Orientia tsutsugamushi の毒力決定因子
Contents
1. 0 1 2 8 4 0 1 2 3 Days after infection Days after infection 2 10 IL la recombinant mouse IL 1a Ot A B C Gilliami D Kawasaki e O IL la recombinant IL 1a 42 23 0000 inwtrol 00000 TN IFN y 0 71 79 800 nn 00000 A 6611 C burnetii 691 7000 OOOU NOIJUDDUDDUDBDDDUDUDUDBDUDUDBDUUDUDBDBUDUDBUHU in 200000000 000 NOD D I Kuroki 000 Kawssaki 0 lU UU NOIJDDDUDBUDUDUDDUDBUNOIJDUDUDUDUDUU NMMA I T NO kurok GOOOO0000000g2. 0 00 0 0 Kuroki 0 0 0 0 J PUKaweseki Kuroki 400 6 Kawssaki Kuroki 10 O Ehrichat 1 D 0 d 0 0 D U D U U 0000 Aeketsaruu sime laye 0 0 0 0 150 000000000 62 000
3. Kuroki 00 UU UH 774 62 630 00 6 64 Kuki lU UL OO 5 59 OOOO etn 0000 Kuroki D t0 00 0 C3HD U D U U 0 480 0000 0000000 00000000000 00 T lyrphocyte activation 1 0000000000000 491 50 5 00000 00000 0 0 0 0000 UUDDDUDDUDUUDUDBUDDUDUDUDUUDUUUDBDDBDDUHDHDUS IIA A A I9IIIIAIA IIAI2 O Groves 48 0 0 BALB cQ
4. 0 U D IL 12 00000 000 Gillian 2 480 0000000000 000000000000 2 4408 0 00 0 Kawesaki 0000 010 1 550 85100000000 2 420 200 0 00 00 0000 NO 00000 250000 000 33 8 Karp Kuroki 9 A B S a7 5 2 S z l 5 0 1 2 3 4 0 1 2 3 4 8 Gilliam Kawasaki D 5 S g7 5 2 O o a8 z 5 T I T 1 0 1 2 3 4 0 1 2 3 4 Days after infection Days after infection treated with nomal rabbit serum O with anti TNFa serum 2 3 TNFa Ot AD Karp BO CO Gilliani DO Kawasaki 25AU BO 000000 Kuroki 0000 0 0000000000000 OO 2 5CU 20000 0000 000 2000 0000000000 34
5. 0000000000000 000000 0000000 50 440000 000000000000 38 40 lU UI L 800000000000000000000 000000 50 000 14 buffy coat Well Felix 0 0 0 Ore
6. 7 i vtroQ DOOO0000000g 000000 Karp Kuroki OOUUUUUUUUUUO 20000000000000000000 Kap 23 uuummnnaaagaagaagagggadgududugdkuweinngng 4000000000 uguugggggagamngnuuguggugagagagaaanmummuuudtgiatdtt Kapp O0O00000000000 DO00000000 Kurki 0000000000000000 3000000000000000000 0000000 Kap 0000000000000000000000000 DOO0O0O0OOCOOOOCOOOOO0O000000000000000000 uuuunnnnpnuuuunununnnunnuuuunuunnununuuuuun 000000000000 uuuunnunnpnuuuunununnnnnuuuunununnnunpuuuuun n vitro 00000000000000 00 0
7. GGillianjkarp ken OO0 0 0000000 BAL 0 00000 0 00 000 0 0000 7 11 ggg L929 0000000000 10 0 0 0 0 0 FBS 150 00000 0000010 00 m 00000000 Eae s MEM 0000 Co LTD Tokyo 00000000 7080000 BALB d 0 0 0 0 0 10 proteose peptone Difco Lab Detroit MI USA 1 0000030000000 PBS 0 200x g 100 0000000000000000 0 FBSJI 10 0 00 D Difco Lab Detroit MI USAJ O O00 1x 100 mp DDD D D umBguugt 0 5 mg 0 0 Lab Tek 4 charrber slide Nalge Nunc International Naperville IL USAD OO veig 00 0 0 0 0 0 0 5 COJ 0 00 0 37 G D ugggPpsipnnauguugggagagaagguauuaggaggggagagagtu ugggggagagngguaggugadadgaau Ot I ll Kuroki O Tamura et all 0 00 600 00 E9290 00000000 000000 etit 1000 000000000 20 6850 0 0 0 0
8. UU DUDUUUuu lU l 64 00100 1 Nagayo M Tamiya T Mitamura T Sato K On the virus of Tsutsugamushi disease and its demonstration by a new method Trans Japan Pathol Soc 20 556 566 1930 2 Ogata N Aetiologie der Tsutsugamushikrankheit Rickettsia tsutsugamushi 201 f Bakt 1 Abt Orig 122 249 253 1931 3 00 00000000 Onentia tsutsugarus 0000 0000000 54 815 832 1999 4 Tarriya T Recent advances in studies of Tsutsugarrushi disease in J apan Tokyo Medical Culture Inc 1962 5 HOO 00000000000000000000 00000 10 174 179 1983 6 0000 000000 000000000000 0000000 30 310 339 1984 7 Takahashi M Machida K Murata M Misurri H Hori E Kawarrura A Jr Tanaka H Seasonal development of Leptotrombidium pallidum Acari Trombiculidae observed by experimental rearing in the natural environment J Med Entorrol 30 320 325 1993 8 000000000 00000000000 00 000000 0969 9 Jones B M The penetration of the host tissues by the harvest mte Trorrbicula auturmalis Shaw Parasitol 40 247 260 1950 10 Urakarri H Takahashi M Murata M and Tamura A Electron rricroscopic study of the distribution
9. Kurokil Kawssaki O00 Gillian 5ebpannmnanaunaun 109 Hong 505 43 47kDa OO OOOO 0000 0 Oaks Kapi l 58 Gilliam DNAD DG DO UO B D U D U U OOOO0 300 150 0 110 9 580 560 4700 26 uml 00000 2 43 4KDa 59 0000000000 Gilliard Karp
10. 1 0 10 10 19 0 Gilliam 1 0 08 o 0 6 Es 0 4 0 2 0 Kuroki Kawasaki E Uninfected IL 1o ng mL 1 0 0 8 0 6 0 4 0 2 0 6h 1d 2d 4d 6h 1d 2d 4d 1 2d 3d 4d After infection After infection After infection h hour d day h hour d day h hour d day E treated with nomal rabbit serum L with anti TNFa serum 024 0 0 ee 0000000 Karp CO Kuroki DO Kawesaki EL 00000 35 A Karp B Gilliam 10 8 6 4 2 C Kuroki D Kawasaki E Uninfected 8 6 4 2 0 Gh 1 2d 4d 6h id2d3d4d 6h 1d 2d 4d After infection After infection After infection h hour d day h hour d day h hour d day B treated with nomal rabbit serum L with anti TNFa serum O25 0 0000000 Karp Gillian CO Kuroki DO Kawasaki 0000 225 TNFa 000
11. DE TNFa D OD UU UO U D U D U U recombinant 0 0 TNFa 00000 43000 0 0 00000 00 0 0 0 TNF JIL 1 Recombinant TNFa 0 0 Kuroki 000 2 2B000 00000000 2500 36 OOOO 200 unit m I H1 DU D TNFo 0 00000 LI D 0 Gilliamr 0 264 10 200 00000 000 0000000 2000000000000000000000000000 0 000000000 600 GGillian 100000 recombinant DO B D O D OU O l D U D 00 0 2 00000000000000000000 2 68 10 300 n 00000 Giliam 00000000000 TNF Dpu gagpnapgaagagpnapngagagaunpunpdudlbnlub Gilliam tL Recorbinat TNFa 000 2 7 2200000 6 3000000000000000000 3 2 78 11 3100 00 0000 00000 000 00 00 0 0 0 TNF Ot 0000 1 16 0 28000 2900 000 0000000000000 TNFernO DD b
12. OOO 1950 OO 43000000000 1000000 4410000 1960 0 00 n 20000000000000000000000000000 4 48010 00000 46 et lU L Gillian 4 1 3 4 amp UU UI L 000000000000 0 T lymphooyte activation 10 DL 00000 Lm 49 50 5 T lymphocyte activation 1 51 520 0 0 OGiliamp D 00 0 OOO
13. 0000000 56 UBL 52 000 tsutsugamushi TNF B LH LU D U 53 mehaj98 99 0 0 000000000000000 dow 000 00 00 0000 DnpnnupBnnnupupnaapaunanpnoegnmaunuuungn IDD 0000 TNO 830 000000000000 5 0000 00000000 0000 0 00000000000 tol lke OO 1000 OOOO OtO TNF J uggumugugggpnnpnuuupbBuluggugggpnmumnuggiui gut Mendoza 0 505
14. 8 9 etu otong 0100000000 30 0000 40 195000000 100 19700 000000 10000000 1000000000000 19700000 19800 0000000 20000000 40000 eoppnpnuanggpnnupnpnununagudgnnagugnpnpnan 230000000 219700 000000000 6
15. A l OO SO 0000000000 0000 O l Kuroki 000000000000 U 1 780 0 group B streptococci SIN 1 1 p 1 1 JII UU Gilliam 000000000000000 Kuroki Kawesaki 000000 U 1 1 1 OO reconbinant 1 19 000000000 10 0000 0000 0000 I 1e 0 umm 43 IL 1 Nopnpnpnnaggpnaanppan 1 1 00000000 superoxide 0000 Mycobacteriumavium 0000060 790 0000
16. etn nd 0000 000 Onmentatsutsugamush in wtro L lJ 400 0 00 00000 59000 00000 00 0 00 0000 0 0 0 00 0000 39 Kuroki 38 0 Kawasaki 110 00000 0 00 00000 D UL D lU UU l 401 OO OOOO UL 530 00000000000
17. OO 0 04 00000 0000 505 ot 0000080000000000 200000000 56000000 Du gagpnaprNEDODBOOODODUTNFIDOUDUUUUDI 42 4 kba Toll like receptor TLR 000 103 104 105 106 1070 000 18400 00000 0 LPH 0000 TQ 1 12 00 TER 4D OO OD DH D U D 00 D 108 000000000 0 0 Mycobacterium 10300 Legionella 1050 000000 TLR40 OO 2 5 U 0 03 deoxy D mannoocutolosonic acid 0 0 0 00 320 Kurki 0 0 Kawsaki OOO
18. dflOtI IU DU 2 0 00000000000000 000000000 00000 0 qiii 00000 00000 etur t 000000000000000 1 2 00 0000 000 929 000 00000 1000000000 ON doubling time L9290 0000 90 300 DO D 150 180000000 16 445000 00000 100 2000 OOO000000000000000O 21 080000 810 050 08 12730 emQOO00000000000008 0 250 0 564 ni O 0 050 25y 000 26 0000 0000 0 0 0 000 000 0 0 0 uummnnnauuuguuggguumumnpna dduuun 00000 UUDDUDDUDDUDUDUUHUHUUUUDUUUDUDUDUDUDUDUUDUU 05000000 umaguauuseersegngggaggaggaasnaagpnugg 05 000 00000000 Ackettsa l 00000 00000000000000 uugummnnanagaagaagagggguguugguuuggugumummuBBaad ett 0000000000000000000 22000000000000000 LPS 0000 28 290 0000000000000 DO0OOOOOOOOO0O0CO0O0000000000000 30 310 uummmnpeeunuugadgguguunmmnpnaaaddg 2 0 00000 0 00000000000000 0 000 3deoxy D mannoocutolosonic acid 00000000000000000000 320 970000000 oeenuagggagagaagugmuauggagagagagaagutttlttldgdbblu tsutsugamushi QO OOOUOUOOUUUSCtG0 00000000 LPSIJ U
19. eennpnnugupnpna gnannpunHnd 5 lU UI L 5 11 wrogjg gnapesg pngaggssupnupngaagpnapdgagduadbnd Gilliam OO 0 O00 0000 OBALB c 1 wet 0000 D EU 000000000 000000 48 OOOO 580000000000 591 0 19291 00 2400 000 00 0000 UUIDUDUUDUUDDUUDDUBDBDBDUUDUUUDOUUDUUDBUBDBDUUDDUDUBU
20. 1 3 1 2 1 strain of no of bacteria 96 average no of Ot in cytoplasm in phagosome undefined bacteria macrophages injected intact plasmolyzed intact plasmolyzed examined examined Karp 86 2 5 51 0 3 0 41 3 3 1 65 5 5 2 66 2 2 3 66 133 84 7 Kuroki 71 6 11 47 0 2 041 4242 79 10 9 9 61 7 0 3 24 134 219 3 could not be defined either in cytoplasm or in phagosome on ultrathin sections average with standard error for 3 mice 2000 0 0 Kuroki 0000 81 177 8 0000000000 00 0000 000 00000000
21. 1001 Gilliam O00000 KurokiQ I 0000 5050 00000000000 41 00000 0010 1 amp 4 charrber slide O 0 5 COJ 000 37G 00000 Karp 0 0 00921 00000000 54 Ot Gilliam Karp Kawasaki 0 0 U 1929 5 200 90 10000000000 56 200000 D 00 O 10000 50000 0 00000 00 00 0 0 0 0210 850 RPM Ot Ot IU 9290 000000 0 20000000000 505 0 080000 0 20 SDS 1000 0 5500000000000 9090 0000000000000 62 53 M Tris HCI 000 pH6 8700 100 100 000000000000 4500000 1000000000000 00 BieRed mni PROTEAN II 0000000000 192mM i 000 00 10 5050 0 25mM Tris HCIQO 0 2000 58 00000000000000000000600 200 00000000 25 SMO 000000000060 oudinnmnmnnnmnnnaunnmmnmrm sentzp 0 00 1020 0 D
22. 8000000 3000000000000000000000000 pDn ggauggagagpupngugngeepunununua nagpnanmnan 56kDa 0 0000000 10000000 200000000000000000 etn TNF recorbinan TNF 00 0000000 300000 1 200 OO 4000000000000000000
23. 20 43 250 43kDa 00 00 000 DU 000000000 109 11 43 47Da 56 4ekDa 5ekba fusion 00000000 420 0 0O 00O S6kDa D gpgaggagogpnapngaugagaggopumebannnunuagnaugnaun uggugugugggapnpnpnuuupBulugugggpnmumnuddgiuli gut OOUUUUUUUUUO 63 OU uummnnpnbpuuuuggugu
24. 5 540 n vitro Gilliam OOOO O00 DO 55000 0 0 BALB c O Gilllam 000000000 0 0 0 56 7 in uggmugugugggpnpnpnuuupBauguggupgggpnsupnupgggug dgut
25. TNF A Ot TNF 1 Kuroki Kawasaki 39 A Karp B Gilliam 3 0 2 0 IL 1o ng mL C Kuroki D Kawasaki E Uninfected IL 1o ng mL N e 0 6h 1d 2d 4d 6h 1d 2d 3d 4d 6h 1d 2d 4d After infection After infection After infection h hour d day h hour d day h hour d day treated with nomal rabbit serum with recombinant TNFa 28 Recombinant mouse TNFa 0 00000000000 OtUO00000 IL 12 0000 0000 Karp CO Kuroki DO Kawasaki 0000 40 B Gilliam 20 A Karp 15 M 10 Nitrite u 50 C Kuroki D Kawasaki E Uninfected Nitrite uM 6h 1d 2d 4d 6hid2d3d4d 1 2d 3d 4d After infection After infection After infection h hour d day h hour d day h hour d day treated with nomal rabbit serum Ll with recombinant TNFa 29 Recombinant nouse TNFa 0 00 000000000 00000 00 NO D UU U 000 Karpi BO Gilliami CO DO EOD D 0000 41 m A Karp 1 B Kuroki Log No of O tsutsugamushi 9 C Gilliam 1 D Kawasaki Log No of O tsutsugamushi
26. OOU 4 etn r utu 47 31 00000 1 4 charrber slide well 5 COJ D 0 00000 Ot OO 1929 NOHOOOOODOOOOKOOOO08 Charrber slide O 000000000000 00 0 25m0 000 50 l OO 37 2000000000000 00000000000000000 D O5SM0 000 50 2 00 00 0 00 0000 0 0000 00000 10 00000000 L TNFQ OO 1 DD 31 000000 310000 O gt gt o uggggaggggHg Strains Source Type ugugaggegu1llll Gilliam Hunan Glliam dic c n rp nan rp Mat suzava Hunan JP Kawasaki Kurok O00 Shi buya Hunan JP Ug dev u DD Kato Hunan Kato Kavasaki Hunan Kawasaki Kur oki Hunan Kur oki D 600 day 00000 shi nekoshi Hunan Shi nokoshi oO0000 40 1 1 Lept ot or nt di LX mte i L fui FU i 48 032 QO0 M0000000000 St rai ns 0000060 LD so Glliam 1 93 10 _ 1 78 10 9 12x 10 ddy gt 2 29x 10 4 47x 10 CHH 2 14x 101 Karp 2 25 109 5 6
27. 2 Kuroki Kuroki 0 0 A B 810 Karp infected Kuroki infected T O macrophage 8 A neutrophil x lymphocyte 56 c 8 5 4 a lt 2 E A r cU EM sebz ar fess 10 5 10 0 5 10 15 oo n Days after infection Days after infection 100 in macrophage A in neutrophil se Kuroki 0 1 No of O tsutsugamushi peritoneal cell 0 5 10 15 Days after infection 1 1 Ot Karp Kuroki BALB c 00000 Ot A Karp Kuroki OL D U D A 00 C
28. 0000000000000000000 43 87 8800 0 0 000 U 0 0000 restriction flagrent length polymorphism RFLP III 89 90 34 OO 600000000000000 56 Gillian Kap 0 00000000 Karp OO 56 0000 0 0000000000000 0 00 0 0 40 91 920 000000000 JPL Shirrokoshi O0 0 O 00O 0000000 1 10 000000 Gilliam 00000000000 93 400000000 2200 0 0 0 0 00000 00 0 00 0 00 0 GO 0 0 IKaweseki 5 LX INFUIDOOOU 800 0000 0 0 00000 00000 40 91 9900 Kawsek Kurok 0000000000000 0 0 uggggggagumuguiuuuu 102000000000000 00000000 0 Gilliam Karp Kawesaki Kuroki 0 0000000000 O00000 00000000000000000000000000000
29. 00 0 tuberculosis 750 00000000000 2 monocytogenet 300 0 00 0 0 0 0 00 0000 0 0 recombinant 0 00000000000 00 GilliamO Kuroki D 00000000 4000000000000 7000000 0000000000 recombinant 0 Kuroki Kawesaki D 0 D 0 0 0 0 0000000000000 etp rt 0 IL o 00 D Non utat bue Reconbinant DO OB DO X D U D U 000 IL 1 p recombinant Ot 1 NO lU OtUOHO0 P388D1 Kap D D D D D U TNFa 00000 T 821 J77410 00 TNFa ED D BL D 0 80 OO Beryengr D D D J D L
30. Karp ET Kuroki 000 00000 C Karg I Kuroki 0 0 0 0 O0 NMMAQ 00 J NMMA Kuroki na 0 N9 monormethyl L arginind 30 O21 QQOO0U00000000000000 Strain q Tm LD 0 25ml LD ICU Gilliam 1 93 x 10 1 78 x 10 9 22 x 10 Karp 2 25 x 10 5 62 x 10 2 20 x 10 Kawasaki 826x105 3 16x 10 3 83x 107 Kuroki 149x105 3 16x 10 lt 2 12 x 10 10 infectious dose in L929 cell culture 50 lethal dose in BALB c mice D cells in a chanber and mice were received 0 25ml of inocula Kuroki 00000000 Kap 218 2 1 2 2 2 400 00000 00 00000 000000000000 210 0000000000 Gillian 0000 400000000
31. 00 00000 0 000000000 uagguagudutu utaluttutututtuiitiulututlutlttutlutututL 04000 000000000 60 60000 00000000000 000000 1M DOCU D D 7 U 2000 00 0 0 000 0 000 00000 O00000 0 Quentol 812 Nissin Co Ltd Tokyo 0000 00 0000 UUDDUUDDUDDUDUDUDUUDDUUuDUDGuuUDuuupUpuUunpuuunUu r2 00 12 1 000000 Kuroki 000 Karp Kurokil 0000 0 BALB cQOO0U0000000 100000 20 000000 0000 10000 00000000 000000 U 1 1 Inocula 1 KKK Strain ICU 0 25ml LDso 0 25ml LDs y ICU Karp 2 25 x 10 5 62 x 10 2 20 x 10 Kuroki 1 49 x 10 3 16x 10 lt 2 12x 10 10 infectious dose in L929 cell culture 50 lethal dose in BALB c mice cells in a chanber and mice were received 0 25ml of inocula 122 Kapood 1400 0 BM Kap 0000000000000000 UIDUUI l 600000000 3000 OOO
32. 6h 1d 2d 3d 4d After infection h hour d day 6 h 1d 2d 3d 4d After infection h hour d day Os E with recombinant TNF a Ot TNF Ot TNF Karg Gillian 3 38 8 1 Kuroki 2 Kawasaki E 7 A 9 s Sig paa e Y 5 5 T T T 1 T T T 1 0 1 2 3 4 0 1 2 3 Days after infection Days after infection 660 B Kuroki B 2 Kawasaki B 3 Uninfected 580 500 420 c 3401 LL 260 180 100 20 6h 1d 2d 3d 4d 6h 1d 2d 3d 4d 6h 1d 2d 3d 4d After infection h hour d day e B treated with nomal rabbit serum zt After infection h hour d day indicate TNF of less than 20 units mL 2 7 Recorrbinant mouse TNFa After infection h hour d day with recombinant TNF a Ot
33. and Liu Q H Epidemiology and ecology of rickettsial diseases in the People s Republic of China Rev Infect Dig 9 823 840 1987 47 Hanson B Comparative susceptibility to mouse interferons of Rickettsia tsutsugarrushi strains wth different virulence in rice and of Rickettsia rickettsii Infect Immun 66 4134 4141 1991 48 Nacy C A and Groves M G Macrophages in resistance to rickettsial infections early host defense rrechanisrrs in experimental scrub typhus Infect Immun 31 123 1250 1981 49 Groves M G Osterrran J V Host defenses in experimental scrub typhus genetics of natural resistance to infection Infect 19 583 588 1978 50 Groves M G Rosenstreich D L Taylor B A and Osterrran J V Host defenses in experimental scrub typhus mapping the gene that controls natural resistance in mice J Immunol 125 1395 1399 1980 5 Patarca R Freeman J Singh R P Wei F Y Durfee T Blattner F Regnier D C Kozak C A Mock B A and Morse H C Structural and functional studies of the early T lymphocyte activation 1 Eta 1 gene Definition of a novel T cell dependent response associated wth genetic resistance to bacterial infection J Exp Med 170 145 161 1989 52 Singh R P Patarca R Schwartz J Singh P and Cantor H Definition of a specific interaction between the early T lyrrphocyte activation 1 Eta 1 protein and murine m
34. 81 0 00 J74100000000000000000000 44 0000000 2000000 TN IL 12 0 ugggugugugggpnpnpnuuupbBauguggugggpnsunmnudgdggugi gut ugggugugugggpnpnpnuuupBauguggugggpnsupnupgaggdgidgut DnaugeepnnnauguunguupnnunnanuuadgpnpnBpnpnagunpnpu recombinant 0 0 0 45 O tsutsugamushi 0 inwtrqqjDDd gdDadaupu 46 Ot 8 DO00000000000 56 DO0O0O0O000000000000000000000 25 000000 ugggggggaguuuggggggagumauguu 400000000 00000000 860 0000000 DO0000000000t0o000000000000 56
35. Kato Kawasaki Kuroki Shimokoshi BALB c 0 0 0 0 0 000 C3H ddyo 00000000000000 00 Shirrokoshi O BALB c LD OU D 0 U D 0 000 0 daro 000 000 O00 DKarprKetanin 0 000 100 100 00000000000 0 Kurok Shimokoshi DOOOOOOOU0O00000000000000000 LU 00000 BALB c C3HD 000000000 0 000 5610 0 10000 0000 0 0 0 0 0 0 0 0 0 100000000000 000000000 00 BALB c C3H0 nna Bp ap 550 0000000 DO0O00000000 0 000 O0 0 0 O O 20 000 0000000 0000000000000 ddr O LOsO00OCOO0O0OOOCO0OOCOOOO0 OD 0000000000 lU UI L 100000000080 TNF 0 TNFOOOOO LULU Ul 51 uggggggaggmumuggggaggagu TNF UU UO D 7 D D C DI U U uaiggnpaauuugugggggagueepnpnmmauututuuutu TNF J J UUUDUUDUUDUUUUUUUUUUUUUUUuu O00000000 0 Gilian Karp Kato Kawasaki Kuroki Shirrokoshi Kto 0 000000000 0000000 19800 000000000000
36. N R and Holt J G ed Bergey s manual of systerratic bacteriology Vol 1 The Willians amp Wilkins Co Boltirrore London 687 729 1984 86 Ohashi N Nashimoto H Ikeda H and Tamura A Diversity of immunodominant 56 kDa type specific antigen TSA of Rickettsia tsutsugamushi Sequence and corrparative analyses of the genes encoding TSA horrologues from four antigenic variants J Biol Chem 267 12728 12735 1992 87 Tange Y Kanenitsu N and Kobayashi Y Analysis of immunological characteristics of newy isolated strains of Rickettsia tsutsugamushi using monoclonal antibodies Am J Trop Med Hyg 44 371 381 1991 88 000 00000 0 00 0 0 00 000 00000 0 0 0 0 0 0 0000 000000 66 1262 1269 1992 89 Furuya Y Yoshida Y Katayarra T Yarramoto S and Kawamura A Serotype specific amplification of Rickettsia tsutsugamushi DNA by nested polymerase chain reaction J Clin Microbiol 31 1637 1640 1993 90 Kawarrori F M Sugieda M Kanda T Akahane S Yarrarroto S Ohashi N and Tamura A Two step polyrrerase chain reaction for diagnosis of scrub typhus and identification of antigenic variants of Alckettsia tsutsugarrush Vet Med Sci 55 749 755 1993 91 Tamura A Makisaka Y Kadosaka T Enatsu T Okubo K Koyarra S Qiang Y and Urakami H Isolation of Or entia tsutsugamus
37. OO Karg I Kurokig 0 O e 000 ALI LC LC D LO D D 12 3 0 00 00 0000004 wef vto 000000000000 0 OU D 20000000 0 Kurki OO 109 0000000000000 ugggugugugggpnpnpnuuupBguguggupgggpnsupnugggdgidgut 6000000000 000 Kuroki 8 OO00000000g Karp Kuroki Log No of O tsutsugamushi 0 2 4 6 8 Days after infection 012 wreggusu
38. Silverman D L and Wisserren C L Jr Corrparative ultrastructural study on the cell envelopes of Rickettsia Rickettsia rickettsii and Rickettsia tsutsugamushi Infect Immun 21 1020 1023 1978 Schrarrek S Brezina R and Kazar J Sone biological properties of an endotoxic lipopolysaccharide from the typhus group rickettsiae Acta Virol 21 439 441 1977 Anero K Fujita M and Suto T Chemical properties of lipopolysaccharide from spotted fever group rickettsiae and their common antigenicity wth lipopolysaccharides from Proteus species Infect Immun 61 4350 4655 1993 Allison A C and Perkins H R Presence of cell walls like those of bacteria in Rickettsia Nature 188 796 798 1960 Myers W F R A Osterman J V and Wisserren L Jr The presence of diarrinopirrelic acid in the rickettsiae Proc Soc Exp Biol Med 125 459 462 1967 Amano K Tamura A Ohashi N Urakami H Kaya S and Fukushi K Deficiency of peptidoglycan and lipopolysaccharide components in Rickettsia tsutsugamushi Infect Immun 55 2290 2292 1987 Ohashi N Fukuhara M Shirrada M and A Phylogenetic position of Rickettsia tsutsugamushi and relationship anong its antigenic variants by analyses of 16S rRNA gene sequences FEMS Microbiol Lett 125 299 304 1995 Tamura A Ohashi N Urakami H and Miyamura S Classification of Ricke
39. T and Fedorenko V DNA binding activity of 77 protein and temporal expression of the gene that upregulates landomycin E production in Streptomyces globisoorus 1912 Microbiology 151 281 290 2005 2 Gromyko O Rebets Y Ostash B Luzhetskyy A Fukuhara M Bechthold A Nakamura T and Fedorenko V Generation of Streptomyces globisoorus SMY622 strain wth increased landomycin E production and it s initial characterization J Antibiot 57 383 389 2004 3 Qiang Y Tarrura A H Makisaka Y Koyarra S Fukuhara M and Kadosaka T Phylogenetic characterization of Orientia tsutsugamushi isolated in Taiwan according to the sequence homologies of 56 kDa type specific antigen genes Microbiol Immunol 47 577 583 2003 78 ugguaguggggpnpnpnuuupguguggugggpBsumnuidgiuli gut Uum UU 00 UU OU UU OOUUUUUUUUUUO LU lu 0000 0000 LU u 79 0000 LU Uu LU 0000 LU Uu
40. Welsh C J and Feng H M Cytokine induced nitric oxide dependent intracellular anti rickettsial activity of rouse endothelial cells Lab Invest 76 129 138 1997 Rich K A Burkett C and Webste P Cytoplasmic bacteria can be targets for autophagy Cell Microbiol 5 455 468 2003 Yarreguchi N Hasegawa T Tamura A and Urakami H Morphological analysis of growth inhibition of Rickettsia tsutsugamushi by tetracycline chloramphenicol and erythromycin Niigata Prefectural Hosp Med Bul 32 38 40 1984 Howe D Barrows L F Lindstrom N M and Heinzen R A Nitric oxide inhibits Coxiella burnetii replication and parasitophorous vacuole rreturation Infect 70 5140 5147 2002 Park J and Rikihisa Y L arginine dependent killing of intracellular Ehriichia ristici by macrophages treated wth gamma interferon Infect Immun 60 3504 3508 1992 Boockvar K S Granger D L Poston R M Maybodi M Washington M K Hibbs J B Jr and Kurlander R L Nitric oxide produced during murine listeriosis is protective Infect Immun 62 1089 1100 1994 Croen K D Evidence for antiviral effect of nitric oxide Inhibition of herpes sirrplex virus type 1 replication J Clin Invest 91 2446 2452 1993 van Furth R van Zwet T L Buisrran A M and van Dissel J T Anti tumor necrosis factor antibodies inhibit the influx of granulocytes and monocytes into an inflar
41. af NOD D A O 00000000 Kani Gillian Kuroki Kawesaki 000 OtOOO0000000 TNE U D IL 1e 000 CH 0 0 DI 32 4 1 2000000000 228600000 10000 4000000000 000 0000000 100000 Kawsaki 4 20000000000000000 20 2200 000 TNF 1 19 0 00000000000000 20 etn 224 000000 TNaQ OO rTNFDDDUU 4 1 O00 0000 CI D Kuroki 0000000000000 0000000000 40000 60700000000 2380 TNOOOOO
42. avium Infect Immun 64 3224 3230 1996 80 Thorres S M Garrity L F Brandt C R Schobert C S Feng G S Taylor M W Carlin J M and Byrne G 1 mediated antimicrobial response Indolearrine 2 3 dioxygenase deficient mutant host cells no longer inhibit intracellular C Yarrydla spp or Toxoplasrra growth J Immunol 150 5529 5534 1993 81 MacKenzie C R Hadding U and Daubener W Interferon induced activation of indolearrine 2 3 dioxygenase in cord blood monocyte derived macrophages inhibits the growth of group B streptococci J Infect Dis 178 875 878 1998 82 Jerrells T R and Geng P The role of tumor necrosis factor in host defense against scrub typhus rickettsiae Differential induction of tumor necrosis 72 factor alpha production by Rickettsia tsutsugamushi and Rickettsia Microbiol Invrunol 38 713 719 1994 83 Kim M K and Kang J S tsutsugarrushi suppresses the production of inflarrrretory cytokines induced by its own heat stable corrponent in murine macrophages Microb Pathog 31 145 150 2001 84 Ree H l Kim T E Lee Y Jeon S H Hwang U W Chang W H Determination and geographical distribution of Orientia tsutsugamushi serotypes in Korea by nested polymerase chain reaction Am J Trop Med Hyg 65 528 534 2001 85 Wess E and Moulder J W Order Rickettsiales In Krieg
43. 00 00 D 0060 0 17000000000 O 5 pH9 50 0 pu gpapggauggnunuununuununupngugpnapnagnpau PBS 0 J I I J 0 10 850 0 Invwtrdj innpnnnnnnmnnmnnnmna Chamber slide DOOOUOOOO000000000000U0000000 025m0 000 50 CoN 00 0 37 2000000000000 05mg 000 50 Codi n 00 37 INFON 55 42 00 041 000000000 7 wtr gogogo ooog Kur oki Kavasaki 000 n 96 1 17 0 105 64 8 000 7 115 6 18 5 234 1 36 0 000000 20uii ts nh 0 0 200000000 10 00 amp 0 0 56 10000000 42 1 0000 etg TNF l pnnugunggupnpnpnpnnpeeununa unpng 0000 56 22 6 0 0 1000000000000 00000 41000000000000 Giltiamg Kent OD D UD U U TNFDDDUDGOCUUO 00 U DU 0 DKeaweseki 0 Kuroki 422 TNET
44. 10000 OD0 0000000000000000000000000 0 0 10 0 00000000000 2000000000000 1DICUU ooo 0000000010000 0 00000000 144080000 10000 W20000000000000000000000000d 148100 0000000 000000 1000000000 20000000 0000000000000000 00 0000000 u1iccug 0 0 Kurki 200 0 00000 40040000000000000000 1481000000 00000 0000000 H daa not Krk euo phagosord vacuole 20 Kuroki N 00000000 0 000000000000000000000 0000 K
45. D 1657 uiuauuuuuuvweesagggagaggagaagaugtg 830 00 0000 Gillian Kato Kawasaki Shimokoshi 16SrRNA 0000 000 985 0000 00000 0 0 0 0 0 0 0 0 0 0 0 0 0 0 00 R typhi R rickettsi R sibiricat 0000 98 198 0000000 uggagaggaaggguaaggaggguagudu 9037190 500 00 0 0 0 00 0 000 0 000 0 0 00 0 0 000 uggaaggaagggagmguagagnmauuguudulull 16SrRNA 0 Tamra 00 Ot Genus Rickettsia 000000 00000 000000000 00 Orient ia 000000000 Oriet a tsutsugamushil 1 000 1000 00000 III U Dpu gagpnapgaamiuuagupnapipnpgpoguaogugoudut cilia 00 35 0 0 00 0 19800 0 0 00 0000 0 0 00000 00 0 0000 00000000 300000000000 Kawssaki 37 Kuroki 38 O Shimokoshi 33 0 OOO D HD B dL D B D UD U D 0 Ctr 000000000000000 Gillian 00
46. I Hi D LH D OLD HH l 00000 22 3 1 O0 Gilliam D O 000 0 BALB c BALB cOOOOO0000000 Kuroki D nvtvo O00 wtro III 00 0000 2 Groves 470000000 uggmugugugggpnnpnuuupBauguggugggpnsupnupggpgdgidgut 00 Kuroki Kuroki lU Ul 5 amp 00059 0 192900 0 240 00000000000000000600 Ot UI L
47. Kawssski Kuroki 0000 00 400 0 00 0 0 Karp Kato JG L JPQ Kuroki Shimokoshi 0 O0 0000000000000 00000000000 90 Lx 10 0 L 10 9100 00000 0 0 0 0 0 000 Gilian Kap 30000000
48. MEM 00 D MEM Dounce 000000 Kontes Glass Co Vineland NJ usag 00000000000000 0 0 200 1000 00 00000 00 0000000000000 29290 0000 00000 0 00000 00200 uggggggagaaggguguagugaguauaugagututtl a utttttu ugggagaadaatuttttll ul 0 00 infected cel counting units ICU 1 259 0000000000000 0 19290 000 000 5m0 0 00000 000 0 0 0 00000 0 00000 0000000 FBS 0 OOO 100000000000000000 0 25m charrber slidd 0000 09290 000000 40005 coN 000 a qdiuuuggguuagaagaagmguuuudaeesatuttttitcurn n 0 000 well 1 0 0 0 0 0 B B 0 0 0 Ox 20 29 0000000000 050 zi 80000 BALB d D 0000 0000000400000000 0 400 HOODOO fo 00000000000 kuokQ 000000000000 00 OO OOOOUO0O00U00000000U000000000000000 PBS 0 10 uggggaagagiuuagagaag 50000000000000 uggggggaagugugugaguggaugiuagdag otoo 10111 59 510 100 1010 0000000000000000 300000000000 ugggggagaguuggaaagngggguggaugadaaggu 000000 0 31 20 750 1250 000000000000000 inununununmunmmmmmimmiuuiiis Chamber slid 0 0000000000000000 Ott j H 025m0 50 CO 0 0 37 20000000000000000000 00000000000000 05mg 000 50
49. OTNFO IL 1a 00000000000 0 00 Gillian 00 00000 Kaweseki 9 0 0 O Gillian Kuroki Kawasaki D E D HH D J D 1 I 92910 0000000 2 2 221 Kuroki 000000000 000000 00 21 Kuroki CUL 29 15 NMMA NUMA pe B Karp infected Kuroki infected control 2 6h id 2d 4d 5d 6h 1d 2d 3d 4d 5d After infection After infection z 3 e NMMA g 0 NMMA o Kuroki NMMA S Kuroki NMMA o 2 Days after infection 2 1 NS mononethyl L arginine NMMA ugeegmuaummaauu Kuroki NO A NMMA OOO NO 08 NO
50. 00 Gilliam 0 0 40 JGOO 0000000 Kawasaki Kuroki Shimokoshi JG JPL 6000000 OO 0 400 Gillian Karp 3 420 1390000000 OOO Kuroki Kawesaki 5 5 00000000000000000000000 0 Gillian Karp Kato 3 OO O00 00 OO Kawesek Kuroki Shimokoshi 3000000000000 western 5ear nut 25 40000 0 00 5ebarn nnb utu lID l
51. 0000 uauguauduuaitdutelutlututu tL LLELELELELEL 000 DL EL IL 1a recombinant TNFa recombinant IL 1a 1 1 I 00000 TNFa 0 IL laQQOOO0U0U0U0000U0000U00U0UUOO 0000000 0000 0000000 0000 000 00000 O TNFa 0000 1 16 l 0 000 28000 0000000 2500000000000000 00000 0 00 0 0000 0000 Recombinant TNFa 0000 IL 12 nd 00 000020 0000000000 000000000000000 000 Reconrbinat 0 IL 1 a 00 Kuroki 000 22B000 25000000 0000000 28 TNF IL OtUHOOUOUOUO0O000000000 1929 DO0O000000000000000000000000 1004 10 4 910 0000000 200 210 FBS 100 00000 0 00 00000 000000000 19290 00000000000 180 2400 50 CO2U l 0 00000000 09 1 0 000 99535 00000000 0000000 3000000 1004 1 0 0253 NaOH 0000000000 00000 630 501 00000000000 OO IL la 0 0 0 0 O enzyme linked immunosorbent assay kit Genzyrre Co Cambridge Mass JO O tsutsugamushi OO 000000000000 0 0 0 0 0 Kurokig 0 0 O
52. 000000 80000000000000 000 22000000000 00000000 KkuoklifGOO0000000000000000000O uuummumnaaaagaaaggagnnaaaagaagagggudugetenpnaadaudud 00000000 300000000000000000000000000 uuuunnnnpnuuuunununnnnnuuuunununnnunuuuuun uummmnnaaaadagdg OLIIUUUUDUDUDUDUDUDUUUDUUUUOLIDUUUSuNu UUUDUDUDUDUUUDU 0 TNFa 0 IFN y 00000000000 0 auo phagosonel vecuole 00000 660 0 000 0000 monocytogenes 0000000000000000000 0000000000 auo phagosora vacule 0 000000000 6700 000000 DL D auto phagosorral vacuole 0 000000 Kuroki 1 0000 uummnmnpnoteuuuug L29Q00000000000000000000 uguggaguddagkuwesnnniut etn 0000 I 0O auo phagosorel vecuole 000000000 680 0 0 0 00000 00 000 00000 Ot auto phagocytosis 1l HH HH 0 0H BH B B BE DE C E HE I U 0 OOOO0000 KurokiQ BALB cQOOO00000000 uguugggggagamngnuugugguugagagagaaangmmuuudtgtdtt ugggggggggagaagagguuuutut Kurokil 00000000 00000000000 00000000000 24 ugggugugugggpnpnpnuuupbBuguggugggpnmupnudggigdgi gut 0 0000000060 25 000 0000000000000 O tsutsugamushi 26 000000000
53. 000000000 pu gagpnapngug 0 0 SDS PAGE 0 4 4 uumnpnpnnuugggnnnpnpnauuugggguiiii l Gillian Kar Kaor 30000 61 40 91 92 95 T Kawasaki Kuroki 9 0000 0000000000 00 4410 000000000000 000 0 00000 GiltianiKkarpp 000000000000 TQ 2 56 0 0000000 00 000000000000 silent mtetionQ nu D 0000000 pu gagpnapgagaaggpnanpg
54. 000000000000000 0 Kawasaki Kuroki 4 UUDUDDUDUUDUDUDDUDBDDUDDUDBDDUDUDBDDUDUDBDDUDD 2 2 223 00000 400000000000 IL lo NO 0 400000000000000000000000000 TNF JIL QNO 228900000 00 Giliam DO D D U D U U KurokiQ 0 0000000 4 800000000 0 0 228010 000000 IL t1a 0 00 31 19110679157 0 0 4h 8h 12h 1d 2d 3d 4d 4 LO S 50 O O 42 Cu 8c lt c o uz amp 40 o gt G Q T annn IN 93U3IN Sd INNSSNNSENNSENNSENNSENNNNNNNENNNENNSNNNNNNNNNNNNNNNNNNNNNNENNNENNNENNNENNNNN xd 4h 8h 12h id 2d 4d 4h 8h 12h 1d 2d 3d 4d E 6G o O A C o 8c lt d day After infection h hour Bl indicate Karp infection WF indicate Gilliam infection TF E indicate Kuroki infection O Z indicate Kawasaki infection L indicate mock infected cell indicate TNF of less than 20 units mL 022 0 0000000000 TNF IL 1
55. 2x 10 1 38x 10 ddy 2 14x 10 912x105 cGHHj 3 16x 10 Kato 1 07 10 1 07x 10 1 49x 109 ddy gt 3 16x 10 9 33 10 CGHHj 3 16x 10 Kawasaki 8 26 107 BALB c 8 32x 10 ddy AL 3 99x10 GHH AL Kur oki 149x100 AL 2 24x 109 8 71 10 CGHHj AL Shi nokoshi 5 76x10 AL 4 90x 10 917 0 0 D 0 Gilliari Kato Kawesaki Kuroki Shimokoshi 1 600 BALB c OOHOUOOU000LD 000000000000000 ddi C3H HAD 00000000000 32 60 00000000 axeicun oo 00000 BALB dT 00000 0000 0 LI Gilliam Kato 30000 00000 100 100 1050 0000000000 ddp d p 0000 ODO000COCO0O000C000000000000000000 00 0O Kuroki 0 0 B 0 0 O BALB c ddY C3H He E O E 0 0 Shinokoshi Lb41 000 BALB c O 0 0 LD D 7I UU 0 00 0 0 00 000 0000 Karp Gilliam Kuroki 0 400000000000000 49 s100000000000000000000 0 4000 0000000 6000000000000 III lI O LD 0 100 000000 000000000000000 00 Gillian Karp Kator
56. DL U 0000 OtO 505 41 Gilliam D DO U 0 B D U D 00000 TNFD EO UO 7 BU D 000 0 Kaweseki Kuroki pu gagpnapngaggnpusi4 4Kbepnn nano d DO D 1200000 OOO 10000 00000 000 0 0000 000000000 43 4 43 Gillian Kapil I 0 1 D UD U SDSPAGE D D U D 56 QuigkTimey C 2 yt u TIFFAILZWAj LigevEcEOEaEA C G CAESENE CAAAOCEQZQ AC COIK vC C AB 0 41 otg SDSPAGEG LH HH HH D D D D D KP Karp G Gilliam KR Kuroki KW Kawasaki 00 Kuroki Kawasaki OONOORWON 20 25 20 25 30 TNF units mL TNF units mL 42 Kuroki 00 00 TNF IL 00000000000 41000000000 57 TNF 43 4 10
57. Ikeda 0000 pu gagpnapganupngagurwpppngagupnungpnagnanu 100 100 00000000000000 00000000 4000000000000 060 Kuroki Shimokoshi Matsuzawa shbuyajt upnggsnggapngupnagupagugdutdgdbouTNF O O O33 OQUQ0000000000000000000 NHOUOOUCOCCOOO 0000 Strai ns Goth 2 Tw 2 LD so Type Gilliam 1 78x 101 G Karp 5 62x 10 3 KP Kato 1 00x 105 2 KT keda 1 07x 107 3 JG Kavasaki 162 4 13 2 AU KW Kur oki 120 5 12 1 AL 3 KR Shi nokoshi 81 2 3 3 AL S Mat suzava 123 4 12 7 AL JP Shi buya 73 4 3 5 AL JP Fui 4 10 3 AL Fui i LX 1 73 1 5 6 AL LX 004000000 900000 00 1 0000 2 00 60000 0 0 0 lt 0 units nh 3 4 M a 100000000000 ASL umn nm DE OU 50 Ut 40000000000 7000000000000000000 32 00 000000 500000000 C3H Hef ddyo O OOOO LD0 l 0000000000 0 BALB c 0 00 D Gillian Karp
58. Kuroki QOOOO000000000000000000 uggagaugaaggauaggguguaganu uggaaggaaggauugaaggguaggagagmuaudamdu etn rm u 000 iliam UO U D DI U U D DU 0000000 0000 00000 uggagamgasanuuuaaggaaggguagnuu UUUOUUUUUUUO uggaamgaagguaguuudaagNormudattleldttulddtttlu uggggagaaggwog Acketsa 661 Coxiella burneti 691 Ehrlichia ristic 70 D D B d OE BE E 000 Lste7anmenocytogen s 717 O 0 0 0 0O O herpes simplex virus type I 720 uggaamugaamuugaaugaamggu uduu CUL BALB cOOOOUO0O0000000 00000000000 iliam 000000 uuummaubiuuuuutuiubtuieatiututurtutdteautdtegttel Lte u tL uggaaungaaggguaggsanuagguaguguagmadgan etr uggagaggaggaggugaunagagaaguaguueatludre u edid tr tu OD0O0000000CO0O00000000000000 TNFoT IL 1o 00000 00000000000 00 73 740TNFo 10 120 IFN y I D UH 0 Mycobacterium tuberculosis Leishmania major L monoc
59. Orientia tsutsugamushi OOOO uguugduuuutuutuiit 2006 UU UU UU OU 1 lU UH 2 000 ormnentiatsutsugamush in invto t 0d ubt 0000000 0000000000000000000000 11 OOO 0000000000000 O utsugarasht 0000000 00000 00000000000000000000000 26 tsutsugamushi 00000000 46 000 tsutsugamushi 00000000 53 UU eo 0000 6 OOOO BpnupupunununnupupnunapnapnmnpBpnapnagpnun 78 in uu 4 200000000 0 Aecketsa tsutsugamushi 00000000 1995 0000 OnetiaQ O O00 Or ent a tsutsugamushi Ott 0000000030 UUIUDDUDBDUUDDUDBDUUDDUBDBDBUDUDBDUUDUDBDUUDU195 I 0 ugggugugugggpnpnpnuuupgBaugggupgggpnmupnudgigdi gut 0 0000 00 0 00000 00000 0 0 0 1946
60. U 7 OOO 1 UI L 414000000000 Karp 0003000000 600000 100000 2000000000000 30000 6000000 00000000 1 1 000000000 Kuroki 0000000 40000000000000000000000 OO U 1 4 1 18110 0 11 10 00000 Kuroki 0000 300000 000000000 0000000000 QOOOOO0O000000000 8000 4000000 500000000 400000000000000000 OOO 14
61. U lll astu 205 4 lU UL 000 0 0 0000000000000 0000000000 Ot 00000000 300000000000 510000000000 Otono 0002 0000000 00 03400000 00 0 003 000 5 600 Takahashi
62. acrophages 7 vitro and its effect upon macrophages n vivo J Exp Med 171 1931 1942 1990 69 53 55 56 5 58 59 61 62 63 Shirai A Catanzaro J Phillips S M and Osterman J V Host defenses experimental scrub typhus role of cellular inmrunity in heterologous protection Infect Immun 14 39 46 1976 C A and Osterman J V Host Defenses in Experimental Scrub Typhus Role of Normal and Activated Macrophages Infect Irmrun 26 744 750 1979 Catanzaro P J Shirai A Hilderbrandt P K and Osterman J V Host defenses in experimental scrub typhus histopathological correlates Infect Irmrun 13 861 875 1976 Yun J H Koh Y S Lee K H Hyun J W Choi Y J Jang W J Park K H Cho N H Seong S Y Choi M S and Kim S Chemokine and cytokine production in susceptible C3H mice and resistant BALB c during Orzent a tsutsugamushi infection Microbiol Immunol 49 551 557 2005 Kobayashi Y Kawamura S and Oyana T Immunological studies of experimental Tsutsugarrushi disease in congenitally athymic nude rice Am J Trop Med Hyg 34 568 577 1987 Ewing E P Jr Takeuchi A Shirai A and Osterman J V Experimental infection of mouse peritoneal mesothelium wth scrub typhus rickettsiae an ultrastructural study Infect Irrrrun 19 1068 1075 1978 Rikihisa Y and Ito S Entry of Aickett
63. and the vertical transmission of Rickettsia tsutsugamushi Leototrorbidium pallidum pn J Med Sci Biol 47 127 139 1994 1 0000 00000000000000 000000 304 43 49 1982 12 0000 00000 00 0 0 0 00000 00000 0 0 00000 0 000 30 10 17 1982 13 00000 000 00000 0 0000 0 0 0 000 0000 00000 000000 Aicketsia tsutsugamushi 0000000 000000 es 109 117 1989 65 14 Woodrran D R Grays R and Weiss E Improved chicken errbryo cell culture plaque assay for scrub typhus rickettsiae J Clin Microbiol 6 639 641 1977 15 Urareki H Tsuruhara T and Tamura A Electron microscopic studies on intracellular multiplication of Rickettsia tsutsugamushi in L cells Microbiol Imrrunol 28 1191 1201 1984 16 Moree M F and Hanson B Growth characteristics and proteins of plaque purified strains of Ayckettsia tsutsugamushi Infect Immun 60 3405 3415 1992 17 and H Easy method for infectivity titration of Rickettsia tsutsugamushi by infected cell counting Nippon Saikingaku Zasshi 36 783 785 1981 18 Dasch G A and Weiss E Characterization of the Madrid E strain of Rickettsia purified by renografin density gradient centrifugation Infect Irmrun 15 280 286 1977 19 Weiss E Coolbaugh J C and Willians J C Separation of viable Rickettsia typhi from yolk sac L cell host components by renografin density gradient centrifugation A
64. gu uuggggnmmumua dkegpunt 000 Kuroki 000000 124 OtOOO0000000 929000000600 100000 00 00 000000000000000000000000000000000 000000000000000 0000000000000 t0000 0000000000000000 0 00 Kapi 0 0 Kurokig OO00000000000000000000000000 1 1000000 0000000000000 0000000000000 0000000000000 30 0000000 reas ik oea 00 1438000000000 0000000000000 0000000000000 000000000000 ot 0000000000000 00000000 ram 0000000000 0000000000000 19 240 00 90000007 0 1 3 00 1 000000000 0000000006060 000000 onnunnnmungngng 000000000 0 00000 0 000000000000000000000000 200 0 000000000000000000 OO Kuroki 00000 05
65. hi from 73 92 93 95 97 Leototrorbidium fui and its characterization Microbiol Immunol 44 201 204 2000 Tamura A Yarrarroto N Koyama S Makisaka Y Takahashi M Urabe K Takaoka M Nakazawa K Urakami H and Fukuhara M Epidemiological survey of Orientia tsutsugamushi distribution in field rodents in Saitana Prefecture Japan and discovery of a new type Microbiol Inmunol 45 439 446 2001 Shirai A Robinson D M Brown G W Gan E and Huxsoll D Antigenic analysis by direct immunofluorescence of 114 isolates of Rickettsia tsutsugamushi recovered from febrile patients in rural Malaysia J pn J Med Sci Biol 32 337 344 1979 Tamura A Ohashi N Koyarra Y Fukuhara M Kawarrori F Otsuru M Wu F and Lin S Y Characterization of Or entia tsutsugarrushi isolated in Taiwan by inmunofluorescence and restriction fragment length polymorphism analyses FEMS Microbiol Lett 150 225 231 1997 Tamura A Makisaka Y Enatsu T H Okubo K Fukuhara M and Mahara F Isolation of Orzent a tsutsugamushi from patients in Shikoku and finding of a strain which grows preferentially at low temperatures Microbiol Immunol 43 979 981 1999 Yamamoto S Kawabata N Ooura K Murata M and Minarrishirra Y Antigenic types of Rickettsia tsutsugamushi isolated from patients wth Tsutsugamushi fever and their distribution in Miyazaki P
66. mretory exudate and enhance the growth of monocytogenes in various organs J Infect Dis 170 234 237 1994 71 74 Svanborg C Godaly G and Hedlund M Cytokine responses during mucosal infections role in disease pathogenesis and host defence Curr Opin Microbiol 2 99 105 1999 75 Cho H Lasco T M Allen S S Yoshimura T and McMurray D N Recombinant guinea pig turror necrosis factor alpha stimulates the expression of interleukin 12 and the inhibition of Mycobacterium tuberculosis growth in macrophages Infect 73 1367 1376 2005 76 Kemp K Hviid L Kharazmi A and Kerrp M Interferon production by humen T cells and natural killer cells in vitro in response to antigens from the two intracellular pathogens Mycobacterium tuberculosis and Leishrrania major Scand J Immunol 46 495 499 1997 77 Ladd C H Blum C and Kaufrrann S H Control of natural killer cal mediated innate resistance against the intracellular pathogen monocytogenes by ganny delta T lymphocytes Infect Immun 64 1744 1749 1996 78 Carlin J M and Weller J B Potentiation of interferon mediated inhibition of Chlamydia infection by interleukin 1 in hunan macrophage cultures Infect Immun 63 1870 1875 1995 79 Sarrrento A and Appelberg R Involverrent of reactive oxygen intermediates in tumor necrosis factor alpha dependent bacteriostasis of Mycobacterium
67. ntigenic and genotypic variation in Orientia tsutsugamushi which were isolated in J apan and their classification into type and subtype Microbiol Imrrunol 40 627 638 1996 41 0000000000000 0000000000000000600 00000 2760 155 160 1922 42 Kobayashi Y Tachibana N Matsumoto 1 Oyane T and T Isolation of very low virulent strain of Rickettsia tsutsugamushi by the use of cyclophospharide treated mice 181 188 In Kazar l Ormsbee R A Tarasevich N eds Rickettsiae and rickettsial diseases VEDA Publ House Slovak Akad Sci Bratislava 1978 43 Murata M Yoshida Y Osono M Ohashi N Oyanagi M H Tamura A Nogami S Tanaka H and Kawamura A Jr Production and characterization of monoclonal strain specific antibodies against prototype 68 strains of Rickettsia tsutsugamushi Microbiol Inrrunol 30 599 610 1986 44 0000 0000 0000 00000000000000000000 0000000000 0 000000000 000006000 00 O 9 39 1952 45 Kawamura A Jr Murata M Osono M Nogami S Shirasaka A Tanaka H Sudo K Suzuki K Miyairi T and Kijina H Sutadies on inapparent infection of Tsutsugarrushi disease in Izu Shichito seroepiderriology and demonstration of an avirulent rickettsia strain for mice Jpn J Exp Med 50 91 105 1980 46 Fan M Y Walker D H Yu S R
68. oka M Nakazawa K Urakam H and Fukuhara M Epidemiological survey of Orientia tsutsugamushi distribution in field rodents Prefecture Japan and discovery of a new type Microbiol Invrunol 45 439 446 2001 3 Tamura A Makisaka Y Enatsu T Urakam H Okubo K Fukuhara M and Mahara F Isolation of Orientia tsutsugamushi from patients in Shikoku and finding of a strain which grows preferentially at low temperatures Microbiol Immunol 43 979 981 1999 4 Tamura A Ohashi N Koyarra Y Fukuhara M Kawarrori F Otsuru M Wu P F and Lin S Y Characterization of Orzent a tsutsugamushi isolated in Taiwan by immunofluorescence and restriction fragment length polymorphism analyses FEMS Microbiol Lett 150 225 231 1997 5 Ohashi N Koyarra Y Urakarri H Fukuhara M Tamura A Kawervori F Yarramoto S Kasuya S and Yoshimura K Derronstration of antigenic and genotypic variation in Orzent a tsutsugamushi which were isolated in Japan and their classification into type and subtype Microbiol Irmrunol 40 627 638 1996 6 Ohashi N Fukuhara M Shimada M and Tamura A Phylogenetic position of Rickettsia tsutsugamushi and the relationship among its antigenic variants by analyses of 165 rRNA gene sequences FEMS Microbiol Lett 125 299 304 1995 000000 1 Rebets Y Ostash B Luzhetskyy A Kushnir S Fukuhara M Bechthold A Nashirroto M Nakamura
69. ppl Microbiol 30 456 463 1975 20 Tamura A Urakami H and Tsuruhara T Purification of Aickettsia tsutsugamushi by Percall density gradient centrifugation Microbiol Immunol 26 321 328 1982 21 Tsuruhara T Urakarri H and Tamura A Surface morphology of Rickettsia tsutsugarrushr infected mouse fibroblast Acta Virol 26 506 511 1982 22 Urakami H Tsuruhara T and Tamura A Intracuclear Alckettsia tsutsugarrushi in cultured mouse fibroblasts L cells Microbiol Immunol 26 445 447 1982 23 H Tsuruhara T and Tamura A Observations of the same whole cells infected wth A cketts a tsutsugamushi by means of transmission and scanning electron rricroscopy J Electron Microscopy 31 212 215 1982 24 Urakam H Tsuruhara T and Tamura A Penetration of Rickettsia tsutsugamushi into cultured mouse fibroblasts L cells an electron microscopic observation Microbiol Immunol 27 251 263 1983 25 Tamura A Ohashi N H Takahashi K and Oyanag M Analysis 66 26 27 28 29 31 32 33 35 of polypeptide conposition and antigenic components of Rickettsia tsutsugarrushi by polyacrylarride gel electrophoresis and intrunoblotting Infect Imrrun 48 671 675 1985 Tamura A Urakami H and Ohashi N A view of Rickettsia tsutsugamushi and the other groups of rickettsiae Eur J Epidemiol 7 259 269 1990
70. refecture J Japan Assoc Infect Dis 63 109 117 1989 Urakami H Takahashi M Misumi H Okubo K Enatsu T and Tamura A Detection isolation and characterization of Orientia tsutsugamushi in Leototronbidiuminterredium Med Entorrol Zool 51 169 177 2000 Lin M and Rikihisa Y E riichia chaffeensis downregulates surface Toll like receptors 2 4 CD14 and transcription factors PU 1 and inhibits lipopolysaccharide activation of NF kappa B ERK 1 2 and p38 MAPK in host rronocytes Cell Microbiol 6 175 187 2004 Boland A and Cornelis G R Role of YopP in suppression of turror necrosis factor alpha release by macrophages during Yers ryainfection Infect Inmrun 66 74 100 101 102 103 104 105 106 107 108 1878 1884 1998 Uehara A Sugawara S and Takada H Priming of hunen oral epithelial cells interferon gamma to secrete cytokines in response to lipopolysaccharides lipoteichoic acids and peptidoglycans J Med Microbiol 51 626 634 2002 Mendoza F Melendro E Baltazares M Banales J L C Chapela R and Selman M Cellular immune response to fractionated avian antigens by peripheral blood mononuclear cells from patients with pigeon breeder s disease J Lab Clin Med 127 23 28 1996 Steinitz M and Tamir S An improved method to create nitrocellulose particles suitable for the irmrobilization of antigen and an
71. sia tsutsugarrush into polyrrorphonuclear leukocytes Infect Irrrrun 38 343 350 1982 Urakami H Tsuruhara T and Tamura A Electron microscopic studies on intracellular multiplication of Rickettsia tsutsugamushi in L cells Microbiol Immunol 28 1191 1201 1984 Urakarr H Tsuruhara T and A Penetration of Rickettsia tsutsugarrushi into cultured mouse fibroblasts L cells an electron microscopic observation Microbiol Irmrunol 27 251 263 1983 Koh Y S Yun J H Seong S Y Choi M S and Kim S Chemokine and cytokine production during Orzent a tsutsugamushi infection in mice Microb Pathog 36 51 57 2004 Cho N H Seong S Y Huh M S Han T H Koh Y S Choi M S and Kim 1 S Expression of chemokine genes in murine macrophages infected wth 70 65 67 69 70 71 72 Orientia tsutsugamushi Infect Immun 68 594 602 2000 Baogolini M Dewald B and Moser B Interleukin 8 and relatedcherrotactic cytokines CXC and CC cherrokines Adv Immunol 55 97 179 1994 Geng P and Jerrells T R The role of turror necrosis factor in host defense against scrub typhus rickettsiae Inhibition of growth of Rickettsia tsutsugamushi Karp strain in cultured murine errbryonic cells and macrophages by recombinant turror necrosis factor alpha Microbiol Immunol 38 703 711 1994 Walker D H Popov V L Crocquet Valdes P A
72. st P Differential regulation of inflanrretory cytokine secretion by 75 109 110 111 112 hunen dendritic cells upon Chlarrydia trachomatis infection Infect Immun 72 7231 7239 2004 Ohashi N Tamura and Suto T lImmunoblotting analysis of anti rickettsial antibodies produced in patients of Tsutsugamushi disease Microbiol Immunol 32 1085 1092 1988 Niu D Chen W Zhang X Chen M Cui H Wei W Wen B and Chen X Immunogenicity of 40kDa fragment of the 47kDa recombinant protein and DNA vaccine from Karp strain of Or entia tsutsugamushi N Y Acad Sci 990 527 534 2003 Oaks E V Rice R M Kelly D J and Stover C K Antigenic and genetic relatedness of eight Rickettsia tsutsugamushi antigens Infect Immun 57 3116 3122 1989 Yu Y Wen B Wen B Niu D Chen M and Qiu L Induction of protective immunity against scrub typhus wth a 56 kilodalton recombinant antigen fused wth a 47 kilodalton antigen of Orientia tsutsugamushi Karp Am J Trop Med Hyg 72 458 464 2005 76 0000 LU LU 1 Fukuhara M Fukazawe M Tamura A Nakamura T and Urakarri H Survival of two Orientia tsutsugamushi bacterial strains that infect mouse macrophages wth varying degrees of virulence Microbial Pathogenesis 39 177 187 2005 2 Tamura A Yararroto N S Makisaka Y Takahashi M Urabe K Taka
73. ta Proteus etes mrabisOXKOOOOOOO0U000000g 610000000 929 HeLa Vero 130 pDna gemmppngagagupnpnaupnaupnapngebpnmnanpnmnabpgnmnnpu 000001400000000 15 610 00000000000000000 03000000 19290 000000000000 1 00000 0000000000 R rickettsiy 0000000 18 13 nrnoetmnd 0000 etu 00000000 200 Aj otn mnn HOUUUUUUUUUUUUUUO HOUUUUUUUUUUUOUUUO 0
74. tibody J Immunol Methods 187 171 177 1995 B Thieblerront N Quesniaux V J Brown N Mpagi J Miyake K Bihl F and Ryffel B Toll like receptor 4 expression is required to control chronic Mycobacterium tuberculosis infection in mice J Immunol 169 3155 3162 2002 Leveque G Forgetta V Morroll S Smith A L Burrstead N Barrow P Loredo Osti J C Morgan K and Malo D Allelic variation in 7244 is linked to susceptibility to Salmonella enterica serovar Typhimurium infection in chickens Infect Irmrun 71 1116 1124 2003 Akamine M Higa F Arakaki N Kawakami K Takeda K Akira S and Saito A Differential roles of Toll like receptors 2 and 4 in n vitro responses of macrophages to Legronella pneumophila Infect Inmrun 73 352 361 2005 Torres D Barrier M Bihl F Quesniaux V J Maillet 1 Akira S Ryffel B and Erard F Toll like receptor 2 is required for optirral control of Listeria monocytogenes infection Infect Immun 72 2131 2139 2004 O Connell R M Vaidya S A Perry A K Saha S K Derrpsey P W and Cheng G Immune activation of type IFNs by Z ster a monocytogenes occurs independently of TLR4 TLR2 and receptor interacting protein 2 but involves TNFR associated NF kappa B kinase binding kinase 1 J Immunol 174 1602 1607 2005 Gervassi A Alderson M R Suchland R Maisonneuve J F Grabstein K H and Prob
75. ttsia tsutsugamushi in new genus Or entia gen nov as Orentia tsutsugamushi conb nov Int J Syst Bacteriol 45 589 591 1995 Shishido A Hikita M Sato T and Kohno S Particulate and soluble 67 antigens of Rickettsia tsutsugarrushi in the complement fixation test J Immunol 103 480 490 1969 36 Shishido A Kono S Hikita M lida T and Kaweshirra H Corrplement fixation and direct immunofluorescence for typing of tsutsugarrushi disease rickettsia Acta Med Biol Niigata 15 87 95 1967 37 Yarramoto S Kawabata N Tamura A Urakarri H Ohashi N Murata M Yoshida Y and Kawamura A Jr Immunologcal properties of Rickettsia tsutsugamushi Kawasaki strain isolated from a patient in Kyushu Microbiol Immunol 30 611 20 1986 38 Ohashi N Tamura A Sakurai H and S Characterization of a new antigenic type Kuroki of Rickettsia tsutsugamushi isolated from a patient inJpn J Clin Microbiol 28 2111 2113 1990 39 Tamura A Takahashi K Tsuruhara T Urakarri H Miyamura S Sekikawa H Kenmotsu M Shibata M Abe S and H Isolation of Rickettsia tsutsugamushi antigenically different from Kato Karp and Gilliam strains from patients Microbiol Irmrunol 28 873 882 1984 40 Ohashi N Koyarra Y Urakarri H Fukuhara M Tarrura A Kawamori F S Kasuya S and Yoshirrura K Demonstration of a
76. uoki 00000000000 0000 14 nwvtrol 000 0000 ett t 4000 Kan B 00 4000 nu l 00 2000 nuvol tdtudutdzuutatdttdtrttr KuokilD 20 in 000000000000000 Kucoki E 00 4000 7 vtrop Kuroki 1 3 40 0000000 Kurki wvo 21 000000 UUIDUDDUDBUDUDUDDUDBDBDUDDUDBDDBUUDUDBDUDUUDDUuu Kapi td Kur ood 2000000000000000 Kuroki Kapi l 00000000 Kuki OO Kx
77. ut 00000 IL 12 2 8A JBI JE 2 1 150 30000 28d DIII NOOO 2000000 0 20 0000 0000 00 00 0 0 000 IL 1 IL 12 p NOQOUOO 226 It 10 0000000 IL 10 0 0 1 I 1e 0000 IL 14 00000000 reonbinant IL 000000000 00000000 Kuroki 0000 22CQO00000000000 080m D 2500000000000000 2ng m reconbinant IL 1o 0 OO O00 37 eengupgguagupna pngagaganuDnptlu recorbinat 000000000000000 2100 1 16 uumnpnpnpnuugggpgugiuii of tsutsugamushi A 1 Karp 2 Gilliam P 5 660 0 1 2 3 40 1 Days after infection Days after infection B 1 Karp B 2 2 3 4 Gilliam B 3 Uninfected TNF units mL 100 5801 500 420 340 260 1804 kp k p km kc h 1d 2 4d After infection h hour d day e treated with nomal rabbit serum 2 6 3 TALL
78. ytogenes 0000000000000 75 76 770 IL 10 BIEN v 000 B 00 00 B 7 U 00000 uggagaggaagggaaggaguaguetamuaatatldettluldttlu uggaamgageenguguagmuguagnunguaamgagudud etn ut uagaguugiututtutlutllutluitultluttluttlutllu uggageegaaunguungaugagmnguaagnmgagnuuduulut 27 TNFO OO00O0 0OOO0OOCOO0O0OO0OO O00 0000000000 21 00000 HO ugugagugaggaggaggaug udut utltL aerek 4 charrber slide well 5 COJ 000 37Q 00000 0000 00000 00 00000 11010 Chamber sidd 02510 0 00 20 000000000000000000000000 0000000 05m0 000 50 CO 00000000000 0 10000000000000 00 0 59 M NS monorrethyl L arginine 000000000000000000 0000000000000 0 8000 4 500 00 0 0 00 0 00 0 0 NO000 00 80 Q 0000 0 NOT O O O Griess Reagent Kit O0 00000
Download Pdf Manuals
Related Search