Home

KOD -Plus- Mutagenesis Kit

image

Contents

1. e Substitution 5 005 03 20bp 25bp e Deletion 0 e Insertion 5 100 10 0000 3 001 20690 00 25bp Inverse POR 0900000 000000000 0 buffer D 0 00000 U 00 0 00 0 0000 0000000 000000000 000 000 00000 000 000 000 p 0 0 0 00 00000 B 000 0 00000000 0 000 0 0 00 0 00000000000000 0000 000 0 0 00 100 200 nmm 0000 00 000 0 0 0 00 00000 0 0 0
2. 0 00000 0 PCR o 8 010 pmol y 0 Plasmid DNAQ O O 0 50ng L IO 00000 e 00 00000 0000000000000 00000 5 10x Buffer for iPCR 5 2mM dNTPs 5 00000 1010 pmol p ID 1 51 00000 2110 I0 1 54 Plasmid ID KOD Plus 1 1 Total Volume 501 e 000000000 00PCRODO 000D O 94 C 2 min 98 C 10sec 68 C ated 1000 000 4 C Hold 010 0 0 O 000K 0 p D OO 0 000 00 0 0 05000 000 p pau 0 O20 0 0 00000keO 0 010 000 000000 000 0 0 0 0 1 20000000 00 000000000 00 0000000000 D HD 050 000 0100 000 000 0 00 D D 0 0 0 0000 D 0000 00 0100 200 000 00000000 000 0 0 00000 0 000 000000000 0000 00 0 0 0 000 6 00 000 00000 35H 10x Buffer for iPCR 5u 94 C 2min 2mM dNTPs 5 98 C 10586 Control Primer 1010 pmol y I 1 5u X 68 C 5min Control Primer 2110 pmol y 10 151 4 C Hold Control Plasmid pAK119M I 1p KOD Plus Total Volume 50u 0 000 0 Plasmid o
3. 2 mutation D OU 0000000000 Plus GOOO0000000 00000000 000000000000 0 00 d2ndsite mutationn 0000 00 00 00 0 00000 0 2 mutationg 000 000 0 000 00 0 00 000 0 001000010000000000000011 00000 00 0 0 Plasmid O O 0 00000 0000000 Plasmid 00000 0 0 0 000 0 0 0 0000 Plasmid pAK119M 0 0 D 00 0 00 000 0 0 0 0000 1 2 0 60 D 0 0000 0 00 0 000 d 0 UU 0 00 00 00 000 0000 6 00 000 OOO B OO 0 0000 0000 ag p d 00 00000 0000 D 00 00 0000000000000 0000000 0000 0000 00 0 0000 0 800 OO 00 QOHOOOOU0O0 00000 009509 000000000 000000 5 3 5 3 5 3 pAK119M 4 3 kb lacZa White Colony uda Prog Blue Colony LacZa gt N Met Thr eThr STCP C AATTTCACACAGGAAACAGCTATGACCOATGAT TACGTAAGTTT GCATGOCT GCAGGT CGACTCTAGAGCATC 3 CCAACGTACGCACGT CCAGTT GACATCTCCTAG 5 A Control Priner 5 GOMGCTTGOATGOCTGOAGGIQGA 3 AAATTTCACACAGGAAACAGCTATGACCATOAT TACGEAAGCT TGCATGOCTGCA
4. Plasmid Inverse PCR B DNA Plasmid C T4 Polynucleotide Kinase Ligase PCR D PCR 0 0111 No 20111127 1 11 10 251 I 2 10x Buffer for iPCR 1251 3 2mM dNTPs 1251 4 Dpn 1 100 1 50u 5 T4 Polynucleotide Kinase 5U u I 50 6 Ligation high 2501 7 Control Plasmid pAK119M 50 1 101 8 Control Primer 1 10 1 10p 9 Control Primer 2 10 1 101 00000 0 0200 000 00000000 50 0 0 00000 0 0 0 00 00 0000 uuu LB 1 L1 L1 LU 50mg ml 20 DET 0000 496 X gal 100mM IPTG 00000 0 Plasmid 000 O Blue White 0 0000 00000 ut 00000000 O Competent high DH5a Code 90301 00 O 4 109 Code No DNA 900 T 00 0 00 0 0 00 000 0000000000000000 LOW 0 0000 0 0 Plasmid 0 00000000000000 000 0 0000 0 0 Plasmid Opn 0000 00000 00 0000 000 0000 00000 Opn ii 0G ATCO 0 0 00000000000000 00000 0 000 000000000 Pasman O00 0000000 JM1090 FW 0000000000000 00 Plasmid Udam methylase 0000 00000 0000 0 0000 0000 00 0 0 000 00 0JM1100SCS1100 00 00000 D 00000 0 00 00000 000000 00000000
5. KOD Plus Mutagenesis Kit Code No SMK 101 HOUUUUO TOYOBO CO LTD Life Science Department OSAKA JAPAN A3634K 1 E E HT Inverse PGRE 2 1 3 111 2 4 D0 0 CAVE 4 EL EDAD tad 4 DO mg WE TEE 4 PC RE Ie 5 00 E 00 2nd site mutation 1 0O 0 5 gp ggg Sass tta 6 12 E 8 1 1 16 3 401 qe 8 HIE Dpn i0 O00 O Plasmidg O O ouais coe etd eke eed 9 PCR Self ligation sss 9 Ps ES TTC 10 1 154 10 11 MEE 12 seh 12 13 000 0 0 0 0000 00 0000 NOTICE TO PURCHASER LIMITED LICENSE Use of this product is covered by one or more of the following US patents and corresponding patent claims outside the US 5 079 352 5 789 224 5 618 711 6 127 155 and claims
6. OOO DO WO BL BED B CEDE D C O0 100mM IPTG 4 X gal 20u ID 0 000 unum lt 0 0 0 0 PCRO gt 2000 KOD 201 1 0000 101 T4 Polynucleotide Kinase 1 5000 MO PNK 111 1 5000 S0 PNK 112 Ligation high lt 0 900 0000000000 gt 5000 LGK 101 MagExtractor Plasmid 5000 0 NPK 301 lt 0000000 000 Plasmid 0 0 00 gt MagExtractor PCR amp Gel Clean up 200 NPK 601 lt DNA fragment 0 0 00 gt Magical Trapper lt 00000000000 gt 00 MGS 101 Competent high DH5a 100u I 0100 DNA 903 lt 0 000000 0 sec 0 0 0 gt Competent high 109 100u 1 10 DNA 900 SOOO 7 09 0000 0000 05000 0 0 gt 11 00010 00 00 0 0 0000 0000000 mul 0 530 8230 0000000000 20 80 TEL 06 6348 3786 FAX 06 6348 3833 E mail order_lifescience bio toyobo co jp 0000 0000000 mul 0 103 8530 1 0000 00000 170 90 TEL 03 3660 4819 FAX 03 3660 4951 E mail order_lifescience bio toyobo co jp 00000 000 TEL 06 6348 3888 FAX 06 6348 3833 0000 9 000 12 00 13 000 17 00 II 0000 00 00 E mail techosk bio toyobo co jp http www toyobo co jp bio
7. 506 rm nDen 241 00 0000000000000 0000 O PCROOO020 000 PCROO0 0000 00000 00 0000 e 0000000000 0373000 0000 00 0 0000 0 0 0 0 0 1000 00 0 000000 Se 00000 0000 00 0 00 0000 00 000 0 00 00011010101101010101010101001001011100101010010011 000 10000 O Self ligation T4 Polynucleotide Ligation high 000000 00 0000000 ULigation highd OOOO 0000 000000000 00 0 000000 e Doni 000 2p 7y Ligation high 5 T4 Polynucleotide Kinase 11 Total Volume 151 amp 00000000 0000000000000000 16901 100 0000 00 0 00000 0 000000000 000000000 0000000 e 00000 000000000000 0000 000000000000000 0 high DH5a Code No DNA 903 T Competent high 09 0 90010 0O00 0000000000000 0000000 1101 0000000000000000100 Competent 00 I D D D 00 0 0000 000000 30 0 000 0 0 168 a md D Bug D U 36D 00000 00 2000000000000 0000000 000 OpBRs2zeqg 00000000000 000000000 00 00 0pBR3220 1p90 0 000 00000000 000000 100 0 0 1 10 220 00000000
8. 000 0 0000 1000 0 00000000000 4241300 0 0000 00000 0 0 0 0 200 0 0 0000 50600 900u MO 0 087 C 10 D D 000 0 000 DU e 100 200 0 d 0000000 0000 0 00 00000 0 0 00 000 0 0 0 0 0 00 000 1 pb 0000000 37901110 168 0 0 0000 020000000000 000000 00 ttrocugpBR322n 00000000 0000 000000000 ap 1000 000 00000000 00 0000000000 0800 00 0000 0040 80000 000000000 0000000000 Plsmidn 0 000 xu 00 Plasmich 0000 000000 000000000000 0000000000 00 00000000 0000 0 00 00000101000000000001 0 000000 000 200000 000 00000000 00000000 00 00 0 000 0 0000 0000 00 0 0000 0000000 0000 000 un uut 000 00000 uu OUD U D E EL UL D LU 0000000 Plasmid 0 000000 000000 0000100 Plasmid 0 000000 uuu 000000 00 000000 OUUOUUY OU uuu Inverse PCR 0 DO 00000 000 000 Inverse PCR DO 000000000 Inverse PCR 00000 000 Plasmid 0 IPTG X gal 00
9. outside the US corresponding to US Patent No 4 889 818 The purchase of this product includes a limited non transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser s own internal research No right under any other patent claim such as the patented 5 Nuclease Process claims in US Patents Nos 5 210 015 and 5 487 972 no right to perform any patented method and no right to perform commercial services of any kind including without limitation reporting the results of purchaser s activities for a fee or other commercial consideration is conveyed expressly by implication or by estoppel This product is for research use only Diagnostic uses under Roche patents require a separate license from Roche Further information on purchasing licenses may be obtained by contacting the Director of Licensing Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 USA 0 0000 000000000 PCR KOD 0000 00 00 D 00 Inverse PCR 00 0 00000 0 000 0 00 20 D 0 00 00 00 000 000000000 000 0 00 0 00 0 0 000 00000 000000000000 00000 0 00 00 0000 00 0 000000 000 00 0 00000 0 0 SelHigatienn 0000 000 0 0 000
10. 0 0000 uult 0000 00000 000 0000 00000 00000 LI DUO UU 000 00 10 cfu ug pBR322 0 0050 Hu 00000000 000 Lu 000 00000 000 0000 00000 00000 000 0000 00 00000 00000 0 ium 00000 00 00 00000 00 00 00 00 000 00000 0000000000000 O uii 000000 0 In vitro dam methylase 0 00 00 000 000000 0 Plasmid 0 0 0 O0 OU 00 00 0000 0 timum 0 0000 00 LB 0 0 00 00 O0 0 U UI D D IPTG X gall 000 0 00 00 00000000 00 000000 0000 uuum tut 01 00010 D LU 1L 10g bacto tryptone 5g bacto yeast 109 0 0 0 00 0 pH7 20 1 0000 LB 000000000 1LO LBO O 000 01590 nga 000 000 0000000000 50 0000000 000000 0 0 100 g miIQO 0000 0 8 0000000000 ED 000 000 OLO LBO 0 000 01590 00000 d d d 0000000000 50 0000000 20 OOOO arm 00000 0000 8 0 00000 100mM IPTG 10mL 0 249 IPTGQUO 0 0 00 0 000 0 10 00 00000 000 0 0201 000000 A X gal 10mL 0 49 X gal 5 bromo 4 chloro 3 indolyl D galactoside N N dimethyl formamide OMF D 0 OW 0 1044 t 020 00 000000
11. 0000000000 0000 00 0 000000 00000 vitra dam methylaser 0 00 0000 0 1090 damn DT 0 Plasmid 0 0 OO 00 00 000 LILIPCR Primer OU 00000 uu unu 0 0000000000 0 0 000000 0 50 00 0005000 0030 0 206 0 0000 250 0 0 OOOO OOOO OPCRO OOOO OOOO OO ONO OOOO 0 WO 0000000 KOD 03 5 Exonuclease O Proofreading 00000 0000000 0000000000000000 00000000000 00 00 0 0 0 0 0 0 00 00000000 Inverse PCRO 0000000000 0000 000 00 00 0509000 00000 0 0 00 00000 0 0 00000 0 000 00 0800 00 9000000 00 0 00 00000 5 0000 000000000 00000 0000 00 0 4 0 000 00000 0 0 n 0 00 00 00 0 00000 0000 Mery RE N 00000 0000 00 00 00000 0 0 0
12. 1 0000000000 Inverse PCR L1 O H1 HL DD beni 0 0 00 0 00 00 0 0 0000 1 6bpr 0 0 1 00 0000 0 0 000 00000000 0000 02000 0 0000 00000000 Mutant Clone Collection 0 0 0 Saturation Mutagenesis O 0 00 0 2 0000000 0951 OKOD Plus G 0 0 00 00 000 00 0 00 2nd site mutation 000000 0000 000 0 000 010kbp 3 00 00000 0 00000 Selt ligation D 00 O00 000 000 000 0000 00 320 000 0 0 0 0000 utt Hanna 01 00000 0 Inverse Inverse PCR 100000 0 0 59 2 JBL O00 0 plasmid 0 37 C ihr Self ligation A Kinase Ligase 0 O00 16 1hi Jol Transform E coli D 00000 00 0 0 0000000 000
13. GDI CGACTCTAGAGGATC 3 TGICCATACTGGTACTAATGCATT CCAACGTACGCACGT CCAGTT CACATCTCCTAG 5 GCTITTGIGGATACTGGI ACTAATGC 5 Control Priner 2 AL Thr Met eThr Pr oSer LeuH aCysAr gSer Thr Leud uzsp C AATTTCACACAGGAMACAGCTATGACCATCAT TAGGOOMAGCT TGCATGGCTGCOAGGI GGACTCTACAGCAT 3 5 000 000 0 p PlasmidQ 00000 0 B B D 00 Control Plasmid 119 20 galactosidase alpha fragmenti LacZa 6 Plasrrid X gal 6 TAAL stop gt CCAD LacZa X gal

Download Pdf Manuals

image

Related Search

Related Contents

Sage Euro Conversion Tool  Ficha Técnica  SERIE ZERO - Zanotti Transblock  VIZIO E50-C1 User's Manual  Samsung MM-C8 Manual de Usuario  Computer Gear 26-1002B SATA cable  Smart Data Link with KM Switch User Manual  TDG138 - Teleallarme GSM con anti-jammer  Mirolin - Marks Supply  user manual  

Copyright © All rights reserved.
Failed to retrieve file