Title 大腸菌におけるGC-CG transversion型突然変異の抑制機構 の
Contents
1. C CC 2 MutM Saccaromyces cerevisiae Ogg1 C C N ORF FabA DNA C C2. 28 Aboul ela F Koh D Tinoco I Jr and Martin F H 1985 Base base mismatches Thermodynamics of double helix formation for dCA3XA3G dCT3 YT3G X Y A C G T Nucleic Acids Res 13 4811 4824 Akasaka S and Yamamoto K 1994 Hydrogen peroxide induces G C to T A and G C to C G transversions in the supF gene of Escherichia coli Mol Gen Genet 243 500 505 Au K G Clark S Miller J H and Modrich P 1989 Escherichia coli mutY gene encodes an adenine glycosylase active on G A mispairs Proc Natl Acad Sci USA 86 8877 8881 Babic I Andrew S E and Jirik F R 1996 MutS interaction with mismatch and alkylated base containing DNA molecules detected by optical biosensor Mutat Res 372 87 96 Bjoras M Luna L Johnsen B Hoff E Haug T Rognes T and Seeberg E 1997 Opposite base dependent reactions of a human base excision repa
3. mutM GST MutM MutM C C Val Asp Lys Arg Glu 7 Tyr Thr Lys Glu ORF FabA fabA LRM 5 WAH MutM GC CG
4. CC103 Miller 1992 1998 CC103 GC CG DNA GC CG UV B y MacBride etal 1991 Akasaka et al 1994 Sargentini et al 1994 Buchko et al 1995 o 72 mutHLS GC CG QG G CCC Kramer etal 1984 Su etal 1988 Schaaper 1993
5. 2 3 CC103 GC CG GC CG 1 GC39 KRIZ Singer OPI Singer er al 1989 GC39 mut39 ar39 67 9 23 66 0 19 66 9 90 mut39 67 67 DNA mutY Nghiem et al 1988 o TT miniTn10
6. Schaaper et al 1987 Dra1991 Echols et al 1991 Modrich 1991 Smith 1992 Miller 1992 Modrich et al 1996 Wallace 1997 Miller 1992 1996 1998 Modrich et al 1996 Wallace 1997 Mol 1999 Eisen 1999 Modrich 1991 Modrich et al 1996 Mol et al 1999 Eisen et al 1999 DNA Schaaper 1993 o DNA 10 10 Schaaper 1993 o AY y FIBER DNA
7. 12 FAL OGGI OGG1 MutM 2 CC103 Cupples etal 1989 1 3 GC CG CC103 4 5 14
8. GC CG urY MutY 8 8 1 DNA Ogg1 mutY d e GA GA GA A GST GA C C A CO GE on Co bo dA EA C C
9. CC103 3 4 FE Gal X Gal CC103 P1 lysate CC103 GC CG GC39 GC CG GC CG
10. Molecular Cloning Fritsch et al 1989 A Short Course in Bacterial Genetics Miller 1992 1 1 2 DNA 2 DNA 3 Ogg7 Girard Girard et al 1997 S cerevisiae 2 9 1 0 PCR Ogg KOD Plus DNA TOYOBO 1 1 kb pKK223 3 Amersham Pharmacia Biotech pKK223 3 YOGG1 CC104 mutMmutY RIAL BRR RR
11. 2 SDS PAGE 8 PVDF N N 1 0 VDKRE YTKE 9 KERO ORF FabA N p4 9 37 9 2 FabA 1 4 MutM
12. 3 mutM 2 1 2 2 MutM 1 MutM GST fusion Nagashima et al 1997 Shinmura et al 1997 o GST tag MutM mutM 1 6 M7 1 MutM 13 1 3 CC
13. P1 lysate lysate Pl CC103 1 1 2 single colony isolation BSR GOO OEK LR COMMOIm 277 b AR Y Larr 4 37C 1 OD BREL d EK COMRO1 ml 100 pg ml LB 37C 2 4B LI HER 9 1 3 Singer PI Smger er al 1989 25 P1 lysate SSL GOO LB Berlyn etal 1996 Singer et al 1996
14. P Gal X Gal 1 4 mu 9 miniTn 0 GC39 DNA BamHI pUC118 BamHI JM109 LB gr39 miniTn70 BeaBest miniTn70 Halling et al 1982 2 1 1 6 8CC 15 8 1 2 DNA 20 fmol MutY 10 ml 20 mM Tris HCl pH 7 6 0 5 mg BSA 10 10 mM EDTA 37 2 ml 2 5 M NaCl
15. 2 3 o MutM MutM C C 4 mu MutM C C 19 M5 6 o MutM in vitro ASEZ EKEN SZ ZE PaPy Hatahet et al 1994 Tchou et al 1991 Tchou et al 1994 David et al 1998 MutM DNA DNA AP Mol etal 1999 Eisen ef al 1999 Hatahet et al 1994 Tchou et al 1991 Tchou er al 1994 David et al 1998 MutM CC
16. BE MRL Muy 8 8 1 5 DNA 1 6 8 17 18 mutM CC103 CC103 mutY Lact 4 MutM in vitro 8 8 Michaels et al 1992a Tchou etal 1991 MutM 8 8 GC CG DNA 8 dGMP DNA
17. DNA ORF mutY mus ERA urY CC104mut39 CC104 mutY GC TA DERE R4 CC103urY Lac 4 o 8 GO 23 8 Bridges eta al 1996 Cheng et al 1992 DNA 8 Wood etal 1990 Shibutani etal 1991 Tchou etal 1993 8 GC TA
18. 8 8 8 17 8 8 8 1 1 8 o TOBA 8 0 7 nmol mg 8 0 1 nmol mg 18 BIR DNA GG G_G
19. GST tag MutY MutY 8 MutY 8 M15 MutY 8 8 8 data not shown 17 g 5 MutY 8 1 6
20. Immobilon P Millipore 20kDa 1 0 8 ORF A gt dii l ds Randam Tn 10 insertion mutagenesis A Short Course in Bacterial Genetics Miller 1992 21098 Kleckner et al 1978 CC103 miniTn 10 tet lym Kleckner et al 1978 39 5C 2 0 4 15 ugm 40 pg ml 5 Bromo 4 chloro 3 indolyl D galactside X Gal 500 ug ml Phenyl B D galactside P Gal
21. GC CG ER EtA GC39 DNA mutY MutY Y GC CG MutY 8 8 MutY 8 1 7 8 La
22. 7 8 GO 8 GC CG 9 MutY Friedberg et al 1995 DNA
23. MutM OGG mutM C 1 C C 2 C A 3 C G 4 C T V 35 A C 6 A A 7 A G 8 A T 9 G C 1 0 G A 1 1 G G 1 2 G T 1 3 T C 1 4 T A 15 T G 1 6 T T 1 OGG1 band MutM band edi Unknown band FabA Band free probe C1234567 890112134156 1 2 C
24. Cronan etal 1988 5 pombe p190 210 FAS 1 2 AGO DNA DNA Kaslan et al 1994 1 DNA 20 renaturing strand exchange Kaslan etal 1994 DNA processing KRE TOGO C C MutM FabA C C S pombe 2 C C mutHLS C C mLS DNA Schar et al 1993a b S pombe 2 C C Cmb1 Cmb2 Fleck etal 1998
25. Muts C C 2 Wagner etal 1995 Babic et al 1996 GC CG 2 1 C C G G CC103 C C Cmb1 Fleck et al 1994 C C CC C A CT
26. Tajiri et al 1995 Moriya et al 1993 Cheng et al 1992 Grollman et al 1993 MutM MutY MutT 3 8 MutM FaPy 8 DNA Demple et al 1994 Tchou et al 1991 Michaels et al 1991 Rabow et al 1997 MutY 8 Demple et al 1994 Michaels et al 1990a Michaels et al 1990b Michaels et al 1992 8 DNA G A Aboul ela et al 1985 o MutT DNA 8 3 8 1 Maki etal 1992 mutMmutY 2
27. 3 3 1 Lac GC39 2 Lac PEA 15 GC9 GC24 3 Lae GC40 GC41 2 3 Lac GC CG GC CG GC39 2 2 GC39 Singer PI
28. data not shown MutM C C DNA MutM CCC 2 CC CC C 2 FabA 7 8 FabA S512 BRA 9 o FabA B hydroxydecanoyl acyl carrier protein dehydrase Cronan etal 1988 Silbert etal 1967 Magnuson etal 1993 Saito etal 1995 FabA DNA
29. C C MutM van der Kemp et al 1996 Nash et al 1996 Sandigursky et al 1997 Bjoras et al 1997 Dherin et al 1999 Ishida et al 1999 MutM 7 van der Kemp etal 1996 Nash et al 1996 MutM CCC M10 11 Ogg7 14 Ogg7 uz OGG1 0QOGG1 1 C C Pa 1 0 0GG1 MutM 1 1 0OGG1 C C
30. C C C C C T C A 12 3 5 8 CCC 9 12 C A 1 3 16 C T C C C T C A 1 0 14 CC C C 1 2 CC C C 4 3 ar 2
31. 3ZP C C 50 3 C 1 C C 2 C A 383 Cag 4 C T 5 A C 6 A A 7 A G 8 A T 9 G C 1 0 G A 11 G G 12 G T 1 3 T C 1 4 T A 15 T G 1 6 T T 1 shifted band me shifted band2 gt b 123 4 JO amp 9101112 13141516 3 C C C C 1 C A 2 C T Larr Za 3 A C 4 T C 5 8 C C 9 1 2 C A v Y13 16 C T 6 10 1 4 C
32. 4 KBA mutY KEH muty pLC20 5 Nishimura et al 1992 2 1 2 1 3 PCR mutY PCR PcoRI Sall EcoRI Sall pGEX 4T 3 pGEX MutY CC104mutMmutY 5 ZZ 6000 rpm 1 5 1g 3 ml bufferA 50 mM Tri HCl pH 8 0 1 mM EDTA _80C bufferA 3 8000 rpm 12000 rpm 4 C 3 0 6 Hise Re REA TH HH ped EE 6000 rpm BIDEN
33. McGoldrick er al 1995 AMYH Muty 41 DNA 26 MutM OGG1 FabA FAS 27 B Weiss J H Miller M M Wu A Holmgren B Bachmann
34. 16 Halling et al 1982 mut39 miniTn10 mutY Michaels et al 1990a Tsai Wu etal 1991 GC39 mutY GC CG 4 ur3 miniTn7 CC104 Cupples et al 1989 mutY Nghiem et al 1988 7g739 mutY amp 2 4 MuEY GC39 GC CG mutY pGEX 4T 3 Amersham Pharmacia Biotech mur GST MutY
35. 40 60 2 HiTrap Q 3 HiTrap Heparin 4 purified protein NH gt VDKRE 7YTKE d d k k d x E coli FabA NH2 MVDKRES YTKEDLLASGRGELFGAKGPQLP 8 N FabA N ORF FabA NN MutM band gt FabA band bd free probe 9 fabA mutM C C C MutM FabA C 1 2 fabA 3 mu
36. GST All GST tag 9 C C ur 40 60 bufferA bufferA 1 1 HiTrap Q Amersham Pharmacia Biotech bufferB 20 mM Tri HCl pH 8 0 150 mM NaCl 2 o 55H 2 bufferC 20 mM Hepes pH 7 6 150 mM NaCI HiTrap Heparin Amersham Pharmacia Biotech 3 Le bs Y 3 HiPrep 16 60 Sephacryl S 200HR Amersham Pharmacia Biotech bufferB 4 1 0 C C 4 17 5 SDS PAGE
37. GC TA DRAB Nghiem et al 1988 Tajiri et al 1995 Moriya et al 1993 mutY GC CG gt 24 2 1 8 marY GC CG 3 8 Bridges etal 1996 24 8 DNA 8 dAMP dGMP Braun Braun etal 1997 8 GC CG 2 MutY DNA 8 GC CG
38. Aboul ela etal 1985 C G G 1 1 CC 2 G C CCC 2 data not shown C C K 2 50 1 C C 2 C C 1 G G
39. 11 1 5 C A 8 1 2 1 6 C T 50 1 shifted band erde em shifted band2 erla ya free probe mp 1234 567 8 91011121314151617181920212223 4 CC CC 2 CC 1 mutD L gt 2 mutL L gt 3 mutM 4 muth L gt 5 mutY L gt 6 ung L gt 7 vs 8 uvrD 9 ada gg 1 0 xthnfo La 1 1 gK4 1 2 hupA hupB 1 3 gps 14 mfd 15 nthnei 1 6 7ec4 1 7 mutH L gt 1 8 mutS L gt 19 recB recC spcg 2 0 topA 21 umuC umuD 2 2 uvrA L gt 2 3 topB
40. 1 e E e E d ak shifted band shifted band2 erle free probe gt Ww 1234 567 8 9101112 13141516 5 MutM BLZ1 GST MutM IPTG Glutathione Sepharose 4B GST MutM GST tag MutM 3 W C C 1 C C 2 C A L gt 3 C G 4 C T 5 A C 6 A A 7 A G 8 A T 9 G C 1 0 G A 1 1 G G 1 2 G7 T 1 3 T C 1 4 T A L gt 1 5 T G 16 T T 1 MutM Band e i234 6 MutM C C MuLM G
41. C C Y mutM OGG1 C 1 C C 2 C A 3 C G 4 C T 5 A C 6 A A 7 A G 8 A T L gt 9 G C 1 D G A 1 1 G G 1 2 G T L gt 13 T C 1 4 T A L gt 15 T G 1 6 T T 1 B galactosidase 461 Glu A NK T 106 104 105 pr A E M13 Miller CC lacZ E lacZ ER 461 dE GOZ d A EOS LEN e CC101 CC106 8 galactosidase CC101 AT CG CC102 GC AT CC103 GC CG CC104
42. SS _wa O E ZE KYOTO UNIVERSITY ENAI AL Kyoto University Research Information Repository 0 O O GC CG transversion 000000000 Dissertation Kyoto University 7 0 0 O http hal handle ne 2433 151660 Kyoto University AI A tg x gt r H an Bio GUI 3 KBR Ic BI A GC CG transversion Fill ZE HK DE Fe 1 i ES fa Sa OSES ZERO O b GO CG GC CG UV B y GC CG DNA QGC CG
43. Jiricny et al 1988 CCC S cerevisiae Fy h e hT OGGI 8 DNA AP van der Kemp et al 1996 Nash et al 1996 Sandigursky etal 1997 MutM 8 8 Mol etal 1999 Eisen etal 1999 van der Kemp etal 1996 Nash etal 1996 Sandigursky et al 1997 Wallace 1997 S cerevisiae CCC M10 1 1 MutM van der Kemp et al 1996 Nash etal 1996 C C TWA DOK S cerevisiae OGG lizat Abn CC
44. dCMP MutY 8 MutM 8 MutM MutY Bridges 5 Bridges etal 1996 Braun Braun ef al 1997 GC CG 23 GC CG Nghiem 13 14 mt ER GC TA Nghiem etal 1988 3
45. 1 0 Bridges et al 1996 GC CG Mackay Mackay etal 1994 8 DNA dCMP dAMP dGMP MutY 8 8 1 7 1 8 GC TA 0 4 GC CG MutY MutY hMYH Slupska etal 1996 hMYH 5 3 5 MutY HeLa
46. Cmb1 22kDa DNA HMG Cmb1 MutM FabA HMG Magnuson et al 1993 Boiteux et al 1987 Cmb1 C A C T KE TT GA O GpG Fleck et al 1998 Cmb2 CCC Fleck etal 1998 C C Fleck etal 1999 mutHLS DNA CC C MutM FabA MutS 21 MutM CC cerevisiae Miret et al 1993
47. Singer etal 1989 P1 lysate GC39 LB Beryn et al 1996 Singer et al 1996 GC39 uz39 66 9 90 67 9 23 66 0 19 nuz39 67 2 3 mut39 miniTn10 mut39 miniTn 70
48. 2 23 5 fmol 4 30 12 1 X TBE 100 V 80 X Sd da Gl TIE yt APG bos CPT MD C A b gt 76 C G b Y7T7 AJA 8 A G Jarr A T b 710 GeO ziz i G A 1 2 G G 1 3 G T b 1 A T A L gt 15 T G 1 6 T T FNIVLE DNA 1 4 6 2 1 DNA 580 DNA 2 1 4 16 4 DNA 5 8 GO DNA 3 7 9 2 DNA 5 80 DNA 1 0 1 3 3 DNA 5 80 DNA shifted band err de i Esr SE gr er erd oo Shifted band2 pr e rr er amp amp gt WWW 12345 67 8 910111213141516 2 C C
49. 1 2 MutM OGGI GC CG CC103 CC103 Cupples etal 1989 M13 GC CG 22 4 5 1 4 3 3 1 QGC CG CC103 6
50. 18 19 20 21 de d 24 25 26 27 28 29 30 9678 Fleck O Schar P and Kohli J 1994 Nucleic Acids Res 22 5289 5295 Fleck O Kunz C Rudolph C and Kohli J 1998 J Biol Chem 273 30398 30405 van der Kemp P A Thomas D Barbey R de Oliveira R and Boiteux S 1996 Proc Natl Acad Sci USA 93 5197 5202 Nash H M Bruner S D Scharer O D Kawate T Addona T A Spooner E Lane W S and Verdine G L 1996 Curr Biol 6 968 980 Sandigursky M Yacoub A Kelley M R Xu Y Franklin W A and Deutsch W A 1997 Nucleic Acids Res 25 4557 4561 Cupples C G and Miller J H 1989 Proc Natl Acad Sci USA 86 5345 5349 Girard P M Guibourt N and Boiteux S 1997 Nucleic Acids Res 25 3204 3211 Nagashima M Sasaki A Morishita K Takenoshita S Nagamachi Y Kasai H and Yokota J 1997 Mutat Res 383 49 59 Shinmura K Kasai H Sasaki A Sugimura H and Yokota J 1997 Mutat Res 385 75 82 Cronan J E Jr Li W B Coleman R Narasimhan M de Mendoza D and Schwab J M 1988 J Biol Chem 263 4641 4646 Bj r s M Luna L Johnson B Hoff E Haug T Rognes T and Seeberg E 1997 EMBO J 16 6314 6322 Dherin C Radicella J P Dizdaroglu M and Boiteux S 1999 Nucleic Acids Res 27 4001 4007 Ishida T Hippo Y Nakahori Y Matsushita I Kod
51. 5 AATTCCCGGGGAT CCGT CAACCT GCAGCCAAGCT 3 5 AATTCCCGGGGATCCGT CGACCTGCAGCCAAGCT 3 5 AATTCCCGGGGAT CCGTCTACCT GCAGCCAAGCT 3 5 CCGGAATTCATGTCTTATAAATTCGG 3 5 GCCCAAGCTTCTAATCTATTTTTGCTTC 3 5 CCAAAATCATTAGGGGATT CAT CAG 3 5 AACAACAGTGAATTCGGT GACCAT 3 5 ATATAGTCGACGTT GCAGGAAAGTA 3 5 GAACTAGT GCAT CCCCCGGGCT GC 3 5 GAACT AGT GGAT CCCCCGGGCT GC 3 5 GAACTAGT GOAT CCCCCGGGCT GC 3 5 GCAGCCCGGGGGATGCACTAGTTC 3 5 GCAGCCCGGGGGATACACTAGTTC 3 5 GCAGCCCGGGGGATCCACTAGTTC 3 2 DNA 1 8 CC 9 1 0 yOGGI 1 1 mut39 1 2 1 3 grY 1 4 19 MutY 1 6 0 8 Ta Group Strain Papillation Mutants per 108 cells Lact Rif GC39 148 188 GC9 125 1550 GC24 101 1460 II GC40 d 15 1280 GC41 28 256
52. 95 C 5 95 0 1 0 1 20 mM EDTA 98 C 5 7 M 20 80 C 11 REA 1 1 CCC G G GC CG C C G G GC TA 8 GC CG 5 Purmal et al 1994a b MutY 8
53. MutY 3 7 1 4 1 3 5 7 9 1 1 MutY 2 4 6 8 10 1 2 MutY DNA time hr A AAA d 24 mer eee 16 mer eie 14 mer M 0 1 2 3 4 6 8 10 B17 8 MutY 8 2 DNA 20 fmol 60 ng MutY 3 7 0 1 0 GO G POA Po urpe 6 24 mer eie 16 mer 14 ner ad E e qe E gt eae M 12345678 910111 213141516 B18 8 MutY 20 fmo 8 1 8 8 9 1 6 2 DNA MutY MutY 1 8 9 16 0mg 2 10 12ng Lb gt 3 11 2 4 n
54. Regulation of fatty acid biosynthesis in Escherichia coli Microbiol Rev 57 522 542 Maki H and Sekiguchi M 1992 MutT protein specifically hydrolyses a potent mutagenic substrate for DNA synthesis Nature 355 273 275 McBride T J Preston B D and Loeb L A 1991 Mutagenic spectrum resulting from DNA damage by oxygen radicals Biochemistry 3 0 207 213 McGoldrick J P Yeh Y C Solomon M Essigmann J M and Lu A L 1995 Characterization of a mammalian homolog of the Escherichia coli MutY mismatch repair protein Mol Cell Biol 15 989 996 Michaels M L Pham L N ghiem Y Cruz C and Miller J H 1990 MutY an adenine glycosylase active on G A mispairs has homology to endonuclease III Nucleic Acids Res 1 8 3841 3845 Michaels M L Cruz C and Miller J H 1990 mutA and mutC two mutator loci in Escherichia colithat stimulate transversions Proc Natl Acad Sci USA 87 9211 9215 Michaels M L Pham L Cruz C and Miller J H 1991 MutM a protein that prevents G C T A transversions is formamidopyrimidine DNA glycosylase Nucleic Acids Res 1 9 3629 3632 Michaels M L Cruz C Grollman A P and Miller J H 1992 Evidence that MutY and 34 MutM combine to prevent mutations by an oxidatively damaged form of guanine in DNA Proc Natl Acad Sci USA 8 9 7022 7025 Michaels M L and Miller J H 1992 The GO system protects organisms from the mu
55. Scharer O D Kawate T Addona T A Spooner E Lane W S and Verdine G L 1996 Cloning of a yeast 8 oxoguanine DNA glycosylase reveals the existence of a base excision DNA repair protein superfamily Curr Biol 6 968 980 Nghiem Y Cabrera M Cupples C G and Miller J H 1988 The mutY gene a mutator locus in Escherichia coli that generates G C T A transversions Proc Natl Acad Sci USA 8 5 2709 2713 Nishimura A Akiyama K Kohara Y and Horiuchi K 1992 Correlation of a subset of the pLC plasmids to the physical map of Escherichia coli K 12 Microbiol Rev 56 137 131 Purmal A A Kow Y W and Wallace S S 1994 Major oxidative products of cytosine 5 hydroxycytosine and 5 hydroxyuracil exhibit sequence context dependent mispairing in vitro Nucleic Acids Res 2 2 72 78 Purmal A A Kow Y W and Wallace S S 1994 5 Hydroxypyrimidine 36 deoxynucleoside triphosphates are more efficiently incorporated into DNA by exonuclease free Klenow fragment than 8 oxopurine deoxynucleoside riphosphates Nucleic Acids Res 2 2 3930 3935 Rabow L E and Kow Y W 1997 Mechanism of action of base release by Escherichia coliFpg protein role of lysine 155 in catalysis Biochemistry 3 6 5084 5096 Radicella J P Clark E A and Fox M S 1988 Some mismatch repair activities in Escherichia coli Proc Natl Acad Sci USA 85 9674 9678 Saito K Hamajima A O
56. Modrich 1991 Modrich et al 1996 Miller 1996 1998 Mol et al 1999 Eisen et al 1 1999 G T MutS Msh MutS Msh MutL MIh Pms GATC MutH Modrich 1991 Miller 1992 1996 1998 Modrich et al 1996 Miller 1992 1996 1998 Modrich et al 1996 Miller CC Cabrera et al 1988 Nghiem et al 1988 Cupples et al 1989 E 8 Cupples et al 1989
57. 4 mM spermidine 0 5 mM EDTA 10 glycerol 25 mM NaCl 25 mM KCl 0 01 mM ZnCl and 0 125 mM each dNTP Sonicated calf thymus DNA 5 ug was added to the reaction mixture Electrophoresis was performed at 100 V on non denaturing 12 polyacrylamide gels in TBE buffer 89 mM Tris borate pH 8 0 and 2 5 mM EDTA The gels were dried and then autoradiographed at 80 C using Fuji RX film Purification of GST MutM proteins A plasmid expressing GST MutM fusion protein was kindly supplied by Dr J Yokota National Cancer Center Research Institute Japan The GST mutM fusion gene contains the whole coding region of the E coli mutM gene amino acids 1 269 25 26 The fusion protein was expressed in E coli strain BL21 with 1 mM IPTG and purified on a Btathione Sepharose 4B column The GST MutM fusion protein was further treated with thrombin protease to remove the GST tag Purification of C C mismatch binding protein The cell extracts of E coli mutM mutant was divided into 4 fractions 0 20 20 40 40 60 and 60 80 saturation of ammonium sulfate and the binding activity to mismatch containing oligonucleotides in each fraction was tested The 40 60 ammonium sulfate saturation fraction exhibited the highest binding activity The precipitates obtained with 40 60 ammonium sulfate saturation were dissolved in buffer A and dialyzed against the same buffer Fraction I Fraction I was loaded on a HiTrapQ anion exchange column Amersham Pharma
58. Aburatani H 1999 Structure and chromosome location of human OOO7 Cytogenet Cell Genet 8 5 32 232 236 Kaslan E and Heyer W D 1994 Schizosaccharomyces pombe fatty acid synthase mediates DNA strand exchange in vitro J Biol Chem 269 14103 14110 Jiricny J Hughes M Corman N and Rudkin B B 1988 A human 200 kDa protein binds selectively to DNA fragments containing G T mismatches Proc Natl Acad Sci USA 8 5 8860 8864 van der Kemp P A Thomas D Barbey R de Oliveira R and Boiteux S 1996 Cloning and expression in Escherichia coli of the OOO7 gene of Saccharom yces cerevisiae which codes for a DNA glycosylase that excises 7 8 dihydro 8 oxoguanine and 2 6 diamino 4 hydroxy 5 N methylformamidopyrimidine Proc Natl Acad Sci USA 93 5197 5202 Kleckner N Barker D F Ross D G and Botstein D 1978 Properties of the translocatable tetracycline resistance element Tn 10in Escherichia coli and bacteriophage lambda Genetics 9 0 427 461 Kramer B Kramer W and Fritz H J 1984 Different base base mismatches are corrected with different efficiencies by the methyl directed DNA mismatch repair system of E coli Cell 38 879 887 Mackay W J Han S and Samson L D 1994 DNA alkylation repair limits spontaneous base substitution mutations in Escherichia coli J Bacteriol 176 3224 3230 33 Magnuson K Jackowski S Rock C O and Cronan J E Jr 1993
59. GC TA CC105 AT TA CC106 AT GC 314 CC103 CC103mutM CC103mut39 X Gal P Gal 37 6 A CC103 B CC103mutM C CC103mut39 G C GO A G G GO G G A E a ek band ed aa band2 es Gres e gt free probe 123 456783 101112131415 1 5 MutY 10 fmol 2 DNA MutY 1 ws GC 6 GVA ho d deb Woe 1 bid GO G 1 3 1 6 G A 1 4 7 10 13 Mury 2 5 8 11 1 4 40ng MutY 3 6 9 12 160 ng MutY 9 G G G G GO G GO G GO A G A substrates erre c pes o 0 products Ju a e 1234 BZ 8 3101112 16 MutY 8 DNA DN A 20 fmol 420 ng
60. Modrich 1996 Miller 1996 Miller 1998 DNA Fleck et al 1994 Fox et al 1994 Worth et al 1994 DNA C C Aboul ela etal 1985 LL mutHLS CCC Miiler 1998 C C GC CG GC CG Miiler 1998 CC C CCC 2 1 o 8 C C C A CTO
61. plasmid vector pKK223 3 Pharmacia after digestion by EcoRI and HindIII The resulting plasmid was named pKK223 3 YOGGI To assure activity of protein encoded by the recombinant gene E coli CC104mutMmutY was transformed with the plasmid pKK223 3 YOGG1 The plasmid could suppress the frequency of spontaneous G C T A transversions in E coli CC104mutMmutY Preparation of cell extracts Overnight cultures of E coli were harvested by centrifugation and the cell pellets about 1 g wet weight were resuspended in 3 ml of buffer A 50 mM Tris HCl pH 8 0 and 1 mM EDTA and stored at 80 C The samples were diluted 3 fold with buffer A and then sonicated in an ice water bath followed by centrifugation at 8 000 rpm for 30 min and subsequently 12 000 rpm for 30 min at 4 C Gel shift assays The synthetic 34 mer oligonucleotides 5 AGCTTGGCT GCAGGTXGACGGATCCCCGGGAATT 3 were 32p_labeled at the 5 end with y P ATP by T4 polynucleotide kinase and then annealed with their complementary oligonucleotides Ss_AATTCCCGGGGATCCGTCYACCTGCAGCCAAGCT gt where X and Y represent purine A G and pyrimidine T C bases respectively Binding of proteins to the duplex oligonucleotides was monitored by gel shift assays according to the method of Fleck el al 18 with a slight modification Protein extracts were incubated for 30 min at 4 C with 23 5 fmol of 22p_labeled oligonucleotides in 25 mM Tris HCl pH 8 0 containing 0 5 mM dithiothreitol
62. 0 CC103 3 11 ANE m3 5 Lac T Rif Papillation Z lt TA Ea Number of Lac revertants per Strain 108 cells en CC103 1 CC103mutY 120 CC104mutY pGEX MutY 18 CC103mutM 2 CC103mut39 146 CC103mut39 pGEX MutY 13 CC103mutMmut39 149 CC104 6 CC104mut39 232 CC104mutY 204 CC104mutY pGEX MutY 18 4 mutM mutY mut39 pGEX MutY CC103 CC104 Lact 3 7 CC103 6 1 0 CC104 2 PGEX 4T 3 Lact To be revised to Nucleic Acids Res Identification of proteins of Escherichia coli and Saccharomyces cerevisiae that specifically bind to C C mismatches in DNA Takehisa Nakahara Qiu Mei Zhang Kazunari Hashiguchi and Shuji Yonei Department of Biological Sciences Graduate School of Sc
63. 4 Mismatch repair proteins MutS and MutL inhibit RecA catalyzed strand transfer between diverged DNAs Proc Natl Acad Sci USA 9 1 3238 3241 Zhang Q M Sugiyama H Miyabe I Matsuda S Saito I and Yonei S 1997 Replication of DNA templates containing 5 formyluracil a major oxidative lesion of thymine in DNA Nucleic Acids Res 25 3969 3973 Miller J H 1992 A Short Course in Bacterial Genetics Cold Spring Harbor Laboratory 40 Press NY Berlyn M K B Low K B and Rudd K E 1996 In Neidhardt F C ed Escherichia coliand Salmonella Vol 2 ASM Press WA pp 1715 1902 Singer M and Low K B 1996 In Neidhardt F C ed Escherichia coli and Salmonella Vol 2 ASM Press WA pp 1812 1815 Wallace S S 1997 Oxidative Stress and the Molecular Biology of Antioxidant Defenses ed J G Scandalios Cold Spring Harbor Laboratory Press NY pp 49 90 Fritsch E F Maniatis T and Sambrook J 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Press NY Friedberg E C Walker G C and Siede W 1995 DNA repair and mutagenesis ASM Press WA 41 shifted band erlie shifted band ia free probe erdi b 23456 7 8 910111213141516 1 SP
64. A P 1991 Insertion of specific bases during DNA synthesis past the oxidation damaged base 8 oxodG Nature 349 431 434 Shinmura K Kasai H Sasaki A Sugimura H and Yokota J 1997 8 hydroxyguanine 7 8 dihydro 8 oxoguanine DNA glycosylase and AP lyase activities of hOGG1 protein and their substrate specificity Mutat Res 385 75 82 Silbert D F and Vagelos P R 1967 Fatty acid mutant of E coli lacking a hydroxydecanoyl thioester dehydrase Proc Natl Acad Sci USA 58 1579 1586 Singer M Baker T A Schnitzler G Deischel S M Goel M Dove W Jaacks K J Grossman A D Erickson J W and Gross C A 1989 A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of 38 Escherichia coli Microbiol Rev 53 1 24 Slupska M M Baikalov C Luther W M Chiang J H Wei Y F and Miller J H 1996 Cloning and sequencing a human homolog hMYH of the Escherichia coli mutY gene whose function is required for the repair of oxidative DNA damage J Bacteriol 178 3885 3892 Smith K C 1992 Spontaneous mutagenesis experimental genetic and other factors Mutat Res 2777 139 162 Su S S Lahue R S Au K G and Modrich P 1988 Mispair specificity of methyl directed DNA mismatch correction in vitro J Biol Chem 263 6829 6835 Tajiri T Maki H and Sekiguchi M 1995 Functional cooperation of
65. Boiteux S O Connor T R and Laval J 1987 EMBO J 6 3177 3183 Fleck O Lemann E Sch r P and Kohli J 1999 Nature Genet 21 314 317 18 FIGURE LEGENDS Fig 1 Gel shift assays for mismatch binding proteins 32p_labeled double stranded oligonucleotides containing all possible single base mismatches 23 5 fmol were incubated with cell extracts prepared from wild type E coli After incubation for 30 min at 4 C the reaction mixtures were separated by an electrophoresis on 12 non denaturing polyacrylamide gels in TBE buffer at 100V The gels were dried and then autoradiographed using Fuji RX films at 80 C Lane 1 C G lane 2 C A lane 3 C G lane 4 C T lane 5 A C lane 6 A A lane 7 A G lane 8 A T lane 9 G C lane 10 G A lane 11 G G lane 12 G T lane 13 T C lane 14 T A lane 15 T G lane 16 T T Fig 2 Mismatch specificity of the C C binding activities determined by competition with different heteroduplexes Reactions were performed with radiolabeled oligonucleotides containing the C C mismatch and a 50 fold excess of unlabeled oligonucleotide as competitor Lane C without competitor lane 1 C C lane 2 T C lane 3 A C lane 4 C T lane 5 C A lane 6 C G lane 7 A A lane 8 A G lane 9 A T lane 10 G C lane 11 G A lane 12 G G lane 13 G T lane 14 T A lane 15 T G lane 16 T T Fig 3 Cytosine containing mismatch binding activities in cell extracts of various mutants of E
66. CL 3 0 12 Fuji RX 80 CTR 8 GST GST MutM Nagashima et al 1997 Shinmura et al 1997 BL21 100 37C 2 354 1 mM IPTG 37 C 8 GST MutY pGEX MutY BL21 22 24 C OD 0 8 0 1 mM IPTG 22 24 C 8 7 Glutathione Sepharose 4B Amersham Pharmacia Biotech GST fat
67. MutT MutM and MutY proteins in preventing mutations caused by spontaneous oxidation of guanine nucleotide in Escherichia coli Mutat Res 33 6 257 267 Tchou J Kasai H Shibutani S Chung M H Laval J Grollman A P and Nishimura S 1991 8 oxoguanine 8 hydroxyguanine DNA glycosylase and its substrate specificity Proc Natl Acad Sci USA 8 8 4690 4694 Tchou J and Grollman A P 1993 Repair of DNA containing the oxidatively damaged base 8 oxoguanine Mutat Res 299 277 287 Tchou J Bodepudi V Shibutani S Antoshechkin I Miller J Grollman A P and 39 Johnson F 1994 Substrate specificity of Fpg protein Recognition and cleavage of oxidatively damaged DNA J Biol Chem 269 15318 15324 Tsai Wu J J Radicella J P and Lu A L 1991 Nucleotide sequence of the Escherichia coli micA gene required for A G specific mismatch repair identity of GIGA and mutY J Bacteriol 173 1902 1910 Wagner R Debbie P and Radman M 1995 Mutation detection using immobilized mismatch binding protein MutS Nucleic Acids Res 23 3944 3948 Wood M L Dizdaroglu M Gajewski E and Essigmann J M 1990 Mechanistic studies of ionizing radiation and oxidative mutagenesis genetic effects of a single 8 hydroxyguanine 7 hydro 8 oxoguanine residue inserted at a unique site in a viral genome Biochemistry 29 7024 7032 Worth L Jr Clark S Radman M and Modrich P 199
68. S cerevisiae OGGI gene cerevisiae and mammalian cells contain a protein OGG1 which functions as an 8 oxoguanine DNA glycosylase AP lyase activity 20 22 28 30 but has no obvious structural similarity to MutM 20 21 Thus the components that repair the 8 oxoguanine are functionally if not structurally conserved in bacteria yeast and mammalian cells So it was 11 of interest to examine if the 5 cerevisiae OGG1 protein had a C C mismatch binding activity as well as the E coli MutM protein The plasmid pKK223 3 YOGG1 carrying the S cerevisiae OGG gene was constructed and introduced into E coli mutM mutant and extracts of the mutant cells were tested to determine whether or not they contained the C C mismatch binding activities The results are shown in Fig 7 There were two dense bands produced by binding to the C C mismatch containing oligonucleotides and weak bands produced by binding to the C T and C A substrates The substrate specificity of yeast OGG1 protein was the same as the binding activity in E coli MutM protein Fig 5 These results indicated that the S cerevisiae OGG1 protein could also bind to the C C mismatches in DNA DISCUSSION Errors during DNA replication are a potential source of mismatches such as G G and C C 4 5 7 8 Genetic recombination between homologous but not identical DNA sequences would be another cause of such mismatches 18 31 32 Mispairs in DNA are a substrate for mismatch repair p
69. ST 1 2 mutM 3 GST MutM d GST MutM Y GST tag MutM Y CC 4 MutM GST tag 8 MutM 31 kDa GST tag 26 kDa 1 kDa 55 6 39 2 26 6 e 20 1 14 3 7 C C 17 5 SDS PAGE M 55 6 39 2 26 6 20 1 14 3 kDa 1
70. We ER LU 20mM Tris HCl pH 7 5 5mM MgCl 1 pg ml pepstatin A 1 mM PMSF 3 mM dithiothreitol DIT 0 5 mm 10 6 Zio TOA godo SEE LL Zo TOWE 14600 rpm 3 0 A De d dE ZA Fleck Flecket al 1994 ARK DNA TT 4 y P ATP 25 mM Tri HCl pH 8 0 0 5 mM DTT 4mM spermidine 0 5mM EDTA 10 glycerol 25 mM NaCl 25 mM KCl 0 01 mM ZnCl 0 125mM dATP dCTP dGTP dTTP 4LT 5 mg DNA 4
71. abeled oligonucleotides 34 mers which contained a defined single base mismatch and the reaction mixtures were subsequently separated on non denaturing polyacrylamide gels Binding of a protein to one of the 34 mers retards its migration through the gel and results in a shifted band The results are shown in Fig 1 We found two dense bands produced by binding to the C C mismatch containing oligonucleotides and weak bands produced by binding to the C T and C A substrates No shifted bands were found for non cytosine containing mismatches such as G T The binding activity was not affected by the sequence context around the mismatches data not shown The C C mismatch binding activities disappeared upon boiling the reaction mixtures data not shown Thus the two band shifts were due to mismatch specific binding of proteins present in the extracts We next analyzed the competition ability of all substrates used in this study against the C C mismatch to determine the substrate specificity of the mismatch binding proteins A 50 fold excess of unlabeled oligonucleotide was used as competitor Fig 2 shows that under these conditions the production of both specific shifted bands was completely abolished by specific competition with unlabeled C C mismatch containing oligonucleotide but unaffected when other oligonucleotides were used as competitors These results indicated that the C C mismatch is the best substrate for both binding proteins C C bin
72. ama T Nishimura S and Aburatani H 1999 Cytogenet Cell Genet 85 232 236 31 qe 33 34 35 36 Od 38 39 40 41 42 43 44 45 Fox M S Radicella J P and Yamamoto K 1994 Experientia 50 253 260 Worth L Jr Clark S Radman M and Modrich P 1994 Proc Natl Acad Sci USA 91 3238 3241 Aboul ela E Koh F D and Tinoco I Jr 1985 Nucleic Acids Res 13 4811 4824 Hatahet Z Kow Y W Purmal A A Cunningham R P and Wallace S S 1994 J Biol Chem 269 18814 18820 Tchou J Kasai H Shibutani S Chung M H Laval J Grollman A P and Nishimura S 1991 Proc Natl Acad Sci USA 88 4690 4694 Tchou J Bodepudi V Shibutani S Antoshechkin I Miller J Grollman A P and Johnson F 1994 J Biol Chem 269 15318 15324 David S S and Williams S D 1998 Chem Rev 98 1221 1261 Silbert D F and Vagelos P R 1967 Proc Natl Acad Sci USA 58 1579 1586 Magnuson K Jackowski S Rock C O and Cronan J E Jr 1993 Microbiol Rev 51 522 542 Saito K Hamajima A Ohkuma M Murakoshi I Ohmori S Kawaguchi A Teeri T H and Cronan J E Jr 1995 Transgenic Res 4 60 69 K slin E and Heyer W D 1994 J Biol Chem 269 14103 14110 Sch r P and Kohli J 1993 Genetics 133 825 835 Sch r P Munz P and Kohli J 1993 Genetics 133 815 824
73. amycin and chloramphenicol were purchased from Wako Pure Chemicals Ampicillin was the product of Meiji Seika T4 polynucleotide kinase was obtained from New England Biolabs Glutathione Sepharose 4B and thrombin protease were purchased from Amersham Pharmacia Biotech Isopropyl 1 thio B D galactopyranoside IPTG EcoRI HindIII and KOD Plus DNA polymerase were obtained from TOYOBO y P ATP gt 259 TBq mmol was the product of ICN Biomedicals Inc Construction of recombinant S cerevisiae OGG1 gene The plasmid overproducing A cerevisiae OGG1 protein was constructed according to the method of Girard et al 24 We synthesized two PCR primers YOGG1 For 5 CCGGAATTCATGTCTTATAAATTCGG 3 and YOGG1 Rev 5 GCCCAAGCTTCTAATCTATTTTTGCTTC 3 S cerevisiae genomic library kindly supplied by Dr M Ajimura National Institute of Radiological Sciences Japan was used as a template for the PCR reaction to amplify the S cerevisiae OGG1 gene The primer YOGG1 For was used to engineer an EcoRl restriction site at the beginning of OGG gene Primer YOGG1 Rev was used to introduce a HindIII restriction site at the end of OGG gene The PCR was performed with a high fidelity KOD Plus DNA polymerase initiated by a 3 min incubation at 94 C followed by 30 cycles of 94 C 30 sec 50 C 30 sec and 68 C 90 sec with a final extension of 4 min at 72 C The 1 1 Kb amplified fragment containing the whole coding region of the OGG gene was inserted into
74. at the low mobility complex consists of the C C mismatch containing oligonucleotide and MutM protein Purification and characterization of the second C C mismatch binding protein Next we purified the second C C mismatch binding protein from cell extracts of E coli mutM 10 strain by ammonium sulfate precipitation fraction 1 followed by chromatography through HiTrapQ fraction 11 HiTrap Heparin fraction III and HiPrep Sephacryl S200HR fraction IV Fraction IV showed homogeneity of molecular mass about 20 KDa Fig 5 The sequence of the N terminal 10 amino acids of the purified protein was determined to be Val Asp Lys Arg Glu T yr Thr Lys Glu This matched the sequence of a predicted polypeptide starting at the second codon of E coli fabA gene 27 This FabA protein should have a molecular weight of 18 969 as predicted from its amino acid sequence This value was consistent with our findings using SDS PAGE of fraction IV C C mismatch binding activities in cell extracts of fabA mutant of E coli Extracts of an E coli fabA mutant were tested to determine whether or not they contained the C C mismatch binding activities The high mobility complex was not found with the cell extracts of the fabA mutant while the low mobility complex was present Fig 6 These results indicated that FabA is a protein that can recognize and bind to C C mismatches in DNA C C mismatch binding activities in cell extracts of E coli with the
75. athways Because C C mispairs are less stable than other types O mispairs 33 they would be a good substrate for mismatch repair However the mutHLS mismatch repair pathway does not recognize C C mismatches 4 8 11 If left unrepaired C C mismatches would have mutagenic consequences and should result in G C C G transversions However spontaneous G C gt C G transversions are rare events 4 8 11 Therefore another specific repair pathway must operate on C C mismatches in E coli The present experiments revealed the formation of two mismatch dependent DNA protein complexes upon incubation of oligonucleotide heteroduplexes with crude extracts of E coli 12 wild type cells Fig 1 Both complexes were formed preferentially with C C mismatch containing oligonucleotides Fig 1 In addition unlabeled duplex oligonucleotides containing C C mismatches efficiently prevented the formation of C T and C A mismatch protein complexes Fig 2 These results indicated that E coli has at least two distinct proteins that specifically bind to C C mismatches The present experiments revealed that E coli MutM protein has the ability to specifically bind to the C C mismatches This conclusion Was reached based on the following facts gel shift assays showed that the low mobility complex was completely absent in the cell extracts prepared from E coli mutM mutant Fig 3 Furthermore purified MutM protein could bind directly to the C C mismatches Fi
76. bi bk Co Pan Jd A ed II 14 mut39 Tn10 15 1 GQC CG 1 1 CCC GG 1 2 CC C EA 1 3 amp 89 ODCCA AVI FREI YNZ OER 1 4 MutM CC 2 GC CG 2 2 2 GC39 2 3 af 9 miniTn70 2 4 MutY 5 1 2 MutM 3 CC 4 C C 5 MutM C C 6 KABAN GC CG
77. ce Foundation to Q M Z 15 REFERENCES 10 11 12 13 14 15 16 17 Drake J W 1991 Annu Rev Genet 25 125 146 Modrich P 1991 Annu Rev Genet 25 229 253 Smith K C 1992 Mutat Res 277 139 162 Miller J H 1992 A Short Course in Bacterial Genetics Cold Spring Harbor Laboratory Press New York Modrich P and Lahue R 1996 Annu Rev Biochem 62 101 133 Wallace S S 1997 Oxidative Stress and the Molecular Biology of Antioxidant Defenses ed J G Scandalios Cold Spring Harbor Laboratory Press New York pp 49 90 Miller J H 1996 Annu Rev Microbiol 50 625 643 Miller J H 1998 Mutat Res 409 99 106 Mol C D Parikh S S Putnam C D Lo T P and Tainer J A 1999 Annu Rev Biophys Biomol Struct 28 101 128 Eisen J A and Hanawalt P C 1999 Mutat Res 435 171 213 Zhang Q M Ishikawa N Nakahara T and Yonei S 1998 Nucleic Acids Res 26 4669 4675 Kramer B Kramer W and Fritz H J 1984 Cell 38 879 887 Su S S Lahue R S Au K G and Modrich P 1988 J Biol Chem 263 6829 6835 Schaaper R M 1993 J Biol Chem 268 23762 23765 Wagner R Debbie P and Radman M 1995 Nucleic Acids Res 23 3944 3948 Babic I Andrew S E and Jirik F R 1996 Mutat Res 372 87 96 Radicella J P Clark E A and Fox M S 1988 Proc Natl Acad Sci USA 85 9674 16
78. cia Biotech 5 ml x2 and the column was washed with buffer B 20 mM Tris HCl pH 8 0 and 150 mM NaCl The C C mismatch binding activity was not retained under these conditions The active fraction Fraction II was then applied to a HiTrap Heparin column Amersham Pharmacia Biotech 5 ml equilibrated with buffer C 20 mM Hepes pH 7 6 and 150 mM NaCl and eluted with a linear salt gradient 150 650 mM NaCl in buffer C The active fraction eluted at 300 375 mM NaCl was concentrated and pooled Fraction III Fraction III was then loaded on a gel filtration column HiPrep 16 60 Sephacryl S 200HR Amersham Pharmacia Biotech 5 ml equilibrated with buffer B The active fraction was concentrated and pooled Fraction IV SDS polyacrylamide gel electrophoresis and amino acid sequencing Fraction IV was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis SDS PAGE on a 17 5 polyacrylamide gel transferred to an Immobilon PSQ membrane Millipore by electroblotting and then stained with Coomassie blue The 20 KDa protein band was excised from the membrane and the sequence of 10 amino acid from the amino terminus of the purified protein was determined by using a gas phase amino acid sequencer RESULTS Identification of C C mismatch binding proteins in E coli To detect C C mismatch binding proteins in E coli we carried out gel shift assays Cell free extract prepared from wild type strain AB1157 was incubated with 5 P l
79. coli Gel shift assays were performed as described in Fig 1 Lane 1 mutD lane 2 mutL lane 3 mutM lane 4 mutT lane 5 mutY lane 6 ung lane 7 vsr lane 8 uvrD lane 9 ada and ogt 19 lane 10 xth and nfo lane 11 alkA lane 12 hupA and hupB lane 13 dps lane 14 mfd lane 15 nth and nei lane 16 recA lane 17 mutH lane 18 mutS lane 19 recB recC and sbcB lane 20 topA lane 21 umuC and umuD lane 22 uvrA lane 23 topB Fig 4 Binding of purified MutM protein to various mismatches The GST MutM fusion protein was expressed in E coli strain BL21 with 1 mM IPTG and purified on glutathione Sepharose 4B column The GST MutM fusion protein was further treated with thrombin protease to remove the GST tag Gel shift assays were performed as described in Fig 1 Lane 1 C C lane 2 C A lane 3 C G lane 4 C T lane 5 A C lane 6 A A lane 7 A G lane 8 A T lane 9 G C lane 10 G A lane 11 G G lane 12 G T lane 13 T C lane 14 T A lane 15 T G lane 16 T T Lanes W and M cell extracts prepared from wild type and mutM mutant respectively Fig 5 Purification of the second C C binding protein Proteins were separated by 17 5 SDS PAGE and stained with Coomassie Blue Lane M molecular weight markers 55 6 39 2 26 6 20 1 and 14 3 KDa lane 1 40 60 ammonium sulfate saturation fraction lane 2 active fraction after HiTrapQ anion exchange column chromatography lane 3 active fraction after HiTrap Hepari
80. ding activities in crude extracts of various mutants of E coli To identify genes responsible for the C C mismatch binding proteins extracts of various mutants of E coli were incubated with the duplex oligonucleotide containing the C C mismatch Production of the low mobility complex was completely abolished in cell extracts of the mutM mutant Fig 3 indicating that the MutM protein specifically binds to the C C mismatch containing oligonucleotide On the other hand extracts from all the mutants used including the mutM mutant displayed the high mobility band binding to the C C mismatch containing oligonucleotide Fig 3 Thus the two complexes contained different proteins Furthermore the proteins in the complexes binding of two proteins was independent of the MutS and MutL proteins because mutations of these genes did not affect the formation of the complexes Binding activity of purified MutM protein to the C C mismatches It was of interest to know whether or not MutM protein could directly bind to C C mismatches We used a GST fusion system for MutM overexpression 25 26 Purified GST MutM fusion protein was further treated with thrombin protease to remove the GST tag Purified MutM protein bound to the oligonucleotide containing C C mismatches with the same specificity as the binding activity in wild type cell extracts Fig 4 These results indicate that the MutM protein directly binds to the C C mismatch We therefore concluded th
81. e mismatches and opposite chemically altered guanines J Biol Chem 273 30398 30405 31 Fleck O Lehmann E Schar P and Kohli J 1999 Involvement of nucleotide excision repair in msh2 pms1 independent mismatch repair Nat Genet 2 1 314 317 Fox M S Radicella J P and Yamamoto K 1994 Some features of base pair mismatch repair and its role in the formation of genetic recombinants Experientia 5 0 253 260 Girard P M Guibourt N and Boiteux S 1997 The Ogg protein of Saccharomyces cerevisiae a 7 8 dihydro 8 oxoguanine DNA glycosylase AP lyase whose lysine 241 isa critical residue for catalytic activity Nucleic Acids Res 25 3204 3211 Grollman A P and Moriya M 1993 Mutagenesis by 8 oxoguanine an enemy within Trends Genet 9 246 249 Halling S M Simons R W Way J C Walsh R B and Kleckner N 1982 DNA sequence organization of IS10 right of Tn10 and comparison with IS10 left Proc Natl Acad Sci USA 79 2608 2612 Hatahet Z Kow Y W Purmal A A Cunningham R P and Wallace S S 1994 New substrates for old enzymes 5 Hydroxy 2 deoxycytidine and 5 hydroxy 2 deoxyuridine are substrates for Escherichia coli endonuclease III and formamidopyrimidine DNA N glycosylase while 5 hydroxy 2 deoxyuridine is a substrate for uracil DNA N glycosylase J Biol Chem 269 18814 18820 Ishida T Hippo Y Nakahori Y Matsushita I Kodama T Nishimura S and
82. encies reflecting the frequency and specificity of mispait formation 2 5 7 8 MutS and MutL are involved in the initiation step of mismatch repair MutS recognizes and binds to single base mismatches in DNA and MutL forms a complex with MutS and MutH Binding of MutL to MutH results in activation of the MutH endonuclease 2 4 5 7 8 Mutations in the mutS mutL or mutH gene significantly enhance the frequencies of spontaneous mutations 4 5 7 8 However the mutator characteristics do not result in enhancing G C gt C G transversions 4 8 11 In E coli the mutHLS mismatch repair pathway efficiently corrects G G mismatches but not C C mismatches 12 14 In addition coli MutS protein shows the lowest affinity for C C mismatches in vitro 15 16 These facts suggest that E coli has a more specific repair pathway to correct C C mismatches for preventing G C gt C G transversions 17 Recently Fleck et al 18 19 reported that there are two C C mismatch binding proteins in Schizosaccharomyces pombe These proteins might constitute a C C mismatch repair system Thus besides the MutSL like pathway S pombe has an additional pathway of mismatch repair that corrects C C mismatches 18 19 It is of interest to know whether or not E colt has an equivalent pathway In this study we performed gel shift assays to identify and characterize C C mismatch binding proteins in order to look for an additional repair pathway for C C mismatches in E co
83. g 4 1 2 6ng 5 13 30ng L gt 6 1 4 45 ng 7 1 5 60 ng DNA aaa AB1157 wild type CC103 GC CG indicater strain CC104 GC TA indicater strain BL21 lon ompT 21336 uvrD260 Tn5 markers of AB1157 BW313 ung 1 dut 1 relAl spoT1 RPCS01 nfo 1 kan A xth pncA 90 marlers of AB1157 JC7623 recB21 recC22 sbcB15 markers of AB1157 WD8014 mutD rpsL CC104mutM mutM Tn10 CC104mutMmutY mutM Tn10 mutY kan SYTS mutT Cm CC104mutL mutL kan BMH71 18 mutS215 Tn10 CSH117 mutY Tn10 NJK2004 nth Cm nei kan markers of SY5 GC4468hupAB hupA16 kan hupB Cm WU3610 45 mfd 1C3126 A umuDC Cm uvrA 115 lon11 MS23 alkAl CS101 recA269 Tn10 ruv 51 rpsL31 CH1692 topAS7 Am tolC Tn10 rpsL N3055 uvrA277 Yn10 MG1655 dps kan TM41 topB kan markers of AB1157 RP4182 A dcm vsr rpsL C218 ada25 alkB Cm ogt 1 kan GW3773 mutH471 kan rpsL31 Gai 1 8 9 10 11 12 13 14 15 16 17 18 19 5 AGCTTGGCT GCAGGT CGACGGAT CCCCGGGAATT 3 5 AGCTTGGCT GCAGGTAGACGGAT CCCCGGGAATT 3 5 AGCTTGGCT GCAGGT GGACGGAT CCCCGGGAATT 3 5 AGCTTGGCT GCAGGT TGACGGAT CCCCGGGAATT 3 5 AATTCCCGGGGAT CCGT CCACCT GCAGCCAACGCT 3
84. g 4 MutM protein shows broad substrate specificity formamidopyrimidine Fapy 8 oxoguanine 5 hydroxycytosine and thymine glycols 34 37 The MutM protein removes these products of oxidative base damage from DNA by its DNA glycosylase activity and incises the DNA by its associated AP lyase activity 6 9 10 34 37 In this study purified MutM protein did not incise the C C mismatch containing oligonucleotide data not shown Therefore it is suggested that the MutM protein can recognize and bind to C C mismatches in DNA and requires another protein s to incise DNA for the repair of the mismatches The MutM protein might be a component of a multienzymic pathway involved in C C mismatch repair The present experiments moreover showed that the second protein that specifically binds to the C C mismatch is the FabA protein of E coli The purified FabA protein could bind the mismatch containing oligonucleotide to form the low mobility complex Figs 5 and 6 In addition cell extracts of the fabA mutant did not display the binding activity Fig 6 The FabA protein is a component of the fatty acid biosynthesis system in E coli and defined as B hydroxydecanoyl acyl carrier protein dehydrase which introduces a double bond into a 13 growing fatty acid chain 27 38 40 However no DNA binding domain 1s found in the amino acid sequence of the FabA protein 27 Interestingly S pombe fatty acid synthase p190 210 complex binds to single stra
85. hkuma M Murakoshi I Ohmori S Kawaguchi A Teeri T H and Cronan J E Jr 1995 Expression of the Escherichia coli fabA gene encoding hydroxydecanoy thioester dehydrase and transport to chloroplasts in transgenic tobacco Transgenic Res 4 60 69 Sandigursky M Yacoub A Kelley M R Xu Y Franklin W A and Deutsch W A 1997 The yeast 8 oxoguanine DNA glycosylase Ogg1 contains a DNA deoxyribophosphodiesterase dRpase activity Nucleic Acids Res 25 4557 4561 Sargentini N J and Smith K C 1994 DNA sequence analysis of y radiation anoxic induced and spontaneous Jacl mutations in Escherichia coli K 12 Mutat Res 309 147 163 Schaaper R M and Dunn R L 1987 Spectra of spontaneous mutations in Escherichia coli strains defective in mismatch correction the nature of in vivo DNA replication errors Proc 37 Natl Acad Sci USA 8 4 6220 6224 Schaaper R M 1993 Base selection proofreading and mismatch repair during DNA replication in Escherichia coli J Biol Chem 268 23762 23765 Schar P Munz P and Kohli J 1993 Meiotic mismatch repair quantified on the basis of segregation patterns in Schizosaccharomyces pombe Genetics 133 815 824 Schar P and Kohli J 1993 Marker effects of G to C transversions on intragenic recombination and mismatch repair in Schizosaccharomyces pombe Genetics 133 825 835 Shibutani S Takeshita M and Grollman
86. ience Kyoto University Kitashirakawa Oiwakecho Sakyo ku Kyoto 606 8502 Japan Running title C C mismatch binding proteins of coli and S cerevisiae Correspondence author Tel 81 75 753 4097 Fax 81 75 753 4087 E mail yonei kingyo zool kyoto u ac jp ABSTRACT The pathways leading to G C C G transversions and their repair mechanisms remain uncertain C C and G G mismatches arising during DNA replication are a potential source of G C gt C G transversions The Escherichia coli mutHLS mismatch repair pathway efficiently corrects G G mismatches whereas C C mismatches are a poor substrate E coli must have a more specific repair pathway to correct C C mismatches In this study we performed gel shift assays to identify C C mismatch binding proteins in cell extracts of E coli By testing heteroduplex DNA 34 mers containing C C mismatches two specific band shifts were generated in the gels The band shifts were due to mismatch specific binding of proteins present in the extracts Cell extracts of a mutant strain defective in MutM protein did not produce a low mobility complex Purified MutM protein bound efficiently to the C C mismatch containing heteroduplex to produce the low mobility complex The second protein which produced a high mobility complex with the C C mismatches was purified to homogeneity and the amino acid sequence revealed that this protein was the FabA protein of E coli The hi gh mobility complex was not fo
87. ir enzyme on DNA containing 7 8 dihydro 8 oxoguanine and abasic sites EMBO J 16 6314 6322 Boiteux S O Connor T R and Laval J 1987 Formamidopyrimidine DNA glycosylase of Escherichia coli cloning and sequencing of the fpg structural gene and overproduction of the protein EMBO J 6 3177 3183 Bridges B A Sekiguchi M and Tajiri T 1996 Effect of mutY and mutM fpg 1 mutations on starvation associated mutation in Escherichia coli implications for the role of 29 7 8 dihydro 8 oxoguanine Mol Gen Genet 25 1 352 357 Buchko G W Wagner J R Cadet J Raoul S and Weinfeld M 1995 Methylene blue mediated photooxidation of 7 8 dihydro 8 oxo 2 deoxyguanosine Biochim Biophys Acta 1263 17 24 Carlioz A and Touati D 1986 Isolation of superoxide dismutase mutants in Escherichia colt is superoxide dismutase necessary for aerobic life EMBO J 5 623 630 Cabrera M Nghiem Y and Miller J H 1988 mutM a second mutator locus in Escherichia colithat generates G C T A transversions J Bacteriol 170 5405 5407 Cheng K C Cahill D S Kasai H Nishimura S and Loeb L A 1992 8 Hydroxyguanine an abundant form of oxidative DNA damage causes G T and A C substitutions J Biol Chem 267 166 172 Cronan J E Jr Li W B Coleman R Narasimhan M de Mendoza D and Schwab J M 1988 Derived amino acid sequence and identification of active site residues of E
88. l MutM band gt UF we FabA band gt bd TO i Fig 6 Nakahara et al E GO yOGGi p 12345 6 7 8 9 10 111213 14151617 Fig Nakahara et al
89. li The present experiments revealed that there are two C C mismatch binding proteins MutM and FabA in cell extracts prepared from E coli cells The binding of these proteins to C C mismatches was independent of MutS and MutL Furthermore it was also demonstrated that Saccharomyces cerevisiae OGG1 protein a functional homologue of E coli MutM protein 20 22 could bind specifically to C C mismatches in DNA MATERIALS AND METHODS Bacterial strains and media Bacterial strains used in this study were derivatives of E coli K 12 The strains and their relevant genotypes were AB1 157 wild type 21336 uvrD260 Kan BW313 ung 1 dut 1 RPC501 nfo 1 Tn5 JC7623 recB21 7ecC22 sbcBl 5 WD8014 mutD5 CC104mutM mutM Tet SYTS mutT Cm CC104mutL mutL Kan BMH71 18 mutS215 Tet CSH117 mutY Tet NJ K2004 nth Cm nei Kan GC4468hupAB hupA16 Kan hupB Cm WU3610 45 mfd 1C3126 A umuDC Kan MS23 alkA1 CS101 recA269 Tet CH1692 topA57 tolC Tet N3055 uvrA277 Tet MG1655 dps Kan TM41 topB Kan RP4182 A dcm vsr C218 A ada25 alkB Cm ogt 1 Kan and GW3773 mutH471 Kan E coli CC104 was ara A gpt lac 5 rpsL F lacI378 lacZ461 proA B 23 Bacterial cells were grown in LB medium 4 at 37 C with aeration The final concentrations of tetracycline kanamycin chloramphenicol and ampicillin were 15 50 20 and 50 ug ml respectively Enzymes and chemicals Tetracycline hydrochloride kan
90. n C C mismatch repair systems 45 Thus it is expected that DNA repair systems other than the mutHLS system must play a role in C C mismatch repair in E coli cells It is possible that MutM and FabA are components of such repair pathways as mismatch recognition proteins like Muts In S cerevisiae rat and human cells OGG1 proteins are identified as an 8 oxoguanine 14 DNA glycosylase AP lyase 20 22 They remove 8 oxoG paired with cytosine and guanine like E coli MutM protein 6 9 10 20 22 The present experiments demonstrated that S cerevisiae OGG1 protein could specifically bind to C C mismatches like E coli MutM protein Fig 7 OGG1 has no significant structural homology to the E coli MutM protein in the amino acid sequences 20 21 It is sure that these proteins recognize and bind to the mismatches as an essential function ACKNOWLEDGEMENTS We wish to express our thanks to Drs J Yokota National Cancer Center Research Institute Japan M Ajimura National Institute of Radiological Sciences Japan K Yamamoto Tohoku University Japan B Weiss Michigan University USA A Nishimura National Institute of Genetics Japan M M Wu Harvard University USA A Holmgren Karolinska Institute Sweden and B Bachmann Yale University USA for kindly supplying E coli strains and plasmids This study was supported in part by grants from the Ministry of Education Science Sports and Culture of Japan and the Nissan Scien
91. n column chromatography lane 4 active fraction after gel filtration column chromatography Fig 6 The C C binding activity in cell extracts of fabA and mutM mutants Cell extracts of E coli wild type lane 1 fabA lane 2 and mutM lane 3 were incubated with the C C mismatch containing heteroduplex Gel shift assays were performed as described in 20 Fig 4 Fig 7 The C C binding activity in cell extracts of E coli mutM with pKK223 3 YOGG1 carrying S cerevisiae OGGI gene 32P 1abeled double stranded oligonucleotides containing all possible single base mismatches 23 5 fmol were incubated with cell extract prepared from E coli mutM mutant with pKK223 3 YOGG1 carrying S cerevisiae OGG1 gene Gel shift assays were performed as described in Fig 1 Lane 1 extracts from E coli wild type lanes 2 17 extracts from E coli mutM mutant with pKK223 3 YOGG1 Lanes 1 and 2 C C lane 3 C A lane 4 C G lane 5 C T lane 6 A C lane 7 AJA lane 8 A G lane 9 A T lane 10 G C lane 11 G A lane 12 G G lane 13 G T lane 14 T C lane 15 T A lane 16 T G lane 17 T T 21 E 1 234567 8 910111213141516 Fig 1 Nakahara et al C TA A e rr m PE eS e pu 12345 6 7 8 910111213141516 Fig 2 Nakahara et al 1 2 3 4 5 6 7 8 9 10111213 1415 16 171819 20 21 2223 Fig 3 Nakahara ef al W 123 4 5 67 8 9 10 1112 13 14 15 16 Fig 4 Nakahara ef al Fig 5 Nakahara et a
92. nded and double stranded DNA leading to condensation of large DNA aggregates 41 Furthermore the protein is capable of renaturing complementary single stranded DNA and exhibits strand exchange activity 41 Thus some enzymes which catalyze fatty acid synthesis also have DNA processing activities The mechanisms of the involvement of the MutM and FabA proteins in C C mismatch repair in E coli cells are under investigation in our laboratory In S pombe there are at least two different mechanisms for mismatch repair pathways The major system recognizes all base mismatches except C C probably like the mutHLS system in E coli The minor system can recognize C C mismatches and leads to short excision tracts 42 43 Furthermore recent reports have shown that S pombe has two distinct C C mismatch binding proteins termed Cmb1 and Cmb2 19 Purified Cmb1 protein has a molecular mass of 22 KDa The deduced amino acid sequence contains a high mobility group HMG domain a motif common to a heterogeneous family of DNA binding proteins Unlike the Cmb1 protein MutM and FabA do not have the HMG domain 39 44 The Cmb1 protein recognizes C T and C A mismatches and in addition T T mismatch C A loop O methylguanine C mispair and 1 2 GpG intrastrand crosslinks produced by cisplatin 19 On the other hand Cmb2 protein recognizes only the C C mismatch 19 It is also suggested that components of the nucleotide excision repair system are involved i
93. rmed in cell extracts of a fabA mutant From these results it is possible that MutM and FabA proteins are components of repair pathways for C C mismatches in E coli Furthermore we found that Saccharomyces cerevisiae OGG1 protein a functional homologue of E coli MutM protein could specifically bind to the C C mismatches in DNA INTRODUCTION Base pair mismatches arise continually in DNA as a result of several mechanisms including errors during DNA replication spontaneous oxidation of bases and recombination between homologous but non identical DNA sequences 1 6 The repair of such mismatched bases is essential for reducing the frequencies of spontaneous mutations and maintaining the integrity of the genome 4 10 In particular low rates of spontaneous G C gt C G transversions would be achieved not only by the correction of base mismatches during DNA replication but also by the prevention and removal of oxidative base damage in DNA 4 7 8 11 We previously found that MutY protein prevents the generation of G C gt C G transversions by removing the unmodified guanine from the 8 oxoguanine guanine mispairs in Escherichia coli 11 In addition C C and G G mispairs generated during DNA replication would be a source of the mutations Bacteria and mammalian cells have evolved several repair mechanisms to deal with mismatches 5 7 10 In E coli a general repair system referred to as the mutHLS system corrects most replication errors with effici
94. scherichia coli 2 hydroxydecanoyl thioester dehydrase J Biol Chem 263 4641 4646 Cupples C G and Miller J H 1989 A set of lacZ mutations in Escherichia coli that allow rapid detection of each of the six base substitutions Proc Natl Acad Sci USA 86 5345 5349 Dherin C Radicella J P Dizdaroglu M and Boiteux S 1999 Excision of oxidatively 30 damaged DNA bases by the human alpha hOgg1 protein and the polymorphic alpha hOgg1 Ser326CyS protein which is frequently found in human populations Nucleic Acids Res 27 4001 4007 Demple B and Harrison L 1994 Repair of oxidative damage to DNA enzymology and biology Annu Rev Biochem 6 3 915 948 Drake J W 1991 Spontaneous mutation Annu Rev Genet 2 5 125 146 Echols H and Goodman M F 1991 Fidelity mechanisms in DNA replication Annu Rev Biochem 6 0 477 511 Modrich P 1991 Mechanisms and biological effects of mismatch repair Annu Rev Genet 2 5 229 253 Eisen J A and Hanawalt P C 1999 A phylogenomic study of DNA repair genes proteins and processes Mutat Res 435 171 213 Fleck O Schar P and Kohli J 1994 Identification of two mismatch binding activities in protein extracts of Schizosaccharomyces pombe Nucleic Acids Res 22 5289 5295 Fleck O Kunz C Rudolph C and Kohli J 1998 The high mobility group domain protein Cmb1 of Schizosaccharomyces pombe binds to cytosines in bas
95. tM 1 OGG1 band gt MutM band erdi FabA Band gt free probe gt C1234 56 7 8910111213141516 M10 OGG1 MutM 0GG7 mutM C C 1 C C 2 C A 3 C G 4 C T 5 A C 6 A A 7 A G 8 A T 9 G C 1 0 G A 1 1 G G 1 2 G T L 1 3 T C 1 4 T A L gt 15 T G 1 6 T T 1 OGG1 band ritz MutM band FabA Band free probe eri e o o C1123456 7 8 91011213141516 1 1 OGGI
96. tagenic effect of the spontaneous lesion 8 hydroxyguanine 7 8 dihydro 8 oxoguanine J Bacteriol 174 6321 6325 Miller J H 1996 Spontaneous mutators in bacteria insights into pathways of mutagenesis and repair Annu Rev Microbiol 5 0 625 643 Miller J H 1998 Mutators in Escherichia coli Mutat Res 409 99 106 Miret J J Milla M G and Lahue R S 1993 Characterization of mismatch binding activity in yeast extracts J Biol Chem 268 3507 3513 Modrich P 1991 Mechanisms and biological effects of mismatch repair Annu Rev Genet 2 5 229 253 Modrich P and Lahue R 1996 Mismatch repair in replication fidelity genetic recombination and cancer biology Annu Rev Biochem 65 101 133 Mol C D Parikh S S Putnam C D Lo T P and Tainer J A 1999 DNA repair mechanisms for the recognition and removal of damaged DNA bases Annu Rev Biophys Biomol Struct 2 8 101 128 35 Moriya M and Grollman A P 1993 Mutations in the mutY gene of Escherichia coli enhance the frequency of targeted G C gt T A transversions induced by a single 8 oxoguanine residue in single stranded DNA Mol Gen Genet 239 72 76 Nagashima M Sasaki A Morishita K Takenoshita S Nagamachi Y Kasai H and Yokota J 1997 Presence of human cellular protein s that specifically binds and cleaves 8 hydroxyguanine containing DNA Mutat Res 383 49 59 Nash H M Bruner S D
Download Pdf Manuals
Related Search