Home
本発明は、動物内に存在するまたは非生理的プロセスに関係する一つ
Contents
1.
2.
3.
4.
5. 5 000 000300
6. 100 100000000000000000000000000000 100000000000000000000000000000
7. 13000000000 0 0 ood 0 0 0 0 0 Jacobson in Inmunol mmunopathol 84 223 43 1997 10000000000
8. 9 00000000000000000000 1000 Krieg O Nature 3740 546 9 1995 CpG 0000000000000 10000000000000 HHHHHHHHHHHHHHHHHHHH 100000 00000 00000 0 CG HHHHHHHHHHHHHH 1100000000000000 10000000000000 HHHHHHHHHHHHHHHHHHHH 1000000 000
9. a a m Q L3 3 Fat u a _ C3 oo r3 3 r3 3 3 3 3 um EE n ES LL eh ET 3 3 3 Ca s 3 3 a mm 3 3 L3 r3 rJ e 3 C3 3 3 3 2022925 3 s
10. D IL 4 IL 10H HHHHHHTh2 HHHHHHHHHHH 00000000 0 DNO 0000001 500000000000 NODHHHHHHHHHHHHHHHHHHHHHHHHHHHH DO0000000000000000000000000000 TO 0O O O o coe 1000000000 2 DNA 0000 1M I DDM NOD Lt 100 70 000 0000000 000 100000 10 BGL 0 BGLO 2000 250ng dLHHHHHHHHHHHHHH 150 2nt 0 25 2000 50u 9 H 0 2ntLH PBSH
11. 40 2005 510533 2005 4 21 0 PLPH Hu 0 EAE 0 O PLP139 151 1 2 10 0 0 0 CFAD 0000 0 0 PLP139 1510 0 0 0 0 0 0 0 0 0 0 0 0 0 0 00 PLP139 151 U 00 11 5 0 5 0 pH 0 0081 0000 000 p 0 005 0000 0 00050 a 0000 0 PLP p139 151 w440 LO H1470 b PLP 10 0 p178 191 00000000000000000 100 WM 44 H
12. 0 300 0 1100000000000000000000000 0 2 HHHHHHHHHHHHHHHHHHHHp cDNA 70 340 00000000000000 200000 insB pcDNAHHHHHHHHHHHH20HHHHHHHHHHHHHHHXHHHHH pl 0 02 000 000 000 0 0000000000 000000000 0 14 i nsB pcDNAI 220000000000 pecDNA 0 insB pcDNAI 00003000000 ins B pcDNAI 0 012 pcDNAHHHHHHHHHHHHH0 035H 0 0 0 0360 nsB pcDNAI NODI ood 0 100000000007 0 NOD
13. DNA 1000 0000000000000 24000 200 000 00 0 10000000 0000000000001 50000 Od DNA 0000 0 1558 W NODH 0 0000000 0 15550 0 000 0 0 00 00 0 000 00 00 0 0 HHHHHIMH 100000000 000 100000000 PLP HHHHHHHHHHD PLP139 151100000 LN 10000000000 PLP139 1510 AQ 0 BO D 0O HHHHHHHHHH LN 10000000000 PLP139 15110000
14. Vaccine 18 1893 901 2000 O Robinson and Adv Virus Res 55 1 74 20000 0 DNA 100000000000000001000000001 1 20 11 12000 1 05 5 0000000000000 Wazlo and Er tl Arch Immunol Ther Exp 490 1 11 200100 B HHHHHHHHHHHHHHHHHHHHHHHHHHHHH DNAD Tinmernanl 0 Blood 970 1370 1377 20019 0 B DNAD 0 1000000000000000000000 0000 DNAHHHHHHHHHHHHHHHHHHHHHTHHHH 717000000000000000000
15. 0 TO 1000100 1L 100 110000 TN 100 1o 00800 RANTES Fas 0 1IH 10000 10000 20000 10000 3 Od 000000 30 T 100 2 5 NONE COMES 2 ES nn Od
16. N __ O E mm 3 Q 3 rc Ot um g C O E 3 3 3 a 3 3 C 3 Lj Ej 3 ot oO 3 O r3 3 reru ty m E r3 lt oO r3 a O I O lt Bs 3 3 Oo E372 37 o r3 O r3 pe m AEST 2 r3 3 _ D r r E s l S 3 O ec _ psp ES 3 3 Ej a 3 Oo a 3 L3 oO v O r3 583 3 r3 3 _ 3 3 Eso m r3 3 Lj 3 3 3 zz E O r3 r3 O _ lt Ez
17. EAE DNAD pCD 100000000000 DNA pCDNA3 CM SV 40 7110000000000 1000000000000 Q agen Endo free Qagen 0000000 PBS 10 000 0 0 0 05 o 0 250000000 Si gna 0 0 2 0 000000 0 DNA 1 9 nt DNA 2 UU UU cedi C3d
18. BUE E O 00000 0 X0 0 0 0 000 0 0000 3 n 5 0 0 0 0 X0 0 YO 0 0 0000 0 00000 0 3 0000 x000 Y H 00 0000000000000000 Xx 0000000000000 100000000000000 600000 000000001000000 10000008 0000 30 1000000 U lD Ul OUUU 65kDa 67kDa 100000000000000000000 1A2H 1A 2b HI U UJ U U gl i rra38 69kD p52 0i 9900000 N L1
19. 000 1000000000000 100 1M6 M5 10000 060 Ausubel Current Protocols in Mol ar Bi ol ogy Chs 2 and 40 Wley Intersci ence 1989 Mani ati Mol ecul ar Cl oni A Laboratory Manual Cold Spring Harbor Lab New York 1982 4 458 066 7 4 650 675H 00000 10000 0 0 IM5 ON CpGlHHHHHHHHHHHHHHH ISS ODN HHHHH
20. XnolH XDalH 0 0 lt 00000000000000000000000000 prARG ET Promega HHHHHHHHHHHHHHHHH 10000000000000000000000 DAD 0 0 pl us Maxi preps Pronegal 0 10000000000000000000000 05 mi DNAQ PBSH 1n9 nt PBS 0 1nt 0 250 10000000 1 912000000000000 100 10002000 1000000000000 0 05m LO O0 0 0 0 0 PBS H 119 90 PLP139 1510 0 2ng PBST 0 0 4n0 nt
21. 1000000 544 lU DNAD DNAH 0000000 DNI I I HH 10000000 5 19770 Proc Natl Acad Sci 74 5463 5467 DNAD DNAHH HH uu DNAD 000 1000000000000 00 20u HHHHHHHHHHHHHHHH 2 1 9 0 DNAD DNA 37 1 2 0 1000000 0 0 Hu 0 0 Me thods of Enzymol 650 499 560 19800 0 l l 50nM Tri s pH7 6 50nM Na
22. 10 10000000 1n n 0 0 RES DNA E 1 zs E Q agen Corporation DNAD 0 0 WOVE 100 DNAD 10000000 10000000 10000000 10000000 0000060 0 MBP SLE 10000000 0 000 T 10 20 30 50 2005 510533 2005 4 21
23. 1000000000 110100000 1000000000 14000000 BD HHHHHHHHHHHHHH HHHHHHHHHHIA2HHHHHHH HHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHH 2100000000000000000000 9900000 10 0000000000000 8000000 1000010000 HHHHHHHHHHHHHH 0001 hnRNP A2 RA33 Sa 9 39 I 1110 DIM MIM oO XO 00 0 0 0 HSP 6 600 RNA hnRNP B19 000000000004 000000000 19 1100000000000000000000000000000 1000000000 19900000 20 2100000000000000000000000000000 1000000000000 19000000 1100000001000 1 00000000000000000 65 1000000010000000000000000000000 00000 20000000000000000000000 190 0 30 1 PDC E2 74kDa POC 0 O0 0 0 0O E 30 00 2 OA 2 OCGDCH 000 0 20400
24. 71100000000000000000000000 SLE n RA m E 000000 0 0 Fox 99 82 88 1995 000 vs B 0000000000000 200 30H HHHHHHHHHHHHHHHHHHHHHH 10 S HK QD poA e nae Kn ORs S RE MS RA TNFa Mor el and J Rheunatol 28 1431 52 20001 TNFa 00000000000000000000000000000000 20 100000 100000 00000000000000000000000 Br ocke Nature 379 343 6 1996 Critchfi eld Sci ence 263 1139 43 19941 Annu Rev Immunol 12 809 37 19940 10000000000 1100000 Gumanovskaya munol 97 466 73 19991 MKow nO O Arthritis Rheum 42 1204 8 1999 Q Trent Sci ence 261 1727 30
25. CN m Sg 2 AMS m e ooo r3 ow 3 um x 3 N Fo oo _ 3 ED Lu 3 Ed 3 C3 CN E 3 On ono _ _ OOF ra le t Oo m 3 rrr lt 3 Oo C3 CO oO g EE mm 3 o c Ng oN O o 3 oO 1 5 lt r3 oO O 1 3 oO ui Ln E g 3 C3 3 Ej E m st 3 3 r3 3 3 C3 3 3 P ES o L3 E3 EJ 3 3 o 3 C3 r3 3 c 3 3 m 7 3 a 4 ME Roto Eel id 2 Lr gt 3 3 um 3 a 2 es L3 AS 3 a r3 N Cj 3 Oo Sc or ooo aS Ties C3 r3 gel Q Oo
26. NAg 0000000000000000000000000 100000000 5440 00000000001 ED EL i 0 0 5900000000 D 5 15 0 00 0000000000000 00 PBS 0 170 0 250 0 000 10000 2 0 MBP 4 0 pTARGET Promega Corp 0000 25 g IL 4 50u 90 pTARGETH DNAD uu DAJ 6HHHHH 0 0 0 5440 00000000000 200 LO PBSH D 50 100 1 50 0 6 100 1 4 6 DNAHHHHHIL 4H D Psp EP S e p ED EE SEDET GET BI EL
27. 34 2005 510533 2005 4 21 100000 10000000000000000000 100000000000000000000 Ausubel O0 1987 Current Protocols in Molecular Bi ol ogy Wl ey I ntersci ence ati 50 19920 in Molecular C oni ng A laboratory Manual Cold Spring Harbor Laboratory HHHHHHHHHHHHHHHHHHH
28. J ankovi Neurol 550 52 6 2000 1000000 o 0 00 0 HHHHHHHHHHHHHHHHHHHHHHHHHHHH CAG HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH Cell 72 971 983 19930 22 2005 510533 2005 4 21
29. EcoRIH 0 0 XpalH pcDNA3 10 Invitrogenl 10000000000000000000000000000000 DNA O0 O O Qiagen Endo free Qagenl 1000000000 30 4 NOD O O Taconic Farns 0 100000000 0000 30 40 PBS 1 0 0 05nt 00000000 0 25 000000 0 00 0 100000000 22 0 05ntH 0 0 0 0 0 DNAD 1 019 90 DNA 1000000002 Chenstri p Boehringer Ma nnhei nf 100000 One Touch 11 meter Johnson Johnson 1000000 250no dL 1000000 000000000000 00 1000000 10 504 n O0 O0 300000 000000000000000000 30 0 5 2000000000 11000 250 0 1000000 00 9 23 HHHHHHHHHHHHHHHH NOD 100 40 0 NOD 00000 0 0 50 0 25 48H 100u gt 0 0 0 00 0 0 DNAD
30. 100000 100000 10000000 CpG 0 DNA B Ps D Krieg O Nature 3740 546 549 19950 PNAS USAQ 930 2879 2883 19960 S ato O0 J Rheumatol 260 294 301 1999 CpG EH SEDE ceq 00000 100000 100000 CpG 10000 DNA 100000 CpG 1000 0 4940000000 CpG 000 EE PHH 10 100 6900000000000 0 100 1000000 LOVE ET EDD EB BE ET TD el mi UU 0 000000 0010000 10u 100u g 000 100000 12 0000 lt 00000000000000 02440 0000 108048000 0000000000000 DNA Elo a ie Ele E BIETET E 48 ugauguugagagauaugagagagugaduatl 504 57 2005 510533 2005 4 21
31. 0 O0 GVHD D l 1000 0 0 Bal b c H 2 0 D Bal b k H 2 lii Ep EE 1000000 DNA GVHD D D Balb c 0 00000000 MniMACS di MACSH Biotech KitH c Kit 2 800cGy Bal b 0000 000 000 GV H 2 1000000110 M 0000 DNA 10 3 GVHD M DNA rc PAR Ho UR c ee GVHD GVHD GVHD p 11000000000000 5400000000000 Moa a ERN 1000000000000 24 000 1000000 1000000000 GVHD 0000000 DNA DNAD II E GVHD 10000000000 000 1000000 000 00000000000 000 0 0 2440 0000000
32. IO LU U FOE Fo 00 2000000000 98 99 40 1000000000000 100000000 a 0000000 0 1 200000 30 2 1000 10000000 50000010 00000000 90 HH HHHHH U U 10000000000000000000 1000000000 0000000000000000000000 1420 IA 2B 65k 67kDaH HHHHHHHHHHHHHHHHHHGADHHHHHHHHHHH Lg O 000 69kDa CA690 0 p520 208 00000000000 c0 0 0 00000000 0000000000 50 19 2005 510533 2005 4 21 10000000 4000 0 0 000 0 00 0 00 0 40 3 HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH TNFa 100000
33. 00 00 1HHHHHHHHHHHHH 100 100 100 10010 Nogo Huber Schweb Biol Chem 381 407 19 20000 Reilly Neu 7 239 40 2000 Chen Nature 403 434 9 2000 90 100 10000000 90 Al 100 000000 HHHHHHHH Nogo U U JU UJU DU DD UU lU lU U Rain Proc Nat Acad Sci USA 98 6929 34 2001 MErkl er Neurosci 21 3665 7 Bl ochl Comp Neurol 433 426 36 20011 Br osant e J Neurosci 20 20000 000000000000000 1000000 1000000000 90 0 0 2700000000000 600000000 AS472H HHHHCHHHHHHHHHHHHHHHHHHHHHHHH
34. g o N R D DES EM os eu m EX alc AES gt oe er omn es E I T En ae ee E EE E pu s as O Ooo IN S PIE o_o s m 3 oO Lm 1 3 E 3 Exi 3 3 3 3 3 3 1 sf 3 E fe aid zar A ZP a WEE O n r3 r3 3 4 77 ue FJ EJ epa ee ee i 3 EJ m mE e Y e mE O _ zi Enc Co Ec EE oO e Oo 3 3 3 3 3 3 3 r3 EE Ei Seer C u BE r3 r3 oOo 3 3 3 3 r3 3 3 3 r3 og r3 3 3 3 3 3 3 3 3 L3 r3 ood r3 3 st 3 3 3 3 3 3 N oO poo r3 3 oN EU oOo lt 5 m Se TY
35. 10000000 00000000000 IHHHHHHHHHHHHHABHHHHHHDNAHHHHHHH 10000000000000000000 DNA PBSH 0 119 90 0000000 DNAH 50 LO HHHHHHHHHHHHHHIH CpG l 10 0 0 O 104 9900000000000 cedi 0000020 000000000 2 0 ugaagudgaguuudglul ultH u DNAD O 40 6 0010 ELISAH HH ABHHHHHHHHHHH HHHHHHHHHHHHHHH
36. FERE Nogo 1 ATPase 5HT2 Cr Afr e 9918 5HTa 5HTip HMG CoA A B 100 B 100 00000000000000 oap 6000 30000000000000000000 Ed E 0000000
37. 10000000 AD 10000000 Uu Games J Nature 3730 523 527 19950 Hsiaol O Sci ence 2740 99 10 1996 0000000000000 0 0 0 Nature 4080 98 985 2000 Schenk Nature 4000 173 177 1999 00000000000000 10000000000 0 DeMgtt 050 Proc Natl Acad Bard Nat Med 6 916 19 2000 ci USA 98 8850 8855 20011 H 10 1280 168 0000 Schrag Bm 3210 21 22 20000 0000000000000 Forno Norville Acta Neuropathol Ber a 0000000000000 Di ckson Curr Opi n Neurol 140 423 432 200 a HHHHHHHHHHHHHHH
38. 100000000 ELLs 0000000000000 DAJ 0000000 9HHHHHHHHHHHHHHHHHHHHHHHHHHH 100000000 550 00000000000 0 930750 Harlan G7BL 6H HHHHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHHHH DNAD Hod 0000 10 1000000000000000 100 04000000100 1000000000000 04400000 100000000000000 000 10 1100 100000 Del 1 30 100000000000000 Sal nen rthritis Rheum 440 947 955 2001 Ri nt al 0 J Anat 1900 201 208 19971 0 HHHHHHHHH 1000100000000 DNA 11000000 100001 1000000000000000 DNA Nogo All Nogo A 000 1000000000000000000000 000000000000000 0 20 0 00 66 AS472H 0 000000 lt 0000000 600 DNA 0 0000000000000 DNA 0 D
39. DN 46 2005 510533 2005 4 21
40. HHHHHHHHHHHHHHHHHHHHHHHHHHHH PCR Mul lis Methods Enzymol 1550 335 350 1987100000000 PLP g E 1000000000000 16 2 000000 PLP 139 151 5 CTCGAGACCATGCATIGTTTGGGAAAATGGCTAGGACATCCCGACA AGTTTTCTAGATAGCTA 3 PLP 139 151 L144 R147 5 CTCGAGACCATGCATTGTTTGGGAAAACTACTAGGACGCCCCGACAA GTTTTCTAGATAGCTA 3
41. O 0 O0 O0 LN 0000000000000 O 0 10u gmp 000 9 230 0000 NODHHHHHHLNUHHHHHH 10000 PCRH O O pcDNAD O 0 InsB pcDNAHHHHHHHHH10HHHH2 1000 5000 LNC 2 150000000000000 80 9 2 0000000 7200000000 nRNAH 0 PCR 000 10 10 nsB pcDNAI OD D pcDNA D 1000000 0000 DNA let OA Bo AE AE BHABHHHH HH 1 42 0 0 DNAD O00000 2000000 20 0 41000 ELI SA D 0 10000000000 000 B10 B4 IHHCpHHHHHHHHHHH 0 9nM 1000000 B50 1 A20 000000 0 EDTA D 10000 A5 0 000000 EDrA pTAR GETHHHHHHHHHHHHHHHHHHHHHHHHHH 10000000000 DNA EAE D 100000 57860 00000000000 MOGp35H 5 50 0 0 1000000000 DNA EAE 0 0 MAT 10000 100000 1510 EAE 0 770000 SJL J IHHIFAHHH0O 5ngHHHHHHHHH D PBSH OOD 100 g0 15100 0 0 1000000007 0 100000000000000000 1200000000000000 PBSH 1000 1710 0 25 10000000 20000 1000 0 2m TED MAG 10004 pTARGET 25 990000 IL 4 50u 90 0000000000600
42. 0 i 10000000000100000 BO 1000000000 1000000 83 97 Wucherpfenni 00 O J Clin Invest 100 1114 1122 1997 000 100000 500 000000000 TO 100000000 60 10000 0 0 0 200 MBP 80 120 0 0 80 PLPH 0 MAG 000 1000000000000000 0 MGI 00 100 0 7 MOGL 220 MOG34 560 Moc64 960 000000000 3 10 Hg T 10 Kerlero de Rosbo Eur J Inmunol 27 3059 69 19 97 T Ab MBP 87 99H 1000 ksenberg Nature 362 68 70 19930 87 99 7 0 HFFKI TH 10000000000 0 0 0 OJ Clin Invest 100 1114 22 1997 MOBP21 39 MOBP37 607 J MOBPH HH Holz J Inmunol 164 1103 9 20000 0 10000 Mogi 0 0 MBPO 00 MBPH 0 0000000 00000000 0 and Hauser Methods 10 420 34 19960
43. 5HT2 ISS 5HT2 C3d 5HT2 ISS C3d on C3d ISS C3d da C3d 155 ISG C3d ISS C3d 5 159 SHTyg C3d 5 ISS C3d 5HT p ISS 5HTip 55 C3d HMG CoA 777 7 2 155 HMG CoA 155 C3d HMG CoA C3d A 155 A 3 A ISS C3d B100 158 B100 C3d B100 ISS C3d AB ACE ISS C3d ACE ISS 155 C3d ISS
44. 1 Foo mE oO m 3 m 1 3 L3 3 3 3 3 E O 1 m Hono 3 3 Ye ooo 3 L3 ooo L3 L3 r3 Oo E3 gooo 3 L3 lt a EE lt zu z a Q 5 NI C O L3 I gt wak za as a 27 gt CES S N 3 ES B E s e C asi 2 5 XX C V L1 C gt EE 5 E gt lt O L3 3 E3 I gt in in 50 30 2005 510533 2005 4 21
45. EAUH 0000000000 12 PCRH 5 la BB t H Liu 10u 90 5ng H 0 025ng 5ng DNA O O O 60 12 1000000000 30 12 0 0 11000000 z E man i ler 1000 10 1 10000001 IDNHHHHHHHHHHHHHHHHHHDNHHHHHHHHH 0000000000000000000000000000000000 01070000 DD D BOE D BD BG DE DD DG Bo D Borm T H IHHHHHDNHHHHHHHHHHHHHHHO0 9nMMHHHHH 10000000 ONO nM 200000 HHHHHHHHH DNHHHHHHHHHHH
46. HHHHHHHHHHHHHILH 0000000 100000000000000000000000 10000000000000000000000000000000000000 UU LU U uultu HHHHHHHHHHH 0 0 DNA O pTARGET DNAH 0000000000000 DNAI 0 0 0000 DNA 000000000 60 12 1 000 1000030 12 101 1101 EM T NS Dm nnn 0000000000000
47. r 1 B 1 HM e 1 L1 1 1 L1 100000 100000 Cc 000000 25440 00000000000000 800000 100000000 58 2005 510533 2005 4 21 1000000000000000000 1001000 pNA DNA
48. 10 20 30 50 32 JP 2005 510533 2005 4 21 at a ase ERU nnnnnnn IMO 4 425 7321 4 458 066 5 218 1030 5 453 496 Tetrahedron Lett 21 4149 250 19950 70 55750 19860 250 14370 1984 Journal Chensoc 939 66570 19870 00 00000000000
49. 100000000000000000 DNA DNAD 1000 1000 0000000000000 0 00000000000000000 00 DNAD 1000 1000 HHHHHHH 1000 1 a B 0000000000 000 Verna and Sonia Nature 389 239 42 1997 DNA HHHHHHHHHHHHHHHHHHHHHHHHHHH 100000000000000000000000000000000 DNA HHHHHHHHHHHHHHHHHHHHH Robi nson and Torres Sem n I munol 9 271 83 19970 BH HHHHHHHHHHHHHH PH UJU DU 9009100011010 0000000000000
50. 10 SLE 50 100 1000 0010 14 2005 510533 2005 4 21
51. 10 20 30 50 2005 510533 2005 4 21 29 10 20 30
52. 50 E 5 3 oa ree puce TN _ 3 1 C uw T ud lt _ Ee _ lt C 3 3 E Dj 3 3 SET aes ES ES ES 3 3 3 oO 3 3 5 eu E x oOo 8 le 3 3 Rx oe 104 Do e MERI iss x Eh i t Ae SI 5 3 o go Ol s L3 r3 e 3 ouan O go ES Ot ESP eae lt Ol A O m EX Ot nS Ot 3 ot n m ot s s E E Car ra E LI E lt Ln L3 Es 3 3 oo 3 3 LI 2 m J 3 3 3 Ez 3 um 3 C3 O go a mo 3 oO 3
53. FK 506 DNAI Al HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH GVHD 2005 510533 2005 4 21
54. Ausubel Current Protocols in Molecular Bi ol ogy HHHHHHHHHHHHHHHILH 10000000000000000 Messing 0 0 Nucl eic Acids Res 309 1981 Maxam 0 Methods in Enzynol 650 499 19800 000000 0 HHHHHHHHHHHHHHHHHHHHHHHHHH 10000000000000000000000000000000 Mani atis Molecular Cl oni 133 134 19820 100 H E Hod Hod HHHHHHHHHHHHH 1 0000000000000 00000 100 1 5 1000000000000000000 100000000000000000 100 1000000000000000000 1MG 10000000
55. 25 2005 510533 2005 4 21 3 zes Cell 1060 105 11 E ka I SE E L M NR n MEME 11000000000000000000000 00000 10002 Chi esi Trends Pharm ical Sciences 22 247 54 20010 D 000 Chi esi Tren rnacol Sciences 22 247 54 20010 100 1000000 Hu Tansey Proc Nat Sci USA 98 6494 99 111 18
56. 10 1000000000 10000000000 1100000000000000000 20 10000000001 00000 1000000000000000000000000000 0000100000000 1000000000000000 30 15 2005 510533 2005 4 21 _ ITY VBS DON LOND B 10
57. ee ER E E ET DL ET LET 1000 DNAHHHHHHHHHHHHHH 000 0D00000 0000 Pe Pa uugeagaguauaguauuuduRRuuusuuusuuumldl RA TER EP P debe ED 01 Mal f ai Proc Nat Acad Sci USA 97 9561 6 CUTE Di IE Eas MER BLADE cDNA IX 65 00 0000000000 DNAD 1 PCR DNAHHHHHHHHHHHHHHHHH Xhol Xbal 00 PCR 0000000000000 pTARGETH 0 0 O 0 Xhol Xbal DNHHHHHHHHHHHHHHHHHHHHHHHH 160 90 0 0 0 0 0 0 0 11 2 Fe 10000 000000000000000 00000000000 1004 HHHHHHHHHDNAHHHHHHOQOAHHHHHHHHHHHHHHH CFA I U iD 100k HHHOIHHHHHHHHHHHHHH
58. HHHHHHHTHHHHHHHBHHH 10 20 30 50 10 2005 510533 2005 4 21
59. a a m Q m a 2 ED E 3 3 3 EJ eo 3 C3 3 3 ooo cl E31 I1 oO 3 3 3 3 3 A EE um 3 3 3 2 ES 3 3 3 C3 3 ooo ae G ooo 3 3 3 cono g 3 E 3 oao c O 3 C3 c ndm o e ES 52300 m LI il s gt uc g gt 3 3 3 3 moo 3 ae LI i die ul 3 m 3 3 E n Ea EL 5 i OO zm GOD Eb So 8 CN 3 3 ooo 3 n 2 1 oy oes LI m x E t E 3 3 m 3 3 oao TE 3 ac 1 3 3 3 3 _ ooo BN E VENIS Ln 3 3 a 3 3 3 CN 3 3 3 Ix ma NS S e os _ EE _ T i e nr LI E P i euet at d LI gm m Ao PME o Ol C3 SELF 5B LI E DES 27 UE ST _ CI LI a
60. N z 3 5 o En ES Fa mta a L3 m m _ a i _ E r3 r3 3 r3 3 lt r3 r3 3 i Ej EX 3 oOo o E 1 xg EE I 3 ZI p eT nm IA r3 3 r3 MENS E r3 Ez E rJ a x pe MEE 4 _ 8 M 3 E o lt C3 EJ EI ESS fe 3 ooo Ol ul yee 3 LIE E a E D r3 3 L3 r3 ms ee O I I m E ovx Ol 3 5 Ex E51 Ej E Ot lt Ss fe ee 3 02 Ol zz ar 3 T P ESI O _ VER ie Ni ROLE ux Ea I m al 5 E ES FEN IND 3 Lr a mx Sa C3 Ee Fees ua 3 Es 3 3 E vil Hcet 3 RE O _ GN EAE O _ SE _ CN 3 5 3 B 3 3 LN Q _ _ O I 3 s LES ES 1 DUM _ en ex a NEL
61. 0 EAUH HHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHEA 10000 cago ap mio pog og qon 0 100000 0 0 000000 400 600 0000000000000000 ood eo OBERT 08 0 o 0 cRESTO O0 000000 00 00000000 000 000000000000 0D000 000000 200 00000000 000 000000000000 100000 Gershw ng munol Rev 1740 210 225 20000 0 Mackay O mmunol Rev 1740 226 237 20000 0 J ood 0 900 95 0000006060 MI 480 74kDaH 000000000 000000000 00 2 0 00000 2 ood ood PB Gershw Immunol Re v 1749 210 225 20000 0 0 MBckay Immunol Rev 1740 226 237 20000 PB 1009 50 000000000000 0 0 PDC 20 0 E2 74kDa 0 2 00 000000000 c 0000 BCO 2 OA 10000 0 000000 30000 0 10 20 30 0 0 NAD NADH D 2 100000 10000 10000 000 PDHHHHHHHX HHE 3HHHHHHHHE3BPHHHHHHH 0 00000 PDC E2 E3BP
62. 0000000000000600 gs C 0 0 250m dL 20 I A20 1A2 000 HHHHHHHHHHHHHHHHHHHHHHHHHHHH 06800000 1 000 HH HHHHHHHHHHHHHHHHHHHHHHHH O00000 DOM 0000001080 c TO 0O 0O 0 0O T HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
63. 5 1 100000000 19 02 19 02 0 25 00 25 00 25 16 25 16 25 28 25 28 0 29 00 000 290 000 0 37 00 000 37 00 1 15 09 15 00 81 H LS SD SL SZ TZ UG ZM ZW EN AZ BY KG KZ RJ TJ TM EP AT BG CH CY CZ DK EE ES Fl FR GR E I T LU M SE K TR ON BF B GN GQ MR NE SN AE AG AL AMAT AZ BG ER BY BZ CA H CN Q CZ K ES Fl H MH HJIDI IL INIS KG KR KZ LG LK LR LS LT LU LV MG W MMK N Q OM PH PL PT RO RJ SG SD SE SG SI lt SL TJ TM TN TT TZ UA UG S VG W YU ZA ZM ZW 70000 000000 00 00 IH HHHH 0000 HHHHHHHH HH 000 72000 HH 100 1000000 000 00000 00000 000 79000 00000
64. AM 1000000 5 1 P IT p H ones Clin Pathol 530 813 21 20000 3 55 0 5580 La BSS Rm ma m CD Im 3 Kug Scl SSA Ul Sn M 1 1 M 10 J o 1 Kul SRP Scl 70 U1 0 H K ATPase B ut SLE U1 SS A Ro52H SS A Lag SS B Gr p780 Scl 70H 00000 0000000000000 1000000 71 0000000 To TPO HHHHHHHHHHHHHHHHHHHHHHH UU UU EMU BB 0 0 AHHHHH
65. 2 P450 1 3 H K ATPase tRNA 2 LISTE HHHHHHHM CNSH 1000000000000 35000000 00000 1000 0 10000 000000000 200 4000000000 HHHHHHHHHHHHHHH ecb ie A HHMSHHHHH E ME E 000000000
66. 10 20 30 50 2005 510533 2005 4 21 24 10 20 TI MP 1L 1 00100000000 30 100 10000000 100 1000000000000000000000000000 1000 20 T3 IlHHHHHH rT3 13
67. 1000000000000 34000000 39 39 MBP O MAGHH HHHHHHHHHHHHHHHHHH3 34 39 2005 510533 2005 4 21
68. 2005 510533 2005 4 21 52
69. B 1A2 IA 2B 5 67 kDaJ H 38 69 kDa p52 LUT 2 20 MW E a Je di H pue RB Ze HCE BE HR gt F H TRER 16 JP 2005 510533 A 2005 4 21 1 AU V L V XI GP 39 hnRNP S
70. 1000000000000 100000 1000000000000 100000 1000000000000 100000 1000000000000 100000 DiFiglia Sci ence 2770 1990 1993 1997 O Scherzi nger Cell 9 19970 0 Davi es Cell 90 537 548 1997 1 0000000000000 0 00 01 000 010000 1700001000 10 Prusi ner Proc Natl Acad Sci USA 95 1 98 20 2000000000000 1000000010000000000000000000000000 EE Eb E EHE 30 2 si 23 JP 2005 510533 A 2005 4 21 3
71. 10 10000000000000 1999 Fundament munol ogy Fourth Edi ti on Li ppi ncott Raven New York 10000000 9 2005 510533 2005 4 21 1 BOR HE RS BIS HA LER SLE Dr n n oaaao 0O n n
72. x v N 3 2005 510533 2005 4 21
73. 2 PDs L 4 PDs 11 10 PDs 11 13 cDNA IL 4 P450 IL 4 P450 1L 10 F F 7 i P450 IL 13 cDNA IL 4 IL 13 10 XE 3 60 J P 2005 510533 2005 4 21 1 DG 1 1 4 06 1 IL 13 3 DG 3 IL 4 06 3 IL 10 06 3 IL 13 26 1 06 3 06 1 06 3 IL 4 cDNA IL 4 AChR JL 4 ACHR IL 10 AChR IL 13 ATPase IL 4 IL 4 1 4 K NA L 4 tRNA 1L 13 CDNA IL 4 cDNA 7 4 777 9 IL 13 IL 4 10 1 13 4
74. Ol a _ Ol O O Ol L3 in 3 3 CN 3 L3 O I oo El Ez 3 C3 3 1 oO 3 3 3 3 m 3 L3 CO 3 L3 5 _ L3 L3 3 Ln 3 3 1 E N lt 2005 510533 2005 4 21
75. B100 ISS B100 C3d B100 ISS C3d 100000 00000 000000000 ED 10000000 DNA 100000 AE AE goo a I LJ D DD Ol DN ApO000OO00O0O000000000 CD40 CD40L CD40 CD40L 0 O B7 CD28 CTLA4 1g 000 0 aE DI I IHH nD 000 000000 B7 1 B7 20 TH OO CD28H 0 CTLA4 CD28H THHHHHHHHHCTLA4HHHHHHH CTLA4H 000000000019000 0 DNAD 000 DNAI 1010000000000 10000000 CTLA4H D 0 190 00 DNA RT PCRH OO O O 0 O 19000 DNA CTLA4H 0 0 0 O 0153 FasH 00000 100000 0544000000000 bNAI UD ep oA PO EE ES EDO DESEE EET ET 1000000000 59 0000001 50000000000000 4 MBPH MG MOG 0 0 00 0 10 30 50 63 2005 510533 2005 4 21
76. MBP IL 4 MBP IL 40 MBP IL 13 PLP IL 4 PLP IL 10 PLP 10 13 MAG MAG IL 4 11 10 MAG IL 13 IL 4 CNPase 1 10 oe B a B 10 o B IL 13 MBP PLP MAG IL 4 MBP PLP MAG 11 10 MBP PLP MAG CNPase o B IL 4 CDNA cDNA 4 CDNA 10 cDNA 4 777 IL 13 AS DU Yay Ny PT 1 4 P1 1 10 IL 13 NITYA E P2 1 4 P2 1 10 P2 IL 13 cDNA LMA cDNA 1 10 cDNA IL 13 10 20 B CARRET 59 JP 2005 510533 A 2005 4 21 2 IL 4 1A2 IL 10 1 2 IL 43 1A 2B IA
77. 10000 00 2 IL 4 10030000 pVAX1 100 DNA 10004 100 DNA 200u LO PBSH 50u g DNAD 1 0 40000001 64 2005 510533 2005 4 21 UJ a e B 250ny dL 80 0 pVAX1H Invitrogen 00000000000 240 0 0 0 87 560 00 00 0 0 0 0 0 IL HHHHHHHHHHH
78. DNAD 100000000000000000000000000000 2005 510533 2005 4 21 55 10 20 30
79. ME r3 r3 E 3 r3 O I 3 E 3 3 3 oO oO L3 Lr 3 ow Ol oO ma oo a 3 3 3 r3 3 3 m 3 3 lt ca Oo m E g 3 3 E 3 3 r3 O 3 mn 3 3 mo oono r3 FON 5 a cime EC 5 3 r3 3 3 1 lt EB r3 3 1o mw m 3 r3 r3 3 lt lt O N oO 3 EM A 3 r3 3 3 r3 3 EA zx It 8 ES r3 3 m Ed 1 ogo ca _ E N E Ui rim O _ r3 cn r3 r3 3 oO r3 E E 3 lt 3 3 3 3 3 r3 3 r3 ooo 3 os s ET r3 r3 E EX REO L3 Ez EE mo E E m l O EX EE 5 bes iE r3 _ ia ex E u 2 Cele 3 r3 r3 3 43 3 r3 Ej 3 s SUE 1 3 E O _ _ 3 3 _ a 55 T DE x 2 Ep SESS Ls ES a 8 E 75 eS r3 r3 _ cu CT al EE r3 r3 Ed E on r3 Em 3 r3 r3
80. 10 DR 10010 DNA GVHD GVHD MH HLA GVHD GVHD TH GVHD 2005 510533 A 2005 4 21 50 26 B Appel baum Nature 4111 385 389 2001 HLA Appel baum Nature 411 385 389 20010 HLA DR 30 DPB1 HLAD HLA B 30 HLA A B10 DOB1 20 30 50 OKT3 GVHD DNAD 100
81. CNSHHHHHHH 10000 MRI 19900000 l om 10 20 30 50 17 2005 510533 2005 4 21 gt m 100000000000000 EAEH 000 HHHHHHHHHHHHHHHHHHHH MBPH HHHHHHHHHHHHHHH 0 Md 0000000000000 00 1000 CNPase 0 0000000000000 MBOP 0 000 0000000000000 00000000 B 0
82. Zi 4 CDNA IL 4 1 4 cDNA IL 4 CDNA 1L 40 CDNA IL 13 lbh Fay tee t 13 2 ILS RISA cDNA cDNA IL 10 cDNA 11L 13 SOX9 IL 4 SOX10 IL 4 IL 4 IL 13 lt IL 13 0000000000000000000000000000000 5440 000000 550 O Cad O 1550 C3d 0 155 t O C3dg t O ISSO Cad
83. 155 C3d ISS C3d 20 90 1 155 Nogo 1 C3d Nogo 1 ISS C3d ACE 155 C3d ACE ISS C3d H K ATPase ISS ATPase C3d ATPase ISS C3d 9j 185 C3d ISS C3d ISS C3d 155 C3d 155 C3d ISS C3di 30 62 2005 510533 2005 4 21
84. DNAH 1 00 0 0 00 0 0 0 O 10 2200 0 0 0 0 0 0 0 Boehringer Mannhei m 0000000000000 00 1 One Touch II ne ter Johnson Johnson 250ng dLH 000000000000000000000 10 20 30 50 45 2005 510533 2005 4 21 1A 2 DNA HHHHH Chemstri p Boehringer Mannheim 00000 One 100000000000 NO BI 9 230 i nsB pcDNAI 0000 0 DN4 1000000000000 5 CCGGAATTCGCCATGAGCCACCTAGTAGAAGCACTATACCTCGTAT GCGGCGAACGAGGTTAGTCTAGAGC 3 1 EcoRI Xbal pcDNA3 10 Invi t
85. US 74 100108774 14 100128048 54 57 0 100 100 HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH 0 100 100 0 1000 100 100 HHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHH 0 0 0 100 0 100 100 0000000000000000000 0000000000000000000 000 00000 HHHHHHHHHHHHHHHHHHHHHHHHH 100 HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH 10 2 2005 510533 2005 4 21 UU LU HHHHHHHHHHHHHHH HHHHHHH HHHHHHHHHHHHHHH 110000000000000000000000000000000000000 JU DD DU Ul
86. H 37Ra Di f co Laboratori es 1000000000000000000000 100000 100000000000000000 19000 HHHHHH 1480 PBSH 6 00 0 0 0 0 1108 0000000 0 0 4 g m 100000 10000000 10000000000 iH Dti 100000 200000003 1000400000000 500000 10 20 30 50
87. u lt a at ed s E ale Oy on 3 em __ T O gt 3 m ol CN I twooooa m ni m 3 3 r 3 33 3 EXE g 3 ol 3 3 3 E um 3 mo E 3 a E LI ot step E 5 x i EAE EC 5958 CN mood o LH 3 cA Bo SS lt s a eit un Jo VM e IA as pM I CN 1 C3 c um o 3 I um Oo LLI CN s Oo m amp E P 56 2005 510533 2005 4 21
88. IMIHHHHI HHHHHHHHHHHHHH 1000010000000000000000000000 0000 20000000000000000000000 6000 48 48 U 1000000 1 40 TL 10 11 13 6HHHHHHH I L 4 1L 10 1L 13 DEAE EE EE D 8 I L 4 1L 100 IL 13 1 LJ L1 Cc 1 L1 1000000000000000000000000 W B 1L 40 1L 100 IL 13 480 HHHHHHHHHHHHHHHHHHHHHHHHH 7 2005 510533 2005 4 21
89. 000 10000000000 ODOT 000000000 Nat Med 7 899 905 2001 1000000 0000000000000000000 0 100 100 100 0 1000 tRNAI T 0 HHHHHTHHHHHHHHHHHHHHH 1000000 CD4 T CD4D Tn 1000 LH 000 0000000 6847 TO00000000000000000000000100 00000 0 0 Msmann 1nmunol 1360 2348 2357 19860 0000000000 10 20 30 50 8 2005 510533 2005 4 21 T 10000000000 200000000000000000000 10 1010000710000 20 7112000000000 11000000000 20 11 20 0 00000000 y0 FN y0 00000000000 Tho 00000000 IL 40 IL 50 11 60 000 10 130 0000000 Cherw nski J Exp 1690 1229 1244 19871 IL 90 00 11 100 Th2H 0000000000 Van Sni Exp Med 1690 363 368 1989 Fi orenti J Exp Med 1700 2081 2095 19890 1L 3 HHHHHHHHHHHGMGSFHHHHHHHHHHH TNF a 0000000000000 Thi0 00 11200000000000000
90. 2005 510533 2005 4 21 19 UP q 11 2005 510533 P2005 510533A 43 7 4 21 2005 4 21 51 Int C1 F1 A61K 48 00 AGIK 48 0 ZNA 4BO24 A61P 1 16 AGI1P 1 16 4CO84 A61P 3 04 1 3 04 A61P 3 10 AGIP 3 10 A61P 19 00 AG1P 19 00 RER 272 BO 21 2003 546821 P2003 546821 71 500159163 86 22 14 11 21 2002 11 21 85 16 5 20 2004 5 20 86 PCT US2002 037686 87 w02003 045316 943 87 15 6 5 2003 6 5 05 1850 60 332 070 350 900 32 13 11 21 2001 11 21 74 100102978 33
91. oO ES H E 3 L3 3 3 Oo oo 3 x 3 o 3 3 ooo E N sm 3 _ on 3 3 3 3 3 3 ooo 3 5 3 3 Oo 3 3 ME 3 3 P 3 _ OF ooo 3 a 3 3 O L3 r3 ra O 3 C C C E Bo Ez oa E 3 m 3 3 gt O r3 s Sa 3 3 r3 a 3 EQ ES gt E _ oo 3 lt s 3 3 oO o O 3 m r3 L3 3 n E3 E 3 E EC ea 3 3 md A ie EI 3 Oo 3 L3 r3 3 3 EI mm a 27 a __ 3 E 3 3 3 C3 3 3 mo 3 L3 Ez 3 oO E A 1 amp r3 oO 3 EX c OO O Ed Poss I _ 3 L3 _ lt 3 3 E F pes O O oag uu 3 a Eee E FJ r L3 oO a MEM EN Oo lt I BI oe en Oo oa 5 3 E 3 3 3 eN 3 Oo 3 3 3 3 3 C CN lt cg Oo Lj 3 3 m r3 3 3 3 3 3 3 3
92. FEARED 0 000000000 HHHHHHHHHHHHHHH 10000000000000000000000 870 000000000 1000000027000000000 10000000 10000000 100000000000000000000000 00 100000000 DNI D LU U HHHHHHHHHH 0 PLPH HHHHHHHHHH 100000000000000 0 1000000000000000 11 40 00000 DNAT 0000 10011 40 00000 5400000000000 0 000000000000000000000000000000 000000000600 10000000000000 DNAD 11 40 00000 DNAD O EAE H 0000 0 1000000 DNA PLP139 151 IL 4 MOG PLP L 4 4 P 0 0018 0 0003 0 0158 0 1714 DNAH O 0 0 MOG MAGHHHHPLPHHHHHH4HHDNHHHHHHHHHHHH 25u 99 0100000000000000000000000 O0 1100000 502 HHHHHHHHHHHEAEHHHHHHHHHHHH 100000000000000000000000000000000000000 00000 10000000200000000 100000000 1000000 10 20 30 50 2005 510533 2005 4 21 42
93. 0 0 SV40 SV40 SV40 HndIIIHHHHHHHHHHHHHHHHHHHHH DHFR 00 0000 mrp 0 00 0 0 0 0 00000000000000000000 0000000 2 2100000 0 Southern and Berg 19820 J Mol ec Appl Genet 1 327 0 0 Mulligan and Berg 19800 Sci ence 209 1422 Od Sugden 19850 Cel Bi o 5 410 4130 3 IlHHHHCG418HHHHHHHHHHHxgptHHHHHH 000000 10000000000000000000 Hod 10000000000 bpNA Hurt t ti DNA DNA DEAE Vi rol 52 456 4571 0000000000 Kriegl er 1990 Gene Transfer and Expressi Labo ry Manual Stockton Press EJ oana
94. HHHHH H 1000000000 0 0 DNA 0000000000000 ISSH HHHHHHHHH cDNAHH HH cDNA TRNAI n E me yi P Ap Ep yusa Ey ME anoop 000000 110000000000000000 5 InHnnnnnn cDNAI ISSH HHHHHHHHHHHHHHHHHHHHHHHHHHH 100000000000 0 155 004 00000000000000 cedi 0 00 000000000000 000000000000000 33 2005 510533 2005 4 21 DNA PCR
95. PLP178 1910 100000000000000 LN 003 CPM 50 Al 0 001no 0 O0 LNCH CPM Al 102 4010 76 702 ELI SAD DNA 000 0000000000 PLP139 151 prargeTH 0 00000000000 DNAI 10005 1000 LN 000000 P 151 0 O ELI SA HHY HHHHHHHH IL 2H 000 HHHHHHHHHHHHHHHH ng nL RNase 0 INCU U UL nRNAI 0 RNase 1000005 1000000 0000000000 H HHHHHHHHHH NOD 1000000 410000000 NOD B 9 230 1000 pcDNAI H 0 0 0 nH dut 100000 65 2005 510533 2005 4 21
96. 00 0 0 Wisma no O Nat Med 20 899 905 19960 000 5 939 4000100000000 DNAI 000 HD 1000000 97 462539 Ranshaw I munol a nd Cell Bio 75 409 413 19970 000 10000 10000000000 TNFa 0000000 00000 Fas 10 DNA YoussefH J Clin Invest 1060 361 371 200 J Clin Invest 1060 671 679 2000 WI J 1 munol 16 50 5860 5866 20000 Wldbaun J Inmunol 1610 6368 7634 19980 Youssef J Autoi mun 130 21 9 1999 11000000000000000000000000000000000 1000000000000000000000000000000000 1000000000000010000000000000000000 1000000000000000000000000000000000 000000000000000000000000000000000 10 20 30 50 2005 510533 2005 4 21 13 10 20 30
97. 10000000 1000000 Tem ett Curr Opin Neur gs 99 ne Di ckson Curr ion S65 7 1998 Neur ol ogy Neuron 16 92 1 32 1996 Opi n Neurol 14 423 32 2001 0 Prusi ner Proc Natl Acad Sci USA 95 13363 83 1998 51 S2 17 di scussi on S65 7 19980 Chesebr o Neuron 24 503 6 1999 Sel koe Neuron 6 487 98 1991 Lin O Neu 9 303 7 19960 Kaye Neurol 51 S45 52 di scuss Cumi 24 499 502 19 Ross Neuron 19 1147 50 1997 Yank U U U ow and Evans Neurol ogy 51 53
98. 68 3 o r3 3 n 3 ER e LE A un a own n oe E bd H ro 3 3 3 3 3 r3 3 om om 3 lt 3 O 3 5 L3 L3 r3 5 3 O I Eas DEUM Ol e oe d S 3 3 N 3 r3 ma O Lt r3 ON O 3 3 r3 o o Ol Ox ro r3 moo 3 3 c 3 L3 5 E Ea mo u 3 3 _ O L3 m _ Ol E 3 3 r3 ooo _ ED 3 r3 a __ O I own a E 3 a s _ E e _ r3 oO r3 e oO Tye AeA pm i r3 3 r3 3 r3 Aas Cl C N 5 5 _ 5 O N 3 3 8c rm um a Cv _ r3 m 5 a a Ol Ol 53 2005 510533 2005 4 21
99. 00000 DNA 100 0 10 2000000 100000000 son gf 2005 510533 2005 4 21
100. B CQ r3 r3 oo 3 3 oo 3 3 oO 3 go 3 3 ium L3 L3 hy C3 c0 EP Ez 3 oO 3 3 oO 3 Oo r3 3 3 o es ca m 3 3 a o e N N oOo 1 Oo C3 3 7 e Os in lt lt 4 5 on In 5 1 mi iS E CJ L1 3 wg ECL E E C Q O I C CN CN m ao EE LL Ica E 7 7 LUE S se w GS oO RD m O re B odi er ee eae EE ee EN cU eee se EINEN eee SI r3 __ n lt Oo ogl e Psoto 5 oom s 5 5 3 a I LIT 22 Joo S __ Ed ot s lt LA VI lt El ot a EE lt e O Ol M LI CI m m L3 ot I o 5 ROM 5 e c ux lt s 2
101. Wley and 15 5 1 15 5 24 19940 CI I Bi PO GP 390 HHHHHHHHHHHHHHHHHIH DNA 1 HH uuu HHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHHIH DNAHHHHHHHHHHHHHHHHH DA 0000000000000000 Bi PO gp390 I VI 0000 6 0 00000000 HHHHHHHHHHHHHHH HHHHHHHHHH DNAD 00000 0 PCR HHHHHHHHH 100u 9HHHHHHDNAHHHHHHH 100000001 0 HHHHHHHHH 1000000000001 000000000 HHHHHHHHHH 00007 1004000 Jp E MPO
102. ao N 5 A O il 3 3 4 LI mr 50 ELI SAD 2005 510533 2005 4 21 50
103. cDNAHH HH L1 L3 L3 L3 g a 5
104. oana L3 36 2005 510533 2005 4 21 110000000000000000000000000000000 DNAD 0 DNA 000000000000000000000000000000000 DNA 00000
105. 0000000 0 80 0000000000000 00000 0 0 0000000000000 0000 0000 000000060 RAJ TH 0 0 B HHHHHHHHHHHHHHHHHHHH 0000000000000 0 000000000 00000 000 T 100020 0000000000000 EB 100 000000000000 0 0 O0 30 RAO O0 O O HLA DRO 000000000000000 D 0 U HLA DRI 0000000000000 0 0000000000 000 30 0 00 18 2005 510533 2005 4 21 67 747 00000000000 RAHHHH 1000000000000 TH 00000 1000100 HHHHHHHH 10000 ll hnRNP A2 RA33 Sa 0000000 gp 390 000000001001110 01 0 XI HSP 65 60 gM hnRNP B1 hnRNP DJ 000000000000 UU tu HHHHHHHH HHHHHHHHHHHHHH de i m nated HHHHHHHHHHHHHHHHHHH UU 11000008000 10 HHHHHHHHHII caig 0000 257 270
106. 2 HHHHHHHHHHHHHH QAHHHHHHH 120 ER 1 Col i gan John Wl ey and Sons Inc 15 5 1 15 5 24 19 10000000000001000 UU UU 2100000000000 HHHHHHH HHHHHHHHHH 41000000000 41000000000 L1 w 0000 HHHHHHHHHHHHHHHHHHH WlIliams J Proc Nat Acad Sci USA 91 1 766 1994 HHHHHHHHHHHHHHHHHHHHILH WIliamsq Proc Natl Acad Sci USA 910 2762 2766 199 10000000000000000001 1 LJ g HHHHHHHHHH 1 w 0 0 GP 39 L1 DNAD 10000 47 2005 510533 2005 4 21 120000001010000000
107. 50000000000 250 16 000 DNA 0 0000000000000 0 0 9 230 0 PCRI O l 0 0 0 0 0000000000003 3 O H i nsB pcDNA pcDNAIH 20 0 20000000 500 Hod 10 g m 0 BO 9 230 0 10000000000000 7200000 L 40 TGF B J 11 100 0 0 IFNy 10000000000 PCRI pcDNAI insB pcDNAI I FN y I L 100 insB pcDNAI FN y B 0 pcDNAH 38H p 0 05 insB pcDNAI 0 1L 1000 O O pcDNA 30 pH 0 010 1L 4 TGF BHnRNAH 00000000003 0 HHHHHHHHHHHHHHHHHH 1000000000000 100000000000000000000 IA 2H D D DNA HHHH NOD GADO 65kDa A 20 DNAHHHHHHHHHHH 100 0 HHHHHHHHHHHHHHHHHHH GAD65H 1A 2 cDNA pTARGETH 100 D Q agen Endo free Mega 0 Q agen 100000000 00000 30 40 H PBSH 1H D 0 05ntH 0 0 0 1 0 250 0 Si gnal 0 100000000 20 0 1000000 0 9nM 100000000 0 0590
108. 9 23H DNA NOD H 0 Aj HHHHHHHH DNA 000000 Hod pcDNAI 100000000 BO 9 23 i ns B pc DNA 100000000 Hod 00 ns B pc 10 100 IFN YH 0 0000 0 0 0 BI 9 23 0 10 5S CCGGAATTCGCCATGTGCACGTCAATCTGTTCACTGTACCAGCTAGAGAACTACTGC 3 100080000000000000 5 GCGGCGAACGAGGTTAGTCTAGAGC 3
109. RU 0 ct ct 35 2005 510533 2005 4 21 0 0 0 0 400 SV40 BO
110. 19930 1000000000 Pozzilli and Gi sel 30 Cavallo Di abetes Metab Res Rev 16 306 7 20000 00000000000 50000 O Nussenbl att Ophthal nol 123 583 92 1 9977000000000000000000000000000000000 710000000000000000000710 000000000 100000000000000 10000000000000 100000000000000 1000000001 Hurtenbach U J Exp Med 1770 1499 1993 O 1000000000 TCRH Vandenbark Nature 3410 541 1989 000000 1 HHHHHHHHHHHHHHHHHHHHHHHHH 40 0 n Wi ner HL munol Today 180 335 19977 00000000 000 1000000000000000000000000 00000000000000000000000000000000000000 B HHHHHHHHHHHHHHHHHH B HHHHHHHHHHHHHHHHHHHHHHHHH 1000000000000000000000000 100000 00000000000000000 HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH 50 11 2005 510533 2005 4 21 L1 L3 L3 L3 n HHHHHHHHHHHHHH
111. 28 IL 4 1A2 b 1 10 1A2 b 1 13 65 67 GAD IL 4 1 10 GAD IL 13 H IL 4 CH IL 10 CH IL 13 IL 4 IL 10 AU IL 13 IL 4 1 10 IL 13 HSPs IL 4 HSPs IL 10 HSPs 11 13 glima 38 IL 4 69 IL 4 p52 1 4 1 4 GLUT 2 IA2 IL 4 50072 122 IL 10 GLUT IA2 IL 13 GLUT 142 GAD IL 4 GLUT2 IA2 GAD IL 40 GLUT2 IA2 GAD 1 13 GLUT2 JA2 GAD H HSPs gima 38 1A2 GAD IL 13 2 GAD HSPs glima 38 GLUT2 IL 4 A2 GAD IL 13 A2 GAD H HSPs glima 38 GLUT2 IL 13 J p cDNA 11 4 cDNA 7 4 Z gt V IL 10 J 20 cDNA 13 fog Z AS Ig 1 4 Ig 1 10
112. Cumm ngsH Neurol ogy 51 52 17 discussion 565 7 1998 AD O 6500000000000 100 85 50 2025 20 2 AD AD 0 OO AD 00000 0 0 00 10000 O 100 110000 BD uu oo B AB 1Iwetsubo O Neuron 130 45 53 1994 Li ppal 10 20 30 50 21 2005 510533 2005 4 21 Lancet 3520 1117 1118 19980 ABHHHHHHHHHHHHHHHHHHH 10000000000000000000000000000 APPO 0000 0 400000000000 90 Sinha 0 Ann N Y ad Sci 9200 206 8 20001 APPO 0 000A600 0000000000000000 HHHHHHHHHHHHHHHAPPHHHHHHHHHHHHHHHH Ap 000000 AD 00000000 HHHHHABHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHH 0010 0010 ion 565 7 19980 Hake Cleve Clin J Med 68 608 9 613 4 616 2001 Farl ow and Evans Neurol 51 S36 44 di scus
113. DNA 60 D 1100000000000 5440000 2004 LO PBS 50u g0 1 0 D D 100 DOOD 1000 6 10000000000 OO FEAR 0000 5 0 a BI 1000 100 FCSH 000000 10u g m0 150 000 30 rIL2 0 3 Phar m ngen IFNy 0 D BO IL 4 IL 10 ELI SHQ 00000 ELI 5 NOD 10000007 1000 BGL 10 1000 10000000000 Bag 2000 250ng dLHHHHHHHH ill 150 0 00 PARET PBS 0 0 0 0 0 0 0 2m0 0 25 2000 11000 pVAX1 00000000000000 1 00 20 000 100000 506 9900000002 pVAX1H 0 0 1 20 11 4 0000000600 DNA 0 00000 0 210 PBS 0 50 9000000 0000 41000 11 0 0 DNAHHHHHH 200u L PBS 50u 90 NS 1 DNHHHHHHHHH IlHHHHHHHHHIMH 40 0 1 0 250ng dL 0000000060 gt 100000 75000 50000 25000 0 0 0 005 0 01 0 015 0 02 ng ml Lass 100000 75000 50000 25000 9 0 0 005 0 010 015 0 02 mgAmD PLP 139 15
114. F J l O I Ee e aN 5 _ LI SSeS T Ot _ n eee 5 LI 3 3 A lt s vi O _ 5 EC E i 3 3 E a 43 2005 510533 2005 4 21 10000000000000000000000800000000000000 DN NOU IDDMJHHHHHHHHHHHHH 100 10000010000
115. HHHHHHHHHHH 24 1000000000 1000000000 24000000 40 20 0000000000000000 0000000000000 100000000000 240 00000 10000000000000000 O E2 74 PD 3000000000000 0000000000000 10000000000000000000000000000000 21000000000000000000000 25000000 1000000000 1000000 50 4 2005 510533 2005 4 21 10000 1010 U 0 0100000 100000 HHHHHHHHHHHHHH HHHHHHHHHHHHH MBP PLPH HHHHHHH 0 CNPase 100000000 HHHHHH 000 MOG B 1000000000000000000000000000 1000000000000000000 HH MBP 35 PLP 35 MAG 350 0 HHHHHHHHHHHHHHH
116. 100000000000000000000000000000 10000000 DMA 000000 48000000 RAD 000000 48000000 1HHHHHHHHHHHHHHHHHHHHHHHHHHHHHH 1000000000 43000000 2HHHHHHHHHHHHHHHHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHH 480 000 IHHHHHHHHHHHHHHHHHHHHHHHHHHHHH D 0O00000000000000000000000000000 48 48000000 10000 54000000 1 100 10000 IHHHHHHHHHP PDCI 74kDa 000 3 0000000 2 000 10000 000000000 0 0 0 2oanpci n 1000000000 0 55 10000000000 0000 00000 1000000000 550000060 2HHHHHHHHHHHHHHHHHHHHHHHHHHHHHH IHHHHHHHHHHH55HHHHHH HHHHHHHHHHHHHHHHH 0 POCO E2 74kDaH HHH P X0 E 30 00000000000 0000000000600 100000000000000000000000000000 10000000000000000 55000000 1000 480 00000 1 0000 hnRNP A2 RA33H SaHHHHHHHHHHH gp39 10010010 Dp 010 0 000000000 5 600 RNA O 0 0 0 0 O hnRNP B1H hnRNP PHHHHHHHHHHA 60000000 1HHHHHHHHHHHHHHHHHHHHHHHHHHHHHH 10 20 30 50 6 2005 510533 2005 4 21
117. 40 10 0 10000000000000040000000000000000 MBPH MOG MAG 00 0 0 0 0 0 00 000000000000 000 0 EAEG EAEH 0 EAEH 04 000000000000000005000 eut 0 HHHHHHHHHHHHHHHHHDNAHHHHHHHHHHHHHH EAE H H SJL J CFA PLPp139 151 4 AVY CP OG MBP MAG PLP DNA 41 1 6 1 56 1 6 2 4 123 JP 2005 510533 2005 4 21 lt 0 0001 0 0064 HHHHHHHHHHDNAHHHHHHHHHHHHHMBPH MOG M GI 0 PLPH I UD 400000000000000 50u 990100000000000
118. E2 21000000000 0000000 0 000 PPO PPO 000000000000 IHHHHHHA 0 0 0 00000000 0 20 2005 510533 2005 4 21
119. PIPHHHHHHHHHHHiii 3 HHHHHHLH 000 JU UU lu v IH UUUUUd HHHHHHHHHHH Vii 10000000 BiPHg 6 110000000 0 0 DNAHHHHHHH 20 ACR20 0 500 ACR50 700 0 ACR70H ESRO O O CRP HHHHHHHHHHHHHHHHHHHHHDNA HHHHH EAU HHHHHHHHHHHHHHHH HHHHHHHHHHHHHHHHHHHHHHHHHHHH 10000000 0000000000000 RBP DNA PCRJHHHHHHHHHHHHHHHHHHH pTARGETH HHHHH100u 9HHHHHHHHHHH EAU 48 20
120. or more other such docpments such combination being obvious to person skilled in the art document member of the ame patent family 70 2005 510533 2005 4 21 International application No INTERNATIONAL SEARCH REPORT PCT US02 37686 Box I Observations where certain claims were found unsearchable Continuation of Item 1 of first sheet This international report bas not been established m respect of certain claims under Article 17 2 for the following reasons 1 Claim Nos because they relate to subject matter not required to be searched by this Authority namely Claim Nos because they relate to parts of the international application that do not comply with the prescribed requirements to such an extent hat no meaningfol international search can be carried out specifically Claim Nos because they are dependent claims and not drafted in accordance with the second and third sentences af Rule Box Observations where unity of invention is lacking Continuation of Item 2 of first sheet This International Searching Authority found multiple inventions in this international application as follows Please See Continuation Sheet As all required additional search fees were timely paid by the applicant this international search report covers all searchable claims As all searchable claims could searched without effort justifying an additional fee this Authority di
121. 0 0000 0000 HHH HHH HHHHH HH 000 72 00000 00000000 0000000 00 0000 0000 72 HH 0 0 n 72 HH 0 000 000 00 000 0000 00 0000000 HHH HH 48024 BA08 BA80 OX2 642 HN7 AA3 BA35 CA59 DAO1 2 DA6 001 M24 M66 O11 74021 22161 2701 ZA751 24961 28071 28151 22351
122. 00000 5 173 41 410000 5 139 9410 00000000 92 010700 0 0 93 037690 0 Lebkowski 0 Cel Bi ol 89 3988 3996 19880 Vi ncent Vacci nes 90 Cold Spring Harbor Laboratory Press 19900 Carter B J Current Opinion in Biotechnology 30 533 539 1 9921 Muzyczka N Current Topics in McrobiolH 0o 0000000 1 munol 158 97 129 19921 Koti n M Human Gene Therapy 50 793 801 19941 Shelli Gene Therap 10 165 169 19941 0 Zhou Exp Med 1790 1867 1875 1994 10000000000000000 10000 0000000000000 0100 10000 10000000000000000 10000000000000000 10000 0 Hug Biochim Bi ophys Acta 10970 1 17 19910 Strau bi nger in Methods of Enzynol ogy Vol 101 512 527 1983 2005 510533 2005 4 21 37
123. 0000000
124. 00000000 00 000000060 00000 110000000000000000000000000000000000000 DU 100000000000000000 10000000000000000 100000000000000000 100 30 0000000000000 1 25 Bo 00 DN Ji U UU U U l 1100000000000000000000000000000000000000 1L 4 I L 10 00 11000000000000000000000000000000 110000001 HHHHHHHHHHH 0 0 0 ood 0 IL 4 1L 100 1L 13 0 D IF 100 Edge Nature 292 756 1981 Nambai r Sci ence 2230 1299 19841 0 J Bi ol Chem 2590 6311 1984 Edge Duckworth O Nucleic Aci ds Res 9 1691 1981 0000 Beaucage Tet Letts 221 1859 19811 Matteucci J Am Chem Soc 1030 3185 19817 0 0 1000000 G DE r D H 000 0 0 1000000 0 0 0 0 1000000 Edge Nanpair i JayH HHHHHHH 1000000000 10000000000000000000000 10 20 30 50 39 JP 2005 510533 2005 4 21
125. 000000000000 OP l 000 0 MBPH 6 000000000000 de i mi nat ed MBP 0 0 0 0 10000000 139 151 103 1160 215 2320 43 64 178 191 26 Mei nl J Clin Invest 92 2633 43 19930 0000000 1 110 59 76 87 990 100000000 MOG 1 220 35 559 64 960 BO 1000000000000
126. 00000000000000000000000000000000 100000000000000000000 5 39 9 3460 5 580 859 5 589 466 100 0 0 00 0 0 00000000000 HHHHHHHHHHHHHHHHH 5 219 7400 Bi otechni ques 70 980 990 19891 M A D e Therapy 10 5 14 19900 Scar pal Virology 1800 849 852 19911 Bur ns Proc Natl Acad Sci USA 90 8033 8037 1993 Boris Lawrie Genet De 30 102 109 19930 0 O Haj Ahnad Virol 570 267 274 19860 Bett 0 J 670 5911 5921 199 30 Mttereder Human Gene Therapy 50 717 729 1994 Set h J Vi rol 680 933 940 19941 Barr Gene Therapy 10 51 58 1994 Berkner L Bi oTechni ques 60 616 629 19880 0 0 Ri ch O Human Gene Therapy 40 461 476 19931 HHHHHHHHHAAMHHHHHHHHHHHHHHHAAMHHHHHHH 1000000000000000000000000000000
127. 000000000001 60 1000 1000000000000 160 50 IMH 100 10 0 000H DNA 1 DNAD DNA 100 IMGH 00006 100 O0 10 0000 IISH TGACTGTG Pu Pu X Y Pyr Pyr AGAGATGA 10 TGACTGTG AGAGATGAI O0 I 0 0 0 0 0 0 0 0 0 0 0 0 00000 20 000000000000000000000000000 00 200 1000 TH 0 1000 1000 1000 1000 1000 1000 6 225 292 0 0 6 339 0680 O Zeuner Arthri ti s and Rheunatism 460 2219 24 2002 IM 20 GG 100000000 5 000 0 0000 0 0 0 0 0 0000 0 H 3 GTGGTT ATGGTT GCGGTT ACGGTT GTGGCT ATGGCT GCGGCT ACGGCT GTGGTC ATGGTC GCGGTC ACGGTC 5 000 0 0000 0
128. 05 510533 2005 4 21 B10 11 R 100003 DNA DNAI BIO RII CFA RBP161 80 ColliganH 8 OH 102 10000 1 2000005 0000050 0000003 0000000000000 m 100000 gt g B10 RIII 00 000000000 00 thRBP1 61 800 000000 100 g PH UU UU 0001000 m gt gt
129. 1 PTargeT 66 5 a PLP 74 121 gt JP 2005 510533 A 2005 4 21 B A PcDNA EI IpNA NOD 9 23 TERT IFN 1L UCIL 130 mRNA INg 9 0 2 1 35 e s HY x 2 YN 4 3 0 he DNA RY x 2 VET IL 4 IMS d PP Hp SP E E eS He 6 67 2005 510533 2005 4 21 ELISA ttt 1 32 ngint SML OPN DNA 7 7 IFNy 68 2005 510533 2005 4 21 Qh 6 IMS PVAX1 182 182 IMS 24 69 INTERNATIONAL SEARCH REPORT CLASSIFICATION OF SUBIECT MATTER IPC 7 A61K 31 70 US CL 514 44 According to International Patent Classification IPC or to bath nationa tion j B FIELDS SEARCHED 4 Minimum documentation searched cl
130. 147 100 11 6 0 50 0 O0 0 0099000000000 100 p 0 02 PLP 0 0 178 191 0 100 100 100000 11 5 0 40 0 0 p 0 0030 00000000 pi 0 0070 0 pl 0 0001 DNA PLP139 151 100 000 PLP139 151 LN LU LU 0 100 100 20 1 PLP139 151 DNA LN 00080 0 O O PLP139 151 PLP139 1511 00000000000 DNA 0000000000000 10 20060 0000000000000 0000 nRNAI 0 10 PLP139 15101 000 00000000000 11 150 nRNAI PLP139 151DNAI 000 IL 20 1 150 Y 30 10 0 0 0 0 GAPDH 0 0 PLP139 151 L R DNA 0 PLP139 1510 00000 0 DNAD O
131. 155 0 0 a 0000000 550 cad 1550 gos mm B 0 155 C3d ISSHHHHHHHHHHHC3dHHHHHHHHHHHISSH cad 10 20 30 50 61 2005 510533 2005 4 21 DNA DNA 3 155 C3d 155 ISS C3d 155 C3d ISS 3 ISS ISS ISS ISS JSS 3 C3d C3d C3d 155 ISS C3d ISS C3d ISS C3d ISS C3d ISS C3d
132. 3 r3 3 C C C C C cQ mo Fo fo SS O N 3 3 mu 5 r4 mato 3 L3 r3 lt ET L3 e L3 oO 5 oo o c Dn 3 3p oO o L3 lt 3 oO 3 3 zi Q 3 i O r3 El E N 5 1 Cl N i 3 3 EE 1 Q EJ a C C lt 5 E ea lt lt oa Ln lt s L3 ey 2005 510533 2005 4 21 51
133. 48 50 52 53 65 66 71 and 74 drawn to a method of treating neurodegenerative disease Group V Clalms 1 7 30 48 50 52 53 68 71 74 drawn to a method of treating obesity Group VI Claims 1 7 31 48 50 52 53 69 71 and 74 drawn to a method of treating osteoarthritis Group VIL Claims 1 7 32 and 71 drawn to a method of treating spinal cord injury drawn to a method of treating a viral disease with a replication competent clonal virus Group VITI Claims 1 7 33 48 53 70 71 and 74 drawn to a method of treating graft versus host disease Group IX Claims 34 47 51 73 drawn to a method of treating multiple sclerosis The special technical feature each of Groups I IX ls drawn to treating a different disease using different Self peptides For the insulin and numerous peptides using in group I would not be used any of the other groups and pyruvate dehydrogenase complex and numerous peptides listed in claim 25 of group would not be used in any of the other groups Each type of disease has a different pathogenesis requires different search criteria The special technical feature linking groups and I appear to be that they use a vector encoding self peptide However Jindal et al Int J Exp Diabetes Res 2001 Feb 2 129 38 anticipates claims of 1 but not groups II IX Therefore the technical feature linking the inventions of groups 11 and I does not constitute a special technical feature as def
134. 6 440 Clin J Med 68 608 9 613 4 616 2001 di scussi on 565 7 1998 IJJ UD DU Ul AB 000 0000000 Di ckson Cu di scussi on rr Opin Neuro n 423 432 20011 Neurol ogy 51 S2 S65 7 1998 nm ng 1000000000 HHHHHHHHHHH Yankne ro Neuron 24 Neuron 160 9 503 506 1999 32 1996 Ross Neuron 19 Dickson Curr Opin Neuro 01 14 147 50 19970 Ch 423 32 20010 10 20 30 50 12 2005 510533 2005 4 21
135. Cl 5 6nM MCI O DIT 50 10u M dNTPQ 0 O0 20000 150 25000000000000000000 4 dNTPH 0000000000000 0 0 Klenow 5 00000 10400 dNTPH 3 0000000000000 0 00 0 0 0 10 O dNTPH 10 0 dNTP 0000 Kl enow 0 0 0 0 es U 0 11000000 U UJ m 1 UJ U 0 150 5040000000000 20nM Tri s Cl pH 7 59 0 10mM MgCl j 10nM DITO 33ng BSA 10nM 50nM 40u mj ATP 0 010 0 020 50 0 0 O T4 9200000000000 1000 14 CQ hrM ATP 0 0 60 550 0 0 0 T4 0 00 HHHHHHHHHHHHHHH 330 100p DNAD 0 OOOO link ersover
136. HHHHHHHHHHHHHHHHHHHH 2005 510533 2005 4 21 49
137. Ig IL 13 Z 4 7 U gt 4 10 134 PAD IL 4 II CID IL 4 11 10 CH IL 13 IL 4 11 10 IL 13 6 CEPI IL 4 G6PI 11 10 G6PI IL 13 GP 39 IL 4 39 IL 10 GP 39 1L 13 BIP 6 GP 39 IL 4 7 479 7 BIP G6PI GP 39 L 10 7 477 BIP G6PI GP 39 IL 13 cDNA MA 30 cDNA IL 10 cDNA 10 13 cDNA IL 4 cDNA L 13 cDNA 4 S SAg IL 4 SAg IL 10 SAgT IL 13 IRBP IL 4 IRBP IL 10 IRBP 1 13 I s FEZTL W 3 0 2 U IL 4 13 SAg IRBP IL 4 5 IRBP IL 13 SAg IRBP IL 4 SAg IRBP IL 13 7 F J cDNA cDNA IL 4 cDNA 7777 IL 10 7 74 77V IL 13
138. NA Nogo 10000000000000000 Nogo 3T 0000000000000 E12 DRAI 000 D 00 P4 00 1000000000000 10000000000 1000000000000 DNA 0000000000000 0 DNAI 0 0 0 DNA 0000000000000 1000000000000 21 BBB HHHHHHHHHHHHHHHHHHHHHHH Ranon Cuet Neuron 250 425 435 2000 Neurosci 219 3665 3673 20010 100000 100000000000000000000000000 944000 HHHHHHHHHHHHHH HHCGVMHDHHHHHHHHHHHHHHHHHHHHHHHHHHHHH 54 2005 510533 2005 4 21
139. X0 0 YO 00000 00 3 Msg GTGCTT ATGCTT GCGCTT ACGCTT GTGCCT ATGCCT GCGCCT e ACGCCT GTGCTC ATGCTC GCGCTC ACGCTC 1000 1 0000000000000 0000000 1000 11556 CoG 15519 6 225 292 1150 0 155 1000 DNA 0000 1000 10 MISO AAGGTTH U 0 0 0 0 0 0 0 0 0 0 00 00 0 0 0 0 40 IMO 0000000 1M 1000 0 115 GG 5 XJ 0 YO 3 MS GGGGTT AGGGTT GAGGTT GGGGCT AGGGCT GAGGCT AAGGCT GGGGTC AGGGTC GAGGTC AAGGTC 10000000000000 5 000 000 0 0 YO 0 0000 0000 0 3 31 2005 510533 2005 4 21 GGGCTT AGGCTT GAGCTT AAGCTT GGGCCT AGGCCT GAGCCT AAGCCT GGGCTC AGGCTC GAGCTC AAGCTC 1000000000000000001 000000000000000 1 1 1 1 L1 L1 1 100000 100000 g E g 5 DNAD
140. ass allele DRB1 0401 J Clin Invest 111 December 1996 Vol 98 pages Y 2597 2603 entire document Further documents are listed in the continuation of Special categorica of cited documents document defining the general state of the art which 35 not considered to be of particular relevance earlier application or patent published on or after the international fing date document which may thraw doubts on priority claim s or which k cited ta establich the publication dete of another citation or other special reason as specified document referring fo an oral disclosgre use exhibition or other means ipe Dein 42 the intemstionel filing date but Inter than the priority date claimed Name and mailing address of the ISA US of Patents and Trademarks Box PCT Washington D C 20231 Facsimile Na 703 305 3230 Form PCT ISA 210 second sheet July 1998 See patent family later document published after the intemational filing or priority date and not in conflict with the application but cited to understand the principle or theory underlying the invention document of particular relevance the claimed invention cannot be considered novel or cannot be considered to involve an inventive step when the document is taken alone document of particular relevance the claimed invention cannot be considered to involve an inventive step when the document is combined with ont
141. assification system followed by classification symbols 0 3 514 44 435 320 1 2005 510533 2005 4 21 International application PCT US02 37686 Documentation searched otber than minimum documentation to the extent that such documents are included in the fields searched Electronic data base consulted during the international search name of data base and where practicable search terms used BAST MEDLINE _ DOCUMENTS CONSIDERED TO BE RELEVANT Citation of document with indication where appropriate of the relevant passages Relevant to claim JINDAL et Prevention of diabetes in the NOD mouse by intta muscular injection of recombinant adeno associated virus containing the preproinsulin gene Int J Exp Diabetes Res 2001 Val 2 pages 129 138 entire document URBANEK RUIZ etal Immunization with DNA encoding an immunodominant peptide of insulin prevents diabetes in NOD mice Clin Immunol August Vol 100 2 pages 1 2 4 8 11 13 164 171 entire document RAPOPORT M J Interleukin 4 reverses T cell proliferative unresponsiveness and 5 14 18 71 72 6 7 16 17 71 72 prevents the onset of diabetes in Nonobese Diabetic mice J Exp Med July 1993 Vol 78 pages 87 99 entire document WICKER L S et al Naturally processed T cell epitopes from human glutamic acid 5 14 15 18 decarboxylase identified using mice transgenic for the type 1 diabetes associated human cl
142. d not invite payment of any additional fee As only some of the required additional search fees were timely paid by the applicant this international search report covers only those claims for which fees were paid specifically claims Nos Ip 4 4 No required additional search foes wore timely paid by the applicant Consequently this international search report is restricted to the invention first mentioned in the claims it is covered by claims Nos 1 2 4 18 71 72 Remark on Protest The additional search fees were accompanied by the applicant s protest No protest accompanied the payment of additional search fees Form 210 continuation of first sheet 1 1998 71 2005 510533 2005 4 21 PCT USO2 37686 INTERNATIONAL SEARCH REPORT BOX OBSERVATIONS WHERE UNITY OF INVENTION IS LACKING This application contains the following inventions or groups of inventions which are not so linked as to form a single general inventive concept under PCT Rule 13 1 In order for all inventions to be examined the appropriate additional examination fees must be paid Group I Claims 1 18 71 72 drawn to a method of treating diabetes Groups II Claims 1 8 19 23 48 50 52 54 60 64 71 72 and 74 drawn to a method of treating rheumatoid arthritis Groups Claims 1 8 24 28 48 50 52 59 71 72 and 74 drawn to a methad of treating primary biliary cirrhosis Groups IV Claims 1 7 29
143. ined by PCT Rule 13 2 as it does not define one contribution as a whole over the prior art Accordingly graups II IX and I are not so linked by the same or a corresponding special technical feature as to form a single general inventive concept This application further contains the following species of inventions Species I using a polynucleotide encoding the self pratein s wherein the polynucleatide is Species IL using polynucleotide encoding the self protein s wherein the polynucleotide is RNA The species listad above do not relate to a single general inventive concept under PCT Rule 13 1 because under PCT Rule 13 2 the species lack the same ar correspanding special technical features for the following reasons The special technical feature of each of the species of groups and 1 is drawn to using a polynudeotide encoding the Self protein s wherein the polynudeotide is DNA or The polymucleotide in the form of DNA RNA has different structural characteristics and different mode of operation As indicated above the Jindal reference anticipates species 1 but not species 11 accordingly the two species are not so linked by the same or a corresponding special technical feature as to form a single general inventive concept Form PCT ISA 210 second sheet July 1998 72 2005 510533 2005 4 21 HHHHHHHHH
144. rogen 100000000 Q 9 23 DNA O HU O O O O DNA 2 v D 5 m 3 Q EX kd 5 5 Ed DNAH HHHHHHHHHHHHHHHHHHHHHHHHHHHH 5700000000000 DNA 1000000 A 20 65kDa 69kDa CA69 DNA 000000000 PCR 9 p 5 0 025190 5rg 30 12
Download Pdf Manuals
Related Search
Related Contents
NumaView™ Software Interface Addendum Logitech 600 User's Manual defensor aBs3 BLE MODULE ISP130301 ISP130301 Bluetooth Low Energy LC-10T-S2 PREMIERS SOINS JA道東あさひ組合だより2010年 1月号(約10MB) TV One 1T-SX-634 video switch Digitus Printer connection cable, 10m 製品のお取扱いに関するお願い Copyright © All rights reserved.
Failed to retrieve file