特表2008-543274 特許4964151
Contents
1. 100000000000 000 100000000000 100000000000 000 Hod Gakh 0 Cavadini Isaya G Mtochondrial processing peptidases Biochim Biophys Acta 2002 Sep 2 1592 1 63 77 19 2008 543274 2008 12 42. 10 20 30 40 50 6 2008 543274 2008 12 4 10000 000 DOOoO0O0O0000000000000000000000000
3. 0000000000000 0000 0000 00080 non 11111 000 00000000 0 Biermann J van den Bosch H In v processing of the human alkyl di hydroxyacetonephosphate synthase cursor Arch Biochem Biophys 1999 Aug 1 368 1 139 46 CI r3 E Salvesen GS In
4. 23 2008 543274 2008 12 4
5. J RT DD OD LD 0000000000000 Kawai et RIKEN Genome Exploration Research Group Phas e Team and the FANTOM Consortium Functional annotation of full length mouse cDNA collection Nature 2001 Feb 8 409 6821 685 90 Okaz aki Y al FANTOM Consortium RIKEN Genome Exploration Research Go up Phase amp 11 Team Analysis of the mouse transcri ptone based functional annotation of 60 770 full length cDNAs Nature 2002 Dec 5 420 6915 563 73 1 11 11 1111 10 20 30 40 50 qu er y 10 2008 543274 2008 12 4 Gene Entrez human 5 http ww ncbi nl mni h b gene amp cnd Ret ri eve amp dopt Gr aphi cs amp l i st ui ds 219743 Sw ssprot TrEMBL muse Tysndl
6. 10000 LE B 1 11 10 20 30 40 50 14 2008 543274 2008 12 4 111 1 1 1 l Van Veldhoven PP Bau
7. L L3 L3 L3 L3 L3 L3 L3 L3 L L3 L3 L3 L 1 L3 L L3 L3 LJ L L3 L3 L3 L3 L3 LJ L3 L3 D L3 D L3 L3 oana D L3 L3 L3 2008 543274 2008 12 4 22 10 20 30 40 50
8. 2008 543274 2008 12 4 16 10 20 30 40 C 50 1 1 lt lt lt 17 2008 543274 2008 12 4
9. oci ation of non specific lipid transfer protein nsL TP wth fatty d oxidation enzymes peroxisomes EMBO 1998 Dec 15 17 24 7179 89 1 11 1111 1 1 11 1 Mouse Gene Prediction Database Search Results for 1300019N10Ri k XM 125636 1 and top 100 correlated genes http ned utoronto ca profile php nanmeofgene XM 125636 1 0 000000000000 D Mouse Gene Prediction Database Search Results 1300019N10Ri k XM 125636 1 and top 100 correlated genes http ngpd med utoronto ca profil e php nameof gene XM 125636 D B 0 D L3 L3 L3 n
10. B a MS d Keen Ryan Beyer A Mathur S Scheetz Gac e BD Faraci FM Casavant TL Sigmund CD Gene expression profiling of potential target genes in mouse aorta Physiol Genomics 2004 Jun 17 18 1 33 Dyck JR Cheng JF Stanley Barr Chandler Brown S Wallace D Arrhenius Harmon Yang Nadzan Lopaschuk Malonyl coenzyme decarboxylase inhi bition protects the ischemc heart by inhibiting fatty acid oxidation and sti mul ati ng glucose oxidation Circ Res 2004 14 94 9 e78 84 0000 11 1111 1 Lopaschuk Inhibiting fatty acid oxidation as a novel therap eutic approach to treating ischaenc heart dis
11. 1 11 1111 1 11 1111 utt SNR mcg SE E 8 p Tsukanoto Yokota S Fujiki Isolation and characterizatio n of Chinese hamster ovary cell mutants defective in assenbly of pero xi sones J Cell Biol 1990 Mar 110 3 651 600 S Hayashi H H jikata M Ishii N Furuta S Kagamyana H T Com plete nucleotide sequence of cDNA and predicted amno acid sequence of rat acyl CoA oxidase J Biol Chem 1987 Jun 15 262 17 8131 79 000 112111 1 11 1101 010 10 1 10010 11001 1 10101111 S Hashinoto T Ohno K Mura S Fu iki Y Peroxisome targeting signal of rat liver acyl coenzyne oxi das e resides at the carboxy terminus Cell Biol 1989 Jan 9 1 83 91 Wrtz KW Phospholipid transfer proteins revisited Biochem 1997 un 1 324 Pt 2 353 11111 11 11 1 00000000 Seedorf U E llinghaus Roch Nofer Sterol carrier protein 2 Biochim Biophys cta 2000 Jun 26 1486 1 45 54 Otera H Nshinura M Setoguchi K T Fujiki Biogene
12. 40 PORT 50 l 1 1 2008 543274 2008 12 4 3 10 1 1 20 1000
13. 10 20 30 40 50 2008 543274 2008 12 4 28 10 10000000 000000000 009 000 11100 01010100 010 Tb 1 11 11 11 11111 01 11 11 01 11 100000 O AD OO TEO BUSI GE DES 1 1 lg U 1 10000 100000 1 1 1 10000 10 00 41 11 1 1 1 800000009 00 Josep 1 1 1 100000 100000 1 1 1 10000 11 1 0 0 0 UOU0O0000000000000000000000000000000000050 UOU0O00 000 000o00000000000000000000000050 UOU0O00000000 000000000000000000 00000000 DEDE ED EE CLOS 11111 EG CO JV EE 1141 1 1111 10 0 1 aA at 20
14. 722000 H 100000000000 0 0000000000 1000 00 2045 55 03010817 4B063 05 902 RI Qo 455 QUI 099 P Qu2 R5 MO P MB 055 Q6 Qe R2 16 525 G33 A 536 001 002 40084 7 ZA361 7 701 24811 20021 2331 40085 3 EFOl HP KA03 82 4045 ANLL BA DN5 6 2 FAZI 72
15. 30 1 1 40 50 J 2008 543274 2008 12 4 4 1
16. C 10 20 30 40 1 1 1 1111 1111111111 1 T T sukanoto Hata S Yokota S Mura S Fujiki Y Hijikata a S Hashimoto T Amno termnal presequence of the precursor of perox isomal 3 ketoacyl CoA thiolase is a cleavable signal peptide for peroxi somal targeting Biochem Biophys Res Comun 1991 Dec 31 181 3 947 541 Sw nkels BW Gould SJ Bodnar AG Rachubinski Subramani 5 A nov el cleavable peroxisomal targeting signal at the
17. Johansson Borg LA A spectrophotone tric method for determnation of catalase activity in small tissue sam ples Anal Biochem 1988 174 1 33 6 00 UD DDD 00 0 0 0 0 0 0 00 Pennington RJ Biochemistry of dystrophic muscle Mtochondrial succinate tetrazolium reductase and adenosine triphosphatase Biochem J 1961 Sep 80 649 54 101018 OO00000000 Oo0000000000000000 10000000 000 000 0000000 O0 0 SEE ie now E 0 HUD SE z E DDD D D D DO 0000000000000 0000000000 000000 oOoO00 0 00000000
18. 011111 11 Hg m BE oHG Db 0111111111 041 1111 11 11 0000 PALIPSHU POL LPSH VU By Ly Ze 29 2008 543274 2008 12 4 30 2008 543274 2008 12 4 uu Tysndi 0 0 1 0 5 2 pg DNA 2 2 2 2 pcDNA 2 1 9 1 5 0 15 50 1 lt 1 37 31 2008 543274 2008 12 4 0000 Tysndl 0 0 2 0 2 pg DNA SCP2 o 2 2 8 0 1 2 2 pcDNA 4 2 0 2 0 100 75 lt 1 4 SCP2 50 am mAcox1 mSscP2 37 25 kDa 12 345 32 2008 543274 2008 12 4 0000 Tysndl 0 0 0 2 2 pg DNA HA Hsd17b 2 gt pcDNA 4 2 1 8 O 150 gt 100 lt 79 K 15 50 35 lt 35 K 25 15 33 0000 37 25 20 10 kDa 1 90 562 563 568 FLAG 2008 543274 2008 12 4 2008 543274 2008 12 4 34 0000 Z 22 2 9 3 4 27 2 A amp t 7 5 4 Vo 4 4 E RIF E 250 150 100 75 50 37 25 20 15 kDa 12 34 5 6 2008 543274 2008 12 4 35 0000 o vu o 92092145 4 HERH w S 3 lt
19. 10 l 1 1 DU 1 1 1 l 000000 20 30 40 00000 ACCATGGGCTACCCTTACGACGTGCCT GACTACGCCAACCCCGACCTGCGCAAGGAGC 3 50 5
20. Kikuchi M atano N Yokota S Shi nozawa Inanaka Taniguchi H Proteonic lysis of rat liver peroxisome presence of sone speci fic isozyne of Lon protease Biol Chem 2004 Jan 2 279 1 421 80 J 0000000000000 1 11 1111 Tsukanoto Hata S Yokota S Mura S Fujiki Hijik ata Myazawa S Hashimoto Amno terminal presequence of the prec ursor of peroxisomal 3 ketoacyl CoA thiolase is a cleavable signal pept ide for peroxisomal targeting Biochem Biophys Res Commun 1991 Dec 31 181 3 947 54 Sw nkel s BW Gould SJ Bodnar AG Rachubinski Subra mani S A novel cleavable peroxisomal targeting signal at the amno t erm nus of the rat 3 ketoacyl CoA thiolase EMBO 1991 Nov 10 11 325 5 62 Tsukanoto T Hata S Yokota S Mura S Fujiki Y Hijikata M M yazawa S Hashimoto T Characterization of the signal tide at the anino termnus of the rat peroxisomal 3 ketoacyl CoA thiol ase precursor Biol Chem 1994 Feb 25 269 8 6001 10 n h
21. 44 45 10000 Subramani S Koller A Snyder VB Inport of peroxisomal matrix and membrane proteins Annu Rev Biochem 2000 69 399 418 10 20 30 40 50 7 2008 543274 2008 12 4 1111 11 Purdue PE Lazarow PB biogenesis Annu Rev ell Biol 2001 17 703 52 1 1 Olivier Kovacs W Masuda K Keller Krisans SK Identification of peroxisomal targeting signals in cholesterol biosynth enzymes thiolase hng coa synthase MPPD and FPP synthase Lipid Res 2000 Dec 41 12 1921 35 1000000 0 Tsukanoto T Hata S Yokota S Mura S Fujik i Y Hijikata M Myazaw S Hashimoto nal presequence f the precursor of peroxisomal 3 ketoacyl CoA thiolase is cleavable signal peptide for peroxisomal targeting Biochem Biophys Comun 1 991 Dec 31 181 3 947 54 111 Sw BW Gould SJ Bodnar AG Rachubi nski S A novel cleavable peroxisomal targeting signal at the amno te rm nus of the rat 3 ketoacyl CoA thiolase EMBO 1991 Nov 10 11 3255 62 11111 Tsukamoto Hata S Yokota S Mura S Fujiki Hiji kata Myazawa S Hashimoto T Characterization of the sig nal peptide at the terninus of the rat peroxisomal 3 ketoacyl Co A thiolase
22. medium for odi xanol improved density gradie iso osmotic isolation of rat liver peroxisomes 1996 15 237 1 17 23 el and GB Khanna S Gonzalez GA Peroxisonal membrane nonocarboxyl ate transport redox shuttle systen Biochem Biophys Comun 25 304 1 130 50 Antonenkov VD Sormunen RT Hiltunen JK T peroxisomes in vitro mammalian peroxisomes are osnotica Am Physiol Cell Physiol 2004 287 6 C16 jiundguudguuiuldudguuiuliuilublilu 10 20 30 40 50 15 2008 543274 2008 12 4 10000001600 0000000060680 1000000 100060
23. 1000000000000 000 0 0 Wuters FS Bastiaens Wrtz KW Jo vin TM FRET nicroscopy demonstrates molecular association of non specif ic lipid transfer protein nsL TP wth fatty acid oxidation enzymes n peroxisomes EMBO 1998 Dec 15 17 24 7179 89 1 DU 1 111111 1 0 0 Wuters FS Bastiaens PI Wrtz KW Jovin TM FRET mcrosco py demonstrates molecular association of non specific lipid transfer pro tein nsL TP wth fatty acid oxidation enzymes peroxisomes EMBO 1998 Dec 15 17 24 7179 89 10 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 00 IO0OO0OO0O000000000000000000000000000pB000000050 111 1 1 1 1 H Wouters FS Bastia ens PI Mrtz KW Jovin TM FRET nicroscopy demonstrates molecular 855
24. Cal S uesada V Lopez Otin Polyserase a human polyprotease w th the ability to generate independent serine protease domains from a single translation product Proc Natl Acad Sci 5 A 2003 Aug 5 100 16 9185 900 5 Qu esada V Llamazares M Diaz Perales Garabaya Lopez Otin Human pol 2 a novel enzyme wth three tandem serine protease domain s in a single polypeptide chain Biol Chem 2005 Jan 21 280 3 1953 00000000 Sandy P Ventura A Jacks RNAi a practical guide i ot echni ques 2005 Aug 39 2 215 24 10 30 40 50 24 2008 543274 2008 12 4
25. E odjo r3 2 12 222 2 E3 E EIE E U0O0O00000000000000000000000000000000000D0X UOU0O00000000000000 000000000000000000000 100000 Tysndl Tysndl 39 2008 543274 2008 12 4 1 111111 1 1 1 1 1 IU U D um 1 1 40 2008 543274 2008 12 4 INTERNATIONAL SEARCH REPORT International application No PCT JP2006 312085 A CLASSIFICATION OF SUBJECT MATTER INV A61K38 00 07 16 40 G01N33 68 According to Intemational Patent Classification IPC or to both national classification and IPC B FIELDS
26. Raychaudhury 5 Datta 5 Peroxisomal function is altered during leishmania infection Med Sc Monit 2003 Apr 9 4 BR125 9 0000 n 1 DI oana L3 oana a O oana Uu D 000 27 JP 2008 543274 2008 B B
27. involve an inventive step when the document 15 taken alone s citad to establish the publication dale of another document of particular relevance the clalmad invention citation or other spacial reason as specified cannot be considered to involve an inventive step when the 0 document referring to an oral disclosure use exhibition or document is combined with one or more other such docu other means ments such combination balng obvious to person skilled document published prior to the international filing date but In the later than the priority date clalmed amp document member of the same patant family Date of the actual completion of the Intemational search Date of malling of the International search report 3 November 2006 20 11 2006 Name and mailing address of the ISA Authorized officer European Patent Office 5818 Patentlaan 2 701540 2049 Tx 31 651 epo nl el 31 7 TX 31 651 epo 2 4 Fax 91 10 340 2018 Turri Matteo Form PCTASA 210 second sheet Apri 2005 41 2008 543274 2008 12 4 INTERNATIONAL SEARCH REPORT International application No PCT dP2006 312085 C Continuation DOCUMENTS CONSIDERED TO BE RELEVANT Citation of document with indication where appropriate of the relevant passages Relevant to No BEIER K ET AL SELECTIVE INDUCTION OF PEROXISOMAL ENZYMES BY THE HYPOLIPIDEMIC DRUG BEZAF
28. Enzymes ed Beynon R and Bond JS 110 Oxford Univers ity Press 11 01 25 2008 543274 2008 12 4 11111111 11111111 B Beier K Volkl Hashimoto T F ahim Selective nduction of peroxisomal enzymes by the hypoli pi dem ic drug bezafibrate Detection of modulations by automatic image analys is in conjunction wth microscopy immunoblotti ng Eur Cell Biol 1988 Aug 46 3 383 93 L 1 L3 L3 n n ooo n
29. 111 00 Subramani 5 Koller A Snyder VB Inport of peroxisonal matrix and menbrane prote ins Annu Rev Biochem 2000 69 399 41810 00 0 0 0 0 0 0 0 0 0 0 00000000000000 00 0000 00 000 00000 000000000 00000000000000 00 0000 00 000000 00000000000 1000000000000 0000 0 0 0 V Subramani S human somal targeting signal receptor 5 is translocated into the peroxisomal matrix and recycled to the cytosol Cell 2001 Apr 20 10 5 2 187 960 0 00 0000000000 00000000 Og 1 0000000000 Nair DM Purdue Lazarow 7 transloca tes in out of peroxisones in Saccharonyces cerevisiae Cell Bio I 2004 Nov 22 167 4 599 604
30. 2008 543274 2008 12 4 19 PT RRA 1 2008 543274 P2008 543274A 43 220412545 2008 12 4 61 Int Cl 120 2006 01 C12Q 1 37 ZNA 20045 120 1 02 2006 01 C12Q 1 02 4B063 A61K 45 00 2006 01 6 1 45 00 4C084 AG1K 39 395 2006 01 AGIK 39 395 D 4C085 A61P 9 10 2006 01 A61K 39 395 N 4HO45 RAR CH 438 21 HERE 882007 555819 P2007 555819 71 HARA 503359821 86 22 18 6 9 2006 6 9 85 20 2 6 2008 2 6 ME 1236 2 B14 86 BRE 2006 312085 71 504013775 87 w02006 132445 FREA AS 87 8 2 14 2006 12 14 MERA RES 85249438 81 RABERBS 8 005 169380 P2005 169380 1 HBA 100107515 32 17 6 9 2005 6 9 jf EL 33 OP TAREA 100107733 FHL RA 100115347 Ft X T lt 54 07 CRS UET 2 7 0 OO RRRA 57 0 000 I0000000000000000000
31. huma g TYS i bi n sprot search de TYSNDI 10 20 30 40 50 2008 543274 2008 12 4 11
32. 10 20 30 40 50 5 2008 543274 2008 12 4
33. 5 5 18 16 13 ER 160 100 75 50 37 ioo kDa 4 39 4 5 6 8 9 10 11 12 13 14 15 16 17 18 19 20 1 36 2008 543274 2008 12 4 0000 Scp2 1 EK ae 1315 0 12 78K 62K 28 16 37 2008 543274 2008 12 4 o gl SIAT Do cd w E SS SATA PINNA 115 1 mAcaal 12 3 4 5 6 7 8 9 10 11 12 13 14 RISER 1 1 2008 543274 2008 12 4 38 00000 qum gt I I R LM PM PN UOU0O0000000000000000000000000000000000050 UOUO0O0O0000000000000000000000 51 51 51 51 n DI 2 E EIC 2 2 lt 222 DO m aaa a aaa EX
34. 543274 2008 12 4 1000000000 51 1 4 1000000000 0000 30 2006 01 0000 9210 05000 30 2006 01 0000 0000 1500 2006 01 3 06 1302 2006 01 15 00 4300 2006 01 13 02 4900 2006 01 43 00 3350 2006 01 4900 0000 375 2006 01 33 50 3353 2006 01 33 15 16 40 2006 01 33 53 0000 1900 2006 01 16 40 19 00 80000 AP KE LS NA SD SL SZ TZ UG M ZW EN AM BY KZ M RJ TJ EP AT BE BG CH CY CZ CK EE ES FI FR GR HJ I E IS I T LT LU LV PL RQ SE 9 SK TR OX BF B MG Q SN TD TG AE AG AMAT BG BWBY EZ CH CN O CR QJ CZ LE DK EM LZ EG EG ES FI MHR HJ ID IL IN IS JP KE KG KM KN KP KR KZ LG LK L R LS LT LU LV LY M M3 M W MZ NG NQ NZ OM PG PH PL PT RQ RU SG SD SE SG SK SL SM SY 1 TN TR TT TZ UA UG S WZ G W YU ZA 72 72
35. CoA hydroxylase PHYH PTS2 receptor PEX7 Hum Mutat 2004 Mar 23 3 209 18 Sacksteder Gould SJ The genetics of peroxisome bi etics and cel Refsum d and the EE enesis Annu Rev Genet 2000 34 623 652 Titorenko Smth JJ Szilard RK Rachubinski Pe he yeast Yarrowa lipolytica is required for the oli gonerizat iolase in the cytosol and for its targeting to the peroxiso Biol 1998 Jul 27 142 2 403 20 Gover JR Andrews DW Rachubinski Saccharonyces ce sonal thiolase is imported as a dimer Proc Natl Acad A 1994 25 91 22 10541 5 Leiper JM PB Danpure CJ Inhibition of alanine x20p of t ion of th ne 1 1 revisiae Sci U 5 100000060 gl yoxyl ate notransferase 1 dimerization is prerequisite for its some to m tochondrion mstargeting in primary hyperoxaluria type 1 Cell Biol 1996 Nov 135 4 939 51 1000000 0 0 Bellion E Goodnan JM Proton ionophores prevent assenb ly of peroxisomal protein Cell 1987 Jan 16 48 1 165 73 1000000 0 0 HR Russell KA Vries Y Cregg JM Peroxi sora targeting inport
36. SEARCHED Minimum documentatlon searched classification system followed by classification symbols K Documentation searched other than minimum documentation to the extent that such documents are included jn the fields searched Electronic data base consulted during the international search name of data base and where practical search terms used EPO Internal BIOSIS Sequence Search C DOCUMENTS CONSIDERED TO BE RELEVANT Catagory Citation of document with indication where appropriate of the relevant passages Relevant to claim No KEEN HENRY L ET AL Gene expression profiling of potential PPARgamma target genes in mouse aorta PHYSIOLOGICAL GENOMICS vol 18 no 1 17 June 2004 2004 06 17 pages 33 42 XP002404515 ISSN 1094 8341 cited in the application table 6 x Further documents are llsted in the continuation of Box C See patent family Special categories of cited ra aas later dna published after ihe one A document defining the general state of the art whichis not Or pro are one application bu considered 10 be of particular relevance E Understand the principle or theory underlying the E earlier document but published on or after the intemational document of particular relevance the claimed Invention filing date cannot be considered or cannot be considered to gt nesciens Which n pount on
37. precursor Biol Chem 1994 Feb 25 269 8 6001 10 Hettena EH Distel B Tabak HF Import of proteins into sones Biochim Biophys Acta 1999 Aug 12 1451 1 17 34 11110111 Titorenko Rachubinski RA The life cycle of the per oxi sone Nat Rev Cell Biol 2001 May 2 5 357 68 1111 Titorenko VI Rachubinski peroxisome orchestratin important developmental decisions from inside the cell J Cell Biol 2004 1 164 5 641 5 Cohen GB Rangan VS Chen Smth S Baltimore D The human thioesterase Il protein binds to a site on 1 Nef criti cal for down regulation Biol Chem 2000 Jul 28 275 30 23097 105 JUD Gavva NR Ven SC Daftari M Yang Yang F eng LP Seto E Davie JR Shen NAPP2 peroxisomal pro tein is also transcriptional corepressor Genom cs 2002 Mar 79 3 42 3 31 1000000 0 0 Van der Klei IJ Veenhuis Yeast peroxisones functi on biogenesis of a versatile cell organelle Trends Mcrobiol 199 7 Dec 5 12 502 9 111 1 Veenhuis Kiel JA Van Der IJ Peroxisome asse mbly in yeast Mcrosc R
38. 0000000000 1111 1 0100 1 11 11111 121 1 11110101 111 11011010 Seedorf sch P Engel Schrage K Assnann Sterol carrier protein X eroxisonal 3 coenzyne A thiolase wth intrinsic sterol and lipid transfer activity Biol 1994 Aug 19 269 33 21 Antonenkov VD Van Veldhoven Vaelkens E Mannaerts GP Sub specificities of 3 8 CoA thiolase and sterol carrier pr 2 3 oxoacyl CoA thiolase purified from normal rat liver sone rol carrier protein 2 3 oxoacyl CoA thiolase is involved in the ism of 2 methyl branched fatty acids and bile acid intermediates U Bry is p rrier 277 83 strate otei n s Ste met abol J Bi 10 20 30 40 21 2008 543274 2008 12 4 ol Chem 1997 Oct 10 272 41 26023 31 0800000000060 111111
39. 00000000000000000000 ee ee ee 0 00000010 00010100 001010101001010101000101010001010110 ee ee ee 0000 00010 00101010 001010101001010101000101010001010110 I000000000000000000000000000000000000000 8 11 11 11 111 11 01 0111 11 11 1 0 EPA 01 00000 1 0010000000000110000101001001010110 0 1000000 10 2008 543274 2008 12 4 2 10 20 30 l
40. 00000000050 100000 100000 100 1 1 UOUO0OO0O0000000000000000000000000000000000 100000 OD 1 1 1 1111 11 13 0111 o d BE M 41 01 01 11 11 11 11 111101 BOE EET ESTE UOU0O0000000000000000000000000000000000050 0000 Tysnd u fa 4815 7 AY 29 37 2 4 37 Bt BER Amid 36 SARA1 37 BC016840 BC030242BC042629 BC047424 GenBank 39 SwissProt TrEMBL 435 aa Q8IVQ3 399aa 055001 398 055074 566 40 VR UVB KUVAT A74127077 t Q9DBA6 0 4 2 gt 7 Q96AROD54 162 27 42 187 2946 308 531 222 398 05507402289 534 055001 41 309 373 41 Bh Hh He KEAR SEL Hh ABRAABAG 2 SEAS 2 43 44 98 16 Peci Casi 27 Amid 1 10 65610120 nt Scp2 Acaal 54040031
41. 1 1111 1 11 111 Huyghe S Schmalbruch H De Gen dt K Verhoeven Guillou F Van Veldhoven Baes Peroxisonal mul tifunctional protein 2 is essential for lipid homeostasis Sertol cells and male fertility mice Endocrinology 2006 Feb 16 Epub ahead of print as doi 10 1210 en 2005 1571 1 111 11 1 Mukherj i M Kershaw Schofield CJ Werzbicki AS Lloyd Utilization sterol carrier protein 2 by phytanoyl CoA 2 hydroxylase in the peroxi som al alpha oxidation of phytanic acid Chem Biol 2002 9 5 597 6050 0000000000000 00000000
42. 2008 543274 2008 12 4 12 3 ACCATGGGCT ACCCT TACGACGT GCCT GACT ACGCCCCTT CT GT CGCT TT 5 10 20 30 40 50 13 2008 543274 2008 12 4 L3 L3 DO
43. IBRATE DETECTION OF MODULATIONS BY AUTOMATIC IMAGE ANALYSIS IN CONJUNCTION WITH IMMUNOELECTRON MICROSCOPY AND IMMUNOBLOTTING EUROPEAN JOURNAL OF CELL BIOLOGY vol 46 no 3 1988 pages 383 393 XP009073995 ISSN 0171 9335 cited in the application abstract Cm KUROCHKIN I V SCHONBACH C In Silico Prediction of Peroxisomal Proteins in Mouse GENOME INFORMATICS vol 14 2003 pages 539 540 XP002404518 Retrieved from the Internet URL http www jsbi org journal G1W03 GIWO 3P068 pdf gt cited in the application KUROCHKIN IGOR V ET AL Sequence based discovery of the human and rodent peroxisomal proteome APPLIED BIOINFORMATICS 2005 vol 4 no 2 2005 pages 93 104 XP001247925 ISSN 1175 5636 cited in the application KUROCHKIN 1 4 ET AL Identification of Potential Peroxisomal Proteins in Mouse GENOME RESEARCH vol 15 2003 page 1560 XP002404517 Retrieved from the Internet URL http www genome org cgi reprint 13 6 b 1560 gt cited in the application DATABASE EMBL 8 February 2001 2001 02 08 Mus musculus adult male liver cDNA RIKEN full Tength enriched library 10 1300019 10 product hypothetical protein full insert sequence XP002404522 retrieved from EBI accession no EM_PRO AK005069 Database accession no AK005069 Form PCTASA 210 continuation of second sheet April 2005 42 2008 543274 2008 12 4 Int
44. M Kurochkin IV Mtojina K Goto S S Sato Yokota S Imanaka T Insulin degrading enzyme exist s inside of rat liver peroxisones and degrades oxidized proteins Cel 10 20 30 40 9 2008 543274 2008 12 4 Struct Funct 2000 Oct 25 5 309 15 Kurochkin RIKEN GER Group GSL Members Nagashima T Sch ouni nbach C Identification of Potential Peroxi sonal Proteins in Mouse Genome Res 2003 Jun 13 6b 1560 http ww me or g cgi content f ul 13 6b 1560 100001060 Kurochkin 5 nbach Konagaya A In Silico Prediction of Peroxisomal Proteins in Muse Genome Informatics 2003 De 14 539 40 http ww 561 org j ournal Gl V03 G W03PO68 pdf 10000060 Kurochkin Nagashima Konagaya Sch ouni Sequence based Discovery of the Human Rodent Peroxisomal Proteone Appl Bioinformatics in press June 2005 UCSC Genome browser mouse Tysndl http genone ucsc edu cgi bi hgTracks db mbSposi ti on chr 10 61457382 61464634 amp hgsi d 39784308 UCSC Genome browser human 5 http genone ucsc edu cgi bi hgTr acks db hg17 amp posi ti on chr 10 71568974 71575956 amp hgsi d 39784308 Gene Entrez mouse Tysndl http www ncbi nl mni h gov entre z quer y f cgi db gene amp c nd Ret ri eve amp dopt Gr aphi cs amp st ui ds 71767 Gene Entrez hu
45. anino terninus of the rat 3 ketoacyl CoA thiolase EMBO 1991 Nov 10 11 3255 62 Tsukamot o T Hata S Yokota S Mura S Fujiki Y Hijikata M S H n 18 2008 543274 2008 12 4 ashi noto Characterization of the signal peptide at the am ino termnus of the rat peroxisonal 3 ketoacyl CoA thiolase precursor Biol Chem 1994 Feb 25 269 8 6001 10 1000 100000001060 D oana ao O L3 ET gt L L3 L3 L3 n n EX Lr 111 1 1 1 000 1 1 1 1 D Duckwort C Bennett 8 amp Haml 1998 Insulin deg radati on progress and potential Endocr Rev 1998 Oct 19 5 608 24 Kur ochkin V 2001 Insulin degrading enzyme enbarking anyloid des truction Trends Biochem Sci 2001 Jul 26 7 421 50 0 0000000000
46. assembly of alcohol oxidase Pichia pastori S J Cell Biol 1997 Dec 15 139 6 1419 31 10000000 Marzioch M Erdmann R Veenhuis M Kunau VH PAS7 enc odes a novel yeast member of the 40 protein famly essential for import of 3 oxoacyl CoA thiolase a PTS2 containi ng protein into perox somes 1994 Oct 17 13 20 4908 18 Albertini M Rehling P Erdmann R Girzalsky W Kiel JA Veenhuis Kunau VH Pexl4p a peroxisonal membrane protein bind ng both receptors of the two PTS dependent pathways Cell 1997 Apr 4 89 1 83 92 1 UU Elgersna Y El gersna sna V nzel T MCafferyJM Fa rquhar MG Subramani S A nobile PTS2 receptor for peroxisonal prote in import in Pichia pastoris Cell Biol 1998 Feb 23 140 4 807 20 1000000 0 0 Szilard RK Titorenko Veenhuis M Rachubinski y32p of the yeast Yarrowa lipolytica is an intraperoxisomal conponent of the matrix protein translocation machinery J Cell Biol 1995 Dec 131 6 Pt 1 1453 69 000000000 0 Zhang JW Lazarow PB PAS7 in Saccharomyces evisiae encodes a hydrophilic intra peroxisonal protein that is nenb er of the VD repeat fanily and is essential for the inport of thio ase into peroxisomes J Cell Biol 1995 129 1 65 80 10000000 0 Mrita
47. ease Cardiovasc S k 26 2008 543274 2008 12 4 r 2004 Jul 15 4 Suppl 1 51 111 1 1 10 11 01011 1 000 T Mzuno T Onmachi T K Y Kondo H Hase T mtsu 1 2001 Di etary diacylglycerol suppresses high fat and high s ucrose diet induced body fat accumulation 578 6 J Lipid R es 42 3726 8211 3780 Kim S Sohn I Ahn JI Lee Lee YS Lee Y S Hepatic gene expression profiles in a long term high fat diet induce d obesity mouse model Gene 2004 Sep 29 340 1 99 109 00000000 1
48. ernational application No PCT JP2006 312085 C Continuation DOCUMENTS CONSIDERED TO RELEVANT Category Citation of document with Indication where appropriate of the relevant passages amp CARNINCI P ET AL HIGH EFFICIENCY FULL LENGTH CDNA CLONING METHODS IN ACADEMIC PRESS INC SAN DIEGO CA vol 343 1999 pages 19 44 XP001022979 ISSN 0076 6879 INTERNATIONAL SEARCH REPORT SUBRAMANI S ET AL Import of peroxisomal matrix and membrane proteins ANNUAL REVIEW OF BIOCHEMISTRY 2000 vol 69 2000 pages 399 418 XP002404519 ISSN 0066 4154 cited in the application TITORENKO I AL Dynamics of peroxisome assembly and function TRENDS IN CELL BIOLOGY ELSEVIER SCIENCE LTD XX vol 11 no 1 January 2001 2001 01 pages 22 29 XP002349975 ISSN 0962 8924 GOULD S J ET AL Peroxisome biogenesis disorders Genetics and cell biology TRENDS IN GENETICS ELSEVIER AMSTERDAM NL vol 16 1 August 2000 2000 08 01 pages 340 345 XP004215200 ISSN 0168 9525 cited in the application KAISER E ET AL CLINICAL BIOCHEMISTRY PEROXISOMAL DISORDERS CLINICA CHIMICA ACTA vol 173 no 1 1988 pages 57 80 XP002404520 amp SELECTION PAPERS ON PROGRESS IN CLINICAL ENZYMOLOGY PRESENTED AT THE 12TH INTERNATIONAL SYMPOSIUM ISSN 0009 8981 Form POT ISA 210 continuation second sheet 2008 43 2008
49. es Tech 2003 Jun 1 61 2 139 50 1111 Olsen LJ The surprising conplexity of bi nesis Plant Ml Biol 1998 Sep 38 1 2 163 89 1000000 Hinnaert V Mchels PA Structure function biogen esis of glycosomes in kinetoplastida J Bioenerg omenbr 1994 Apr 26 2 205 12 1000000 0 O Myersoen Choe J Fan E Hol VG Mchels Biog enesis of peroxisomes and glycosomes trypanosomatid glycosone assembly is pronising new drug target FEMS Mcrobiol Rev 2004 Nov 28 5 603 43 Van de Kamp Driessen Konings Conpartnental i zation transport beta lactam antibiotic biosynthesis by filanento 10 20 30 40 50 US fungi 8 JP 2008 543274 A 2008 12 4 Antonie Van Leeuwenhoek 1999 Jan Feb 75 1 2 41 78 D O Kikuchi Hatano Yokota S Shi nozava Inanaka i H Proteomc analysis of rat liver peroxisone presence of peroxi some specific isozyme of Lon protease Biol Chem 2004 Jan 2 279 1 421 8 Gould SJ Valle D Peroxisome biogenesis disorders biology Trends Genet 2000 Aug 16 8 340 5 Jansen GA Waterham HR Wanders RJ Molecular basis of isease sequence variations in phytanoyl
50. man TYSNDI http www ncbi nl mni h gov entre 2 quer y f cgi db gene amp c nd Ret ri eve amp dopt G aphi cs i st ui ds 2219743 Sw ssprot TrEMBL mouse Tysndl and human TYSND1 http kr expasy or g cgi bi n sprot sear ch de TYSNDI InterPro domain Peptidase trypsin like serine and cyst eine proteases http www ac uk i nterpro l Spy mode si e amp ac4 Sw ssProt Tr EMBL accession number 10000060 UCSC Genome browser gene expression for mouse Tysndl and neighbors M http genome ucsc edu cgi bi n hgNear 21951 4 397843086 gSvbus e amp d b mrb amp near search AK0050698subni 009216 or der expGnf At as2 amp near count 250 1111 Muse Gene Prediction Database Search Results for 1300 019N10Ri k XM 125636 1 and top 100 correlated genes http med uto ronto ca profil e php nameof 125636 1 JUD D UCSC Genome browser gene expression for human TYSNDI and neighbors http genone ucsc edu cgi bi n hgNear 21951 d 73232388 amp or b hg18 amp near_sear ch TYSND1 amp s t Go g1 amp near order expGnf At as2 amp near count 50 1000000 Array Prospector gene expression for human TYSNDI Sws sProt TrEBM accession Q96AR5 http stri ng enbl hei del berg de 8080 propheci es cgi new new es pl genename Q96AR5SGs peci es 9606 amp col or code 1 amp raxgenes 21065 ubni t SUBM T
51. nandusse 5 Denis S Van Roermund CW Wanders Dacremont Identification f the peroxisomal beta oxidation enzymes involved in the degradat long chain dicarboxylic acids J Lipid Res 2004 Jun 45 6 1104 ion of 111 111 1 1 0 1 DUH 1 1 Veldhoven PP Baes Peroxisomal multifunctional protein 2 is ial for lipid homeostasis in Sertoli cells and male fertility Endocrinology 2006 Feb 16 Epub ahead of print 10 12 Huyghe S Schmalbruch H De Gendt Verhoeven Guillou F Van essent n mce 10 en 2 005 1572 0 1414110111 EE ZEE ETE ET 11 0 PAETOS VD ET TIE 01 41 1111 11 41 IU U 111 1 8911111111 1111 01 01 01 11 111101 11110 101 0 114 1 ex ill li Jiang LL Kur osa wa T Sato M Suzuki Y Hashinoto T Physiological role of D 3 hydrox yacyl CoA dehydratase D 3 CoA dehydrogenase bi functi ona protein J Biochem Tokyo 1997 M r 121 3 506 130 00
52. sis of nonspecific lipid transfer protein and st erol carrier protein x studies using peroxisome assenbl y defecti ve cell mutants J Biol Chem 2001 Jan 26 276 4 2858 6408 11 1 Hl 1 DD 1111 1 11110 1 11 Mkherji M Kershaw Schofield Werzbicki AS loyd MD Utilization of sterol carrier protein 2 by phytanoyl CoA 2 roxylase in the peroxisonal alpha oxidation of phytanic acid Chem Bio 20 2008 543274 2008 12 4 I 2002 May 9 5 597 605 0 11 1 1 1 1111 1 11 1 Ferdi
Download Pdf Manuals
Related Search