Home
fosB 欠損マウスは成体海馬の神経新生の異常とてんかんの
Contents
1. LSM510 META Confocal Microscope System Carl Zeiss Microimaging Japan Tokyo Japan 1 20 30 Kajitani etal 2006 1 2 DF 3 5 7osg79 fosB to
2. 18300124 22221004 23657116 COE He NIS 14 10 11 12 13 Abbosh C Lawkowski A Zaben M Gray W 2011 GalR2 3 mediates proliferative and trophic effects of galanin on postnatal hippocampal precursors J Neurochem 117 425 436 Anouar Y Lee HW Eiden LE 1999 Both inducible and constitutive activator protein 1 like transcription factors are used for transcriptional activation of the galanin gene by different first and second messenger pathways Mol Pharmacol 56 162 169 Ben Ari Y Cossart R 2000 Kainate a double agent that generates seizures two decades of progress Trends Neurosci 23 580 587 Benjamini Y Hochberg Y 1995 Controlling the false discovery
3. fos fos fosBe LGFFB 1 5 CTCGTTTAGGACACAGG CACAGT 3 FBEX2U 5 ACGGTCACCGCAATCACAAC 3 genomic polymerase chain reaction PCR fosBY UIP 5 CAATGCCCCCTTCTGCCCTTTA 3 LIP 5 TGCTACTTGTGCCTCGGTTTCC 3 genomic PCR Ohnishi et al 2008 genomic PCR DNA Seizure scoring 2 Kajitani etal 2006 0 no reaction 1 arret of motion 2 myoclonic jerks of the head and neck with brief twitching movements 3 unilateral clonic activity 4 bilateral forelimb tonic and cloinic activity 5 generalized tonic clonic activity with loss of postural tone including death from continuous convulsion
4. fosB fosBW DG sp 7osB99 AFosB A2AFosB FosB Ds87 7os87 7 vov fosB fosB G fosB fosB C57BL 6J Clea Japan Inc Tokyo Japan 1 C57BL 6 Ohnishi etal 2011 fosB fosB9 6 7osg N17 fosB N12 ER fosB fosB fosB 6
5. 5 20 Danzer 2012 2 Snyder et al 2011 electroconvulsive therapy Danzer 2012 kainic acid KA ECT electroconvulsive seizures ECS fosB Fosb Kurushima et al 2005 Mandelzys et al 1997 Morris et al 2000 Nakabeppu and Nathans 1991 Ohnishi et al 2011 Fos 7osg alternative splicing alternative translation initiatton FosB AFosB A2AFosB
6. jn DG Grant et al 1992 Miyakawa et al 1995 osB9 AFosB A2AFosB DG fosB 10 2 Isir2 Pramparo et al 2011 SMAD3 DLK1 Wang and Symes 2010 Yin et al 2006 AFosB A2AFosB positive FosB negative TGF B1 Ohnishi et al 2008
7. Table 1 10 Allen Institute for Brain Science in situ hybridization ISH images http mouse brain map org o GAL PENK PROC fosB fosB
8. Adobe Photoshop CS5 Adobe System San Jose CA USA Imaje J 1 46r Unbiased stereological counting BrdU parvalbumin in 1 2 3 RIS 50 mg kg BrdU BrdU 1 oe 7 Tashiro et al 2007 FAENA 50 2XSSC 65 2 PBS T 0 3 TRIRON X 100 PBS HzO 10 2M 30 BrdU hilus BrdU 1 8 9 240 um bregma 1 35 3 51 mm Franklin and Paxions 1997 Stereo Investigator MBF Bioscience Williston VT fractionator program 60 125 um
9. Vog7 Gal Abbosh et al 2011 Mazarati et al 2000 11 Newton et al 2003 Thakker Varia et al 2007 FosB AFosB A2AFosB 10 7osB7 fosB 2f 4 GABA Perucca and Mula 2012 fosB d gt 7osP DG parvalbumin 9 7osg 7osg GABA TRH Deng et al 2006
10. Tukey s honestly significant difference HSD P false discovery Benjamini Hochberg Benjamini and Hochberg 1995 Kaplan Meier p 0 05 JMP 9 02 software SAS Institute Cary NC USA B G fosh fosB FosB AFosB A2AFosB FosB 5G4 FosB 43 kDa AFosB A2AFo
11. c m re CA1 CA1 CA2 DG hilus d fosB CA1 CA2 CA3 DG hilus FosB 5G4 N 4 SEM P WE two way ANOVA F7 ss 124 49 p lt 0 0001 A F p lt 0 05 Tukey Kramer HSD post hoc comparison MER 2 fosB a 72 NeuN fosB FosB 5G4 NeuN 50 um b 72
12. 2a control 3 AER 1 2 BrdU Ads 6 BrdU fps8 hilus BrdU ZR DCX NeuN BrdU DCX NeuN orthogonal projections 50 um b hilus BrdU N 5 SEM 44 fosB One way ANOVA control F212 2 53 0 121 F212 8 58 p 0 0049 P Tukey Kramer HSD post hoc comparison c DG BrdU hilus BrdU N 5 error bars fosB d 7osg One way ANOVA control F242 14 53 0 0006 KA F212 20 17 p 0 0001
13. fosB D A fosB ARE 63 24 AD AGT fosB 23 fosB 29 ps89 E Aged RT PCR 2 7osP DIk1 Smad3 Gal fosB TI O Tes t 10 Trh Yos Vgf Gal 7psB 9
14. BrdU BrdU p 0 0066 fosB 2f 3 2b BrdU fosB p 0 0015 t test EK fosB FEKE BrdU p 0 0006 fosB p 0 0006 p 0 002 Tukey Kramer HSD post hoc comparison X 2f LSCIM hilus BrdU DCX NeuN 3a hilus BrdU fosB
15. fosB Bit OF 7ps899 7 fosB 1 2 3 BrdU mn 54 2 BrdU SGZ Ht BrdU DCX NeuN 2b BrdU LSCIM 2c BrdU 70 DCX NeuN Dj 2d e BrdU DCX NeuN BrdU 20 75sg Tukey Kramer HSD post hoc comparison
16. 20 1 a b wild type fosB fosB null Control _ 6h 24h kDa 6 C 6 24 6 24h n 50 zi a FosB 2 235 ae AFosB 25 A2AFosB gt 2 50 Yo 25 amp 2 Anti FosB 5G4 Anti FosB C Anti AFosB 5 5 2 020 020 0 0 7 96 1 17 5 76 0 48 2 57 0 28 lt x lt 020 020 0 0 21 42 Control KA Saline or KA BrdU Sacrifice ENT omw RD ia Day 0 1 23 3 4 5 5 Control KA fas B a 1 a T a 3 k n e de 3 3 E n Brdu DCX NeuN fosg fos8 null E 40000 A E A E 30000 r m E 20000 3 5 10000 n Cont KA Cont KA Cont KA 0 wild type _ fosB9 fosB null Control KA 3 DEX Haul 3 3 a E 10000 0252 m anon 5000 2 4000 E 3 2000 a Control KA p 0 0054 p 0 0107 p D 0006 p 0 0001 x UT 20 03 z p 0033 z E D 23 4 a wild type 100 BHD HS kr 53 20 fos 8 20 40 60 Age weeks b wild type Li corte fosB null Ri cortas seizure fosB null seizure 4 nag I J Ri cortex Ll fes null seizure fos
17. 6 fosB a BrdU 1 70 fosB DG BrdU 200 um b BrdU 70 H RO NUM BrdU DG BrdU 70 H BO BrdU fosB Student t test p 0 7386 1 H H 5 70 N 3 c BrdU 70 fosB DG BrdU NeuN 4 BrdU 70 fosB DG BrdU BrdU NeuN 50 um BRET 5 fosB a Seizure score
18. fosB BroU ESTERI BE 25 CIBC fosB d fosB gt 8 Ed Ji 2 6 A 70 ARO BrdU 19 47 3 50 fosB GCL SGZ hilus CHR 6c fosB gt 7 TON 3 HEL 4 P 14 85 124 vwEBRGGEOE seizure score 2 BrdU 3b hilus BrdU DG 7 osp 7os879 7os8
19. 33 34 1 Relative level of AFosB Relative level of FosB Relative level of A2AF osB 10 Genatype P lt 0 0001 Time P lt 0 0001 8 interaction P lt 0 0001 Control Genotype 0 0035 Time P 0 0001 8 Interaction P 0 0139 Genotype 0 0019 6 1 0 0186 Interaction P 0 185 0 6 24 Time after KA administration h gt Time P lt 0 0001 gt Region P 0 0057 Interaction P lt 0 0001 8 80 B 60 gt gt 40 20 8 0 0 6 24 0 6 24 0 6 24 0 6 24 h CA1 CA2 CA3 DG Hilus 35 2 B Anti FosB 564 Anti MeuM Merged b FosB MeuM FosB MeuM FosB Nau 36 3 Control KA 6 h KA T h Bi5G4 anti DCX 37 4 e AFosB A2AFosB C m mm lt lt m GS GN um um mm m m m n xP s s um Neural Progenitors Neuroblasts neurens 1 2 Type 2b Type 3 38 5 Control day 70 Y ae m 22 ra ey Pol 22 gt c 120 100 0 1 day70 day1 day TO L L wild type fosB null Survival of cells in DG 55 E e ha 7 81025 inzi
20. C57BL 6J 7 fosB Flaherty and Bolivar 2007 A 7osP C57BL 6J fosB C57BL 6J fosB N 4 N 12 17 7 fosB 7os FosB AFosB A2AFosB fosB
21. fosB IET H 8 E 4b 2 fosB E ERAS DARIA FE AV fosB 40 DG parvalbumin 4b 9 50 70 7osp99 7 sp St EE FE E ZDA fosB lt Y Z fosB I 4a FO fosBW fosB Ed fosB 27 3
22. orthogonal projections 50 um 4 DG fosB AAs FosB AFosB A2AFosB SOX2 Lugert et al 2010 GFAP Ki67 7os DG DCX AFosB A2AFosB 5 DCX NeuN BrdU control 3 1 2 BrdU DCX NeuN BrdU 2c 50 um
23. 3 5 MAAATGGTGAAGGTCGGTGTG 3 5 TGAAGGGGTCGTTGATGG 3 Vgf VGF nerve growth factor inducible Smad3 MAD homolog 3 Drosophila Gal Galanin Trh Thyrotropin releasing hormone Sema3e Sema domain immunoglobulin domain 19 short basic domain secreted semaphorin 48
24. E fosB Ohnishi et al 2011 7osg fosB 12 l Snyder etal 2011 VGF GAL Vgf Thakker Varia et al 2010 Thakker Varia et al 2007 GAL Murck et
25. nulwt fosB ddwt sg nuldd fosB 7osg7 12 1 2 unpaired t test p E23 0 05 2 0 2 0 ANOVA p 0 05 an Asymptotic Multiple Testing Correction Benjamini Hochberg FDR Benjamini and Hochberg 1995 NI FORT HU ND 25 AP 1 H AP 1 AP 1 ECS ECS 1 NG DP E S
26. 47 7osB 4b DG GCL fosBY fosB L fosB ENZO 3 AAT 9 fosBW DG a AFosB A2AFosB 7s
27. fosB fosBW AFosB A2AFosB dentate gyrus DG subgranular zone SGZ AFosB FosB AFosB FosB FosB AFosB Kurushima et al 2005 7osp FosB AFosB A2AFosB 3 basal VV ko CHE SLD HETE EU 90
28. 3 4 C57BL 6J 8 10 25 Wako Osaka Japan 1 2 3 50 mg kg BrdU Sigma Aldrich Japan Tokyo Japan 2 Kaijitani etal 2006 40 um PBS
29. CA1 3 fosB FosB 5G4 NeuN orthogonal projection A 50 um DG fosB t FosB 5G4 Hi GFAP fk pi Ki67 DCX 6 72 SIC fosB GCL DG GFAP fosB fosB Ki67 72 fosB doublecortin DCX 31 N DCX fosB
30. 6 24 ERRO IR fosB FosB N 1b FosB AFosB A2AFosB ZI 3 fosB FosB 5G4 FosB C AFosB LSCIM FosB C AFosB FosB AFosB A2AFosB 1c FosB C Bee 6 72 FosB C hace AFosB 6 72 6 FosB AFosB
31. Hesdorffer et al 2012 5 fosB 5 13
32. 50 mg kg amp amp 3 mm HE 1 4 28 mm E bregma 1 mm 2mm bregma 1mm 2mm 0 02 mm bregma mm 3 mm 3mm 8 MEG 6168 Nihon Kohden Tokyo Japan 24 PowerLab 8SP data acquisition system AD Instruments Bella Vista Australia Y 7 F 7 7 NB75H Fujitsu Tokyo J
33. optical dissector etal 1998 GCL hilus 1 Aged DG parvalbumin parvalbumin unbiased DG LE EEG EEG os N 11 fosB N 6 fosBY 17 A N 6 N 6 3
34. NeuN NeuN MAB377 1 400 Chemicon Temecula CA USA SOX2 SOX2 Y 17 sc 17320 1 500 DCX Lugert et al 2010 DCX sc 8066 1 100 Santa Cruz Technology Santa Cruz USA Alexa Invitrogen Japan Tokyo Japan Ki67 NCL Ki67p Leica Microsystems Tokyo Japan parvalbumin parvalbumin MAB1572 1 5000 Milipore Temecula CA USA 100 mg kg 0 1M PBS 496 PFA 4 4 12
35. 50 mM Tris HCl pH 7 5 10 glycerol 400 mM NaCl 1 mM EDTA NaOH pH 8 0 1 mM EGTA NaOH pH 8 0 5mM DTT 0 5 40 protease inhibitor cocktail 30 17 500 x g 7 SDS PAGE 12 5 FosB Kajitani et al 2000 Nakabeppu et al 1993 Ohnishi et al 2011 Image J 1 46r National Institute of Health MD USA 27 Alexa 0 05 ug ml Sigma Aldrich Japan KK 10 Vectashield Vector Laboratories Burlingame CA USA LSM510 META Confocal Microscope System Carl Zeiss Microimaging Japan
36. fosB One way ANOVA Vgf control F26 3 87 p 0 0834 KA F26 1 47 p 0 3023 Smad3 control 2 5 11 0 0506 F26 4 39 p 0 0668 Gal control F26 10 72 0 0105 KA F26 11 2912 0 0093 Trh control F26 0 98 p 0 4297 KA F26 72 35 p lt 0 0001 Sema3e control F26 1 91 p 0 2281 KA F26 2 59 p 0 1548 P fi amp Student s t test post hoc comparison Tukey Kramer HSD post hoc comparison MER 11 fosB Basal FosB AFosB A2AFosB Vog7 Trh Gal DIk1 Srxn1 Serinc2 Pe7x AP 1 Smad3 FosB ee lt FosB L lt X 2 FosB Car12 AP 1 VGF DLK1 GAL TRH 1 PENK DEED 5 4 GAL VGF SRXN1 SERINC2 CAR12
37. Ohnishi et al 2011 fosB AFosB A2AFosB ECS fosB ECS fosB Hiroi etal 1998 7osg fosB Vo Gal Penk Srxn1 FosB AFosB A2AFosB
38. 25 mg kg 2 5 SEM 40 2 9 20 fosB fosB 2 6 2 BF fosB p 0 6145 p 0 0001 f 32 7os 3 p 0 0759 ordinal logistic fit effect likelihood ratio tests b fosB d fosB Nissl EE VIRADA HA ARG AR 6 500 8 CA1 DG a a
39. FosB fosB lt Y 509 SHES AREA Te fosB osg7 EU fosB 2 Immediate early gene Alternative splicing Adult neurogenesis Neural progenitor Proliferation Epilepsy
40. positive cells p 0 0421 6h AFosB FosB C Fisher s exact test 2 7s basal control 3 2 BrdU 6 BrdU 22 b control fosB fosB DG BrdU 200 um DCX NeuN BrdU 50 um d DG BrdU BrdU7DCX7NeuN BrdU NeuN Orthogonal projection
41. hilus DG 3C BrdU LC 5 23 fosB 475 fosB pA SE 0 66 B DG BrdU BrdU 1 ARE 70 6b rdU NeuN gt Iz 6 5 DES 7s fosB 13 80 fosB 80 Ben Ari and Cossart 2000
42. Total RNA fosB d fosB 1 young 7ops879 1 young 24 fosB i 12 2 Vo Smad3 Gal Trh Sema3e xj 10 10 Vg Islr2 Penk Srxn1 Serinc2 Car12 2 1 Trh Penk Srxn1 Smad3 activator protein 1 AP 1 Vgf Gal Trh Penk Srxn1 AP 1 FOS JUN JUNB Zhang et al 1998 1 AP 1 11 10 2 SMAD3
43. EL b 9 parvalbumin aged DEFER fosh fosB se a parvalbumin 200 um WT d d fosB Null fosB b parvalbumin FRE A ERLE 4 amp 77 7 N 4 SEM fosB d fosB S lt AXB NS one way ANOVA F2 1 69 p 0 2389 fosB null mice Figure 4a 70 95 HARE 10 Vef Smad3 Gal Sema RIO TBH RT PCR fosB fosB mRNA SEM N 3 Control KA 24 fosB d
44. BrdU BrdU7DC 50 um e fosB BrdU 2 100 BrdU BrdU DCX NeuN BrdU7DCX7NeuN BrdU7DCX7NeuNT KE 19 BrdU DCX NeuN BrdU DCX NeuN f DG BrdU N25 SEM fosBW fosB gt One way ANOVA control F212 9 56 p 0 0033 KA F212 10 08 0 0027 Tukey Kramer HSD post hoc comparison 3 PEE RN
45. SOX2 FosB AFosB A2AFosB Lugert et al 2010 72 NeuN T OH FosB 5G4 2 AFosB A2AFosB hilus 7 GFAP 3 GCL
46. 20 30 4 48 80C 40 um PBS Kajitani et al 2000 IHC AxioCam CCD Axioskop2 Plus Carl Zeiss Microimaging Japan Tokyo Japan 1 ml 10 mM Tris HCl pH 7 5 0 32 M sucrose protease inhibitor cocktail Nacalai Tesque Kyoto Japan 4 1000 x g C 10 1 ml 10 mM Tris HCl pH 7 5 0 32 M sucrose 1 mM EDTA NaOH pH 8 0 1 mM EGTA NaOH pH 8 0 5 mM DTT protease inhibitor cocktail 0 5 NP 40 CY LF KET 5 1 000 xg 10 120 ul
47. GFAP FosB 5G4 3 GCL 1 SGZ Ki67 doublecortin DCX Lugert et al 2010 3 72 FosB 5G4 FosB AFosB A2AFosB 4 i SOX2 SOX2 L 72s
48. TGF B fosh fosB basal 7os879 basal fosBW fosB fosB9 6 E SE fosB C57BL 6 C57BL 6J 12
49. 43 44 45 46 47 48 49 50 antidepressant mechanisms of seizures Ann N Y Acad Sci 739 135 153 Snyder JS Soumier A Brewer M Pickel J Cameron HA 2011 Adult hippocampal neurogenesis buffers stress responses and depressive behaviour Nature 476 458 461 Soriano FX Leveille F Papadia S Higgins LG Varley J Baxter P Hayes JD Hardingham GE 2008 Induction of sulfiredoxin expression and reduction of peroxiredoxin hyperoxidation by the neuroprotective Nrf2 activator 3H 1 2 dithiole 3 thione J Neurochem 107 533 543 Surmacz B Noisa P Risner Janiczek JR Hui K Ungless M Cui W Li M 2011 DLK1 Promotes Neurogenesis of Human and Mouse Pluripotent Stem Cell Derived Neural Progenitors Via Modulating Notch and BMP Signalling Stem Cell Rev Tahara K Tsuchimoto D Tominaga Y Asoh S Ohta S Kitagawa M Horie H Kadoya T Nakabeppu Y 2003 AFosB but not FosB induces delayed apoptosis independent of cell proliferation in the Ratla embryo cell line Cell Death Differ 10 496 507 Thakker Varia S Jean YY Parikh P Sizer CF Jernstedt Ayer J Parikh A Hyde TM Buyske S Alder J 2010 The neuropeptide VGF is reduced in human bipolar postmortem brain and contributes to some of the behavioral and molecular effects of lithium J Neurosci 30 9368 9380 Thakker Varia S Krol JJ Nettleton J Bilimoria PM Bangasser DA Shors TJ Black IB Alder J 2007 The neuropeptide VGF produces antidepressant li
50. Chen et al 1997 Nakabeppu and Nathans 1991 Ohnishi et al 2008 Sabatakos et al 2008 AFosB alternative splicing AfosB mRNA FosB Z C 101 Nakabeppu and Nathans 1991 A2AFosB AfosB mRNA Met79 alternative initiation DHRC 0 2 AFosB N N Fos C Sabatakos et al 2008 FosB AFosB Jun Kurushima et al 2005 Nakabeppu et al 1993 Tahara et al 2003 AFosB A2AFosB McClung and Nestler 2003 Renthal et al 2008 Sabatakos et al 2008 fosB Ohnishi et al 2011 AFosB A2AFosB
51. Kandel ER 1992 Impaired long term potentiation spatial learning and hippocampal development in fyn mutant mice Science 258 1903 1910 Halmi P Parkkila S Honkaniemi J 2006 Expression of carbonic anhydrases II IV VII VIII and XII in rat brain after kainic acid induced status epilepticus 15 14 15 16 17 18 19 20 21 22 23 24 25 Neurochem Int 48 24 30 Hesdorffer DC Caplan R Berg AT 2012 Familial clustering of epilepsy and behavioral disorders Evidence for a shared genetic basis Epilepsia 53 301 307 Marek GJ Brown JR Ye H Saudou F Vaidya VA Duman RS Greenberg ME Nestler EJ 1998 Essential role of the fosB gene in molecular cellular and behavioral actions of chronic electroconvulsive seizures J Neurosci 18 6952 6962 Hyman SE Comb M Lin YS Pearlberg J Green MR Goodman HM 1988 A common trans acting factor is involved transcriptional regulation of neurotransmitter genes by cyclic AMP Mol Cell Biol 8 4225 4233 Inuzuka M Hayakawa M Ingi T 2005 Serinc an activity regulated protein family incorporates serine into membrane lipid synthesis J Biol Chem 280 35776 35783 Kajitani K Yamaguchi H Dan Y Furuichi M Kang D Nakabeppu Y 2006 MTH1 an oxidized purine nucleoside triphosphatase suppresses the accumulation of oxidative damage of nucleic acids in the hippocampal microglia during kainate induced excitotoxicity J Ne
52. P fi amp Tukey Kramer HSD post hoc comparison 4 Aged 7s DG fosBY 10 fosB N 40 lt 0 0001 Kaplan Meier method and log rank test y 40 94 df 2 b 50 70 fosBY 7osp Lt cortex Rt cortex ARA Lt hipp Rt hipp FER N 5 X 4 fb Y 0 5 mV c fosB fosB Nissl 7os GCL Seizure Seizure 500 hm
53. FosB 5G4 7os FosB AFosB A2AFosB Ponceau S 1a b h control 6 h 24 h fosBY 77 5 fosB fosB 2 FosB fosB FosB AFosB A2AFosB AN 500 um XA fe 4 4 0 h control 6h 72h AD DG fosB FEMS BOLO MRT fosB E 3 fosB FosB 5G4 FosB C AFosB SOX2 Z DG SGZ fosB SOX2 Orthogonal projections 50 um SOX2 FosB N 3 100 SOX2
54. mRNA 7jos8B99 TRH mRNA 100 uro Qa 12 Car12 mRNA aged fosB 2 1 ORLA CS 1 Winum et al 2009 FosB AFosB A2AFosB Car12 AFosB A2AFosB a ERIS fosB Fahrner et al 2007 fosB DG GCL
55. rate A practica and powerful approach to multiple testing J R Stat Soc Series B Stat Methodol 57 289 300 Canu N Possenti R Rinaldi AM Trani E Levi A 1997 Molecular cloning and characterization of the human VGF promoter region J Neurochem 68 1390 1399 Chen J Kelz MB Hope BT Nakabeppu Y Nestler EJ 1997 Chronic Fos related antigens stable variants of AFosB induced in brain by chronic treatments J Neurosci 17 4933 4941 Cote Velez A Perez Martinez L Diaz Gallardo MY Perez Monter C Carreon Rodriguez A Charli JL Joseph Bravo P 2005 Dexamethasone represses cAMP rapid upregulation of TRH gene transcription identification of a composite glucocorticoid response element and a cAMP response element in promoter J Mol Endocrinol 34 177 197 Danzer SC 2012 Depression stress epilepsy and adult neurogenesis Exp Neurol 233 22 32 Deng PY Porter JE Shin HS Lei S 2006 Thyrotropin releasing hormone increases GABA release in rat hippocampus J Physiol 577 497 511 Fahrner A Kann G Flubacher A Heinrich C Freiman TM Zentner J Frotscher M Haas CA 2007 Granule cell dispersion is not accompanied by enhanced neurogenesis in temporal lobe epilepsy patients Exp Neurol 203 320 332 Flaherty L Bolivar V 2007 Congenic and consomic strains In Jones BC Mormede P Eds Neurobehavioral Genetics pp pp 115 127 New York NY Taylor amp Francis Grant SG O Dell TJ Karl KA Stein PL Soriano P
56. s Time after KA administration min lonuoo u19 VM 8 b 3000 2000 i 3 1000 WT did Mull 42 10 3 Vgf 31 Smad3 gt 3 p 0 0267 c 2 5 0 0273 9 p 0 03056 pe y 5 2 E 3 0 Control KA Control KA p lt 0 0001 lt 20 800404 4 60 Trh p ps t 5 0 0253 15 T E 5 5 3 210 p 0 0557 E 0 0092 z m 5 0 009 L a 0 Control KA Control KA 5 3 Sema3e c E EE gt 2 2 1 2 c 0 Control KA 43 11 Transcription N oem 15182 Normal Bm of gt newborn neurons nq 44 1 fos BY os fold change Transcripts Symbol Gene name Untreated 24 h after KA Cluster Id null wt dd wt null dd null wt dd wt null dd Young 10560481 Fosb FBJ osteosarcoma oncogene B 1 66 10526553 Vgf VGF nerve growth factor inducible 1 29 1 42 1 23 10398319 DIk1 delta like 1 homolog Drosophila 1 22 10594404 Smad3 SMAD family member 3 1 67 10464471 Gal galanin prepropeptide 2 30 1 86 1 24 10546417 Trh thyrotropin releasing hormone 3 26 2 50 1 30 sema domain immunoglobulin domain 19 short ba
57. susceptibility of audiogenic seizures in Fyn kinase deficient mice Brain Res Mol Brain Res 28 349 352 16 26 27 28 29 30 31 32 33 34 35 36 37 38 Morris TA Jafari N DeLorenzo RJ 2000 Chronic AFosB expression and increased AP 1 transcription factor binding are associated with the long term plasticity changes in epilepsy Mol Brain Res 79 138 149 Murck H Held K Ziegenbein M Kunzel H Holsboer F Steiger A 2004 Intravenous administration of the neuropeptide galanin has fast antidepressant efficacy and affects the sleep EEG Psychoneuroendocrinology 29 1205 1211 Nakabeppu Y Nathans D 1991 A naturally occurring truncated form of FosB that inhibits Fos Jun transcriptional activity Cell 64 751 759 Nakabeppu Y Oda S Sekiguchi M 1993 Proliferative activation of quiescent Rat 1A cells by AFosB Mol Cell Biol 13 4157 4166 Newton SS Collier EF Hunsberger J Adams D Terwilliger R Selvanayagam E Duman RS 2003 Gene profile of electroconvulsive seizures induction of neurotrophic and angiogenic factors J Neurosci 23 10841 10851 Ogden CA Rich ME Schork NJ Paulus MP Geyer MA Lohr JB Kuczenski R Niculescu AB 2004 Candidate genes pathways and mechanisms for bipolar manic depressive and related disorders an expanded convergent functional genomics approach Mol Psychiatry 9 1007 1029 Ohnishi YN Ohnishi YH Hokama M Nomaru H Yamazaki K Tominaga Y Sak
58. vomeronasal 2 receptor 1 41 50 vomeronasal 2 receptor 39 10559919 2810047C21Rik BC023179 EG665 RIKEN cDNA 2810047C21 gene cDNA sequence BC023179 139 577 predicted gene EG665577 1 10549932 2810047C21Rik EG665577 RIKEN cDNA 2810047C21 gene predicted gene EG665577 1 39 10595094 2310046A06Rik RIKEN cDNA 2310046A06 gene 1 24 10365104 F630110N24Rik RIKEN cDNA F630110N24 gene 1 26 1 21 10545886 1700019G17Rik RIKEN cDNA 1700019G17 gene 1 45 10447429 EG225058 predicted gene 4832 1 21 Aged 10586591 Car12 carbonic anhydrase XII 2 21 ND ND ND 10548879 matrix Gla protein 2 07 ND ND ND null wt fosB FEA 18 dd wt fosB xt null dd fosB5e RAB fosB AFIS 21 2 lt 1 2 unpaired t test p 0 05 gt 2 0 lt 2 0 G ANOVA p lt 0 05 p Asymptotic Multiple Testing Correction Benjamini Hochberg FDR ND 47 2 PCR Gene Forward Reverse Vof 5 GGCGCCCCGATGTTTTTCC 3 5 GACCTCTGGTACGCCGTCA 3 5 CACGCAGAACGTGAACACC 3 5 GGCAGTAGATAACGTGAGGGA 3 Gal 5 GAGAGGTTGGACCCTGAACA 3 5 GGTCTCCTTTCCTCCACCTC 3 Trh 5 GATTCTGGAGCCTTGCAGAC 3 5 AAAGCCAGAGCCATCATCAG 3 Sema3e 5 AGGCTACGCCTGTCACATAAA 3 5
59. vomeronasal 2 receptor r48 Vmn2r51 Vmn2r45 Vmn2r38 V 51 vomeronasal 2 receptor 45 vomeronasal 2 receptor 38 vomeronasal 2 receptor 32 vomeronasal 2 receptor 49 similar to vomeronasal 2 receptor 15 vomeronasal 2 receptor 37 vomeronasal 2 receptor 29 vomeronasal 2 receptor 43 vomeronasal 2 receptor 48 vomeronasal 2 receptor 51 vomeronasal 2 receptor 45 vomeronasal 2 receptor 31 vomeronasal 2 receptor 39 vomeronasal 2 receptor 37 vomeronasal 2 receptor 29 vomeronasal Vmn2r37 Vmn2r29 Vmn2r43 Vmn2 2 receptor 43 vomeronasal 2 receptor 42 vomeronasal 2 receptor r42 Vmn2r45 Vmn2r38 Vmn2r51 V 45 vomeronasal 2 receptor 38 vomeronasal 2 receptor 51 mn2r31 Vmn2r35 Vmn2r48 Vmn2r vomeronasal 2 receptor 31 vomeronasal 2 receptor 35 vomeronasal 2 receptor 48 vomeronasal 2 receptor 50 vomeronasal 2 receptor 39 vomeronasal 2 receptor 32 vomeronasal 2 receptor 49 vomeronasal 2 receptor 43 vomeronasal 2 receptor 35 vomeronasal 2 receptor 31 vomeronasal 2 receptor 39 vomeronasal 2 receptor 50 vomeronasal 2 receptor 37 vomeronasal 2 receptor 42 vomeronasal Vmn2r37 Vmn2r42 Vmn2r30 Vmn2 2 receptor 30 vomeronasal 2 receptor 48 vomeronasal 2 receptor r48 Vmn2r51 Vmn2r45 Vmn2r38 V 51 vomeronasal 2 receptor 45 vomeronasal 2 receptor 38 vomeronasal 2 receptor 32 vomeronasal 2 receptor 49 similar to vomeronasal 2 receptor 15 vomeronasal 2 rec
60. B null seizure Li soria fos E mail seizure 24 21 fos Fold change Literature Symbol Gene name Untreated 24 h after KA APA ECS Naqa ss Den Epilepsy or ddw nul w ddw nuldd Seres Young VGF nerve growth factor Canu et al 1 Wang etal Thakker Varaet Thakker Vari Newton et al Vat inducible 1429 0 s 1997 2010 al 2007 a et al 2007 2003 Dic delta like 1 homolog Surmacz et al Drosophila 2011 Verrecchia et Wang and Smad3 MAD homolog 3 Drosophila 1 67 al 2001 Symes 2010 Gal galanin prepropeptide 230 186 124 a 1 MR al Po PE al thyrotropin releasing Cote Veezet 7 Warg etal Sattin et al Deng et al hormone 326 250 130 al 2005 2010 1994 2006 Immunoglobulin Isir2 superfamily containing 1 33 Me leucine rich repeat 2 Penk preproenkephalin 1 24 451 4 ur al E al wee al sulfiredoxin 1 homolog Soriano et al Soriano et al NT 5 cerevisiae aber 2008 2008 Serinc2 serine incorporator 2 1 38 Beda et al aged Halmi et al Ca12 carbonic anhydrase XII ND ND ND 2006 Winum et al 2009 fosB 63 10
61. BrdU 1 FosB ps8 N Kil 79 130 fosB FosB AFosB and A2AFosB Nakabeppu and nas 1991 FosB FosB C 245 315 7 AFosB A2AFosB FosB Nakabeppu and Nathans 1991 FosB AFosB A2AFosB 0258 455954 AFosB 89890 1 100 gt fosB FosB AFosB and A2AFosB FosB 5G4 1 1000 for western blotting 1 500 for immunohistochemistry Cell Signaling Technology Japan KK Tokyo Japan BrdU 1170376 1 800 Roche Diagnostics Japan Tokyo Japan BrdU ab6326 1 1000 Abcam KK Tokyo Japan GFAP 26 GFAP G3893 1 1500 Sigma Aldrich Japan Tokyo Japan
62. al 2004 GAL E a Abbosh et al 2011 TRH Sattin et al 1994 fosB 11 fos5 fosB SOX2 GFAP RKi67 fosB FosB AFosB Kurushima et al 2005 Nakabeppu et al 1993 fosB
63. apan 5 RT PCR Total RNA ISOGEN cDNA High Capacity cDNA Reverse Transcription Kit Applied Biosystems Japan Tokyo Japan Vgf Smad3 Galanin Trh Sema3e mRNA RT PCR Thunderbird SYBR Green qPCR MIX Toyobo Osaka Japan ABI Prism 7000 Sequence Detection System Applied Biosystems Japan Tokyo Japan 3 T able 3 mRNA Vgf Smad3 Galanin Trh Sema3e Trh Sema3e mRNA 29 Franklin KBJ Paxinos G 1997 The mouse brain in stereotaxic coodinates San Diego Acade
64. eptor 37 vomeronasal 2 receptor 42 vomeronasal 2 receptor 45 vomeronasal 2 receptor 51 vomeronasal 2 receptor 35 vomeronasal 2 receptor 32 vomeronasal 2 receptor 49 vomeronasal 2 receptor 50 1 48 1 52 1 59 1 32 1 49 1 45 1 21 1 27 1 40 1 20 1 50 1 34 1 24 1 23 1 28 1 58 2 26 2 78 2 28 2 74 2 09 1 75 1 23 1 20 1 20 46 Vmn2r42 Vmn2r45 Vmn2r51 Vmn2 vomeronasal 2 receptor 42 vomeronasal 2 receptor 45 vomeronasal 10559901 r31 Vmn2r38 Vmn2r32 Vmn2r49 2 receptor 51 vomeronasal 2 receptor 31 vomeronasal 2 receptor 1 22 38 vomeronasal 2 receptor 32 vomeronasal 2 receptor 49 vomeronasal 2 receptor 29 vomeronasal 2 receptor 43 vomeronasal 10559880 Vmner29 Vmn2r43 Vmn2r3 1 Vmn2 2 receptor 31 vomeronasal 2 receptor 38 vomeronasal 2 receptor 1 42 r38 Vimn2r 5 Vinn2ra9 Vmn2r o 35 vomeronasal 2 receptor 39 vomeronasal 2 receptor 50 vomeronasal 2 receptor 37 vomeronasal 2 receptor 29 vomeronasal 2 receptor 43 vomeronasal 2 receptor 48 vomeronasal 2 receptor 51 vomeronasal 2 receptor 45 vomeronasal 2 receptor 31 vomeronasal 2 receptor 39 vomeronasal 2 receptor 43 vomeronasal 2 receptor 35 vomeronasal Vmn2r37 Vmn2r29 Vmn2r43 Vmn2 10559928 r48 Vmn2r51 Vmn2r45 Vmn2r31 V mn2r39 1 52 Vmn2r43 Vmn2r35 Vmn2r38 Vmn2 10559931 r31 Vmn2r50 Vmn2r39 2 receptor 38 vomeronasal 2 receptor 31
65. fosB Neuropsychopharmacology 2013 Apr 38 5 895 906 REVE ZEB 1 fosp FosB AFosB A2AFosB fosB fosB fosB fosB
66. ke behavioral effects and enhances proliferation in the hippocampus J Neurosci 27 12156 12167 Verrecchia F Vindevoghel L Lechleider RJ Uitto J Roberts AB Mauviel A 2001 Smad3 AP 1 interactions control transcriptional responses to in a promoter specific manner Oncogene 20 3332 3340 Wang Y Symes AJ 2010 Smad3 deficiency reduces neurogenesis in adult mice J Mol Neurosci 41 383 396 Wang YY Smith P Murphy M Cook M 2010 Global expression profiling in epileptogenesis does it add to the confusion Brain Pathol 20 1 16 Winum JY Poulsen SA Supuran CT 2009 Therapeutic applications of glycosidic carbonic anhydrase inhibitors Med Res Rev 29 419 435 Yin D Xie D Sakajiri S Miller CW Zhu H Popoviciu ML Said JW Black KL Koeffler HP 2006 DLK1 increased expression in gliomas and associated with oncogenic activities Oncogene 25 1852 1861 Zhang Y Feng XH Derynck R 1998 Smad3 and Smad4 cooperate with c Jun c Fos to mediate TGF B induced transcription Nature 394 909 913 18 1 BEX fob RERI fosh FosB AFosB A2AFosB a fosB 1 12 5 ug C 6 h 24 h
67. mic Press Kajitani K Yamaguchi H Dan Y Furuichi M Kang D Nakabeppu Y 2006 MTH1 an oxidized purine nucleoside triphosphatase suppresses the accumulation of oxidative damage of nucleic acids in the hippocampal microglia during kainate induced excitotoxicity J Neurosci 26 1688 1698 Kempermann G Kuhn HG Gage FH 1998 Experience induced neurogenesis in the senescent dentate gyrus J Neurosci 18 3206 3212 Lugert S Basak O Knuckles P Haussler U Fabel K Gotz M et al 2010 Quiescent and active hippocampal neural stem cells with distinct morphologies respond selectively to physiological and pathological stimuli and aging Cell Stem Cell 6 445 456 Nakabeppu Y Nathans D 1991 A naturally occurring truncated form of FosB that inhibits Fos Jun transcriptional activity Cell 64 751 759 Nakabeppu Y Oda S Sekiguchi M 1993 Proliferative activation of quiescent Rat 1A cells by AFosB Mol Cell Biol 13 4157 4166 Ohnishi YN Ohnishi YH Hokama M Nomaru H Yamazaki K Tominaga Y et al 2011 FosB is essential for the enhancement of stress tolerance and antagonizes locomotor sensitization by AFosB Biol Psychiatry 70 487 495 Ohnishi YN Sakumi K Yamazaki K Ohnishi YH Miura T Tominaga Y et al 2008 Antagonistic regulation of cell matrix adhesion by FosB AFosB A2AFosB encoded by alternatively spliced forms of fosB transcripts Mol Biol Cell 19 4717 4729 Tashiro A Makino H Gage FH 2007 Experience
68. sB 32 36 kDa 24 kDa fpsg79 1 fosB fosB Basal AFosB A2AFosB 7osB79 6 FosB AFosB A2AFosB VA 24 B 1a FosB N FosB 5G4 fosB fosB 1b 1b IR 6 Fd 1b 1b d fosB
69. sic domain JUSTE secreted hypothetical protein LOC100044162 ree 10511363 preproenkephalin 1 2 17 1 51 1 44 10400304 Egin3 egl nine homolog 3 C elegans 2 03 1 86 1 10 10594048 Isir2 immunoglobulin superfamily containing leucine rich repeat 2 1 33 10552516 kallikrein related peptidase 6 1 58 2 02 1 28 10375608 Scgb3a1 secretoglobin family member 1 1 84 2 69 1 47 10386076 Gilral glycine receptor alpha 1 1 82 2 01 1 10 10411082 Thbs4 thrombospondin 4 2 03 2 21 1 09 10467508 Blink B cell linker 1 21 10550674 Ercc2 excision repair cross complementing rodent repair deficiency 151 1 46 complementation group 2 10560304 Calm3 Calm1 Calm2 calmodulin 3 calmodulin 1 calmodulin 2 1 21 10381096 lgfbp4 insulin like growth factor binding protein 4 1 33 10555570 Phox2a paired like homeobox 2a 1 49 10564805 Pex a peroxisomal biogenesis factor 11 alpha 1 2 10376320 22 mitochondrial ribosomal protein L22 1 27 10550509 peptidoglycan recognition protein 1 1 41 1 54 1 65 10560826 Zfp109 zinc finger protein 109 1 42 1 39 1 44 10550833 21180 zinc finger protein 180 1 41 10477061 5 1 sulfiredoxin 1 homolog S cerevisiae 1 21 10498921 Tdo2 tryptophan 2 3 dioxygenase 1 47 10388254 Aspa aspartoacylase 1 24 1 52 10583887 neuropeptide S receptor 1 1 26 10482766 Rprm reprimo TP53 dependent G2 arre
70. specific functional modification of the dentate gyrus through adult neurogenesis a critical period during an immature stage J Neurosci 27 3252 3259 30 1 s a 1a FosB 5G4 FosB AFosB A2AFosB 0 h FosB N 3 SEM Z fosB d 7os P two way ANOVA FosB Fs js 330 43 p lt 0 0001 AFosB Fs is 24 42 p lt 0 0001 ALIAFosB Fs 1s 16 49 lt 0 0001 A D p lt 0 05 Tukey Kramer HSD post hoc comparison b 0 h control 6 h 24 h fpsB7 7os fosB 7osg FosB AFosB A2AFosB St 5G4 500 um IR
71. st mediator candidate 2 05 1 37 1 50 10516765 Serinc2 LOC 100044221 serine incorporator 2 hypothetical protein LOC100044221 1 38 10438189 Slc7a4 solute carrier family 7 cationic amino acid transporter y system 1 39 member 4 10462702 Hectd2 HECT domain containing 2 1 24 45 10498302 10498620 10551319 10552557 10554655 10574033 10585610 10605493 10433172 10408928 10526410 10527332 10559837 10549923 10559928 10549904 10549921 10549923 10559883 Gm410 Trim59 LOC630539 Adck4 Klk1b8 Mex3b Nup93 Ptpn9 Prrg1 Glycam1 Hspb1 Hspb1 Nptx2 Vmn2r29 mn2r32 Vmn2r49 LOC100042688 Vmn2r37 Vmn2r29 Vmn2r43 Vmn2 r48 Vmn2r51 Vmn2r45 Vmn2r31 V mn2r39 50 Vmn2r39 Vmn2r32 Vmn2r49 Vmn2r43 Vmn2r35 Vmn2r31 Vmn2 r39 Vmn2r50 mn2r32 Vmn2r49 LOC 100042688 Vmn2r37 Vmn2r42 Vmn2r45 Vmn2 r51 Vmn2r35 Vmn2r32 Vmn2r49 V mn2r50 gene model 410 NCBI tripartite motif containing 59 similar to mouse RING finger 1 aarF domain containing kinase 4 kallikrein 1 related peptidase b8 mex3 homolog B C elegans nucleoporin 93 protein tyrosine phosphatase non receptor type 9 proline rich Gla G carboxyglutamic acid 1 glycosylation dependent cell adhesion molecule 1 heat shock protein 1 heat shock protein 1 neuronal pentraxin 2 vomeronasal 2 receptor 29 vomeronasal 2 receptor 37 vomeronasal 2 receptor 42 vomeronasal Vmn2r37 Vmn2r42 Vmn2r30 Vmn2 2 receptor 30 vomeronasal 2 receptor 48
72. tal RNA ISOGEN Nippon Gene Tokyo Japan RNeasy Mini Kit Qiagen Tokyo Japan DNA total RNA 100 ng gt poly A WT Expression Kit Ambion Austin TX USA TAL cDNA WT terminal labeling kit Affymetrix Japan Tokyo Japan L GeneChip Mouse Gene 1 0 ST array Affymetrix GeneSpring GX 10 0 Agilent Technologies Palo Alto CA USA NCBI s Gene Expression Omnibus GEO Series accession number GSE37056 RT PCR Total RNA ISOGEN cDNA High Capacity cDNA Reverse Transcription Kit Applied Biosystems Japan Tokyo Japan Vor Smad3 Galanin Trh Sema3e mRNA RT PCR
73. umi K Nestler EJ Nakabeppu Y 2011 FosB is essential for the enhancement of stress tolerance and antagonizes locomotor sensitization by AFosB Biol Psychiatry 70 487 495 Ohnishi YN Sakumi K Yamazaki K Ohnishi YH Miura T Tominaga Y Nakabeppu Y 2008 Antagonistic regulation of cell matrix adhesion by FosB and AFosB A2AFosB encoded by alternatively spliced forms of fosB transcripts Mol Biol Cell 19 4717 4729 Perucca P Mula M 2012 Antiepileptic drug effects on mood and behavior Molecular targets Epilepsy Behav Pramparo T Libiger O Jain S Li H Youn YH Hirotsune S Schork NJ Wynshaw Boris A 2011 Global developmental gene expression and pathway analysis of normal brain development and mouse models of human neuronal migration defects PLoS Genet 7 e1001331 Renthal W TL Maze Covington HE 3rd Truong HT Alibhai Kumar Montgomery RL Olson EN Nestler EJ 2008 AFosB mediates epigenetic desensitization of the c fos gene after chronic amphetamine exposure J Neurosci 28 7344 7349 Sabatakos G Rowe GC Kveiborg M Wu M Neff L Chiusaroli R Philbrick WM Baron R 2008 Doubly truncated FosB isoform A2AFosB induces osteosclerosis in transgenic mice and modulates expression and phosphorylation of Smads in osteoblasts independent of intrinsic AP 1 activity J Bone Miner Res 23 584 595 Sattin A Pekary AE Lloyd RL 1994 TRH gene products are implicated in the 17 39 40 41 42
74. urosci 26 1688 1698 Kurushima H Ohno M Miura T Nakamura TY Horie H Kadoya T Ooboshi H Kitazono T Ibayashi S lida M Nakabeppu Y 2005 Selective induction of AFosB in the brain after transient forebrain ischemia accompanied by an increased expression of galectin 1 and the implication of AFosB and galectin 1 in neuroprotection and neurogenesis Cell Death Differ 12 1078 1096 Lason W Przewlocka B Van Luijtelaar G Coenen A 1994 Proenkephalin and prodynorphin mRNA level in brain of rats with absence epilepsy Neuropeptides 27 343 347 Lugert S Basak O Knuckles P Haussler U Fabel K Gotz M Haas CA Kempermann G Taylor V Giachino C 2010 Quiescent and active hippocampal neural stem cells with distinct morphologies respond selectively to physiological and pathological stimuli and aging Cell Stem Cell 6 445 456 Mandelzys A Gruda MA Bravo R Morgan Jl 1997 Absence of a persistently elevated 37 kDa fos related antigen and AP 1 like DNA binding activity in the brains of kainic acid treated fosB null mice J Neurosci 17 5407 5415 Mazarati AM Hohmann JG Bacon A Liu H Sankar R Steiner RA Wynick D Wasterlain CG 2000 Modulation of hippocampal excitability and seizures by galanin J Neurosci 20 6276 6281 McClung CA Nestler EJ 2003 Regulation of gene expression and cocaine reward by CREB and AFosB Nat Neurosci 6 1208 1215 Miyakawa T Yagi T Taniguchi M Matsuura H Tateishi K Niki H 1995 Enhanced
Download Pdf Manuals
Related Search
Related Contents
Tecumseh AWA2450ZXT Drawing Data Kenwood DPX-MP3120 User's Manual Philips Battery charger 15 minutes - Ocean Sensor Systems, Inc. Samsung Samsung REX 60 User Manual crivelli piano gestione emergenze gennaio 2015 HUNT ENGINEERING API for Windows Installation and User Manual 内容見本PDF LSA 37 - 2 POLOS - ACC Copyright © All rights reserved.
Failed to retrieve file