形名 CN43H
Contents
1. 00 mm uu 26 8 20 O o fe emn 8 J Psi Ses UL Jo QUART 26 7 Nswsgg 32 7 338 OOOD 14 200NC HOHUUUUUUUO pagapnupnnuugnpnuppnupnna agnpad Bp papuuapnuunpaagpuapngu unpnagDpadgpDadn Dp gpapnapuupnnuuanpa apnpn upnnaagnmnp D pguggnnuapnnugunpunnuggpu unnunapnguaugpnandgpnnpnadn DOUBODD T Da pnnugnpBanpp D papuganpnauapuunnauannunnuunpnunnuggBapnpnaa DOUBGDBOGDD Dpa papuannaugpuupnn apnnupnnuugnpunnuggpBauppnaa 00000 Dp pgapugnnugnpupBupnpnadnpp pa apapunapuupnnauannuapnnunnugnpn unpBupnnaagnmnp Dpa gpapuapnuaupnpagpguapngua unpnagDpadgpadn pDu ggpnnpugapnnapuuuannpuaugnnpunuggnnpa ugpnnpaudu 000i Dpa appupnnugnpnaupnpnupnpnadn Og nO OOod0g D D D D 0 D D T T D T T DpapnnpuauggnnpuuugannnuuangnnpunuggnpnDpnBaugdnpn pu gagpnnppuuggpnpnnpuauapnapnnnugaggnnpaugugagpnpnau pu gagpnnppnuuuggpnnnpuauuapnapnnnuggaugnnpau uugagpnpau Dadn ELMO Weit IJVxS OPO00COOCOO0 0 4 0 052 811 5131 09678567 0 Ge HoOoo00000 0 OOD 6 0 1 453647 9080073 OOOCO M OOOOOOOOO 0 4 O es 052 824 1571 67 8567 0 GOoGOO00000 OO OO 06 6942 3221 40 0039 O00 0 0 00000000 40 00002. the Copyright Law and other laws when a customer uses displays distributes or exhibits an image picked up by a television camera without permission from the copy right holder Please also note that transfer of an image or file covered by copyright is restricted to use within the scope permitted by the Copyright Law CAUTIONS ON USE AND INSTALLATION Carefully handle the units Do not drop or give a strong shock or vibration to the camera This may cause problems Treat the camera cables carefully to prevent cable problems such as cable breakdown and loosened connec tions Do not shoot intense light If there is an intense light at a location on the screen such as a spot light a blooming and smearing may occur When intense light enters vertical stripes may appear on the screen This is not a malfunc tion Ghosts may occur when there is an intense light near the object In this case change the shoot ing angle e Install the camera in a location free from noise If the camera or the cables are located near power utility lines or a TV etc undesirable noise may appear on the screen In such a case try to change the location of the camera or the cable wiring e Moire When thin stripe patterns are shot stripe patterns that are not actually there moire may appears as interference stripes This is not a malfunction Operating ambient temperature and humidity Do not use the camera in places where temperature and humidity exceed the spe
3. 0000 0 Oa 092 281 4131 612 0039 0000000000000 OF OO5 9 OOD O00 Ge 011 631 8636 60 0004 00000 0000000 40 O00 400000000 022 266 3255 680 0021 00000 MO00000 0 GOO 00000 D es 082 248 4800 30 0041 URL http www elmo co jp 0000000000000000000000000000000 00 S NO OOO 00000000000000e EZ Wi SPECIFICATIONS Image sensor 1 2 inch IT CCD CCD Color Camera Head MODEL Effective pixels Horizontal 768 pixels Vertical 494 pixels Effective image area Horizontal 6 54 mm Vertical 4 89 mm Resolution Horizontal More than 470 lines Vertical More than 350 lines illumination for objects Minimum intensity of 1 5 Ix F1 2 3000K illumination for objects S N ratio 46 dB or more INFORMATION This equipment has been tested and found to comply with the limits for a Class A digital device pursuant to Part 15 of the FCC Rules These limits are designed to provide reasonable protection Lens mount C Mount against harmful interference when the equipment is operated in a commercial environment This equip Weight 2 8 oz 789 ment generates uses and can radiate radio frequency energy and if not installed and used in accor 9 3 g dance with the instruction manual may cause harmful interference to radio communications Opera e Design and specifications are subject to change without notice tion of this equipment in a residential area is likely to cause harmful interference in which case the user will be required to cor
4. 000000000000000000000000 D0000000000000000000000 p00000000000000000000000000000000000000000000 J00000000000000000000000000000000000000000000000 00000000000 J000000000000000000000000000000000000000000000000 00000 Jp000000000000000000000000000000000000 Eo D o o 00 0 LRL oooooogoooooooooogooooooooooooooooooooooooo0ggp ugagaggggagagagaggggagaagaougagaggagaagauguuduagaautudaadbttttulu ugagaagggaggagguagudeacudeattde uttu uc tL Lu E EDELEEELUT EB ELE 0 0 CN43H 02000000 IT CCD 0007600 000440 000 654mm ooo 489mm ubBg4orvggudu O00 ovg 00 20 Ix D F120 3000K 151x D F12 30000 460 O oooo0g OOo oo o o o o ell 78g g gagnggnagnagppandadnd L3 pE3ipIpIpBIEIC3 oj o o DOUBDU Da agBpunnuunpagpguapngaapnpnadn oooocooooooooO 000000 EMC 02H D D Bnaagnpad D pBnpBannu 00000000 EXC C2E EMC 03H EXC C5E EMC 05H EXC C10E EMC 12H EXC C15E EMC 20H EXC C20E EMC 30H EXC C30E
5. DO00000000000000000 s AAE 0000000000000000 00 CN43HQOO00000000doo0ddO D nupnapna pupnpupnpuubpuugbpuuabpduduanduuandgapnddgnpnsdopbduccaaip 0 DpBununupuaununpnaupgauaupnapauaupnangangagpnapnadnp Dppa anpnagunugaunugaungappapnpagnpnaaunagndad A0000000 gugagggaudggagg CC4310000000000000000000 uggaggauddgattutlut einnnbpagpnpaaggudgccasipnrg JOU00U0U0U00U00U000000 UuBguatte uedttllu ggaggagaguadatdttdtttul u ggaggaaueadttttdtttlu eulululutlull ggpagugagauadautdttdtttlu ugagauggagaaattttleledebtttlutlu u ggagagaguadattdttdtttl ugagauggagaaauttleadtttlut u d ggagugagagueadtutdttdtttl uaggaudgaaeaeatttllelaelbtttlut u uguggadaudtuttitlu ugguagulasatdseattle ttLt u FEBRE EDIDI deste sentite nte HEMOS g gutealu WEITERE we sects c M E E UT o cc4310 0 0 00 o00000 og o g VIDEO coooooon p ooooo ooooooe oo l ooooooo Lesmgge n0000 000r ugpgagagagagggugamgauguaaugueauddtutteduete utt tLtt u UuBguaudtebtB lu gcpugagapugggcguguapngugaagpBaggadge 5mmtntnt gatugauud UuBagaut E EE a DAE P a enounnununaunnauogoagougnnunnnungggnggagggunnunnunnug D000000000000000000000000000 p00000000000000000000000
6. SA Canada Germany Places contacting chemicals such as pesticides rubber or vinyl products for a long period of time Tel 516 501 1400 Tel 905 453 7880 Tel 0211 376051 53 Fax 516 501 0429 Fax 905 453 2391 Fax 0211 376630 E mail elmo elmousa com E mail info elmocanada com E mail elmoeurope AOL com Web http www elmousa com Web http www elmocanada com Web http www elmo de EMO and XzK 1IVEED are registered trademarks of ELMO COMPANY LIMITED Printed in J apan 23552122
7. cifications Picture quality will lower and internal parts may be damaged Be particularly careful when using in places exposed to direct sunlight When shooting in hot places depending on the conditions of the object and the camera for example when the gain is increased noise in the form of vertical strips or white dots may occur This is not a malfunction e Handling of the protection cap Keep the protection cap away from children Children may put them into mouth or swallow them accidentally The protection cap protects the image sensing plane when the lens is removed from the camera do not throw away e When not using the camera for a longtime Stop supplying power 2 When cleaning the camera mM 6 14 Meizen cho Mizuho ku Always turn off the power and clean with a piece of soft dry cloth Do not use benzine alcohol thinner EMO ELMO CO LTD Nagoya 467 8567 Japan household detergents chemically treated cloths etc If used coating and printed letters may be dis colored When cleaning the lens use a lens cleaning paper etc OVERSEAS SUBSIDIARY COMPANIES Avoid using or storing the camera in the following places Places filled with highly flammable gas ELMO Mfg Corp ELMO Canada Mfg Corp ELMO Europe G m b H i e ERI 1478 Old Country Road 44 West Drive Brampton Neanderstr 18 Places near gaso line benzene or paint thinner Plainview NY 11803 5034 Ontario L6T 3T6 40233 D sseldorf Places subject to strong vibration U
8. rect the interference at his own expense OPTIONAL PARTS USER INSTALLER CAUTION Your authority to operate this FCC verified equipment could be voided For further details contact your Elmo dealer if you make changes or modifications not expressly approved by the party responsible for compliance Camera control unit to Part 15 of the FCC rules Type name CC431E Camera cable This Class A digital apparatus complies with Canadian ICES 003 Cet appareil num rique de la classe A est conforme la norme NMB 003 du Canada Nominal length Diameter 2m 5 0mm 3m 5 0mm CAUTIONS ON USE 5m 5 0mm e Please use this apparatus by connecting only with camera control unit Elmo CC431E 5 0mm e Read the CAUTIONS ON USE AND INSTALLATION in the operation manual of CC431E and follow 5 0mm them 5 0mm 5 0mm COMPONENTS 1 Camera head without lensys inssin iani a 1 EXTERIOR DIMENSIONS 2 Accessory Unit mm inch a Operation manual tette tette 1 9 diameter 26 8 CONNECTION com TERT z EN B 6 9 TE d d i 3 gio gl AG i oli CC431E option e When connecting or discon A Jer J PIN ae Camera con
9. trol unit necting the camera cables BENE J for the camera head and dc unctus ori O mn idio camera control unit always 102 7 IET X C mount lens p eU turn off the power Switch of Ts o A 4 20UNC Threaded hole option Camera head the camera control unit first CAMERA DOINA If not the camera head may NI gt be damaged Camera cable Sess e Use a C mount lens with the Less than 8 5mm option ivy 7 protruded section from the mount base less than 8 5 mm DISCLAIMER We disclaim any responsibility and shall be held harmless for any damages or losses incurred by the user in any of the following cases 1 Fire earthquake or any other act of God acts by third parties misuse by the user whether inten tional or accidental use under extreme operating conditions Malfunction or non function resulting in indirect additional or consequential damages including but not limited to loss of expected income and suspension of business activities Incorrect use not in compliance with instructions in this instruction manual Malfunctions resulting from misconnection to other equipment Repairs or modifications made by the user or caused to be made by the user and carried out by an unauthorized third party Notwithstanding the foregoing ELMOSs liabilities shall not in any circumstances exceed the pur chase price of the product o Ui w N COPYRIGHT AND RIGHT OF PORTRAIT There may be a conflict with
Download Pdf Manuals
Related Search