ood ood 0000000 40000000000000000 00003000000000000 00000000 300 LapTimeno 00000000000000000 000000 Le E r C OA O 100000 0 O LapTime RecRemain GP Remain EE oo LE 1 11 Oda Ea oo Do oo Oooo AllRemain Clock 0000000 uaa 0000000 00 32 O O O 11 11 1 1 1 1000 10 00000000000000000 000000000000000000 guun 00000000000000000 2000000000000 DISPLAYO 1000000000000 0 0 3000000000000 Clock00 000000D0 0000000000000 000000000 100000000000 DISPLAYO 0000000000000 000000000000 OPTION Mog
79. 00 8 50000000000 ED0000000 a a 00000000 STI SHOUD 60000000000 GPO Seto 000 we 1 0 100000000 70000000000000000000 00000000000 M00000 00 80000000000000000000 00000000000 M0000000 9000000000 0 0 00 4 000000050700 m 000 6n 0050000000000000000 0000000000000000000 J E Released 00000000 000 JUUL 00600000000000000500 Release PushENTERDO 0 0000000000000000000 000000 0000000000000000000 r E 0000000000000000 000000000000000000 000000000000 mm Jasa 000000000 1 20000000000 0 000 00o000000000000000 8 100000000 00000 30000000000 GROUP ONDO 0 100008000000000 40000000000000 00000 90000036000 00000000 5 0000000 6 DISPLAY 200000 DISPLAY 70000000000 ED9000000 8110000000 380000000000 GPReleasenn n 0 Z 000000000000 5 D Release AI PushENTERJO 0 0 0 0 000080 980 00000000 0000000 000000000 1 GROUPO 2 I 2m CANCELD 0 0 0 D ggg _ 000000 2000000000000000 DISPLAY 20 000000000 0000 OOO 1 111 1011 1 358000000000 400000000000 5000000000000 EDITOO 1111111100 55
80. 000 0000006000000000 000000000000000000 00000000000000000 0 0000000 004 SEO 111 DISPLAY JL a 0000300 o 00000000000 00000000000000000 8 00000000000 000000000000000 DISPLAYO 2000000000000 00000000 00000 0 400 Auto RECODO kusa UN 0000000000000 300000000000000000 00000000 000 0000000000000000 000 p00000000000000000 LapTime 00000 0000003001 000 0 000 8 0 00 000000 D 0000020 0000000 GP Remaim 000000000 0000000 y es nognam o So lt aa 60 32 pa BOBO gt Oo LE LJ BoXo2 20050 OO 1 0 ons lt E Co EE o lt o0 2000 Co AllRemaim 00000000000 y Clock 00000 00000000 31 1 DISPLAYO 00000000000000000 nnn 00000000 r a 0 0 6 000 00 0000 y 00000000000 OOO L ES 00 0000 y 00 00 y 00000000000
81. 0000 00000050 u 00 OU Yu 00000 00000000 HOLDO 0000000000 0000000 uD og OO00 400000000000000 0 00000000000 0000000000 20000000000 D 0 0 3 Bono a a Hg a lodo o do Jo a El nooo ono 53 E 3 al 53 3 53 E EJ o um nm us um a Ha 3 3 3 E r3 a a 5 em um je El Gio A oon ON r3 r3 OF a r3 oo imu 5 goog S jo jo BN n jua odio lo qa B 95 Eos a BiG E a olg ocola jo a o 25 jo s uA c 53 oS HR agla 007228 lo lo fo mag aan a lo aa a o H Nu olog e oon ans 53 BiG 53 a a 2 11 om oo o pH ORG Blu r3 Ci Oo B EXE Poo 1 c coo 1 r3 Blu 53
82. 0000 0 Entyi00 00000000000 0000000 1 1 1 11 1 LDISPLAYO 20 D 0 0 20000000000 ED0000000 mn 0000000 30000000000 Name Bankoo 0 400000000000080020000 OOOOOOOOO 4 1 Te oF 000000000000000 1 500000000000000000 oP Te Aa paga d00000000 500000000000000000 O O OOOOOOOOO J0000000000000000 6ppppppnpnennnunnun 600000000200000000 0000000000000 Pra a 7 00000000000 0000 70009000080000 0000 0004 00000005060000 4790000005080 000 000000000 3 0470480 0000001050000 b0000000000000000000 und EMI at fa 00 48000000 0000000000 0 000001000000000 O 300000000000000 3000000000000000000 0000000000000000000 0000000000000001000 P000000000000010 40000000000000 00 000 4000000000000000 m0 0 1 000000000000 5002000000000000
83. 000000 00000000000 nn 000000 000000000000 000 0000 00 270000 00000000 0000 000000000000000000 000000000000000000 000000000 m0000 000000 000000000 000000000000 0000 00000000000000000 00000000 CANCELO 0000000000000000000 00000000 00 0000 ONp 000 270000 000000 2DISPLAYO 2000000000000 00000000 00000009000 30000000000 EDITODODDO 020000000000 mo00000000 DD 47 40000000000000000000 000000000 uggaagauu 0000 00 00 0000 Namen CANCELD 0000 DM Nameg CANCEL PushENTERUT 0 E Nado 000000000000000 0000000000000000000 000000 000000 5000000000000000M00 DISPLAY 20 000000000 000000 000 0000000000000000000 0000000000000000000 m 000000000000000 EM w VER 0000000000000000000 000000000000000000 0000000000000000000 0000000000000000000 m 18000 00 80000000 i d 025000000000LP0000000 00 gt 0000000 gt m0000 DD DUUDDDUDO DDDDD 0000000000000000000 0000000000000 00000000000 000000000 2 0000 00 VOL 0 0001000000 00000000 0000000000000000000 lt Q gt Pri 00000000500000000000 gt
84. 00000000 TSRLB JS 000000 1 DISPLAYO 0002000000 MAS i 000000000000000000 20 000000000 OPTIONID Q00000000000000000 1 00000000 30000000000 BEEPJO 00 0000000 1008000000000 40000000000BEEPOFFO 1000008000000000 0000000000000 00 0000800000000 004 00 BEEP ONDO 00000 uu i B gae 2000000000000 OPTIONg 10000000000000 3000000000000 BEEPDD 0000000000000 4000000000000 MAIN UNITOO 0 00 REMOTEDO 000 MAIN UNITO 000000 REMOTED 00000000 5000000000000 BEEP OFFO0 00000000000 Do0000 000000 00000000 0000000000000 0000 00000000000 00000 0 POD 00 000000000000 000000000 00 HOLD innnnnnnnnn 0000000000000000 zd 2000000000000 OPTION d 00000000000000 300000000000 CONTRASTPOD 0000000 1 HOLDO 0 00 o 400000000000000000 000 80100 0009000000 10000000000 1 HOLDODO 00000000000000000 000 11 0 1000000000
85. 000000000000 20000000000 000 0000000 OFF MDLPO000000AC000000 0000 0 3 00000000000 000000000000000 0000000000000000000 00000000000000000 QLINEOUTO 000000000000 LP000000000004000000 0000000000000000000 0000000000000000000 000000000000 0000000 0000000000000000000 00000000000000000LP20 00000000000000 1111010000 0 99000 0 0 0 000000000 OOOOOOO avorites 1 5 Rock 6 9 Pops O 2 0 D D Favorites 10000 500000000 Rocko 60000 90000000 OM Pops 00000000 ONDD 0 1010000000 1 GROUPD 2000000 1000 GROUP ONDO 0000 000000 0 0000000 000 0000 08 000000 El 1 DISPLAYO 20 0 00 00 0 0 0 00000 20000000000 GROUPDD n 008000000000 00000000 GROUP ONO 000 0 0 300 GROUP OFFOOO 000 OFFO00000 IL JL JL
86. 0000000000000000000003000000000000000000 00000280000000000000000 0000000000 0000000 REC PositDD 000 From HeredO 000000 000000 O 0 0 END SEARCHO D 00 RECO DOO 0000000006 D O Om REC Posi a 0 000 From Endog OO D 00000000000 00000000 000000000000 0000000000 0000000 000000 80000 0000000000000 000000000 B00 00000000 0 0 0 000 00 00 0 0 TOC Edito 0000000000000000000 0 REC Posimo 0000 From End 000000000 ENDSEARCHOGODODODO 000000000 0 0 0 20000 3900000000000000000000014M00000000000000000000 90000000000000000000000000000000000M REC Posi o 0 0 00 From Here 00000000 18 nog nog oOo oo Oo 8o0o08o ago ooo o0 Z00005 onoweoo 53 52 53 Dom 0 OOOoOoOO 9 Too e 3 3 3 1 1 BDO Ci El ao DoDoDooaovoDoaosanDo 2 al m Co lt 5 3 3 c3 D nooo yoo o 5 mad H 4 o OO 2o00 2 Ono 4 gee O m e A a
87. O 0000000000000000000 123 00000000000 abcdefghiiklmnoparstuvwxyz 456 0 9 gt 0 789 F 00000 0000000000 0000000000 00000000000000000 000000000000000000 I 00000000 abcdefshi 0000000000 AA 5 0000000000000 DHUUUDDABAMUBUUDHU nmummnmmmmmmmmmmmn iki 000000000000000000 0 00 000 10000000 00 00080 0000000 000000000000000000 2000 000000000000 45 po0000 3 0000000 O O O mo 15 D E Ic m 3 Zo gt m ogoogo da a ET 1 7 r3 F3 r3 r4 r3 2 r3 06508500 G u 0000000 000000000000000 0 MDLP O 111111 1 1 ee 0000025 000000000000000 0000000000000000000 2000000000000000 0000000000000000000 000000000N0 270 0000000000000 abc defa a 2000000000000000 0000 000000000000000 g000000000000000000 00000000 11 11111 11 101010 0 0 Dea JH nn 000 DO 0000 1 1 0 0 0 MARK 0270000 N
88. O00000000000000000 gagamgaggagautag eHOO0000000000000000 Dao ao 100 innnnnnn 0 0000000 oo0o0o0000000000000001 a gogo 0000000000000 DISPLAYO 2000000 00000000000000000 2 A BC Group J0000000000000 GROUP000 30000000000 000000000 1 8111100111 1111 GROUP ONG 40000000000 IERI o o o o o o o 0000000000000000 HOONDODO 0000000000000 as 00000000000000000 000000000000000000 000000000000000 00000 0000000000000000 0N OFF000000000 0000 00000000000000000 ONO OFFO 0 0 0000000005 00000000000 000000 mm 0000000000000000 e 0 00000 000 nn Q 00000 100000 00 00000 10000 Lr Zoo am 0000000080 100 gt 00000000 pago po T 2 i os ooo 2 rm r3 0000000100 0000000 OFF 440 000000200000 00 000000 H000002 00000000000000
89. O020000 00000000 00000000 MDLPo 0 0 0 000 MDLP 000000000000000 BEE 0 BBE Bes Bla 1 IMATE o o oo 000MDLPP0000000000 LP00000 00000000000 MDLPo 0000000000000 0000000000LP000000 MDLPODODO 000000000 0018 0000000000000 1 MLP0000000000 00000 000000000000 REC e 000000000 DED000000000000 000000000000000 1000000000000000 OPTION 2000000000000 000000000000000 a 000000000000000 n 3 1 00 30000000000M LP Stamp SP 800 LPa 81609 4000000000000 Stamp 9000 LP4 3200 08800 00000000000 0000 1600 oo MONO LP000000000 0000000 000000000000000000 00LP2000000000000000 Annan Stamp ONDO O00 400 00000 0 80000000000 3 11001000000000000 1 0 0 01 0 11111 HO Sooo Ole ooa 1 T MDLen 0 MDLPO D 0000000 2 0 5 8 00 0 0080 08000000000 000 00000000000000000000 00 000 ATRACO DSP TYPE R 19 111100 0000000000000000000 100000
90. Press SOUND on the remote control repeatedly to select SOUND 1 or SOUND 2 2 During playback press SOUND for 2 seconds or more The recorder changes to B setting mode Pressing the SOUND button for 2 seconds again changes the recorder back to T setting mode 3 Turn the control repeatedly to adjust the bass or treble To switch B and T Press SOUND for 2 seconds or more To switch SOUND 1 and SOUND 2 Press SOUND for a short time 4 Press M to enter To cancel the Digital Sound Preset On the recorder Select SOUND OFF in step 3 On the remote control Press SOUND repeatedly until nothing appears in the display Notes Digital Sound Preset becomes inoperative when the AUDIO OUT parameter for the LINE OUT jack is set to LINE OUT In this case set the AUDIO OUT to HeadPhone page 94 When you use the Digital Sound Preset the sound may break or become distorted depending on the settings or the track In this case change the settings of the sound quality Changing to another Digital Sound Preset during a recording operation will not affect the quality of recorded sound suorpnasu 6uneredo 103 If you turn group mode on during program play the program play is canceled E E 8 A Adjusting treble and bass Digital Sound Preset See the illustrations in Japanese text pages 39 and 41 You can adjust the treble and bass to suit
91. See the illustrations in Japanese text pages 37 to 39 Settings can be stored to the Personal Disc Memory Selecting a play mode On the recorder 1 While the recorder is playing press the jog dial 2 Turn the jog dial until PLAY MODE flashes in the display and then press to enter 3 Turn the jog dial to select the play mode and then press to enter play mode indication Normal none All the tracks are played once AllRepeat G All the tracks are played repeatedly y 1 Track 17 A single track is played y 1 Repeat C 1 A single track is played repeatedly y Shuffle SHUF After currently selected track finishes playing the remaining tracks are played in random order Shuf Rep G SHUF After currently selected track finishes playing the remaining tracks are played repeatedly in random order PGM PGM Tracks are played in the order that you specified PGMRepeat C PGM tracks are played repeatedly in the order that you specified 102 5 Turn the jog dial to adjust the sound level To move the cursor between T to B Press B or II To switch between SOUND 1 to SOUND 2 Press 81 repeatedly to move the cursor to the top row and then turn the jog dial 6 Press the jog dial to enter The sound settings are saved and the playback display appears again On the remote control 1
92. The disc is labeled On the remote control 1 Insert a disc See step 1 of On the recorder to check the varieties of name you can label page 105 2 Press DISPLAY for 2 seconds or more 3 Turn the control repeatedly until EDIT flashes in the display and then press 88 to enter 4 Turn the control repeatedly until the following item appears in the display and then press l to enter When labeling a track Name When labeling a group GP Name When labeling a disc amp 5 Name 5 Turn the control repeatedly to select a letter and press M to enter The selected letter stops flashing and the cursor moves to the next input position enter When labeling a track Ja Name When labeling a group PY Name When labeling a disc Name The cursor flashes in the letter input area and the track group or disc is ready to be labeled 5 Press The cursor shifts from the letter input area to the character palette 6 Select a letter with the 5 way control key and press to enter The selected letter appears in the letter input area and the cursor moves to the next input position The buttons used for character input and their functions are listed below Functions Operations To move the cursor in 5 way control key the character palette Turn the jog dial move the cursor upward or downward To select a character in Turn the jog dial the letter input a
93. UND 1 TD SOUND 200 0 000000 0 0 2030 0 0 SOUNDO 0 00 48000000000 1000000000000000 0000 0 D am SOUND OFFID 0 00 0 000000 DD 100000000000000 Y 00000000000 640000 050000000000000000 000000000000 111 1 1 1 1 UU 20000000000 0000000 D S ISPLAY 10000000000000 0 O DISPLAYD y e 0000 1 Remair 100000000 y GP Remaim 000000000 y AllRemaig00000000000 y RecDat 00000 300000000000000000 0m000000000095 000 2 Fe 80 100 110 4mp0oo000000 000000000000 100 0 0 0 0 S000000 000000 100 0 00000000 5801000000 00640000 E I I O 000000 100 000000000 E EJEIEEl
94. arm sound and then press to enter The time is set 5 Turn the control repeatedly to select the elapsed time To change the time quickly turn and hold the control 6 Press to enter The Melody timer is set To show the remaining time during play do steps 1 to3 After verifying the time press DISPLAY for 2 seconds or more To check the time remaining on the alarm while playing Follow steps 1 to 3 on the recorder or steps 1 to 4 on the remote control The remaining time and the selected sound appear in the display Press CANCEL on the recorder or DISPLAY for 2 seconds or more on the remote control after you checked To cancel setting the alarm Press CANCEL on the recorder or press DISPLAY for 2 seconds or more on the remote control To cancel Melody Timer Select OFF in step 3 bPower sources You can use the recorder on house current anickel metal hydride rechargeable battery supplied dry battery not supplied It is preferable to use the recorder on house current when recording for a long time When using a battery make sure itis a fully charged rechargeable battery or a new alkaline dry battery to prevent operations e g recording and editing from failing due to insufficient battery power Battery life The battery life may be shorter due to operating conditions and the temperature of the location When recording JEITA Unit approx hours LP2 LP4 17 21
95. ase the part To erase the whole disc 1 While the recorder is stopped press the jog dial 2 Turn the jog dial until EDIT flashes in the display and then press to enter 3 Turn the jog dial until Erase flashes in the display and then press to enter AllErase and PushENTER appear in the display 4 Press the jog dial to enter TOC Edit flashes in the display and all the tracks will be erased When erasing is complete BLANKDISC flashes and 00 00 appears in the display To erase a group 1 Press GROUP for 2 seconds or more to turn the group mode on 2 Follow steps 1 and 2 of the procedure described under On the recorder in Selecting and playing desired groups Group Skip Mode page 101 to check the contents 3 Press M to stop playback 4 Press the jog dial turn the dial until EDIT flashes in the display and then press the dial again 114 To stop the alarm Press any button Notes The settings will be lost when you start recording The timer will begin counting down using the factory setting from the moment you select ON in step 3 The recorder will begin counting down again from the moment you change the elapsed time in step 5 EMT EE Storing the settings for individual discs Personal Disc Memory See the illustrations in Japanese text page 64 The recorder can store the various settings for each disc and then retrieve them automatically
96. ay press After you press M to stop the recorder will automatically turn off in about 10 seconds when using batteries or about 3 minutes when using AC power adaptor Playback starts from the point you last stopped playing To start playback from the beginning of the disc press Be for 2 seconds or more on the recorder or turn and hold the control towards B gt bl for 2 seconds or more on the remote control To Do this Select the track Turn the jog dial and directly viewing press to enter the track number or name Find the Press Turn the beginning of the control towards on current track the remote control Find the Press DPI Turn the beginning of the control towards Bl next track on the remote control Go backwards while playing Keep pressing Ke Turn and hold the control towards on the remote control 94 Recorded Sameasthe Adjusted sound source automatically level You canalso You can also adjust it adjust it manually manually Digital REC level control d You can erase unnecessary marks after recording Erasing a track mark page 113 2 When the sound source is a CD or an MD 3 With a sound source other than a CD or an MD The recorder pauses automatically when it encounters a section with no audio signal for 3 seconds or more Note Track marks may be copied incorrectly when you record from some CD players or multi disc pla
97. baj or jp 0 00 po00000000000000 000000000000000000000 20 amia onu L3 Ed coo eS EE r3 pic awa Es O E CEG 3 m O 2925 a L3 E3 Cy 0 2525 DS E 0 53 E EJE LJ um nooo oo iz L3 r3 r3 Ci 1 oo 1 oo ooo 1 oo aaaHaH oo 1 oo oo paganda J oo i Cr oo DODODOO T Do DOU ood q00000g000 71
98. corder plays the MD digitally and sends analog signals to the connected equipment When connecting a line cable to the LINE OUT jack When connecting a line cable not supplied be sure to set the AUDIO OUT parameter for the LINE OUT jack 1 Press the jog dial 2 Turn the dial until AUDIO OUT flashes in the display and then press to enter 3 Turn the dial until LINE OUT flashes in the display and then press to enter Notes If the AUDIO OUT parameter for the LINE OUT jack is set to LINE OUT VOLUME or Digital Sound Preset will not function The AUDIO OUT parameter for the LINE OUT jack cannot be set to LINE OUT when the supplied remote control is connected When you connect the headphones earphones directly to the recorder set the AUDIO OUT parameter for the LINE OUT jack to HeadPhone To change playback speed Speed Control See the illustrations in Japanese text pages 41 and 42 The playback speed can be adjusted in 7 steps 80 85 100 105 110 Setting can be stroed to the Personal Disc Memory 1 Press DISPLAY for 2 seconds or more during playback 2 Turn the control repeatedly until SPEED flashes in the display and then press B to enter The recorder changes to speed setting mode 3 Turn the control repeatedly to select the playback speed shows the normal speed and the cursor shows the playback speed you are sele
99. cting 4 Press B to set the playback speed S appears in the display when the speed is changed Notes The playback sound will be affected by the playback speed All settings will be lost when you remove the disc from the recorder except when the settings of the disc has been stored to the Personal Disc Memory 104 The number of titles that can be stored on a disc depends on the number of characters that are input for track names group names and disc name About the character palette During operations on the recorder characters can be selected from the character palette in the display Since only a part of the character palette is visible on the display use the 5 way control key to move the cursor and enter characters For configuration of the character palette see page 45 in Japanese text Notes NAME FULL appears when you try to enter more than 1 700 characters on a disc Enter a shorter name for the track group or disc or set the LP Stamp setting to Stamp OFF so that LP is not be added at the beginning of the track name When labeling a disc which has been recorded using the group function make sure group mode is on in order to prevent the group management information from being overwitten by mistake If you enter the symbol between the characters in disc names such as abc def you may be unable to use the group function Labeling recordings
100. de to obtain better sound quality n Recording tracks using the group function Group Mode Recording See the illustrations in Japanese text pages 26 and 27 What is the group function group mode It is a function that allows you to separate tracks on a disc into different groups for playback recording and editing It is convenient for managing multiple CD albums recorded in MDLP LP2 stereo LP4 stereo mode onto a single MD You can create a maximum of 99 groups on a disc How is group information recorded When recording in group mode the group information is written to the disc name recording area automatically Therefore the character string written in the disc name recording area is displayed in its entirety as the disc name if you load an MD recorded in group mode into a system that does not support group mode or if you try to edit the contents of a disc on this recorder with the group mode turned off You can change the character string by performing the procedure of Relabeling recordings in Labeling relabeling recordings page 105 However if you rewrite this character string by mistake you may be unable to use the group function of that MD EEEF DE EE Long time recording MDLP See the illustration in Japanese text page 25 Select each recording mode according to the recording time that you want Stereo recording is possible at 2 times LP2 or 4 times LP4 the normal recording time
101. designated for it NH 14WM Though the battery charging stand and the battery may become hot during the charging procedure this poses no danger Be sure to use the supplied AC power adaptor If you are recharging the battery for the first ime or after a long period of disuse the battery may not charge up to its rated capacity This is a normal characteristic After you use and recharge the battery a few imes it will return to its normal charge capacity When the battery life of a fully charged rechargeable battery becomes about half the normal life replace it Tf the recorder will not be used for a long period of time disconnect the AC power adaptor from a wall outlet and remove the recorder from the battery charging stand Please note the following points when charging the battery directly with the AC power adaptor If you press CHGH immediately after charging has completed charging will begin again If this happens press CHGN again to stop the charging operation since the battery is already fully charged Charging stops when you try to operate the recorder during charging Notes on dry battery Incorrect battery usage may lead to leakage of battery fluid or bursting batteries To prevent such accidents observe the following precautions Insert the and poles of the battery correctly Do not try to recharge the battery When the recorder is not be used for a long time be sure to rem
102. ecorder operations may be picked up if the microphone that you use has a short connector Only the left channel sound is recorded when a monaural microphone is used Setting the clock to stamp the recorded time See the illustrations in Japanese text page 33 To stamp the date and time on the MD when you record you first need to set the clock 1 Press the jog dial while the recorder is stopped 2 Turn the jog dial until OPTION flashes in the display and then press to enter 3 Turn the jog dial until CLOCK SET flashes in the display and then press to enter The digits of the year flash 4 Change the current year by turning the jog dial and press to enter The digit of the month flash 5 Repeat steps 4 to enter the current month date hour and minute When you press the jog dial to enter the minute the clock starts operating If you make a mistake while setting the clock Press to go back wrongly entered item and then enter the correct value You can skip a step by pressing P To display the current time On the recorder 1 When the recorder is not operating or while recording press the jog dial 2 Turn the dial until DISPLAY appears in the display and then press to enter 3 Turn the jog dial until Clock flashes in the display and then press to enter The current time appears in the display On the remote control 1 Press DISPLAY repeatedly until current time appear
103. ed with the AC plug adaptor If the AC power adaptor does not fit the wall outlet use the AC plug adaptor 3 Record an MD D While the recorder is stopped press the jog dial Q Turn the jog dial until SYNC REC flashes in the display and then press to enter Turn the jog dial until SYNC ON flashes in the display and then press to enter To cancel synchro recording select SYNC OFF in this step Press and slide REC to the right REC and REC lamp on the REC switch light up and recording starts Play the source you want to record To stop recording press After you press M to stop the recorder will automatically turn off in about 10 seconds when using batteries or about 3 minutes when using AC power adaptor Note If you record on a previously recorded disc the recorder is factory set to overwrite the entire contents of the disc If you want the recording to start after the existing contents do the procedure Recording without overwriting existing material page 97 before step 3 Record an MD this page To Do this Record from If REC Posi is set to the end of the From Here press END current SEARCH and then press contents and slide REC to the right If REC Posi is set to From End press and slide REC to the right Record over Press gt PPI or I to partway find the start point of through the recording and press M to previous stop Then press and
104. en press W to enter 3 Turn the control repeatedly until Index index search or Time time search flashes in the display and then press B to enter suononunsuj 6uneredo 101 Selecting and playing groups Group Skip Mode Operations are possible regardless of whether group mode is on or off However playback on the recorder will differ depending on whether group mode is on or off When group mode is on Playback starts from the first track of the selected group and ends with the last track in the group When group mode is off Playback starts from the first track of the selected group and ends with the last track on the disc The following procedure is used when group mode is on Insert a disc with group settings On the recorder 1 Press GROUP slightly while playing E flashes in the display and the group become selectable 2 Within 5 seconds turn the jog dial to select your desired group and then press to enter The recorder starts playing from the first track in the group On the remote control 1 While the recorder is playing press and hold PLAYMODE until flashes in the display The group skip mode turns on 2 Within 5 seconds turn the control repeatedly to select your desired group Note If no operation is performed within 5 seconds after step 1 the group skip mode will be canceled and you will not be able to perform step 2 thereafter To continue with ste
105. enter Release and PushENTER appear in the display 7 Press the jog dial to enter The group setting of the selected group is released ORO On the remote control 1 Follow the procedure of To activate the group mode page 97 to turn the group mode on 2 Play a group that you want to release and check the contents see Selecting and playing groups Group Skip Mode page 101 Press W Press DISPLAY for 2 seconds or more Turn the control repeatedly until EDIT flashes in the display and then press to enter 6 Turn the control repeatedly until GPRelease flashes in the display and then press M to enter 7 Press M to enter ORO 6 Turn the control repeatedly until the number of the destination track within the group flashes in the display and then press M to enter To cancel moving Press CANCEL on the recorder Press DISPLAY for 2 seconds or more on the remote control Changing the order of a group on a disc Group Move See the illustrations on Japanese text page 58 On the recorder 1 Press GROUP for 2 seconds or more 2 While playing a track within a group whose order you want to change press the jog dial 3 Turn the jog dial until EDIT flashes in the display and then press to enter 4 Turn the jog dial until EJ Move flashes in the display and then press to enter The group number to which the curren
106. he Personal Disc Memory If the playback does not start Make sure the recorder is not locked If it is locked slide the HOLD switch in the opposite direction of the arrow Suppressing the skips of the sound G PROTECTION The G PROTECTION function was developed to provide a higher level of shock resistance than that of existing players in order to allow the recorder to be used while jogging Note The playback sound may skip if the recorder receives stronger continuous shock a dirty or scratched MiniDisc is played When using the headphones earphones connect them directly to the recorder 1 Press the jog dial 2 Turn the dial until AUDIO OUT flashes in the display and then press to enter 3 Turn the jog dial until HeadPhone appears in the display and then press to enter MD playing CEEE Playing an MD right away See the illustrations in Japanese text page 21 If you want to use the rechargeable battery be sure to recharge them before playing page 91 1 Insertan MD D Press OPEN to open the lid Insert an MD with the label side facing front and press the lid to close 2 Start playing Press on the recorder Turn the control towards B gt Pl on the remote control A short beep sounds in the headphones earphones 2 Press VOLUME on the recorder to adjust the volume Pull and turn the control towards VOL or towards VOL on the remote control To stop pl
107. ical output may not be possible when using an anti skip function e g ESP or G PROTECTION If this is the case turn off the anti skip function Electronic Shock Protection suorpnasu 6uneredo 93 2 A new track mark is added at the point when you press 81 again to resume recording while pausing thus the remainder of the track will be counted as a new track 9 If you open the lid while REC Posi is set to From Here recording will begin from the top of the disc the next time you record Check the point to start recording on the display If the recording does not start Make sure the recorder is not locked Make sure the MD is not record protected Premastered MDs cannot be recorded over About the DSP TYPE R for ATRAC TYPE R is a high level Sony specification used in the Digital Signal Processor DSP which is the heart of the MiniDisc sound This technology gives the MiniDisc recorder twice the signal processing capability as previous MiniDisc Walkman models MDs recorded with this specification TYPE R produce near MiniDisc deck quality sound on MD players that support the specification Even on MD players that do not support the specification it produces higher quality sound than MDs recorded on ordinary MD players This function works only when recording or playing in normal stereo TYPE R does not work when the recorder is in MDLP mode Notes The pause function cannot be
108. ille ECM MS957 ECM MS957 000000 MDR EX 0SL MDR EX7OLP 9 QOD OU MAD SNORE 0009 MDR E888SP MDR Q33LP 0000000000000000000 MDR A110LP 0000000000000000000 000000 SRS Z500 SRS Z500 0000 SRS Z750 bei pe cido SRS Z1000 00000000000000000000 EGET ES MOMO 00000000000000000000 00000 M malicia 000 E 0000000000000000000 Pr 0000000000000 RK G1290 RK MDO 600 0 00 0000000000 0000000000000000 8000 000000 0 RM MC11EL SENAR CET rM c e 000000 00000000000 0000000000 RM MC12ELK 0000000000000CPA 8 51 5 00000000000 DCC E230 sen PE goo ae 00000000000000 RM ee WMC19 E Se er ee 0 0 0 0 0 MZP 10 IC0 0000 0 0000000000MDJ000 000 RPT M1iQ 00000000 g0000000000000000 0010000000 900000 DDD DDD DDD DDD ooo ooo EEE ooo ooo ooo ooo oo oo Co O a r3 p gp mE C 3 oO 1 I La 3 Soe ores GRG
109. lashes in the display and then press 88 to enter 4 Turn the control repeatedly until GP Set flashes in the display and then press M to enter 5 Turn the control repeatedly until the number or name of the desired first track flashes in the display and then press M to enter 6 Turn the control repeatedly until the number or name of the desired last track flashes in the display and then press 88 to enter 7 Follow steps 5 to 7 of On the remote control in Labeling recordings pages 106 and 107 to label a group Erasing phrases On the recorder 1 While the recorder is stopped press the jog dial 2 Turn the dial until EDIT appears and then press to enter 3 Turn the jog dial until BankErase appears and then press to enter 4 Turn the jog dial until the phrase you want to erase flashes in the display and then press to enter Erase appears and the phrase is erased On the remote control 1 While the recorder is stopped press DISPLAY for 2 seconds or more 2 Turn the control repeatedly until EDIT flashes in the display and press 88 to enter 3 Turn the control repeatedly until BankErase appears in the display and then press M to enter 4 Turn the control repeatedly until the phrase you want to erase appears and then press M to enter To cancel the operation Press CANCEL on the recorder Press DISPLAY for 2 seconds or more on the remote control EA Registering
110. mat 00000000000000 e ja to 000240000000000 na 000000 1 000000120000000000 000000000000000000 000000000000000000 00000000000000000 000000000000000000 ATA Aa e 8 11111 1 E 00000000000 dor BE SICHER 00400000000000000 111 1 1 0000000000000000 0000000000000000000 100000000000000 0 0000000000000000000 g ugggaaggaagmgagdga El 3 ooD0000 0OS0000000000000000 000000000 00 0000000000000000 gt D 0000000000000 30000000000 Index oo 000000000000 Timem 0 00000000000080000 00000 aaa aa O o o Re cava 0000 Indexg00 000 0000000000 010 1 100008000000000000 200000000000000000 3 Y 0000000000000000000 00000000000000 0000000000000000000 0000000000000000000 00000 REPRE ERB
111. msnoooo000000 0000 0 p 0000MD 0000MD 000000DmD00 1 0 0 1 L Ji 1186 000000 Finini oo OO MD 0000000 0000MD 0000 0000MD 0000 1 46 49 o Cl o LJ now now Aono 50 51 15 000000 64 38 oo 85 50 67 ZI TEL EE E 0000000 30 OOOO 76 000000000 2 00 000 24 28 17 MDLPOQ 25 ooo 17 oo 29 AVLS 65 DSP TYPE R 19 G PROTECTION 22 MDLP 25 e ao Sm 59 70 00000900000 6 62 61 58 55 61 35 53 26 34 7 37 41 24 Ea al 17 7 39 000000000 14 14 16068 0 33 DRE can jor r3 2 S ze Oo 4 REC i
112. ndication Lights up while recording Flashes when standing by for recording 5 SYNC synchro recording indication Lights up while synchro recording 6 Play mode indication Shows the play mode of the MD 7 Level meter Shows the level of the MD being played 8 LP2 LP2 stereo LP4 LP4stereo MONO monaural indication 9 Sound indication Lights up when Digital Sound Preset is on 10 Battery level indication Shows approximate battery condition While charging the rechargeable battery this indication shows the charging condition 11 Melody timer indication The headphones earphones with remote control a 1 DISPLAY button 2 PLAY MODE button 3 RPT ENT repeat enter button 4 SOUND button 5 H pause button 6 MW stop enter button 7 Clip 8 Control Fe PP yi play AMS FF 44 REW Turn or turn and hold to play fast forward rewind etc 9 Control VOL Pull and turn to adjust the volume 10 Display window 11 HOLD switch suononunsuj 6uneriedo The display window of the remote control Disc indication Track number display Character information display Play mode indication SOUND indication Battery level indication REC indication Group indication Melody timer indication 3 89 bOperating Instructions p Looking at the controls The numbers are keyed to the illustrations in he Japa
113. nds or more on the remote control Notes Track and disc titles that were entered in Japanese katakana characters will appear in Roman letters on minidisc players that do not support the display of katakana Characters Such titles will be marked with a at the beginning and the end You cannot relabel premastered MDs or label MDs that have not been recorded The recorder cannot rewrite a track group or disc name of more than 200 letters that was created by another device uo Storing phrases frequently used in labeling Name Bank Function See the illustrations in Japanese text page 50 Phrases that you often use while labeling can be stored in the recorder s memory Approximately 25 phrases of about 10 characters each with a total character count of about 400 can be stored in the phrase bank The actual number will depend on the length of each phrases suorpnasu 6uneredo Storing phrases while labeling a track or disc You can store phrases in three ways Storing phrases while labeling a track group or disc You can store phrases while labeling a track group or disc by doing the procedure Labeling recordings page 105 1 07 To delete a letter and Press move back all following PLAYMODE letters to the left P If phrases are stored in the name bank the first phrase stored appears in the display page 107 6 Repeat step 5 and enter all characters of the label name 7 Keep pres
114. necessary you can set the level manually during both analog and digital recording 1 While holding down 88 press and slide REC to the right The recorder stands by for recording Notes The setting will remain even after the power is turned off If you start recording while the recorder is in play paused the recording will begin from the point at which it is paused even when the REC Posi is set to From End w iss Recording from a microphone See the illustration in Japanese text page 29 1 Connect a stereo microphone ECM 717 ECM MS907 ECM MS957 etc not supplied to the MIC PLUG IN POWER jack 2 Press and slide REC to the right To select microphone sensitivity 1 Press the jog dial while the recorder is stopped 2 Turn the dial repeatedly until MIC SENS flashes in the display and then press to enter 3 Tum the jog dial repeatedly to select SENS HIGH when recording a soft sound or a sound in the distance or SENS LOW when recording a loud sound or a sound at close range and then press to enter Notes The recorder automatically switches input in the following order optical input microphone input and analog input You cannot record through the microphone while an optical cable is connected to the LINE IN OPT jack The microphone may pick up the operating sound of the recorder itself Use the microphone away from the recorder in such cases Please note that the sound of r
115. nese text pages 11 to 13 The recorder Display window TMARK button Battery compartment END SEARCH button VOLUME buttons The VOLUME button has a tactile dot Terminals for attaching dry battery case DC IN 3V jack GROUP CANCEL button OPEN button 5 way contorl key For basic operations Press B gt to play enter The button has a tactile dot Press gt P to rewind fast forward Press 81 to pause Press CHG to stop charge For moving the cursor and entering selected items during text entry and other settings 11 Jog dial MENU ENTER Press to enter the menu turn to select and then press to enter 12 LINE IN OPT jack 13 MIC PLUG IN POWER jack There is a tactile dot beside the MIC PLUG IN POWER jack 14 REC record switch 15 HOLD switch at the rear 18 O LINE OUT jack 3 c The display window of the recorder 1 Character information display Displays the track group or disc name date error messages track numbers etc Names appear only with MDs that have been labeled 2 Group indication 3 Disc indication Shows that the disc is rotating for recording playing or editing an MD
116. ng from the current point Select From Here in step 4 97 Notes The group function setting is stored even if you eject the MD or turn off the recorder In group mode the recorder treats all tracks without group settings as belonging to the last group on the disc The last group is indicated in the display window on the recorder as Group Within a group the tracks appear in their order on the disc not their order within the group Note that a group setting cannot be made if the total character count for the tracks groups and disc name on the disc exceed the maximum number that can be input To activate the group mode To record tracks in group mode you must first turn the group mode on before the start of recording On the recorder 1 Press GROUP for 2 seconds or more G and GROUP ON light up in the display and the group mode turns on To cancel the group mode press GROUP for 2 seconds or more On the remote control 1 Press DISPLAY for 2 seconds or more 2 Turn the control repeatedly until GROUP flashes in the display and then press M to enter 3 Turn the control repeatedly until GROUP ON flashes in the display and then press M to enter G lights up in the display and the group mode turns on To cancel the group mode select GROUP OFF in step 2 Recording a track into a new group Turn the group mode on 1 Press END SEARCH 2 Press and slide REC to the
117. ntrol 1 Press DISPLAY for 2 seconds or more 2 Turn the control repeatedly until EDIT flashes in the display and then press 88 to enter 3 Turn the control repeatedly until de Move flashes in the display and then press B to enter 4 Turn the control repeatedly to select the destination track number 5 Press 8 to enter To cancel moving Press CANCEL on the recorder Press DISPLAY for 2 seconds or more on the remote control Note If the disc has group settings turn group mode on before moving a track Moving a track with group mode off may affect the structure of the group Notes In step 5 the first track must be either the first track of an existing group or a track that does not belong to a group When selecting the last track in step 4 make sure the track comes after the one selected in step 5 The last track must be either the last track of an existing group or a track that does not belong to a group EEE To release a group setting See the illustrations in Japanese text page 55 On the recorder 1 Press GROUP for 2 seconds or more to turn the group mode on 2 Play a group that you want to release and check the contents Selecting and playing groups Group Skip Mode page 101 Press Press the jog dial Turn the jog dial until EDIT flashes in the display and then press to enter 6 Turn the jog dial until fJ Release flashes in the display and press to
118. o 7 of On the remote control in Labeling recordings pages 106 and 107 suorpnasu 6uneriedo 109 1 On the remote control 1 Searching for a phrase by its first letter You can retrieve a phrase by its first letter and then use the phrase in a new label Searching for a phrase by displaying the stored phrase On the recorder 1 Follow steps 1 and 4 of Labeling recordings pages 105 and 106 A track group or disc is ready to be labeled 2 Press END SEARCH so that the phrase stored in the recorder s memory appears in the display 3 Press M to move the cursor from the letter input area to the character palette 4 Turn the jog dial until the desired phrase flashes in the display Turning the jog dial causes the phrases stored in the recorder s memory to appear one by one in sequential order 5 Press the jog dial while the phrase you want flashes in the display The phrase is selected and lights up in the letter input area 6 Press the jog dial for 2 seconds or more The phrase is retrieved 7 If you continue labeling operation do steps 5 to 8 of Labeling recordings page 106 On the remote control 1 Follow steps 1 to 4 On the remote control in Labeling recordings page 106 2 Press repeatedly until the phrase stored in the recorder s memory appears in the display 3 Turn the control repeatedly Turning the control causes the phrases stored in the recorder
119. og dial 96 Recording a track into an existing group Insert a disc with group settings Turn the group mode on 1 Press GROUP slightly E7 flashes and you can select a group directly group skip mode 2 Within 5 seconds press or PPI repeatedly until the group you want the track to belong to appears Press and slide REC to the right Play the source sound Newly recorded track is added after the current contents Notes Even if REC Posi is set to From Here newly recorded tracks are inserted after the existing tracks in the specified group without recording over the current contents Group skip mode turns off automatically in step 2 if nothing is done within 5 seconds To continue the procedure do step 1 again Recording without overwriting existing material See the illustration in Japanese text page 28 If you wish to avoid overwriting the current contents of an MD do the following procedure All new material will then be recorded from the end of the current contents 1 While the recorder is stopped press the jog dial 2 Turn the jog dial until OPTION flashes in the display and then press to enter 3 Turn the jog dial repeatedly until REC Posi flashes in the display and then press to enter 4 Turn the jog dial repeatedly until From End flashes in the display and then press to enter suorpnasu 6uneredo To start recordi
120. oo 25 El LJ O O El oo 00 E abala o Polo o Mr Oo oloon alaDoa a 00 MENU NAME FULL NO COPY NO DISC No Entry NO SIGNAL NV ERROR P B ONLY PROTECTED REC ERR READ ERR 76 00 0900000000000000 00 0 00 310420 0 DISPLAY EDIT EDIT DO oOo oOo 0000005 DISPLAYO 00020000000 000000 o 0i O O O OLE 000 po00000000 Uu po0000 po0000 TR FULL TrPROTECT 254000000 00025400000 oo TOC ERR TOC Edit 0000 D 0000000 TEMP OVER 000000000 000000 0000 O o O 00000 TMARKO L3 C3 C3 pc S zs mc C3 C3 p 03 C3 C3 p3 C3 SoH ea oes occ C3 C3 C3 C3 C3 C3 as C3 C3 E3
121. ou combine a track that is registered to a group with a track that is not registered to a group two consecutive tracks the second track takes the same registration setting such as the recording date track name etc as the first track However when the group function is on you can only combine tracks within the selected group You cannot erase track marks according to the system limitations suorpnasu 6uneredo EEE EEEF EF Erasing tracks See the illustration in Japanese text page 60 You can quickly erase recorded tracks all the tracks and data of the MD or groups Note that once a recording has been erased you cannot retrieve it Make sure of the contents you are erasing To Erase a track On the recorder While playing the track you want to erase press the jog dial Turn the jog dial repeatedly until EDIT flashes in the display and then press to enter Turn the jog dial until gd Erase flashes in the display and then press to enter Erase OK and PushENTER appear in the display Press the jog dial to enter The track is erased and the next track starts to play All the tracks after the one erased are automatically renumbered 113 1 2 To cancel moving Press CANCEL on the recorder Press DISPLAY for 2 seconds or more on the remote control Ee Adding a track mark See the illustrations in Japanese text page 59 You can add a track mark so that the
122. ou tried to record more than 254 tracks TrPROTECT You tried to record over or edit a track which has been protected from being recorded over Track protected MiniDiscs Some MD recorders will let you protect individual tracks from being recorded over This recorder however does not offer this feature MENU You pressed a key on the remote control while selecting a menu on the recorder NAME FULL You tried to enter more than 200 letters to label a single track or disc You tried to enter a total of more than 1700 letters for track or disc names NO COPY You tried to make a copy from a disc that is protected by the Serial Copy Management System You cannot make copies from a digitally connected source which was itself recorded using the digital connection Use the analog connection instead NO DISC You tried to play or record with no disc in the recorder No Entry You tried to erase a setting in the Personal Disc Memory on a disc that contains no settings in the Personal Disc Memory NO SIGNAL The recorder could not detect digital input signals Make sure that the source is connected firmly If the message appears while recording press M to end recording NO TEXT You tried to use the CD text copying function to copy a track or disc name from a CD that has no text data NV ERROR Internal processing was not correctly done Reinsert the disc or try repeating the recorder operation If the same
123. ove the battery If a battery leak should develop carefully and thoroughly wipe away battery fluid from the battery compartment before inserting new ones suorpnasu 6uneriedo 91 Preparing EEE EE Getting started See the illustrations in Japanese text pages 14 and 15 Charge the rechargeable battery before using Even if the rechargeable battery is not charged you can use the recorder as long as the AC power adaptor is connected 1 Insert the nickel metal hydride rechargeable battery NH 14WM into the recorder with the minus end first To use the recorder with an alkaline dry battery insert the dry battery into the dry battery case and attach it to the recorder 2 Charging the rechargeable battery D Assemble the battery charging stand Make sure all the parts of the battery charging stand are firmly attached Connect the AC power adaptor to the battery charging stand and the AC adaptor to a wall outlet Place the recorder on the battery charging stand Verify that the CHARGE lamp lights up Full charging takes about six hours When it is completed the charge lamp goes off Do not operate the recorder when you place it on the battery charging stand or during the charging If you do so it may cause the recorder malfunction or prevent the battery from charging 3 Connect headphones earphones with the remote control to the recorder and slide HOLD to unlock the control For models suppli
124. p 1 at this point repeat from the beginning of the procedure EEE Using the group function Group Mode See the illustrations in Japanese text pages 35 to 36 The recorder can operate various playback with a disc which has group setting Listening to tracks in a specific group Group Mode Playback Insert a disc with group settings On the recorder 1 Start playback 2 Press GROUP for 2 seconds or more to turn the group mode on Playback stops at the end of the last track in the selected group For details on selecting another group see Selecting and playing groups Group Skip Mode this page On the remote control 1 Start playback 2 Press DISPLAY for 2 seconds or more 3 Turn the control repeatedly until GROUP flashes in the display and then press to enter 4 Turn the control repeatedly until GROUP ON flashes in the display and then press M to turn the group mode on To turn off the group function On the recorder Press GROUP for 2 seconds or more again On the remote control Select GROUP OFF in step 4 Note In group mode the recorder treats all tracks without group settings as belonging to the last group on the disc The last group is indicated in the display window on the recorder as Group Within a group the tracks appear in their order on the disc not their order within the group On the remote control 1 Press PLAYMODE during playback
125. part after the new track mark is counted as new track You cannot add a track mark on a track that has been checked out from your computer 1 While playing or pausing an MD press T MARK on the recorder at the point you want to mark MARK ON appears in the display and the track mark is added To add track marks while recording except while synchro recording Press T MARK at the point you want to add a track mark You can use Auto Time Stamp to add track marks automatically at specified intervals except while digital recording Erasing a track mark See the illustrations in Japanese text page 59 When you record with analog line input unnecessary track marks may be recorded where recording level is low You can erase a track mark to combine the tracks before and after the track mark You cannot erase a track mark on a track that has been checked out from your computer 1 While playing the track with the track mark you want to erase press 81 to pause 2 Find the track mark by pressing slightly MARK appears in the display for 2 seconds 5 Turn the jog dial until EJ Erase flashes in the display and then press the jog dial The group name GP Erase and PushENTER appear in the display 6 Press the jog dial again The group is erased To cancel erasing Press CANCEL on the recorder Press DISPLAY for 2 seconds or more on the remote control bOther operation
126. rea Press P gt Press the jog dial To enter a letter Functions Operation To switch between Press Il katakana capital letters small letters numbers symbols and phrases To move the cursor from Press 88 the letter input area to the character palette To move the cursor Press CANCEL from the character palette to the letter input area To move the cursor to the left or right Pull and turn the control VOL Press or the jog dial for 2 second or more To insert a blank space Press VOLUME before the cursor in the To enter a name To change the letter to Turn the control the one before nextone B gt PPI To insert a blank space Press DISPLAY to type in a new letter letter input area To cancel labeling Press DISPLAY for 2 seconds or To delete a letter in the Press VOLUME nore letter input area 106 On the remote control 1 Insert a disc and do the following See step 1 of On the recorder to check the varieties of name you can relabel 2 Follow steps 2 to 4 of On the remote control page 106 in Labeling recordings to display a track group or disc name 3 Follow steps 5 to 7 of On the remote control pages 106 and 107 in Labeling recordings and then keep pressing the 88 for 2 seconds or more To cancel labeling Press CANCEL on the recorder Press DISPLAY for 2 seco
127. recordings page 107 and display the track group or disc name that contains the phrase that you want to store 2 Pull and turn the control towards VOL or VOL to move the cursor to the right of the phrase 3 Press for 2 seconds or more to store the phrase Entering and storing phrases On the recorder 1 Press the jog dial 2 Turn the dial until EDIT flashes in the display and then press to enter 3 Turn thejog dial until Name Bank flashes in the display and then press to enter 4 Follow steps 5 to 8 of Labeling recordings page 106 to enter a phrase Entry appears in the display and the phrase is stored On the remote control 1 Press DISPLAY for 2 seconds or more 2 Turn the control repeatedly until EDIT flashes in the display and press 88 to enter 3 Turn the control repeatedly until Name Bank flashes in the display and then press B to enter 4 Dosteps 5to7 of On the remote control in Labeling recordings pages 106 and 107 to enter a phrase Note If you have entered and then stored a phrase you cannot retrieve it by following the procedure of Searching a phrase by displaying the stored phrase one by one When you retrieve a stored phrase follow the procedure of Searching for a phrase by its first letter Using a retrieved phrase for labeling There are two ways to retrieving phrases for labeling Searching for a phrase by displaying the
128. right 3 Play the source sound To stop recording press 88 The material that was recorded up until was pressed is entered as a new group EE Adding track marks automatically at specified intervals Auto Time Stamp See the illustration in Japanese text page 29 Use this feature to add track marks automatically at specified intervals when recording through the analog input connector or a microphone 1 While the recorder is recording or in recording pause press the jog dial 2 Turn thejog dial repeatedly until TIME MARK flashes in the display and then press to enter 3 Turn the jog dial repeatedly until the desired time interval flashes in the display and then press to enter Select one of the following intervals OFF 5 min ON track marks are added in every 5 minutes 10 min ON track marks are added in every 10 minutes 15 min ON track marks are added in every 15 minutes To cancel the setting select OFF in this step Notes Automatic track marking by Auto Time Stamp starts when you add a normal track mark to the disc i e by pressing T MARK or M etc The setting will be lost when the recording stopped 5 5 5 Adjusting the recording level manually Manual Recording See the illustrations in Japanese text pages 30 and 31 When you record the sound level is adjusted automatically If
129. s in the display suorpnasu 6uneriedo To display the time in the 24 hour system Press TMARK while setting the clock To change the clock to the 12 hour system press TMARK again 99 2 Press the jog dial 3 Turn the jog dial until RecVolume flashes in the display and then press to enter 4 Turn the jog dial until ManualREC flashes in the display and then press to enter To switch back to the automatic level adjustment select Auto REC in this step 5 Play the program source 6 While observing the level meter in the display adjust the recording level by turning the dial Set the level so that the meter segments light up between the fifth segment and the ninth segment If the level meter lights up to the right of O reduce the input level The upper level meter shows the L channel input level and the middle meter shows the R channel input level If your source is an externally connected component be sure to cue the source to the begining of the material to be recorded before you start playback 7 Press IM again to start recording Notes If you press lil during recording operation the recorder will revert to automatic recording level adjustment mode the next time you start a recording operation RecVolume cannot be selected in step 2 during synchro recording To set the recording level manually during synchro recording do the procedure below 1 Do and O of Record
130. sing M for 2 seconds or longer The track or disc is labeled To cancel labeling Press CANCEL on the recorder Press DISPLAY for 2 seconds or more on the remote control Notes When the recording is stopped while labeling a track a group or a disc during recording or when the playback moves on to the next track while labeling a track during playback the input at that point is entered automatically LP has automatically been added at the beginning of the track names for tracks recorded in MDLP mode You cannot label or relabel the premastered disc Relabeling recordings On the recorder 1 Insert a disc and do the following To relabel a track Start playing a track you want to relabel and change a track name while the recorder is playing To relabel a group Turn the group mode on page 97 and start playing or recording a track within the group you want to relabel and change the group name while the recorder is playing or recording To relabel a disc Relabel the disc while the recorder is stopped or recording If you relabel a disc with group settings turn the group mode on page 97 2 Follow steps 2 to 4 of Labeling recordings page 105 to display a track group or disc name 3 Follow steps 5 to 8 of Labeling recordings page 106 and then keep pressing the jog dial for 2 seconds or more On the remote control 1 Follow steps 1 and 2 of On the remote control in Relabeling
131. slide recording REC to the right Pause Press 2 Press II again to resume recording Remove the MD Press M then press OPEN to open the lid d If REC Posi is set to From End recording operations will always start from the end of the previously recorded material without pressing END SEARCH MD recording SS Recording an MD right away Synchro recording See the illustrations in Japanese text pages 17 and 18 This section explains the basic procedure for making digital recordings using an optical cable connected to a CD player BS tuner or other digital equipment The recorder starts and stops recording in sync with the source sound Track marks are added whenever they appear in the sound source It is recommended to use the AC power adaptor when recording To record from a cassette deck radio etc Recording in analog Analog Recording page 95 To record using a group mode Recording tracks using the group function Group Mode Recording page 96 1 Insert an MD D Press OPEN to open the lid Insert an MD with the label side facing front and press the lid to close Insert an recordable MD when recording 2 Make connections Insert the cables firmly and completely into the appropriate jacks Connect the LINE IN OPT jack of recorder to the digital optical out jacks of the source with a optical cable The recorder switches to digital input au
132. te control see Menu functions page 90 1 Press the jog dial 2 Turn the jog dial until OPTION flashes in the display and then press to enter 3 Turn the jog dial until BEEP flashes in the display and then press to enter 4 Turn the jog dial until MAIN UNIT or REMOTE flashes in the display and then press to enter MAIN UNIT when turning off the beep sound on the recorder REMOTE when turning off the beep sound on the remote control 5 Turn the jog dial until BEEP OFF flashes in the display and then press to enter To turn on the beep sound Select BEEP ON in step 5 bAdditional information ESTE Messages If the recorder cannot carry out an operation error messages may flash in the display window as follows BANK FULL The phrase bank is almost full and cannot store the phrase you tried to enter Delete some phrases from the phrase bank and then reenter the new phrase BLANKDISC You tried to play an MD with no recording on it BUSY You tried to operate the recorder while it was accessing the recorded data Wait until the message goes out in rare cases it may take a few minutes Data Save The MD recorder is recording information sounds from the memory to the disc Wait until this process is completed Do not expose the recorder to any physical shock nor disrupt power supply DISC FULL There is no more space to record on the MD EMPTY
133. tly playing track belongs flashes in the middle section of the display If the group has been labeled press PP to display the group name Press 164 to return to the group number display 5 Turn the jog dial to select the destination point on the disc and then press to enter On the remote control 1 Follow the procedure of To activate the group mode page 97 to turn the group mode on 2 While playing a track within a group whose order you want to change press DISPLAY for 2 seconds or more 3 Turn the control repeatedly until EDIT flashes in the display and then press 88 to enter 4 Turn the control repeatedly until GP Move appears in the display and then press to enter 5 Turn the control repeatedly to select a destination point on the disc and then press to enter A SR Moving a track to a different group See the illustration in Japanese text page 57 On the recorder 1 Press GROUP for 2 seconds or more to turn the group mode on 2 While playing the track you want to move press the jog dial 3 Turn the jog dial until EDIT flashes in the display and then press to enter 4 Turn thejog dial until JI Move flashes in the display and then press to enter 5 Turn the jog dial until the destination group flashes in the display and then press to enter The group number to which the currently playing track belongs flashes in the middle section of the display If
134. tomatically Connect the DC IN 3V jack of the recorder to a wall outlet with the AC power adaptor When the recorder has different sound sources connected at the same time the recorder switches to the digital microphone or analog input in this order of priority You cannot change the recording mode during recording Data Save or TOC Edit flashes while data of the recording the track s start and end points etc is being recorded Do not move or jog the recorder or disconnect the power source while the indication is flashing in the display The lid does not open until TOC Edit disappears in the display If the power supply is disrupted i e the battery is removed or becomes exhausted or the AC power adaptor is disconnected during a recording or editing operation or while TOC Edit appears in the display then it will not be possible to open the lid until power is restored You can make a digital recording only from an optical type output When recording from a portable CD player set the CD player to pause and then do the recording procedure on the recorder Note the following when recording from a portable CD player Some portable CD players may not be capable of digital out unless powered by the AC power If this is the case connect the AC power adaptor to the portable CD player and use it on AC power as the power source On some portable CD players opt
135. trol until the desired point appears in the display 3 Press to cancel the pause Playback starts from the selected point To maintain the correct time Once you set the clock it will keep correct time as long as the recorder is connected to a power source such as the rechargeable battery alkaline dry battery or AC power adaptor However if no power source is connected the clock setting will change back to the factory setting after about 3 minutes When changing the rechargeable battery or alkaline dry battery make sure to do it within 3 minutes Notes Make sure the time is correctly set if you want the time stamp to be accurately recorded for an important recording Under normal conditions the clock may vary by about plus or minus 2 minutes per month p Various ways of playback UT ERE Searching for a specific track or a position quickly Quick Search See the illustrations in Japanese text page 34 You can do two kinds of quick search Index search Searching quickly while monitoring the track numbers or track names Time search Searching quickly while monitoring the elapsed time Selecting the search mode The search mode can be selected only on the remote control while the recorder is stopped playing or play paused The recorder is factory set to Index 1 Press DISPLAY for 2 seconds or more 2 Turn the control repeatedly until SEARCH flashes in the display and th
136. with an analog digital line output optical jack output jack Usable cord Optical cable Line cable with an with 2 phono optical or an plugs or a optical mini stereo mini plug plug Analog Even when a digital source such as a CD is connected the signal sent to the recorder is analog Marked Marked copied after more automatically than 2 eat the same Seconds of positions as blank or low the source level Signal from Digital the source Track marks after more j than 2 ur 6 recorder is seconds of paused while blank or di ada recording rd automatically segment atspecifieg when intervals recording is when the paused Auto time while stamp is on synchro You can erase recording unnecessary marks after recording Notes Itis recommended that you use the AC power adaptor for MDLP recordings During monaural recording of a stereo sound source connected through the digital optical input jack you can still monitor the recorded sound in stereo by using headphones earphones connected the LINE OUT jack When you record in LP4 stereo mode momentary noise may be produced on very rare occasions with certain sound sources This is because of the special digital audio compression technology that enables a recording time 4 times longer than normal If noise is produced it is recommended that you record in normal stereo or LP2 stereo mo
137. yers using digital optical input when the source is in shuffle or program play mode while recording using digital optical input In this case play the source in normal play mode when programs with audio that is digitally broadcast e g digital TV are recorded through the digital optical input EEE EE Recording in analog Analog Recording See the illustration in Japanese text page 24 The sound will be sent from the connected equipment as analog signal but will be recorded digitally on the disc 1 Connect the LINE IN OPT jack of the recorder to the line output jack of the source with an line cable not supplied The recorder switches to analog input automatically 2 Connect the power source To use on AC power see Recording an MD right away 3 Press and slide REC to the right REC and the REC lamp lights up and recording starts 4 Play the sound source Note If you temporarily stop a recording operation by pressing 88 a new track mark will be added at that point when you press 81 again to resume recording The recording resumes ona new track suononunsuj 6uneredo 95 Various ways of recording Um E AAA A Connecting digital optical and analog line inputs The recorder selects digital or analog input according to how the sound source is hooked up Input Digital Analog line optical input Differenc input Connectable Equipment Equipment source with an

Download Pdf Manuals

Related Search

Related Contents

Toshiba Qosmio X875-Q7280  1 miniUSB ケーブル 20cm USB(A)(male)⇔miniUSB(male） Media    Enabling LucidLogix Virtu MVP  EcoBlue Advance Combi User Guide  KRYPTON - DJ Store  Décoration de jardin solaire à LED Mode d`emploi  Pelco Intelli-m c3653m-a User's Manual  release notes - Pelikan Daniel  VIZIO SV370XVT User's Manual  

Copyright © All rights reserved. Failed to retrieve file