Saccharomyces cerevisiae 由来カルボキシペプチダーゼYのV字
Contents
1. A 4 aa EIREJA lt w Sol 892. 6 OT 69 kDa p2 CPY 7 N K Gln24 Arg Pro Leu27 sorting signal 8 9 pH vma H ATPase 6 2 10 proteinase A PrA proteinase B PrB p2 CPY CPY 61 kDa 11 1 2 CPY CPY 1994 X Fig 1 2 12 q 34 B
3. CPY 45 CPY CPY CPY CPY
4. 41 3 2 2 3 2 2 1 CPY C193A C207A C262A C268A 4 CPY C193A C207A C262A C268A 2 CPY pLTCV5HGWT t Forward primer PCR DNA PCR DNA QuikChange Site directed Mutagenesis Kit pLTCV5HGWT CPY pLTCV5HGC198A pLTCV5HGC207A pLTCV5HGC262A pLTCV5HGC268A BY4741pzc7A
5. 52 CPY CPY 11 Cys 5 6 LAL V 1 Cys V Tyr225 Cys Tyr Ala Phe Cys V CPY CPY V
6. pLTex321sV5H Table 2 1 pLTex321sa2V5H pLTex321sCPR5V5H pLTex321sCWP2V5H pLTex321sEUG1V5H pLTex321sPHO89V5H CPY CPY o 13 2 2 2 2 1 E coli JM109 BL21 DE3 Novagen S cerevisiae BY4743 BY4741pzc7A Thermo Fisher Scientific BJ2168 NBRP Table 2 2 pGEM TEasy Vector Promega pColdl QuikChange Site Directed Mutagenesis Kit
7. jn silico Discovery Studio 2 5 5 Accelrys CPY PDB ID 1YSC Minimization AY CHARMm RMS Gradient 0 1 kcal molA 47 Build Mutants EDR Minimization 44 RMS Gradient 0 1 kcal molA WT Potential energy van der Waals energy Electrostatic energy
8. WE E R 48 60 61 CPY LY V CPY ofk A CPY hydro lase fold E alb 75 1 Hayashi R Moore S and Stein W H 1973 Carboxypeptidase from yeast Large scale preparation and the application to COOH terminal analysis of peptides and proteins J Biol Chem 248 2296 2302 2 St
9. CPY FB C193A C207A V CPY 1 C262A C268A V Cys262 Cys268 V 48 Fig 3 1 Disulfide bonds in CPY molecule Four out of five disulfide bonds formed in CPY molecule associate with V shape helix Disulfide bonds are shown in orange thick stick Hinge disulfide bonds Cys193 Cys207 and Cys262 Cys268 and disulfide zipper Cys217 Cys240 and Cys224 Cys233 are framed in blue and pink boxes respectively V shape helix is colored in g
10. CPY catalytic triad Sv 8n VE Gln228 Lys314 V Gln228 65 Ss Ss V V Pro Gly secondary structure breaker Pr
11. 26 81 Tyr147 Leu178 Tyr185 Tyr188 Trp312 Ile340 Cys341 Pi 27 380 Cys341 Cys 27 31 33 Ssz lt 8a 34 36 1 4 V CPY Ser204 lt Thr251 2 a 12 V V CPY foldfamily CPWII A PPCA CPY V
12. 1 18 20 9 16 17 DFP PMSF ZPCK EDTA catalytic triad Ser146 His397 Ser146 hydrogen bondnetwork BOT OC Kw DUR REY VE Gly52 Si Sy HOT Dat Si Hydrogen bond network 8 BO C Si Si Pi Thr60 Phe64 Tyr256 Tyr269 Leu272 Met398
13. CPY EK Kia Escherichia coli ROME Saccharomyces cerevisiae pCold1 HH CPY PrA PrB 1 BJ2168 CPY BY4741prc74 pLTex321sV5H Sahara 38 HSP12
14. Fig 2 4 BLColdCHWT aie LH zE CPY KUL His tag CPY HO CPY 2 3 2 CPY pLTCV5HGWT 1 BJ2168 40 lt 70 TALON Metal Affinity Resin His tag TOYOPEARL Buty1 650M RE Zz SDS PAGE Western blot 69 kDa CPY Tig 2 5
15. tex REF FERT 2010 ma FA FERT FERT FERT Kel BY Tah Y 2011 2010 12 0 E HE BF FE 2008 2009 2010 4 wh ett 11 wr Tay tr ET 2011 9 Y 84
16. Z Phe Leu OH Z Phe Pro OH BTpNA Ac Tyr ORt P315G ok WT 63 ar Zm OF zza P315G Table 4 4 64 4 4 RNase A C B Anfinsen 30 1
17. 4 3 1 Cys BT am D Cys Y225C P315C Q228C K314C EK Cys Y225C P315C Q228C K314C DNA DNA CPY Fig 4 3 A L Q228C K314C Y225C P315C Q228C K314C Y225C P815C
18. Cys262 Cys268 3 3 2 C262A C268A C262A C268A ZZ Phe Leu OH BTpNA C262A C268A WT Table 3 2 Cys262 Cys268 V 46 CPY Th 3 3 38 C193A C207A C262A C268A Discovery Studio 2 5 5 AY CHARMm CPY o Potential energy van der Waals energy Electrostatic energy
19. Fig 1 3 13 37 V CPY 5 4 V V CPY 1 5 CPY V Lk 2 qd 7 CPY CPY 83 V CPY 4 V Y
20. Fig 4 3 B CPY 61 V Cys DED V Q228C K314C Gln228 Lys314 Cys WUT Y225C P315C Tyr225 Pro8315 4 3 3 Q228C K314C a Q228C K314C
21. Ac Tyr OEt ue N BDE 100 mM sodium phosphate buffer Aro 50 mM sodium phosphate buffer pH 8 0 Ac Tyr OEt A2s7 kcat E Km kcat Km Michaelis Menten Hanes Woolfplot 60 4 3 1 V CB Discovery Studio 2 5 5 Tyr225 Pro315 4 5A Gln228 Lys314 5 8 Fig 4 2 2 Cys 4 3 2 Cys
22. 45 3 3 1 Cys Ala pzc7 TDNA MAL DNA BY4741pzc7A SDS PAGE Western blot CPY Fig 3 2 A C193A C207A Fig 3 2 B 2 C262A C268A
23. i 17 2 2 2 5 CPY kk 18 2 2 2 6 CPY 0 Ee 19 2 2 2 7 CPY 2 20 2 21 2 2 2 9 SDS PAGE Western blotting Re 21 20 22 De TE 23 2 3 1 CPY eee 23 2 3 2 CPY 23 2 3 3 CPY Dd 3 26 83 CPY NE 40 Phe Diba T er ae Pes en AEEA TA TR PC aN AT NEI TIRE ey 40 3 2 41 31 STRIA AT aR A Pe ER 41 3 2 2 A DE 0 42 3 2 2 1 CPY C193A C207A C262A C268A 42 AE a dd dd a de dd NE 43 3 2 2 3 SDS PAGE
24. CPY ik N 20 91 421 CPY 67 kDa p1 CPY 2 4 I E In vitro in vivo CPY 1 C jn vivo 5 E CPOY 50 5
25. 2 2 2 2 zc7 Histag pColdl 2 2 2 1 pGCHWT PCR NEA JOT prc7 Saci HindIII SacI prc1 F prel HindIII R Table 2 3 PCR 15 pGEM T Easy Vector pGCHWT2 pGCHWT2 KR A RE 3 4 Sacl HindIlll pre7 Histag Ultrafree DA Millipore DNA pColdl T4 DNA Ligase pColdCHWT Tig 2 1 2 2 2 3 CPY 2 2 2
26. Z Phe Leu OH BTpNA WT Table 4 2 Gln228 TLys814 Cys 4 3 4 Tyr225 Pro8315 4 3 2 Tyr225 Pro315 Cys Cys 2 Y225A Y225F P3158 P315G 62 Y225A Y225F Y225C amp Alt Iz Hz Fig 4 4
27. CPY p1 CPY p2 CPY E CPY CPY Ck CPY Wm CPY
28. 88 4 6 Meike lt lt RK AWELERRKFTKS It pLex321sV5H 5
29. CPY in virto 6 CPY Bi CPY CPY BJ2168 p1 CPY p2 CPY CPY 26 FT DO FE HH CS UL Bil BK AS CPY BY4741pzc7A CPY
30. 4 2 2 3 Tyr225 Pro315 Tyr225 Pro315 OMA CPY YV225A Y225F P3158 P315G CPY pLTCV5HGY225A pLTCV5HGY225F pLTCV5HGP315S pLTCV5HGP315G DNA Table 4 1 58 4 2 2 4 bovine serum albumin Quick Start Bradford Protein Assay Kit ny 4 2 2 5 SDS PAGE Western blotting CPY SDS PAGE Western blotting 2 2 2 9 OW CHS 10 000 Anti CPY antiserum IX 100 000
31. CPY v CPY mt qd E CPY CPY 27 Table 2 1 Descriptions of derived proteins of each signal peptide contained expression vectors Information of each protein was cited by Saccharomyces Genome Database http www yeastgenome org Signal peptides Derived proteins Amount of amino acid residue MFa2 Mating pheromone alpha factor made by alpha cells 89 Peptidyl prolyl cis trans isomerase cyclophilin CPR5 50 of the endoplasmic reticulum CWP2 Covalently linked cell wall mannoprotein 71 Protein disulfide isomerase of the endoplasmic EUGI1 50 reticulum lumen PHO89 Nat Pi cotransporter 41 28 Table 2 2 E coli and S cerevisiae strains used in this study Strain E coli JM109 BL21 DE3 S cerevisiae BJ2168 BY4741prc1A Genotype recAl endAl gyrA96 thi 1 hsdR1I7re mx e14 merA sup 44 7e74 7 AUac proAB F traD
32. fig 1 2 V 3 Cys198 Cys207 Cys262 Cys268 CPY V CPY o B hydrolase lid B 2 48 51 CPY V EK S Si Ss V
33. 14 2 2 2 2 2 2 1 CPY CPY Saccharomyces Genome Database http www yeastgenome org V S cezer7s7ge DNA 39 DNA PCR CPY prel PCR DNA Blend Taq prc1 Left 2 prc1 Right 3 J O Table 2 3 DNA pGEM T Easy Vector pGCWT QuikChange Site Directed Mutagenesis Kit pzc7 3 His Tag pGCHWT DNA pGCHWT DNA
34. Cys RIE Cys Ey 55 CPY Y225A Y225F P315S P315G 4 2 4 2 1 E coli JM109 S cerevisiae BY4741prciA Thermo Fisher Scientific Table 2 2 pGEM T Easy Vector Promega QuikChange Site Directed Mutagenesis Kit Agilent Technologies Blend Taq O Taq DNA Polymerase New England Biolabs Roche TOYOPEARL Butyl 650M Quick Start Bradford Protein Assay Kit Bio Rad N benzoyl L tyrosine p nitroanilide BTpNA
35. 15 co Bhydrolase fold family 1I CPWTII Geotrichum candidum 13 15 CPY 4 Asn13 Asn87 Asn168 Asn368 N CPY SrA gt 1 pug FAR 1 3 CPY CPY 21 Asp338 12 22 24 ik E Asn51 Glu145 25 Pi 192
36. V 2 Cys217 Cys240 Cys224 Cys233 V 2 aq disulfide zipper 12 2 V 46 CPY V 40 E amp Cys193 Cys207 Cys262 Cys268 Cys RHF Ala 3 2 3 2 1 E coli JM109 S cerevisiae BY4741pze7A Therm
37. CPY PDB ID 1YSC V CB 2 I 6 A 4 2 2 2 Cys 4 2 2 1 Tyr225 Pro315 Gln224 Lys314 2 Cys CPY pLTCV5HGWT Table 4 1 QuikChange Site Directed Mutagenesis kit TDNA Y225C P815C Y225C P315C Q224C K314C Q224C K814C DNA DNA BY4741pzc7A MAL SD ura 57 p
38. ak Ss Ss Fig 4 1 36 V V V 54 V Cys Discovery Studioe 2 5 5 EE Pro315 Tyr225 Gln224 Lys314 2 Cys Y225C P315C Y225C P315C Q224C K314C Q224C K314C
39. 86 2011 4 th nn H 85 10 Mai Makino Takehiko Sahara Y 2012 12 Naoki Morita CPY V 2012 KA 2012 9 Y V 2012 2012 9 9 Hiroshi Ueno Amino acid substitution reveals the role of V shape helix on substrate specificity of yeast carboxypeptidase Y The 27th Annual Symposium of The Protein Society Boston MS USA July 2013 1
40. 225 Tyr P8158 P315G P815C Cys TEx 4 3 5 P3158 P315G P3158 P315G Z Phe Leu OH BTPNA P3159 WT P315G Table 4 3 Pro315 P315G 4 3 6 P315G 4 83 5 P315G
41. horseradish peroxidase conjugated anti rabbit IgG secondary antibody GE Healthcare ImmunoStar LD 4 2 2 6 E UNIES PPY 10 mM sodium phosphate buffer pH 7 0 8 5ng 1mM Z Phe Leu OH 5 60 PCA 4 Fluoro 7 nitro 2 1 3 benzoxadiazole N BDF amp 60 C 1 LaChromUltra U HPLC system H 59 Z Phe Leu OH L Leu H Ly Ci WM L hint BTPNA 21 41 0 1 M sodium phosphate buffer pH
42. 60 ROSE 61 4 3 1 61 4 3 2 Cys i 61 4 3 3 Q228C K314C i 62 4 3 4 Tyr225 Pro315 oe 62 4 3 5 P3159 P315G 63 4 3 6 P315G 63 65 De 75 76 et 85 EE E EEEN EA EE EEE RETEST evens Cte RTE te 89 1 Y CPY Saccharomyces cerevieiae C LTRS Re 1 1960 Hayashni 1 1 CPY CPY pre pro Tig 1 1 Pret
43. Sigma Aldrich L benzyloxycarbonyl L phenilalanyl L leucine Z Phe Leu OH benzyloxycarbonyl L phenilalanyl L proline ZZ Phe Pro OH Bachem N acetyl L tyrosine ethyl ester Ac Tyr OEt DN 56 4 2 2 4 2 2 1 Accelrys Discovery Studio 2 2 5 V V Cys Discovery Studio 2 5 5
44. y GME D gt 6 FML 10 mM sodium phosphate buffer pH 7 0 W C 4 8 lt 4ng7ml 1mM Z Phe Leu OH 5 60 PCA 4 Fluoro 7 nitro 2 1 3 benzoxadiazole N BDE 60 C 1 LaChromUltra U HPLC system Z UC Z Phe Leu OH L Leu BTpNA Mr 21 41 0 1 M sodium phosphate buffer pH 7 0 10 20 pg ml DMF 0 3 mM BTpNA U 2000A bit 5 A4in TL p nirtoaniline CPY 3 2 2 5
45. 1 mg CPY Table 2 4 V F BR ZK PERE A 1E q 1lLAyY NVORRD CPY PrA PrB CPY 23 ia pLTCV5HGWT CPY BY4741pzc7A AL CPY 20 90 pH5 0 TOYOPEARL Butyl 650M 50 C 10 61 kDa CPY Tig 2 6 BTpNA 100
46. Table 2 5 2 3 3 CPY i CPY BJ2168 Western blotting MFa2 CPR5 EUG1 PHO89 CPW2 Fig 2 7 Cwp2p GPI 42 44 CPY 24 25 2 4
47. 0 67 Yeast Nitrogen Base without Amino Acids 2 glucose 2 agar 30 pg ml L leucine 20 pg ml histidine monohydrochloride monohydrate 30 pg ml adenine hemisulfate dehydrate 20 pg ml L methionine 20 BJa2CV5HWT BJCPRCV5HWT BJCWPCV5HWT BJEUGCV5HWT BJPHOCV5HWT YPD 2 polypeptone 1 yeast extract 2 glucose OD6oo gt l 3 TT 28 C Zo 0 5 M NaCl 20 C CBR ARH n 50 mM sodium phosphate buffer 300 mM NaCl pH7 0 IC RAs t 0 5 mm 30 1 4 2 2 2 8 bovine serum albumin Quick Start Bradford Protein Assay Kit I 2 2 2 9 SDS PAGE Western
48. WT Table 3 3 Cys Ala WT 47 3 4 TW FERS OSA LS TO gi CPY Cys193 Cys207 Cys262 Cys268 V Cys Ala CBR WT
49. Agilent Technologies Blend Taq Taq DNA Polymerase New England Biolabs T4 DNA ligase Roche TALON Metal Affinity Resin TOYOPEARL Butyl 650M Quick Start Bradford Protein Assay Kit Bio Rad N benzoyl L tyrosine p nitroanilide BTpNA Sigma Aldrich Table 2 3
50. toward Z Phe Leu OH and BTpNA CPY Z Phe Leu OH2 BT pNAb gt WT 100 100 C262A 8 5 1 8 C268A 16 1 9 a Enzyme reaction was performed with 1 mM Z Phe Leu OH at pH 7 0 at room temperature and the amount of released L Leu was detected by U HPLC b Enzyme reaction was performed with 0 8 mM BTpNA at pH 7 0 at room temperature and A410 was monitored spectrophotometrically 52 Table 3 3 The potential energy van der Waals energy and electrostatic energy of wild type and mutant CPYs PDB model of WT PDB ID 1YSC was optimized using Minimization protocol with CHARMm force field Conformation of each mutant was constructed based on the minimized WT model and was optimized Each energy parameter was calculated based on CHARMm force field Potential energy kcal mol van der Waals energy kcal mol Electrostatic energy kcal mol Value Difference Value Difference Value Difference WT 28483 8 2838 3 29477 5 C193A 27967 0 516 8 2812 4 25 9 29056 83 421 2 C207A 27982 0 501 8 2821 3 17 0 29053 3 424 2 C262A 27976 5 507 3 2818 8 19 5 29052 1 425 4 C268A 28001 3 482 5 2824 6 13 7 29066 4 441 1 53 BAR V 4 1 VERAVyrZ AME ORT ERDE a m
51. ul REE DOVE F B BeRIETOMIZTOW THAD Translation pre pro CPY 20 dh Vac osome Activation p2 CPY gt m CPY PrA PrB Processing P a folding 21 glycosylation Glycosylation Fig 1 1 Schematic diagram of maturation steps of CPY in yeast Fig 1 2 Three dimensional structure of mature CPY determined by X ray crystallography PDB ID 1YSC 12 V shape helix Ser204 Thr251 is colored in green The catalytic triad Ser146 His397 and Asp338 are shown in red stick Disulfide bonds are shown in orange thick stick 11 A B C CPY PPCA CPWII Fig 1 3 Comparison of three serine carboxypeptidases which belong to the a 6 hydrolase fold family Each structure was taken from Protein Data Bank PDB Proteins are displayed in schematic flat ribbon colored based on secondary structure V shape helix region is circled in green CPY s V shape helix consists of larger two helices than the other proteins V shape helices of PPCA and CPWII are positioned upward while that of CPY hang down A CPY 1YSC 12 B PPCA 1IVY 37 C CPWII 3SC2 13 12 2 Y CPY CPY
52. Healthcare ImmunoStar LD yA VY ECL Mini camera GE Healthcare 2 2 2 10 CPY BTpNA 21 41 0 1 M sodium phosphate buffer pH 7 0 DMF BTpNA U 2000A 5 Ano Lo p nirtoaniline CPY 22 2 3 1 CPY CPY prel pColdCHWT BL21 DE8 SDS PAGE 8M CARI
53. Pro OH koat 5 1 Km mM Keat Km mM s kcat s 1 Km mM Keat Km mM 1 s 1 WT 151 0 067 0 011 230421 0 54 40 11 0 12 0 08 6 9 3 8 P315G 2 0 0 5 0 019 0 005 100 2 0 21 0 07 0 27 0 23 2 01 5 B CPY BTpNA koat s 1 Km mM Kcat Km mM 1 s 1 WT 0 5740 04 0 038 0 002 15 0 P315G 0 40 0 05 0 031 40 004 13 2 C CPY Ac Tyr OEt koat 5 1 Km mM kcat Km mM 1 s1 WT 160 33 1 8 0 2 90 8 P315G 7 8 5 7 0 89 40 35 36417 74 5 CPY a B hydrolase fold VF hydrolase T CPY PPCA CPWII CPY V 2 wuw
54. S J and Breddam K 1994 Site directed mutagenesis on serine carboxypeptidase Y A hydrogen bond network stabilizes the transition state by interaction with the C terminal carboxylate group of the substrate Biochemistry 33 508 517 26 S rensen S B Raaschou Nielsen M Mortensen U H Remington S J and Breddam K 1995 Site directed mutagenesis on serine carboxypeptidase Y from yeast The significance of Thr60 and Met398 in hydrolysis and aminolysis reactions J Am Chem Soc 117 5944 5950 27 Breddam K and Kanstrup A 1987 Cyanylation of the single 79 sulfhydryl group in carboxypeptidase Y with cyanogen bromide Carlsberg Res Commun 52 65 71 28 Olesen K Mortensen H Aasmul Olsen S Kielland Brandt M C Remington S J and Breddam K 1994 The activity of carboxypeptidase Y toward substrates with basic P amino acid residues is drastically increased by mutational replacement of leucine 178 Biochemistry 33 11121 11126 29 Olesen K and Kielland Brandt M C 1993 Altering substrate preference of carboxypeptidase Y by a novel strategy of mutagenesis eliminating wild type background Protein Eng 6 409 415 30 Olesen K and Breddam K 1995 Increase of the P Lys Leu substrate preference of carboxypeptidase Y by rational design based on known primary and tertiary structures of serine carboxypeptidases Biochemistry 34 15689 15699 31 Bai Y and Hayashi R 1979 Propertie
55. Western blotting Ne 43 SSL 43 3 2 2 5 44 ee 46 3 3 1 Cys Ala 46 3 3 2 C262A C268A 46 3 8 8 PARAON EAE E origi Do E ni 47 Bd ER CA E 48 BAR V J ap Pala Pre Relat rae Pay Mra SB Sd Bs Be aS BS Bed ald tO as Saad I 54 LEN DONE 5 1 DMRS RMR ROOT TR ET nS RE I ETO TSR a RE 54 4 2 56 OAS ERSA A tase coats michaels ts asec E tlc ents aames teamed ohnte 56 Me MNO 2 CO 57 4 2 2 1 wo 57 ADD AO ys ET AE SIOE acs th ea 1 57 4 2 2 3 Tyr225 Pro315 Lil 58 2 59 4 2 2 5 SDS PAGE Western blotting Ne 59 AO OG eel ee ee ela de 59 4 2 2 7 P315G
56. and Kielland Brandt M C 1991 Yeast carboxypeptidase Y requires glycosylation for efficient intracellular transport but not for vacuolar sorting in vivo stability or activity Fur J Biochem 197 681 689 10 Kakinuma Y Ohsumi Y and Anraku Y 1981 Properties of H translocating adenosine triphosphatase in vacuolar membranes of Saccharomyces cerevisiae J Biol Chem 256 10859 10863 11 S rensen S O van den Hazel H B Kielland Brandt M C and Winther J R 1994 pH dependent processing of yeast procarboxypeptidase Y by proteinase A in vivo and in vitro Eur J Biochem 220 19 27 12 Endrizzi J A Breddam K and Remington S J 1994 2 8 A structure of yeast serine carboxypeptidase Biochemistry 38 11106 11120 13 Liao D I Breddam K Sweet R M Bullock T and Remington S J 1992 Refined atomic model of wheat serine 77 carboxypeptidase II at 2 2 A resolution Biochemistry 31 9796 9812 14 Ollis D L Cheah E Cygler M Dijkstra B Frolow F Franken S M Harel M Remington S J Silman I Schrag J and et al 1992 The a B hydrolase fold Protein Eng 5 197 211 15 Liao D I and Remington S J 1990 Structure of wheat serine carboxypeptidase II at 3 5 A resolution A new class of serine proteinase J Biol Chem 265 6528 6531 16 Shimizu H Ueno H and Hayashi R 1999 Role of carbohydrate moiety in carboxypeptidase Y structural study of mutant en
57. blotting CPY SDS PAGE Western blotting SDS 0 1 10 SDS PAGE 0 1 w v CBB R 250 CBB Western blotting SDS PAGE Trans Blot SD Semi Dry Electrophoretic Transfer Cell Bio Rad CAPS buffer pH 11 PVDF 1 A 21 BL21 DE3 BJ2168 Anti His C term HRP antibody Invitrogen 10 000 BY4741prc7A 10 000 Anti CPY antiserum 100 000 horseradish peroxidase conjugated anti rabbit IgG secondary antibody GE
58. carboxypeptidase Y Journal of Biological Macromolecules in press Mai Makino Takehiko Sahara Naoki Morita Hiroshi Ueno Expression of carboxypeptidase Y with various signal peptide in yeast Manuscript in preparation Mai Makino Takehiko Sahara Naoki Morita Hiroshi Ueno Effect of disruption of hinge disulfide bonds on function of carboxypeptidase Y Manuscript in preparation 86 9 508 514 2012 85 Y 83 he RE CPY VA Ph RT Y 2008 E
59. 00 buffer Q buffer 8M urea 16 10 mM B mercaptoethanol buffer 9 1 HOA TALON Metal Affinity Resin His tag 1 ml 10 buffer 50 mM sodium phosphate buffer 300 mM NaCl 8 M urea 10 mM B mercaptoethanol pH 7 0 buffer 5 buffer 30 mM imidazole buffer 5 2 2 2 4 2 2 2 2 pColdCHWT PCR prc Smal Xhol
60. 1 PN KS GABA GAD ERED 13 2013 9 12 CPY V H W 2013 4 86 87 5 9 gt Fe RYE GAD65 2013 KR 2013 10 Ni 14 os NY CPY 1lid FEEKS KR 2013 10H H gt 2013 HERE IV 1 22 12 H 2 24 6
61. 2 pColdCHWT E coli BL21 DE3 100 tg7ml LB 1 polypeptone 0 5 yeast extract 1 NaCl 2 agar PCR SS BLCHWT BLCHWT 200 pg ml LB 37 C CHREIHBEL ODe600 0 4 0 6 0 5 mM IPTG 15 C 14 Ss buffer 50 mM sodium phosphate buffer 300 mM NaCl pH 7 0 Bioruptor 30 60 1 10 bat 0 5 TritonX 1
62. 36 proAB lac I1 lacZAM15 F ompT hsdSslrg mp gal Acl 857 indl Sam7 nin5 lacUV5 T7genel dcm DE3 MATa prb1 1122 prc1 407 pep4 8 ura8 52 leu2 trpl MATa his3A1 leu2A0 met15A0 ura3A0 prc1A kanMX4 29 Sourse Takara Bio Novagen NBRP Thermo Fisher Scientific Table 2 3 Oligonucleotide primers using for preparation of prcl fragment construction of each plasmid vectors of wild type CPY and insertion of His tag encoding fragment Primers Sequences prc1 Left 2 58 TTCTTTTCGTCTTCCCTCCT 3 prc1 Right 3 5 CGTATATATTTCGATCGTAGCTGAT 3 5 CCACGGTGGTTTCTCCTTACATCATCATC prcel1 HistagQC4 F ATCATCATTAAAGCGTGTATGTGTAGGC 3 5 GCCTACACATACACGCTTTAATGATGATG prc1 HistagQC4 K ATGATGATGTAAGGAGAAACCACCGTGG 3 Sacl prc1 5 TACGACGAGCTCATGAAAGCATTC 3 prc1 HindIIT K 5 GCAGACCAAGCTTTTAATGATGATG 3 Smal prc1 5 ACACCCGGGATGAAAGCATTC 3 prc1 Xhol R 5 ACGCTCGAGTAAGGAGAAACC 3 Smal prc1 sp F 5 CACCCGGGATCTCATTGCAAAG 3 Primer pair prc1 Left 2 and prcl Right 3 was used for amplifying prcl fragment His tag encoding fragment was inserted into the 3 termini of prcl by site directed mutagenesis using prcl HistagQC4 F and prc1 HistagQC4 R primers His tag region is shown with a gray background Primer pair Sacl prc1 F and prc1 HindIIT R was used for introduction of restriction sites to the 5 and 3 termini of prci Histag fragment Sacl restriction site and HindIII restri
63. 7 0 10 20 pg ml DMF 0 3 mM BTpNA U 2000A Y Th 5 A40 p nirtoaniline 4 2 2 7 P315G P315G A CPY Hey Le Tess E 19 21 SZF Z Phe Leu OH Z Phe Pro OH 50 mM sodium phosphate buffer pH 7 0 LaChromUltra U HPLC system H Leu Pro BTpNA pH 7 0 pnitroaniline
64. 8SD ura SS YPD in c ODeoo gt 1 0 28 C 0 5 M NaCl L 20 C 3 0 2 ml g wet cell 0 4 ml g wet cell Q pH 7 0 16 20 90 3 ml g ppt 50 mM sodium acetate buffer pH 5 0 pH 5 0 18 pro CPY MA SUK 5 10 mM sodium phosphate buffer 2 M ammonium 42 sulfate pH 7 0 buffer TOYOPEARL Butyl 650M 1 5x5cm 10 mM sodium phosphate buffer 0 1 M ammonium sulfate pH 7 00 10 mM sodium phosphate buffer pH 7 0 CPY centricon
65. A Smal Xhol predl Ultrafree DA DNA pF pLTex321so2V5H pLTex321sCPR5V5H pLTex321sCWP2V5H pLTex321sEUGIV5H pLTex321sPHO89V5H T4DNALigase pLTa2CV5HWT pLTCPRCV5HWT pLTCWPCV5HWT pLTEUGCV5HWT pLTPHOCV5HWT Fig 2 3 DNA TF RE PRS SH OAS h DNA 2 2 2 7 CPY OF 2H x 2 2 2 6 BJ2168 SD ura
66. DNA SmaI prc1 F prc1 Xhol R Table 2 2 PCR pGEM T Easy Vector pGCHWT3 pGCHWT3 Smal Xhol xY prel Ultrafree DA DNA pLTex3821sV5H T4DNALigase pLTCV5HGWT Fig 2 2 17 2 2 2 5 CPY 2 2 2 4 pLTCV5HGWT BJ2168 BY4741pzc7A 40 SD ura 0 67 Yeast Nitrogen Base without Amino Acids 2 glucose 2 agar 380 pg ml L leucine 20 pg ml histidine monohydrochloride monohydr
67. E 1991 B breakers an aperiodic 83 secondary structure J Mol Biol 221 603 613 57 Prajapati R S Das M Sreeramulu S Sirajuddin M Srinivasan S Krishnamurthy V Ranjani R Ramakrishnan C and Varadarajan R 2007 Thermodynamic effects of proline introduction on protein stability Proteins 66 480 491 58 Tian J Wang P Gao S Chu X Wu N and Fan Y 2010 Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp M231 by rational engineering of a glycine to proline mutation FEBS J 277 4901 4908 59 Yasukawa K and Inouye K 2007 Improving the activity and stability of thermolysin by site directed mutagenesis Biochim Biophys Acta 1774 1281 1288 60 Barbe S Lafaquiere V Guieysse D Monsan P Remaud Simeon M and Andre I 2009 Insights into lid movements of Burkholderia cepacia lipase inferred from molecular dynamics simulations Proteins 77 509 523 61 Abdul Rahman M Z Salleh A B Abdul Rahman R N Abdul Rahman M B Basri M and Leow T C 2012 Unlocking the mystery behind the activation phenomenon of T1 lipase a molecular dynamics simulations approach Protein Sci 21 1210 1221 84 KE Mai Makino Takehiko Sahara Naoki Morita Hiroshi Ueno Amino acid substitution reveals the role of V shape helix on construction of yeast
68. EAL i Gea UL E k 7 ea buffer IC 30 mMimidazole buffer 5 5 10 Ny mM sodium phosphate buffer 2 M ammonium sulfate pH 7 0 18 buffer TOYOPEARL Butyl 650M 1 5 x 5 cm 10 mM sodium phosphate buffer 0 1 M ammonium sulfate pH 7 00 10 mM sodium phosphate buffer pH 7 0 pro CPY BY4741pzrc7ACV5HGWT CPY H H dn F 21 0 2 ml g wet cell 0 4 ml g wet cell QKICMMS 1 pH 7 0 16 RRR SERA OA CRA SUK 20 90 3 ml g ppt 50 mM sodium Hf acetate buffer pH 5 0 pH5 0 tr 18 pro CPY 5 10 mM sodium phosphate b
69. Nara Women s University Digital Information Repository Title Saccharomyces cerevisiae HH YOVOOO HHHHHHHHH Author s 00 0 Citation Taa ae eee OO 357 0 Issue Date 2014 03 24 Description URL http hdl handleney10935 3603 Textversion ETD This document is downloaded at 2015 11 06T04 16 29Z http nwudir lib nara w ac jp dspace Saccharomyces cerevisiae Y V 2014 BE UG Res am e Re cc en eC aT DT 5 CO 5 1 2 CPY OO 6 1 3 CPY 7 dN ES A re err TT Ce tren eRe Re ree eet 8 5 8 2 Y CPY cccccccccccccceseeeeees 13 IIR Em 13 2 2 ae AA ASP NCC ee I oa daha caida cuts aude oes Tete utente lace te AN ete cle 14 2 14 DDO SND AEN E A E A E NEA E NE T 15 2 2 2 1 CPY kkk 15 2 2 2 2 kk 15 2 2 2 3 CPY kk 16 2 2 2 4
70. PAGE sample buffer and boiled The supernatant was analyzed by Western blotting Auto lysate of cells expressing mutants was fractionated by ammonium sulfate and was subjected to TOYOPEARL Butyl 650M column The each eluate was analyzed by Western blotting Rabbit polyclonal anti CPY antiserum 1 10 000 and horseradish peroxidase conjugated anti rabbit IgG secondary antibody 1 100 000 were used in Western blotting A B Lane 1 WT lane 2 Y225A lane 3 Y225F lane 4 P315S lane 5 P315G 72 Table 4 3 Relative specific activities of WT and soluble Pro315 replaced mutants P315S and P315G toward Z Phe Leu OH and BTpNA CPY Z Phe Leu OHa BT pNA gt WT 100 100 P3158 51 61 P315G 55 170 The activities of recombinant WT for each substrate were set as 100 active a Enzyme reaction was performed with 1 mM Z Phe Leu OH at pH 7 0 at room temperature and the amount of released L Leu was detected by U HPLC b Enzyme reaction was performed with 0 8 mM BTpNA at pH 7 0 at room temperature and A410 was monitored spectrophotometrically 73 Table 4 4 Kinetic parameters of recombinant wild type CPY and P315G in the hydrolysis of the dipeptide substrates A anilide substrate B and ester substrate C at room temperature Each parameter is expressed as mean 4 E SD calculated from the data of multiple experiments A CPY Z Phe Leu OH Z Phe
71. YM 10 2 50 C 10 3 2 2 2 bovine serum albumin Quick Start Bradford Protein Assay Kit J 3 2 2 8 SDS PAGE Western blotting CPY SDS PAGE Western blotting 2 2 2 9 10 000 Anti CPY antiserum kK 100 000 horseradish peroxidase conjugated anti rabbit IgG secondary antibody Invitrogen s RAK Ik ImmunoStar LD 3 2 2 4 Fil CPY LE Z Phe Leu OH a 43 ny T
72. ate 30 pg ml adenine hemisulfate dehydrate 20 pg ml L methionine BJ2168CV5HGWT BY4741prc1ACV5HGWT YPD cays cf TW 2 polypeptone 1 yeast extract 2 glucose ODeoo gt 1 3 28 C Zo 05M NaCl RIL 20 C CRA BJ2168CV5HGWT 50 mM sodium phosphate buffer 300 mM NaCl pH7 0 0 5 mm 830 1 4 RO 40 70 lt AS 3 ml g ppt 50 mM sodium phosphate buffer 300 mM NaCl pH 7 0 ICUReBIRBSt His tag 1 ml 10 buffer 50 mM sodium phosphate buffer 300 mM NaCl pH 7 00 buffer CS DI 5 HRRLE FX VAT BBR
73. ction site are underlined Primer pair Smal prc1 F and pre1 XhoI R was used for introduction of restriction sites to the 5 and 3 termini of prcl fragment Smal restriction site and Xhol restriction site are underlined Smal prc1 sp F and prc1 Xhol R primers were used for introduction of restriction sites to the 5 and 3 termini of signal peptide region deleted prcl fragment Smal restriction site and Xhol restriction site are underlined 30 Amp PRCI ColE1 ori Sacl His tag TEE cs 4 5 UTR lac operator cspA lac I promoter Fig 2 1 Schematic diagram of the constructed plasmid vector pColdCHWT 31 2 micron ori CYC1 terminator URA3 V5 H tag Xhol Amp PRCI pUC ori HSP12 Smal promoter Fig 2 2 Schematic diagram of the constructed plasmid vector pLTCV5HGWT 32 2 micron ori URA3 signal peptide d Amp Smal HSP12 promoter Signal peptide Fig 2 3 Schematic diagram of the constructed plasmid vector of signal peptide replaced wild type CPY Each signal peptide fragment is inserted downstream of HSP12 promoter region in each template vector Original signal peptide deleted prcl fragment was introduced downstream of each signal peptide region 33 A B 31 0 Fig 2 4 SDS PAGE A and Western blotting B of recombinant full length wild type CPY at purification steps E coli cells in which recombinant full length WT is expressed we
74. evens T Esmon B and Schekman R 1982 Early stages in the yeast secretory pathway are required for transport of carboxypeptidase Y to the vacuole Cell 30 439 448 3 Kaiser C A Gimeno R E and Shaywitz D A 1997 Protein secretion membrane biogenesis and endocytosis in The molecular and cellular biology of the yeast Saccharomyces cell cycle and cell biology Pringle J R Broach J R and Jones E W eds Cold Spring Harbor Laboratory Press Plainview NY pp 91 227 4 Holst B Bruun A W Kielland Brandt M C and Winther J R 1996 Competition between folding and glycosylation in the endoplasmic reticulum EMBO J 15 3538 3546 5 Ramos C Winther J R and Kielland Brandt M C 1994 Requirement of the propeptide for in vivo formation of active yeast carboxypeptidase Y J Biol Chem 269 7006 7012 6 Winther J R and S rensen P 1991 Propeptide of carboxypeptidase Y provides a chaperone like function as well as inhibition of the enzymatic activity Proc Natl Acad Sci USA 88 76 9330 9334 7 Ballou L Hernandez L M Alvarado E and Ballou C E 1990 Revision of the oligosaccharide structures of yeast carboxypeptidase Y Proc Natl Acad Sci USA 87 3368 3372 8 Valls L A Winther J R and Stevens T H 1990 Yeast carboxypeptidase Y vacuolar targeting signal is defined by four propeptide amino acids J Cell Biol 111 361 368 9 Winther J R Stevens T H
75. ls YPD ODeoo gt 1 28 C CHE DIRFBL 0 5 M NaCl 20 2C 83 L 0 2ml gwetcell 0 4ml gwetcell Q MA pH 7 0 16 ROL 20 90 SN At 3 ml g ppt 50 mM sodium acetate buffer pH 5 0 CHR amp BRES pH 5 0 18 pro CPY 5 10 mM sodium phosphate buffer 2 M ammonium sulfate pH 7 0 buffer TOYOPEARL Butyl 650M 1 5x 5cm 10 mM sodium phosphate buffer 0 1 M ammonium sulfate pH 7 00 10 mM sodium phosphate buffer pH 7 00 CPY centriconYM 10 2 50 C 10
76. n of the disulfide zipper Biosci Biotechnol Biochem 66 1393 1395 47 Momany F A and Rone R 1992 Validation of the general purpose QUANTA 38 2 CHARMm force field J Comput Chem 138 888 900 82 48 Schrag J D and Cygler M 1997 Lipases and a B hydrolase fold Meth Enzymol 284 85 107 49 Nardini M and Dijkstra B W 1999 a B hydrolase fold enzymes the family keeps growing Curr Opin Struct Biol 9 732 737 50 Brzozowski A M Derewenda U Derewenda Z S Dodson G G Lawson D M Turkenburg J P Bjorkling F Huge Jensen B Patkar S A and Thim L 1991 A model for interfacial activation in lipases from the structure of a fungal lipase inhibitor complex Nature 351 491 494 51 Schrag J D Li Y G Wu S and Cygler M 1991 Ser His Glu triad forms the catalytic site of the lipase from Geotrichum candidum Nature 351 761 764 52 Haber E and Anfinsen C B 1962 Side chain interactions governing the pairing of half cystine residues in ribonuclease J Biol Chem 237 1839 1844 53 Levitt M 1978 Conformational preferences of amino acids in globular proteins Biochemistry 17 4277 4285 54 Chou P Y and Fasman G D 1978 Prediction of the secondary structure of proteins from their amino acid sequence Adv Enzymol Relat Areas Mol Biol 47 45 148 55 Aurora R and Rose G D 1998 Helix capping Protein Sci 7 21 38 56 Colloc h N and Cohen F
77. nal carboxylate group Si and Si subsites those accommodate amino acid side chains of the substrate P and Pi and additional subsites S2 Ss Colored surface of residues that comprise hydrogen bond network and each subsite are shown 67 A B Fig 4 2 Position ofresidues replaced by Cys Two pairs of residues Tyr225 and Pro315 A and Gln228 and Lys314 B were selected for replacement by Cys The distance of CB atoms of Tyr225 and Pro315 was 4 5 A and that of Gln228 and Lys314 was 5 8 A V shape helix was colored in green 68 Table 4 1 Oligonucleotide primers using for construction of plasmid vectors of Cys substituting mutants Y225C P315C Y225C P315C Q228C K314C and Q228C K314C and Tyr225 and Pro315 replaced mutants Y225A Y225F P315S and P315G by site directed mutagenesis method Primers Sequences Y225C F 5 TCGAGTCGTGCTGTGACTCGCAATC 3 P315C F 5 GATTGGATGAAGTGTTACCACACCGC 3 Q228C F 5 GTGCTATGACTCGTGCTCCGTCTGGTCC 3 K314C F 5 GGGTGATTGGATGTGTCCTTACCACACCG 3 Y225A F 5 TCGAGTCGTGCGCTGACTCGCAATC 3 Y225F F 5 TCGAGTCGTGCTTTGACTCGCAATC 3 P315S F 5 GATTGGATGAAGTCTTACCACACCGC 3 P315G F 5 GATTGGATGAAGGGTTACCACACCGC 3 Each primer was used as forward primers for DNA mutagenesis The sequence of each forward primer is only shown Mutation sites are indicated by double underlines 69 A B Fig 4 3 Western blotting of mutant CPYs expressed in yeas
78. o Gly 58 56 Gly A Pro 57 59 Pro315 cf CPY V T V CPY V 66 fo Hydrogen bond Fig 4 1 Substrate binding sites of CPY molecule Substrates are recognized by hydrogen bond network that interacts with the C termi
79. o Fisher Scientific lal Table 3 1 pGEM T Easy Vector Promega QuikChange Site Directed Mutagenesis Kit Agilent Technologies Blend Taq U Taq DNA Polymerase New England Biolabs 3R T4 DNA ligase Roche q TOYOPEARL Buty1 650M Quick Start Bradford Protein Assay Kit Bio Rad BTpNA Sigma Aldrich N benzoyl L tyrosine p nitroanilide t R i ag benzyloxycarbonyl L phenilalanyl L leucine Z Phe Leu OH i Bachem
80. pressed with signal peptide derived from various proteins Yeast cells in which recombinant precursor WT is expressed were disrupted using bead beater and the supernatant was analyzed by Western blotting Anti His C term HRP antibody 1 10 000 Invitrogen was used in Western blotting Lane 1 molecular marker lane 2 WT expressed with original signal peptide lane 3 WT expressed with MFa2 signal peptide lane 4 WT expressed with CPR5 signal peptide lane 5 WT expressed with CWP2 signal peptide lane 6 WT expressed with EUG1 signal peptide lane 7 WT expressed with PHO89 signal peptide 39 3 CPY 3 1 CPY 5 4 V Tig 8 1 12 2 Cys193 Cys207 Cys262 Cys268 V 2 oo V ZK EMT 2
81. re disrupted by sonication and the precipitates were solubilized with 8 M urea for 1h at 25 C Denatured WT was purified by His tag affinity chromatography on TALON Metal Affinity Resin In Western blotting Anti His C term HRP antibody 1 10 000 was used A B Lane 1 molecular marker lane 2 supernatant after sonication lane 3 precipitates after sonication lane 4 the solution after solubilization lane 5 the eluate from TALON Metal Affinity column 34 A B kDa 97 4 66 2 Fig 2 5 SDS PAGE A and Western blotting B of recombinant wild type pro CPY at purification steps Yeast cells in which recombinant pro CPY is expressed were disrupted using bead beater and the supernatant was corrected After ammonium sulfate precipitation pro CPY was purified by His tag affinity chromatography on TALON Metal Affinity Resin and hydrophobic interaction chromatography on TOYOPEARL Buty1 650M In Western blotting Anti His C term HRP antibody 1 10 000 was used A B Lane 1 molecular marker lane 2 the solution after ammonium sulfate precipitation lane 3 the eluate from TALON Metal Affinity column lane 4 the eluate from TOYOPEARL Butyl 650M column 35 Table 2 4 Summary of purification of recombinant wild type pro CPY Because pro CPY is an inactive form the recovery values are calculated based on the amount of total protein Total protein Recovery Steps mg Cell disruption 310 100 Ammoni
82. reen and catalytic triad is shown in red stick 49 Table 3 1 Oligonucleotide primers using for construction of plasmid vectors of mutants C193A C207A C262A and C268A by site directed mutagenesis method Primers Sequences C193A F 5 GAACCAATGGCCGCTGGTGAAGGTG 3 C207A F 5 CCCTCGGAGGAAGCCTCTGCTATGGAA 3 C262A F 5 CAGGAAGGATGCTGAAGGTGGCAA 3 C268A F 5 GGTGGCAATTTGGCCTACCCAACGT 3 prel inside R CYC1Termination ol CCTTCACAATCCTTCCTGATATC 3 ol AGGTTGTCTAACTCCTTCC 3 Each primer was used as the forward primers for mutagenesis of Cys to Ala The sequence of each forward primer is only shown Mutation sites are indicated by double underlines 50 B Fig 3 2 Western blotting of mutants expressed in yeast cells A and activated and purified mature mutants B Yeast cells after inducible cultivation were lysed in SDS PAGE sample buffer and boiled The supernatant was analyzed by Western blotting Cell lysate of yeast expressing mutants was fractionated by ammonium sulfate and was subjected to TOYOPEARL Butyl 650M column The each eluate was analyzed by Western blotting Rabbit polyclonal anti CPY antiserum 1 10 000 and horseradish peroxidase conjugated anti rabbit IgG secondary antibody 1 100 000 were used in Western blotting A B Lane 1 C193A lane 2 C207A lane 3 C262A lane 4 C268A 51 Table 3 2 Relative specific activity of wild type and mutant CPYs
83. s in yeast cells to low temperature J Biol Chem 277 50015 50021 39 Rose M D Winston F and Hieter P 1990 Methods in Yeast Genetics A Laboratory Course Manual Cold Spring Harbor Laboratory Cold Spring Harbor NY 40 Ito H Fukuda Y Murata K and Kimura A 1983 Transformation of intact yeast cells treated with alkali cations J 81 Bacteriol 153 163 168 41 Aibara S Hayashi R and Hata T 1971 Physical and chemical properties of yeast proteinase C Agr Biol Chem 35 658 666 42 van der Vaart J M Caro L H Chapman J W Klis F M and Verrips C T 1995 Identification of three mannoproteins in the cell wall of Saccharomyces cerevisiae J Bacteriol 177 3104 3110 43 Skrzypek M Lester R L and Dickson R C 1997 Suppressor gene analysis reveals an essential role for sphingolipids in transport of glycosylphosphatidylinositol anchored proteins in Saccharomyces cerevisiae J Bacteriol 179 1513 1520 44 Frieman M B and Cormack B P 2003 The o site sequence of glycosylphosphatidylinositol anchored proteins in Saccharomyces cerevisiae can determine distribution between the membrane and the cell wall Mol Microbiol 50 883 896 45 Blobel G 1980 Intracellular protein topogenesis Proc Natl Acad Sci USA 77 1496 1500 46 Maki T Kozawa H Mima J Ueno H and Hayashi R 2002 Increased proteolytic susceptibility of carboxypeptidase Y caused by modificatio
84. s of the single sulfhydryl group of carboxypeptidase Y Effects of alkyl and aromatic mercurials on activities toward various synthetic substrates J Biol Chem 254 8473 8479 32 Breddam K and Svendsen I B 1984 Identification of methionyl and cysteinyl residues in the substrate binding site of carboxypeptidase Y Carlsberg Res Commun 49 639 645 33 Breddam K 1983 Modification of the single sulfhydryl group of carboxypeptidase Y with mercurials Influence on enzyme specificity 80 Carlsberg Res Commun 48 9 19 34 Olesen K Meldal M and Breddam K 1996 Extended subsite characterization of carboxypeptidase Y using substrates based on intramolecularly quenched fluorescence Protein Pept Lett 3 67 74 35 Nakase H Jung G Ueno H Hayashi R and Harada Y 2000 Interaction mode of H397A mutant carboxypeptidase Y with protein substrates analyzed by the surface plasmon resonance Bull Chem Soc Jpn 73 2587 2590 36 Nakase H Murata S Ueno H and Hayashi R 2001 Substrate recognition mechanism of carboxypeptidase Y Biosci Biotechnol Biochem 65 2465 2471 37 Rudenko G Bonten E d Azzo A and Hol W G 1995 Three dimensional structure of the human protective protein structure of the precursor form suggests a complex activation mechanism Structure 3 1249 1259 38 Sahara T Goda T and Ohgiya S 2002 Comprehensive expression analysis of time dependent genetic response
85. t cells A and activated and purified mature mutant CPYs B Yeast cells after inducible cultivation were lysed in SDS PAGE sample buffer and boiled The supernatant was analyzed by Western blotting Cell lysate of yeast in which mutants were expressed was fractionated by ammonium sulfate and was subjected to TOYOPEARL Butyl 650M column The each eluate was analyzed by Western blotting Rabbit polyclonal anti CPY antiserum 1 10 000 and horseradish peroxidase conjugated anti rabbit IgG secondary antibody 1 100 000 were used in Western blotting A B Lane 1 WT lane 2 Y225C lane 3 P315C lane 4 Y225C P315C lane 5 Q228C lane 6 K814C lane 7 Q228C K3814C 70 Table 4 2 Relative specific activity of WT and soluble mutants Q228C K314C toward Z Phe Leu OH and BTpNA CPY Z Phe Leu OHa BT pNA gt WT 100 100 Q228C 57 65 K314C 33 41 The activities of recombinant WT for each substrate were set as 100 active a Enzyme reaction was performed with 1 mM Z Phe Leu OH at pH 7 0 at room temperature and the amount of released L Leu was detected by U HPLC b Enzyme reaction was performed with 0 8 mM BTpNA at pH 7 0 at room temperature and A410 was monitored spectrophotometrically 71 A 1 1 2 3 4 5 B Fig 4 4 Western blotting of Tyr225 replaced mutants and Pro315 replaced mutants expressed in yeast cells A and activated and purified mutants B Yeast cells after inducible cultivation were lysed in SDS
86. uffer 2 M ammonium sulfate pH 7 0 buffer TOYOPEARL Buty1 650M 1 5 x 5 cm 10 mM sodium phosphate buffer 0 1 M ammonium sulfate pH 7 0 10 mM sodium phosphate buffer pH 7 0 CPY centricon YM 10 Millipore 2 50 C 10 22 2 6 CPY CPY DNA PCR 2 2 2 4 pLTCV5HGWT 19 SmalI prcl sp F prc1 Xhol R Smal Xzol PCR pGEM T Easy Vector pGCHWTspA pGCHWTsp
87. um sulfate precipitation 230 74 His tag affinity chromatography 8 7 2 8 Hydrophobic interaction chromatography 1 2 0 39 36 A B kDa 97 4 66 2 45 0 31 0 Fig 2 6 SDS PAGE A and Western blotting B of recombinant wild type CPY at purification steps Yeast cells in which recombinant WT is expressed were lysed by chloroform and the supernatant was treated with ammonium sulfate Pro CPY in the precipitates was activated at pH 5 0 and activated mature CPY was purified by hydrophobic interaction chromatography on TOYOPEARL Butyl 650M and heat treatment as described in the text In Western blotting rabbit polyclonal anti CPY antiserum 1 10 000 and horseradish peroxidase conjugated anti rabbit IgG secondary antibodies 1 100 000 were used A B Lane 1 molecular marker lane 2 the solution after activation lane 3 the eluate from TOYOPEARL Butyl 650M column lane 4 the supernatant after heat treatment 37 Table 2 5 Summary of purification of recombinant wild type CPY Each parameter was calculated based on the anilidase activity toward BTpNA Total protein Total activity Specific activity Recovery een mens mg nmol min nmol min mg EBL IN Activation 70 360 5 1 100 1 Hydrophobic interaction 1 4 430 310 120 61 chromatography Heat treatment 0 64 350 550 97 110 38 kDa 94 6 Pr De gt 2 51 6 1 2 3 4 5 6 7 Fig 2 7 Western blotting of precursor wild type CPY ex
88. zyme lacking carbohydrate moiety Biosci Biotechnol Biochem 63 1045 1050 17 Dumoulin M Ueno H Hayashi R and Balny C 1999 Contribution of the carbohydrate moiety to conformational stability of the carboxypeptidase Y high pressure study Eur J Biochem 262 475 483 18 Hayashi R and Hata T 1972 Action of yeast proteinase C on synthetic peptides and poly a L amino acids Biochim Biophys Acta 2638 673 679 19 Hayashi R Bai Y and Hata T 1975 Kinetic studies of carboxypeptidase Y I Kinetic parameters for the hydrolysis of synthetic substrates J Biochem 77 69 79 20 Bai Y Hayashi R and Hata T 1975 Kinetic studies of carboxypeptidase Y III Action on ester amide and anilide substrates 78 and the effects of some environmental factors J Biochem 78 617 626 Dele Hayashi R 1976 Carboxypeptidase Y Meth Enzymol XLV 568 587 22 Hayashi R Moore 8 and Stein W H 1973 Serine at the active center of yeast carboxypeptidase J Biol Chem 248 83866 8369 23 Hayashi R Bai Y and Hata T 1975 Evidence for an essential histidine in carboxypeptidase Y Reaction with the chloromethyl ketone derivative of benzyloxycarbonyl L phenylalanine J Biol Chem 250 5221 5226 24 Bech L M and Breddam K 1989 Inactivation of carboxypeptidase Y by mutational removal of the putative essential histidyl residue Carlsberg Res Commun 54 165 171 25 Mortensen U H Remington
Download Pdf Manuals
Related Search