Instructions for use Title アディポカイン産生・分泌に関わる腸上皮細胞
Contents
1.2.
3. Yamauchi et al 2001 al 2002 Hi 23g 3 Lindsay et H Kadowaki 2000
4. Caco 2 CM CM Caco 2 SGBS mRNA OCaco 2 CM SGBS mRNA CM
5. RegB Secq et al 2014 TNF a mRNA nuclear factor kB Ding ez al 2010 1 C HE
6. y PEROT MEU SPF REDEA 25 Barbier etal 1998 TNF a IL 6 IL 1w 1IL 1B Grunfeld et al 1996 Sarraf et al 1997 Gerhardt et al 2001 Bruun et al 2002 Simons et al 2005
7. Fiaf Angpt4 LPL Backhed ez al 2007 3 Fiaf Angpt4 LPL E C RegIB Secq et al 2013 9 ali E
8. vivo 3T3 L1 ex vivo 29 II 1 HE C57BL 6J JmsSlc B6 3 MR KK KK
9. Caco 2 CM SGBS 9 E i23 7 AL 37
10. 38 Ahren B Mansson S Gingerich RL Havel PJ Regulation of plasma leptin in mice influence of age high fat diet and fasting Am J Physiol 1997 273 R113 20 Arita Y Kihara S Ouchi N Takahashi M Maeda K Miyagawa J Hotta K Shimomura I Nakamura T Miyaoka K Kuriyama H Nishida M Yamashita S Okubo K Matsubara K Muraguchi M Ohmoto Y Funahashi T Matsuzawa Y Paradoxical decrease of an adipose specific protein adiponectin in obesity Biochem Biophys Res Commun 1999 257 1 79 83 Aruna B Ghosh S Singh AK Mande SC Srinivas V Chauhan R Ehtesham NZ Human recombinant resistin protein displays a tendency to aggregate by forming intermolecular disulfide linkages Biochemistry 2003 42 36 10554 9 Backhed F Ding H Wang T Hooper LV Koh GY Nagy A Semenkovich CF Gordon JI The gut microbiota as an environmental factor that regulates fat storage Proc Natl Acad Sci U S A 2004 101 44 15718 23 B ckhed F Manchester JK Semenkovich CF Gordon JI Mechanisms underlying the resistance to diet induced obesity in germ free mice Proc Natl Acad Sci U S A 20075 104 3 979 84 Banerjee RR Laz
11. lipoprotein lipase LPL fasting induced adipose factor Fiaf angiopoietin like protein 4 Angpt4 LPL TG Backhed ez al 2007 C Regi pix Iovanna amp Dagorn 2005 RegIB y LT
12. SER 20 I TNTE o IL 6 MCP 1 IL 8 Grunfeld et al 1996 Sarraf et al 1997 Gerhardt et al 2001 Bruun et al 2002 Simons et al 2005 Caco 2 14
13. Cario 2005 van Deventer 1997 toll like receptor nod like receptor Creagh et al 2006 Kawai amp Akira 2007 Slack et al 2009 Lee amp Mazmanian 2010 Jeffrey I Gordon Backhed
14. 24 20C THigure 12 Jejunum lleum Homogenate Colon EN i B6 mouse or KK mouse For24h Murine 3T3 L1 adipocytes Figure 12 Schematic drawing of experimental design in experiment 2 8 ELISA Mouse Adiponectin Acrp30 DuoSet R amp D Systems 31 4 BCA Protein Assay Kit Pierce n 5 One way ANOVA Unpaired test 0 05
15. Boden et al 1996 Hardie et al 1996 Ahren et al 1997 Weigle ez al 1997 I
16. 14 Human primary adipocytes Human SGBS adipocytes A Day 0 10 0 20 B D 400 Leptin 400 Leptin x 5 5 300 300 8 FN 8E PE 5200 200 E 5 100 100 0 0 Caco 2 Caco 2 Caco 2 Caco 2 4 C E 20 Adiponectin _ 15 Adiponectin 8 E g D 10 Eel BE gE 10 EE 5 lt o dq 0 Caco 2 Caco 2 Caco 2 Caco 2 F G Leptin mRNA Adiponectin mRNA 5 2 4 3 2 1 T 1 0 0 Caco 2 Caco 2 Caco 2 Caco 2 Relative mRNA level Arbitrary unit Relative mRNA level Arbitrary unit Figure 3 Effect of co culturing intestinal epithelial cells with adipocytes on adipokine concentration in medium Chart A Morphological changes in human primary adipocytes and SGBS cells Chart B and C Human intestinal epithelial Caco 2 cells were co cultured with human primary adipocytes for 24 h Adipokine concentrations in medium were measured by ELISA The results represent a single experiment Chart D G Caco 2 cells were co cultured with human SGBS adipocytes for 24 h Adipokine concentrations in medium were measured by ELISA D and E and gene expressions of adipokine were measured by qPCR F and G The results represent a single experiment B and C and expressed as
17. Caco 2 ELISA Caco 2 Figure 3B 3C Caco 2 12 pg mL Caco 2 31 3 pg mL 62 5 pg mL SGBS 20
18. a Wellen Hotamisligil 2003 dc MCP 1 v A tumor necrosis factor a TNF a MCP 1 TNF a interleukin 6 IL 6 UN ORE Sugihara et al 1986 A al 1986 TG Ox VAL ziy TG lao jE LO JR
19. 20 SGBS DMEM F 12 10 CM SGBS Caco 2 1 Figure 1 6 Caco 2 DMEM F 12
20. 2 3 17 E y TRIG j U Okuno et al 1998 BE 21 fl FEE Hi H
21. ex vivo ur YY PYY 1 GLP 1 6 RS 9T amp LA pi
22. Barak ez al 1999 Kubota et al 1999 Rosen et al 1999 Wu et al 1999 ACC FAS LPL Bennett et al 1995 Kawabe et al 1996 Lopez et al 1996 PPARy C EBPa ACC FAS LPL mRNA CM CM TG
23. Caco 2 CM 1 90 mg mL vs 1 58 mg mL TNE o IL 6 MIP 1a IL 8 MCP 1 TNF a 4 pg mL IL 6 2 pg mL MIP 1o 10 pg mL IL 8 2 pg mL MCP 1 7 pg mL 26 IV BR 14 H A 1994 Caco 2 ra
24. FS OUO AUGE C BUS TSI 2 Vie CoA CRSKGZU CV Matsuzawa 1999 E Z H al 1994 Masuzaki et al 1995 2ChHAODDNCOVY CHAR PIA fr ODOR 1994 1 Campfield et al 1995 Vaisse et al 1996 16 kDa re 1953 El i Zhang et al 1994
25. Turnbaugh ez al 2008 Cani lipopolysaccharide Cani et al 2007
26. P Hidalgo and Borchardt 1990 Harris e al 1992 Brandsch et al Traber et al 1987 Caco 2 Caco 2 TEER TEER 14 H Caco 2 14 H Hidalgo et al 1989 1 Caco 2 EN CM CM SGBS H
27. Maljaars et al 2008 Sicul Maljaars et al 2008 L PYY GLP 1 Drucker et al 2006 Maljaars et al 2008 Campfield et al 1995 Vaisse et al 1996 PYY GLP 1 OCOaco 2 PYY GLP 1 PYY GLP 1 Ha
28. pu TH f B6 3T3 L1 KK KK ee 2 Kondo et al 1957 NN Carer nae KK KK PYY GLP 1 2 gt m
29. Caco 2 CM mRNA Caco 2 Masuzaki et al 1995 TG mRNA TG PPARy OZEBPo
30. MEN L 3 2 l Q a a 29 IESUS ER 000 0000 ra ie 30 HE WARS ABR REE ASRS Sree 33 A E erg Ts 35 RART o E 37 Jp MM Ll LL L LLL 39 ee 53 ACC Angpt B6 C EBP CM DMEM FAS FBS FGF Fiaf GLP IBMX IL KK LPL MCP MIP qPCR PPARy PYY RPMI SGBS TEER TG TNF acetyl CoA carboxylase angiopoietin like protein C57 BL 6J JmsSlc CCAAT enhancer binding protein conditioned medium Dulbecco s modified Eagle s medium fatty acid synthase fetal bovine serum fibroblast growth factor fasting induced adipose factor glucagon like peptide 3 isobutyl 1 methylxanthine interleukin KK Ay TaJcl lipoprotein lipase monocyte chemoattractant protein macrophage inflammatory proteins quantitative polymerase chain reaction peroxisome proliferator activated receptor y peptide YY Roswell Park Memorial Institute Simpson Golabi Behmel syndrome transepithelial electrical resistance triglyceride tumor necrosis factor 2 nim Ek 22 BR Zg PO IMR n JN LZY VHT eS k OMA 3
31. SGBS Caco 2 o HE 3T8 L1 ex vo
32. ex wvo 36 2 3 2 EML
33. Steppan et Savage et al 2001 Patel et al 2003 Curat et al 2006 Nagaev et al 2006 1 59 Ghosh et al 2003 RAE ON RO Ot 4 E 2001 Ley et al 2006a Neish 2009 Blaser amp Falkow 2009 1014 Hooper amp Gordon 2000 Tilg ez al 2009
34. U1lm Martin Wabitsch uc E ARS AIOE OK 53 MT 2015 6
35. 32 I 3T3 L1 B6 3T3 L1 22 pglmL 31 pg mL A B 400 Leptin 200 Adiponectin w Q o p Q e Leptin concentration pg mL N o o Adiponectin concentration ng mL eo o o o S S SS o BAN Fe Q9 SK S S es S 4 d COMM o X X NA X e Fig
36. VE DSF CM TNF a IL 6 IL 8 MIP 1a33 0 MCP 1 Caco 2 4 27 X 3T3 L1 Hah SGBS E 14 Caco 2 1 EETA HH
37. Sanchez et al 1996 Caco 2 1 Caco 2 CM SGBS 3T3 L1 SGBS Till Lr rr ps 21 II 1 3T3 L1 American Type Culture Collection 10 cm 87 C 5 COz 95 DMEM 10 FBS G
38. 100 ugmL 50 ug mL 6 BD Falcon 1 0X106 cells well 12 BD Falcon 4 0 X 105 cells well 3mL well 6 7 1 5 mL well 12 3 1 Millicell ERS Merck Millipore transepithelial electrical resistance TEER 1000 Q cm2
39. 2 v Z2 gi Bruun et al 2002 Simons et al 2005 TNF a IL 6 IL 8 MIP 1a13 EU MCP 1 72 7 l4 SO EDR 1997 RUM X EU Jes I RADAMEL Grunfeld et al 1996 Sarraf et al 1997 hh van Deventer Oaco 2 CM Mueller et al 1998 Wellhoener et al 2000 Caco 2 CM
40. Caco 2 Caco 2 Rousset 1986 Traber et al 1987 amp DIZ WF Hidalgo and Borchardt 1990 Harris e al 1992 Brandsch et al 1994 Simpson Golabi Behmel syndrome SGBS Sugihara et al 1986 SGBS SGBS Wabitsch
41. CM SGBS Caco 2 12 24 Caco 2 Caco 2 CM Caco 2 RPMTI 1640 24 Caco 2 CM 20C Caco 2 CM 100C 10 Caco 2 CM 20C
42. 24 20C Caco 2 SGBS SGBS 12 Caco 2 RPMI 1640 D 24 20C ReliaPrep RNA Cell Miniprep System 1 BL Promega SGBS 21G AL RNA 80C Cell culture insert Basolateral Mono culture Mono culture Intestinal epithelial Caco 2 cell Human cell line Human primary adipocyte or SGBS adipocyte Human cell line Co culture Figure 1 Schematic drawing of experime
43. 37C 5 COs 95 DMEM F 12 Gibco Q0 170 nM 330nM Sigma Aldrich 10 FBS G 100 U mL 100 pg mL 50 pg mL 6 1 0X 105 cells well 12 4 0X 104 cells well Quick D Quick D E 25 nM IBMX 250 mM Si
44. Caco 2 Hidalgo et al 1989 Caco 2 DMEM F 12 Roswell Park Memorial Institute RPMI 1640 24 Caco 2 CM 20C ee Lonza 10 cm 37C 5 COz 95 PGM 2 Lonza 10 FBS SingleQuots Lonza L Z77v 7 3 7 2 mM SingleQuots Lonza 50 ug mL SingleQuots Lonza B 37 ng mL SingleQuots Lonza
45. E Reaven 1988 Kubota et al 2003 s et al 2003 Hibuse et al 2006 HERES AC CS IS i 1 1 MCP 1 Xu et al 2003 pix E A EDS Pi hE DIR Lazar 2006 Kadowaki et al 2006
46. SID A x FAV YC halle amp Bll el 12 Oe ALEC 54h 4C E 3 000 rpm 5 20C 2 3T3 L1 3 SLC ED PATA SIGHS Ale C2326 1H f KK Ay TaJcl H LH 1 3T3 L1 50 ng mL B6 24 Clad Figure 11
47. 1 Caco 2 CM SGBS Figure 7BC A 1600 d 1400 TEER 1200 9 1000 G 800 600 w 400 200 0 0 10 12 17 21 Time after reaching confluence Day B 300 C 40 Leptin s Adiponectin E 30 E 200 5 uz da E sE 100 97 a c 10 3 amp E 0 0 Supplementation with U D U D Caco 2 cell CM 96 0 100 100 0 100 100 Figure 7 Effect of the CM from undifferentiated and differentiated intestinal epithelial cells on the secretion of adipokines by adipocytes Chart A The time course of changes in transepithelial electrical resistance TEER a marker of enterocytic differentiation after Caco 2 cells reached confluence Chart B and C SGBS cells were cultured in the CM from undifferentiated U and differentiated D Caco 2 cells for 24 h Leptin B and adiponectin C concentration in the medium were measured by ELISA The results are expressed as the mean SEM of the three independent experiments Mean values with different letters are significantly different p 0 05 as estimated by Tukey Kramer s test following one way ANOVA A Mean val
48. fr WE Hirsch et al 1966 250 800 TG 2002 Smith et al 2000 TG Lee et al 1998 TG 130 um Sugihara et al 1987 TG 3 s ME Sugihara ez al 1986
49. AdipoR1 AdipoR2 2004 Tsuchida et al 2001 FIZZ1 Holcomb et al 2000 92 Steppan etal 2001a 2 2 Holcomb et al 2000 13 kDa Aruna et al 2003 Banerjee et al 2001 Chen et al 2002 Raghu et al 2004
50. Figure 3A SGBS Caco 2 SGBS Figure 3D 3E Caco 2 SGBS Caco 2 SGBS mRNA SGBS Caco 2 Figure 3F 3G
51. CM 100 Figure 5D 24 Figure 5E SGBS mRNA qPCR Caco 2 CM 20 CM Figure 5F S 17 A D Caco 2 CM 200 Leptin EE NERIS teptin conc p a og d d a 100 6 150 2 250 g S oe bo 2200 g E100 f Jb 20 gs E rib 10 amp 100 ET E 50 8 Te E 50 Cf 0 0 0 10 20 50 100 15 24 48 Caco 2 cell CM 96 Incubation time hr B E x 3 Adiponectin 15 Adiponectin c 5 o se 5 5 E _ 10 e z 8 t gc 1 8 5 8 8 3 3 o 0 0 10 20 50 100 0
52. E FF Gerhardt et al 2001 pU i RAW ere Hano CM Murakami Wabitsch
53. Ob Rb H Halaas etal 1995 Ob Rb body mass index Hosoda ez al 1996 Gavrilova et al 2000a Hi Shimomura et al 1999 Gavri
54. Li Kennedy Lu 167 Kennedy 1953 Friedman obb Z D Zhang et Tartaglia et al 1995 6 Lee et al 1996 Tartaglia et al 1995 Ob Rb dbdb v ADS o26
55. Backhed et al 2004 Ley 16S ribosomal RNA o26 o2 Bacteroidetes 50 Firmicutes Ley et al 2005 Ley et al 2006b Turnbaugh Turnbaugh et al 2006 op6 Turnbaugh et al 2006
56. 100 U mL 100 ug mL 50 pg mL 12 4 0X 104 cells well 24 1 0X 104 cells well 0 25 uM IBMX 0 5 mM 10ug mL 48 5 ng7mL 2 1 12 3T8 L1 RPMI 1640 10
57. Caco 2 CM e ifs Caco 2 CM 24 20C 3 ELISA ELISA Mouse Rat Leptin Quantikine ELISA kit R amp D Systems Caco 2 CM macrophage inflammatory proteins 1 a MIP 1o IL 8 MCP 1 IL 6 TNE e ELISA MIP 1a CCL3 Human ELISA Kit Abnova IL 8 Human IL 8 ELISA Ready SET Go eBioscience MCP 1 Human MCP 1 ELISA Ready SET Go eBioscience IL 6 Human IL 6 ELISA Ready SET Go eBioscience TNF a Human TNF a ELISA Ready SET Go eBioscience 4
58. Murakami et al 1995 Wabitsch et al 1996 Caco 2 Sidler ez al 2011 Caco 2 CM 2 28 I VAUD e BERRA Tl i SGBS Caco 2 CM
59. 22 21 TZJR 124 0 2004 71 81 52 E Wi fandi AR 4
60. NC AARNE E A BD Falcon ane 1 1 SingleQuots Lonza SingleQuots Lonza 3 1 3 isobutyl 1 methylxanthine IBMX SingleQuots Lonza SingleQuots 10 DMEM F 12 10 CM SGBS Ulm Wabitsch 10 cm
61. f zT EBEREICEKOCERdO5 CtexEm SE 0 PYY GLPE 1 leg 35 B6 KK Arita et al 1999
62. 0 1 Triton X 100 1 1 TG 20C 11 For 24h SSSSS Intestinal epithelial Caco 2 cells Human primary adipocytes Human cell line or SGBS adipocytes Human cell line Higure 2 Schematic drawing of experimental design in experiment 2 3 ELISA Human Leptin Duo Set R amp D Systems Human Adiponectin Acrp30 DuoSet R amp D Systems Resistin Human ELISA Bio Vendor 4 RNA ReliaPrep RNA Cell Miniprep System Promega RNA RNA DNase I Promega DNA ReverrTra Ace qPCR RT Kit Toyobo 1 st strand complementary DNA
63. H KK 12 Hela ARB OBR 7 B6 B6 PBS DMEM KAF PN CR CRAS BE 12 000Xrpm IZ E jk LU 3T3 L1 30 DMEM Zi s 20C Jejunum lleum Homogenate Colon Liver EN c B6 mouse For 24 h Murine 3T3 L1 adipocytes Figure 11 Schematic drawing of experimental design in experiment 1 2 8T8 L1 50 ug mL B6 KK
64. peroxisome proliferator activated receptor y PPARy Moon et al 2003 Steppan et al 2001b Rangwala et al 2004 Steppan et al 2001b al 2001b CCAAT enhancer binding protein a C EBPo Ghosh e al 2003 2 amp Smith 2001 goa Vu F 3T3 L1
65. 2 1 CM SGBS Caco 2 CM RPMI 1640 RPMI 1640 Caco 2 CM ROME Caco 2 CM 24 20C 22 2 CM 3T3 L1 3T3 L1 Caco 2 CM RPMI 1640 RPMI 1640 Caco 2 CM 24 20C 3 CM SGBS Caco 2 CM RPMI 1640 OBR RPMI 1640
66. 472 6 Raghu P Ghosh S Soundarya K Haseeb A Aruna B Ehtesham NZ Dimerization of human recombinant resistin involves covalent and noncovalent interactions Biochem Biophys Res Commun 2004 313 3 642 6 Rangwala SM Rich AS Rhoades B Shapiro JS Obici S Rossetti L Lazar MA Abnormal glucose homeostasis due to chronic hyperresistinemia Diabetes 2004 53 8 1937 41 Reaven GM Banting lecture 1988 Role of insulin resistance in human disease Diabetes 1988 37 12 1595 607 Reiser R Bryson MJ Carr MJ Kuiken KA The intestinal absorption of triglycerides J Biol Chem 1952 194 1 181 8 47 Rosen ED Sarraf P Troy AE Bradwin G Moore K Milstone DS Spiegelman BM Mortensen RM PPAR gamma is required for the differentiation of adipose tissue in vivo and in vitro Mol Cell 1999 4 4 611 7 Rousset M The human colon carcinoma cell lines HT 29 and Caco 2 two in vitro models for the study of intestinal differentiation Biochimie 1986 68 9 1035 40 S nchez L Ismail M Liew FY Brock JH Iron transport across Caco 2 cell monolayers Effect of transferrin lactoferrin and nitric oxide Biochim Biophys Acta 1996 1289 2 291 7 Sarraf P Frederich RC Turner EM Ma G Jaskowiak NT Rivet DJ 3rd Flier JS Lowell BB Fraker DL Alexander HR Multiple cytokines and acute inflammation raise mouse leptin levels potential role ininflammatory anorexia J Exp Med 1997 185 1 171 5 Savage DB Sewter C
67. 5 TG yy 1 gt triglyceride TG Sugihara et TG A H E H ga E TG i TG E Kc E C Reiser et al 1952 Hahn 1943 Frayn
68. Leptin concentration in the medium was measured by ELISA The results are expressed as the mean SEM of the three independent experiments Caco 2 CM CM 100C 10 Caco 2 CM SGBS ELISA Caco 2 CM SGBS Caco 2 CM SGBS Caco 2 CM SGBS Figure 9 25 Higure 9 250 Leptin 200 150 pg mL 100 Leptin concentration 50 0 Heating Caco 2 cell CM 0 100 100 Effect of the heat treated CM from intestinal epithelial cells on the secretion of adipokine by adipocytes SGBS cells were cultured in the heat treated CM from Caco 2 cells for 24 h Leptin concentration in the medium was measured by ELISA The result is expressed as the mean SEM of two independent experiments Caco 2 CM
69. Yamauchi et al 2001 244 30 kDa Maeda ez al 1996 Kadowaki amp Yamauchi 2005 3 6 Tsao et al 2002 Pajvaniet et al 2003 Tsuchida et al 2005 H AdipoR1 AdipoR2 2 Yamauchi et al 2003 AdipoR1 AdipoR2 Yamauchi et al 2003 op6 AdipoR1 BE AdipoR2
70. 1 95 7 van Deventer SJ Review article Chemokine production by intestinal epithelial cells a therapeutic target in inflammatory bowel disease Aliment Phermacol Ther 1997 50 Wabitsch M Jensen PB Blum WF Christoffersen CT Englaro P Heinze E Rascher W Teller W Tornqvist H Hauner H Insulin and cortisol promote leptin production in cultured human fat cells Diabetes 1996 45 10 1435 8 Wabitsch M Brenner RE Melzner I Braun M Moller P Heinze E Debatin KM Hauner H Characterization of a human preadipocyte cell strain with high capacity for adipose differentiation Int J Obes Relat Metab Disord 2001 25 1 8 15 Weigle DS Duell PB Connor WE Steiner RA Soules MR Kuijper JL Effect of fasting refeeding and dietary fat restriction on plasma leptin levels J Clin Endocrinol Metab 1997 82 2 561 5 Weisberg SP McCann D Desai M Rosenbaum M Leibel RL Ferrante AW Jr Obesity is associated with macrophage accumulation in adipose tissue J Clin Invest 2003 112 12 1796 808 Wellen KE Hotamisligil GS Obesity induced inflammatory changes in adipose tissue J Clin Invest 2003 112 12 1785 8 Wellhoener P Fruehwald Schultes B Kern W Dantz D Kerner W Born J Fehm HL Peters A Glucose metabolism rather than insulin is a main determinant of leptin secretion in humans J Clin Endocrinol Metab 2000 85 3 1267 71 Wu Z Rosen ED Brun R Hauser S Adelmant G Troy AE McKeon C Darlington GJ
71. Caco 2 CM CI 5 1 One way ANOVA 0 05 Te 23 ID Caco 2 SGBS Caco 2 TEER 17 Figure 7A 1 14 Caco 2 CM SGBS ELISA Caco 2 CM SGBS 14 Caco 2 CM SGBS
72. DJ The biology of incretin hormones Cell Metab 2006 3 3 153 65 Fischer Posovszky P Newell FS Wabitsch M Tornqvist HE Human SGBS cells a unique tool for studies of human fat cell biology Obes Facts 2008 1 4 184 9 Frayn KN Adipose tissue as a buffer for daily lipid flux Diabetologia 2002 45 9 1201 10 Gavrilova O Marcus Samuels B Leon LR Vinson C Reitman ML Surgical implantation of adipose tissue reverses diabetes in lipoatrophic mice J Clin Invest 2000a 105 3 271 8 Gavrilova O Marcus Samuels B Graham D Kim JK Shulman GI Castle AL Vinson C Eckhaus M Reitman ML Leptin and diabetes in lipoatrophic mice Nature 2000b 403 6772 850 Gerhardt CC Romero IA Cancello R Camoin L Strosberg AD Chemokines control fat accumulation and leptin secretion by cultured human adipocytes Mol Cell Endocrinol 2001 175 1 2 81 92 41 Ghosh S Singh AK Aruna B Mukhopadhyay S Ehtesham NZ The genomic organization of mouse resistin reveals major differences from the human resistin functional implications Gene 2003 305 1 27 34 Grunfeld C Zhao C Fuller J Pollack A Moser A Friedman J Feingold KR Endotoxin and cytokines induce expression of leptin the ob gene product in hamsters J Clin Invest 1996 97 9 2152 7 Hahn PE ABOLISHMENT OF ALIMENTARY LIPEMIA FOLLOWING INJECTION OF HEPARIN Science 1943 98 2531 19 20 Halaas JL Gajiwala KS Maffei M Cohen SL Chait BT Rabinow
73. P Recombinant mouse OB protein evidence for a peripheral signal linking adiposity and central neural networks Science 1995 269 5223 546 9 Cario E Bacterial interactions with cells of the intestinal mucosa Toll like receptors and NOD 2 Gut 2005 54 8 1182 93 Cani PD Amar J Iglesias MA Poggi M Knauf C Bastelica D Neyrinck AM Fava F Tuohy KM Chabo C Waget A Delm e E Cousin B Sulpice T Chamontin B Ferri res J Tanti JF Gibson GR Casteilla L Delzenne NM Alessi MC Burcelin R Metabolic endotoxemia initiates obesity and insulin resistance Diabetes 2007 56 7 1761 72 40 Chen J Wang L Boeg YS Xia B Wang J Differential dimerization and association among resistin family proteins with implications for functional specificity J Endocrinol 2002 175 2 499 504 Creagh EM O Neill LA TLRs NLRs and RLRs a trinity of pathogen sensors that co operate in innate immunity Trends Immunol 2006 27 8 352 7 Curat CA Wegner V Sengen s C Miranville A Tonus C Busse R Bouloumi A Macrophages in human visceral adipose tissue increased accumulation in obesity and a source of resistin and visfatin Diabetologia 2006 49 4 744 7 Ding S Chi MM Scull BP Rigby R Schwerbrock NM Magness S Jobin C Lund PK High fat diet bacteria interactions promote intestinal inflammation which precedes and correlates with obesity and insulin resistance in mouse PLoS One 2010 5 8 e12191 Drucker
74. cDNA 5 mRNA 1 st strand cDNA GeneAce SYBR qPCR Mix No ROX Thermal Cycler Dice Real Time System Takara PCR mRNA GAPDH Table 1 12 Table 1 Primer sequences for reverse transcription quantitative polymerase chain reaction RT qPCR Target genes Primers 5 3 acetyl CoA carboxylase 1 Forward atgtctggcttgcacctagta ACC1 Reverse ccccaaagcgagtaacaaattct Forward gtgatggcagagatggcac Adiponectin Reverse acactgaatgctgagcggta Forward tgcaaactcaccgctccaatg C EBPa Reverse gctgtagcctcgggaagga fatty acid synthase Forward acagcggggaatgggtact FAS Reverse gactggtacaacgagcggat Forward aaggtgaaggtcggagtc GAPDH gaaggtgaaggtcggag Reverse gaagatggtgatgggatttc Forward tgtgcggattcttgtggctttg Leptin Reverse ggaggagactgactgcgtgtg Forward acaagagagaaccagactccaa LPL gagag g Reverse gcggacactgggtaatgct Forward attgacccagaaagcgattcc PPARy Reverse tcttc
75. cultured rat adipocytes Endocrinology 1998 139 2 551 8 Murakami T lida M Shima K Dexamethasone regulates obese expression in isolated rat adipocytes Biochem Biophys Res Commun 1995 214 3 1260 7 Nagaev I Smith U Insulin resistance and type 2 diabetes are not related to resistin expression in human fat cells or skeletal muscle Biochem Biophys Res Commun 2001 285 2 561 4 46 Nagaev I Bokarewa M Tarkowski A Smith U Human resistin is a systemic immune derived proinflammatory cytokine targeting both leukocytes and adipocytes PLoS One 2006 1 e31 Neish AS Microbes in gastrointestinal health and disease Gastroenterology 2009 136 1 65 80 Okuno A Tamemoto H Tobe K Ueki K Mori Y Iwamoto K Umesono K Akanuma Y Fujiwara T Horikoshi H Yazaki Y Kadowaki T Troglitazone increases the number of small adipocytes without the change of white adipose tissue mass in obese Zucker rats Clin Invest 1998 101 6 1354 61 Pajvani UB Du X Combs TP Berg AH Rajala MW Schulthess T Engel J Brownlee M Scherer PE Structure function studies of the adipocyte secreted hormone Acrp30 adiponectin Implications fpr metabolic regulation and bioactivity J Biol Chem 2003 278 11 9073 85 Patel L Buckels AC Kinghorn IJ Murdock PR Holbrook JD Plumpton C Macphee CH Smith SA Resistin is expressed in human macrophages and directly regulated by PPAR gamma activators Biochem Biophys Res Commun 2003 300 2
76. et al 2001 Fischer et al 2008 Wabitsch et al 2001 CM ml I 1 Caco 2 American Type Culture Collection 10 cm Greiner 87 C 5 COz 95 Dulbecco s modified Eagle s medium DMEM Gibco 20 fetal bovine serum FBS Corning 1 Gibco FE Gibco 100U mL
77. resistance Nat Med 2006 12 1 43 4 44 Lee GH Proenca R Montez JM Carroll KM Darvishzadeh JG Lee JI Friedman JM Abnormal splicing of the leptin receptor in diabetic mice Nature 1996 379 6566 632 5 Lee JJ Smith PJ Fried SK Mechanisms of decreased lipoprotein lipase activity in adipocytes of starved rats depend on duration of starvation J Nutr 1998 128 6 940 6 Lee YK Mazmanian SK Has the microbiota played a critical role in the evolution of the adaptive immune system Science 2010 330 6012 1768 73 Ley RE B ckhed F Turnbaugh P Lozupone CA Knight RD Gordon JI Obesity alters gut microbial ecology Proc Natl Acad Sci U S A 2005 102 31 11070 5 Ley RE Peterson DA Gordon JI Ecological and evolutionary forces shaping microbial diversity in the human intestine Cell 2006a 124 4 837 48 Ley RE Turnbaugh PJ Klein S Gordon JI Microbial ecology human gut microbes associated with obesity Nature 2006b 444 7122 1022 3 Lindsay RS Funahashi T Hanson RL Matsuzawa Y Tanaka S Tataranni PA Knowler WC Krakoff J Adiponectin and development of type 2 diabetes in the Pima Indian population Lancet 2002 360 9326 57 8 Lopez JM Bennett MK Sanchez HB Rosenfeld JM Osborne TF Sterol regulation of acetyl coenzyme A carboxylase a mechanism for coordinate control of cellular lipid Proc Natl Acad Sci USA 1996 93 3 1049 53 Maeda K Okubo K Shimomura I Funahashi T Mats
78. 0 63 Tsao TS Murrey HE Hug C Lee DH Lodish HF Oligomerization state dependent activation of NF kappa B signaling pathway by adipocyte complement related protein of 30 kDa Acrp30 J Biol Chem 2002 277 33 29359 62 Tsuchida A Yamauchi T Ito Y Hada Y Maki T Takekawa S Kamon J Kobayashi M Suzuki R Hara K Kubota N Terauchi Y Froguel P Nakae J Kasuga M Accili D Tobe K Ueki K Nagai R Kadowaki T Insulin Foxol pathway regulates expression levels of adiponectin receptors and adiponectin sensitivity J Biol Chem 2004 279 29 30817 22 Tsuchida A Yamauchi T Takekawa S Hada Y Ito Y Maki T Kadowaki T Peroxisome proliferator activated receptor PPAR alpha activation increases adiponectin receptors and reduces obesity related inflammation in adipose tissue comparison ofactivation of PPAR alpha PPAR gamma and their combination Diabetes 2005 54 12 3358 70 Turnbaugh PJ Ley RE Mahowald MA Magrini V Mardis ER Gordon JI An obesity associated gut microbiome with increased capacity for energy harvest Nature 2006 444 7122 1027 31 Turnbaugh PJ Backhed F Fulton L Gordon JI Diet induced obesity is linked to marked but reversible alterations in the mouse distal gut microbiome Cell Host Microbe 2008 3 4 213 23 Vaisse C Halaas JL Horvath CM Darnell JE Jr Stoffel M Friedman JM Leptin activation of Stat3 in the hypothalamus of wild type and ob ob mice but not db db mice Nat Genet 1996 14
79. 10 20 50 100 Caco 2 cell CM 96 Caco 2 cell CM C F 15 Leptin mRNA 15 7 Leptin mRNA ie Caco 2 CM 45 1 a 1 Nw cone gt gt s EZ 2096 2205 505 l 10 ae Be 50 E 7 0 100 0 0 0 0 10 20 50 100 5 10 15 20 Caco 2 cell CM Incubation time hr Figure 5 Effect of the CM from intestinal epithelial cells on the secretion of adipokine by adipocytes Chart A C Human primary adipocytes were cultured in the CM from Caco 2 cells for 24 h Adipokine concentrations in the medium were measured by ELISA A and B Gene expression of leptin was measured by qPCR C Chart D F SGBS cells were cultured in the CM from Caco 2 cells After 15 24 and 48 h of culture leptin concentrations in the media were measured by ELISA D whereas after only 24 h of culture adiponectin concentration was measured by ELISA E and Gene expression of leptin was measured by qPCR F The results are expressed as the mean SEM of three independent experiments A E and represent a single experiment F Mean values with an asterisk are significantly different p 0 05 as estimated by Dunnett s test following One way ANOVA A C and E Mean values with asterisks were significantly different p 0 05 vs 0 h at each concentration of CM supplement as estimated by Dunnett s test following One way ANOVA and mean values with different letters were significantly different p 0 05 at each time point as estima
80. CR The results are expressed as the mean SEM of three independent experiments 16 CM Caco 2 CM ELISA CM CM 100 Figure 5A Figure 5B Caco 2 CM mRNA qPCR Figure 5C SGBS Caco 2 CM 48 CM
81. N ANN Klyde amp Hirsch 1979 2003 gt Mes LEE DIZ EF Itoh Xu et al 2003 Weisberg et al 2003 Hal HE r1 EUR D monocyte chemoattractant protein
82. P Klenk ES Segal DG Vidal Puig A Considine RV O Rahilly S Resistin Hizz3 expression in relation to obesity and peroxisome proliferator activated receptor gamma action in humans Diabetes 2001 50 10 2199 202 Secq V Mallmann C Gironella M Lopez B Closa D Garcia S Christa L Montalto G Dusetti N Iovanna JL PAP HIP protein is an obesogenic factor J Cell Physiol 2014 229 2 225 31 Shimomura I Hammer RE Ikemoto S Brown MS Goldstein JL Leptin reverses insulin resistance and diabetes mellitus in mice with congenital lipodystrophy Nature 1999 401 6748 73 6 Sidler D Renzulli P Schnoz C Berger B Schneider Jakob S Fliick C Inderbitzin D Corazza N Candinas D Brunner T Colon cancer cells produce immunoregulatory glucocorticoids Oncogene 2011 30 21 2411 9 48 Simons PJ van den Pangaart PS van Roomen CP Aerts JM Boon L Cytokine mediated modulation of leptin and adiponectin secretion during in vitro adipogenesis evidence that tumor necrosis factor alpha and interleukin 1beta treated human preadipocytes are potent leptin producers Cytokine 2005 32 2 94 103 Slack E Hapfelmeier S Stecher B Velykoredko Y Stoel M Lawson MA Geuking MB Beutler B Tedder TF Hardt WD Bercik P Verdu EF McCoy KD Macpherson AJ Innate and adaptive immunity cooperate flexibly to maintain host microbiota mutualism Science 2009 325 5940 617 20 Smith SJ Cases S Jensen DR Chen HC Sande E To
83. Spiegelman BM Cross regulation of C EBP alpha and PPAR gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity Mol Cell 1999 3 2 151 8 Xu H Barnes GT Yang Q Tan G Yang D Chou CJ Sole J Nichols A Ross JS Tartaglia LA Chen H Chronic inflammation in fat plays a crucial role in the development of obesity related insulin resistance J Clin Invest 2003 112 12 1821 30 51 Yamauchi T Kamon J Waki H Terauchi Y Kubota N Hara K Mori Y Ide T Murakami K Tsuboyama Kasaoka N Ezaki O Akanuma Y Gavrilova O Vinson C Reitman ML Kagechika H Shudo K Yoda M Nakano Y Tobe K Nagai R Kimura S Tomita M Froguel P Kadowaki T The fat derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity Nat Med 2001 7 8 941 6 Yamauchi T Kamon J Ito Y Tsuchida A Yokomizo T Kita S Sugiyama T Miyagishi M Hara K Tsunoda M Murakami K Ohteki T Uchida S Takekawa S Waki H Tsuno NH Shibata Y Terauchi Y Froguel P Tobe K Koyasu S Taira K Kitamura T Shimizu T Nagai R Kadowaki T Cloning of adiponectin receptors that mediate antidiabetic metabolic effects Nature 2003 423 6941 762 9 Zhang Y Proenca R Maffei M Barone M Leopold L Friedman JM Positional cloning of the mouse obese gene and its human homologue Nature 1994 372 6505 425 32
84. X nem 33 ZAE X nr J HOKKAIDO UNIVERSITY Title HHHHHHHDID oe eee oe Author s 0 0 00 Citation Issue Date 2015 06 30 DOI Doc URL http hdl handle net 2115 59789 Right Type theses doctoral Additional Information Info Sion Rino Ishiharapdf LI Instructions for use Hokkaido University Collection of Scholarly and Academic Papers HUSCAP Iu NOS 0 0 0 0000 Mifiesoemetectiepeu 1 MN Ls 2IO o ona sas 2 I Y II 1 ce 8 MERR Oe 000000000000 ee 9 I Wee 0000000000000 CHEeefemeesierisseosses ensis teen uue 14 10 20 oo E 21 D AR css 8 000 0 0000 eae 22 I 24 IV S I S ML LOL LUE XDMEE MDC 27
85. adowaki T Yamauchi T Kubota N Hara K Ueki K Tobe K Adiponectin and adiponectin receptors in insulin resistance diabetes and the metabolic syndrome J Clin Invest 2006 16 7 1784 92 Kawabe Y Sato R Matsumoto A Honda M Wada Y Yazaki Y Endo A Takano T Itakura H Kodama T Regulation of fatty acid synthase expression by cholesterol in human cultured cells Biochem Biophys Res Commun 1996 219 2 515 20 Kawai T Akira S TLR signaling Semin Immunol 2007 19 1 24 32 Kennedy GC The role of depot fat in the hypothalamic control of food intake in the rat Proc R Soc Lond B Biol Sci 1953 140 901 578 96 Kondo K Nozawa K Tomita T Ezaki K Inbred strains resulting from Japanese mice Bull Exp Animal 1957 6 107 12 Kubota N Terauchi Y Miki H Tamemoto H Yamauchi T Komeda K Satoh S Nakano R Ishii C Sugiyama T Eto K Tsubamoto Y Okuno A Murakami K Sekihara H Hasegawa G Naito M Toyoshima Y Tanaka S Shiota K Kitamura T Fujita T Ezaki O Aizawa S Kadowaki T et al PPAR gamma mediates high fat diet induced adipocyte hypertrophy and insulin resistance Mol Cell 1999 4 4 597 609 Kubota T Kubota N Moroi M Terauchi Y Kobayashi T Kamata K Suzuki R Tobe K Namiki A Aizawa S Nagai R Kadowaki T Yamaguchi T Lack of insulin receptor substrate 2 causes progressive neointima formation in response to vessel injury Circulation 2003 107 24 3073 80 Lazar MA The humoral side of insulin
86. ar MA Dimerization of resistin and resistin like molecules is determined by a single cysteine J Biol Chem 2001 276 28 25970 3 Barak Y Nelson MC Ong ES Jones YZ Ruiz Lozano P Chien KR Koder A Evans RM PPAR gamma is required for placental cardiac and adipose tissue development Mol Cell 1999 4 4 585 95 39 Barbier M Cherbut C Aub AC Blottiere HM Galmiche JP Elevated plasma leptin concentrations in early stages of experimental intestinal inflammationin rats Gut 1998 43 6 783 90 Bennett MK Lopez JM Sanchez HB Osborne TF Sterol regulation of fatty acid synthase promoter Coordinate feedback regulation of two major lipid pathways J Biol Chem 1995 270 43 25578 83 Blaser MJ Falkow S What are the consequences of the disappearing human microbiota Nat Rev Microbiol 2009 7 12 887 94 Boden G Chen X Mozzoli M Ryan I Effect of fasting on serum leptin in normal human subjects J Clin Endocrinol Metab 1996 81 9 3419 23 Brandsch M Miyamoto Y Ganapathy V Leibach FH Expression and protein kinase C dependent regulation of peptide H co transport system in the Caco 2 human colon carcinoma cell line Biochem J 1994 299 Pt 1 253 60 Bruun JM Pedersen SB Kristensen K Richelsen B Effects of pro inflammatory cytokines and chemokines on leptin production in human adipose tissue in vitro Mol Cell Endocrinol 2002 190 1 2 91 9 Campfield LA Smith FJ Guisez Y Devos R Burn
87. cattacggagagatccac 6 TG 2 SONIFIER 250 Branson TG E 7 1 Student s test One way ANOVA 0 05 13 IE 10 Figure 3A
88. entration pg mL 100 50 Adiponectin concentration ng mL Jejunum Ileum Colon Jejunum Ileum Colon Figure 14 Effect of intestinal tissue homogenates on the secretion of adipokine by adipocytes 3T3 L1 cells were cultured in jejunal ileal colonic homogenate of C57BL 6J JmsSlc B6 and KK Ay TaJcl KK mice for 24 h Leptin A and adiponectin B concentration in the medium was measured by ELISA The result are expressed as the mean SEM of three independent experiments Mean values with astarisks are significantly different p lt 0 05 as estimated by Unpaired t test 34 V 48 B6 oC 3T3 L1
89. gma Aldrich 20 nM Sigma Aldrich 0 01 mg mL Gibco 100 nM Sigma Aldrich 3 3 5 L Ji 0 2 nM Sigma Aldrich 2 mM 4 SFC 3FO 0 01 mg mL 20 nM RU 100 nM 33 5 HU 8 F L uw hUvAX 0 2 nM 4 1 SGBS Wabitsch ez al 2001 SGBS 20 2 1 EV AMAIA TG
90. itz D Lallone RL Burley SK Friedman JM Weight reducing effects of the plasma protein encoded by the obese gene Science 1995 269 5223 543 6 Hardie LJ Rayner DV Holmes S Trayhurn P Circulating leptin levels are modulated by fasting cold exposure and insulin administration in lean but notZucker fa fa rats as measured by ELISA Biochem Biophys Res Commun 1996 223 3 660 5 Harris DS Slot JW Geuze HJ James DE Polarized distribution of glucose transporter isoforms in Caco 2 cells Proc Natl Acad Sci U S A 1992 89 16 7556 60 Hibuse T Maeda N Nagasawa A Funahashi T Aquaporins and glycerol metabolism Biochim Biophys Acta 2006 1758 8 1004 11 Hidalgo IJ Raub TJ Borchardt RT Characterization of the human colon carcinoma cell line Caco 2 as a model system for intestinal epithelial permeability Gastroenterology 1989 96 3 736 49 Hidalgo IJ Borchardt RT Transport of bile acids in a human intestinal epithelial cell line Caco 2 Biochim Biophys Acta 1990 1035 1 97 103 42 Hidalgo IJ Borchardt RT Transport of a large neutral amino acid phenylalanine in a human intestinal epithelial cell line Caco 2 Biochim Biophys Acta 1990 1028 1 25 30 Hirsch J Knittle JL and Salans LB Cell lipid content and cell number in obese and nonobese human adipose tissue J Clin Invest 1966 45 6 1023 37 Holcomb IN Kabakoff RC Chan B Baker TW Gurney A Henzel W Nelson C Lowman HB Wright BD Skelto
91. lova et al 2000b 1996 Yamauchi e al 2001 Maeda et al 1996 2001 4F IZ Yamauchi
92. n NJ Frantz GD Tumas DB Peale FV Jr Shelton DL H bert CC FIZZ1 a novel cysteine rich secreted protein associated with pulmonary inflammation defines a new gene family EMBO J 2000 19 15 4046 55 Hooper LV Gordon JI Commensal host bacterial relationships in the gut Science 2001 292 5519 1115 8 Hosoda K Masuzaki H Ogawa Y Miyawaki T Hiraoka J Hanaoka I Yasuno A Nomura T Fujisawa Y Yoshimasa Y Nishi S Yamori Y Nakao K Development of radioimmunoassay for human leptin Biochem Biophys Res Commun 1996 221 2 234 9 Iovanna JL Dagorn JC The multifunctional family of secreted proteins containing a C type lectin like domain linkedto a short N terminal peptide Biochim Biophys Acta 2005 1723 1 3 8 18 Itoh Y Kawamata Y Harada M Kobayashi M Fujii R Fukusumi S Ogi K Hosoya M Tanaka Y Uejima H Tanaka H Maruyama M Satoh R Okubo S Kizawa H Komatsu H Matsumura F Noguchi Y Shinohara T Hinuma S Fujisawa Y Fujino M Free fatty acids regulate insulin secretion from pancreatic beta cells through GPR40 Nature 2003 422 6928 173 6 Johnson PR Hirsch J Cellularity of adipose depots in six strains of genetically obese mice J Lipid Res 1972 13 1 2 11 Kadowaki T Insights into insulin resistance and type 2 diabetes from knockout mouse models J Clin Invest 2000 106 4 459 65 43 Kadowaki T Yamauchi T Adiponectin and adiponectin receptors Endocr Rev 2005 26 3 439 51 K
93. ntal design in experiment 1 2 CM Caco 2 CM SGBS TfHigure 2 Caco 2 CM DMEM F 12 ORS DMEM F 12 Caco 2 CM 24 20C 1 RNA 80 SGBS Caco 2 CM RPMI 1640 RPMI 1640 Oaco 2 CM 24 20 1 RNA 80C Tris HCl pH 7 4 50 mM NaCl 150 mM
94. ted by Tukey Kramer s test following One way ANOVA 18 CM SGBS TG Caco 2 CM Figure 6 2 000 TG Caco 2 CM 5 1 500 conc 50 HE g 51 000 es o 500 0 15 24 48 Incubation time hr Figure 6 Effect of the CM from intestinal epithelial cells on TG concentration in adipocytes SGBS cells were cultured in the CM from Caco 2 cells After 15 24 and 48 h of culture TG concentrations in the SGBS cells were measured The result is expressed as the mean SEM of three independent experiments 19 IV SGBS Caco 2
95. the mean SEM of three independent experiments D G P values were estimated by Student s test p lt 0 05 SGBS mRNA SGBS Caco 2 Figure 4A E A B 2 PPARy mRNA 2 C EBPa mRNA 215 15 3 P EE Es 1 28 is Los 0 5 0 0 Caco 2 Caco 2 Caco 2 Caco 2 C D 2 ACC1 mRNA 2 FAS mRNA 15 215 3 8 3 5 gt E E1 ES 1 215 2s LE ae 3 0 5 amp 05 0 0 Caco 2 Caco 2 Caco 2 Caco 2 E 2 LPL mRNA 15 lt 5 pog 33 0 5 a 0 Caco 2 Caco 2 Figure 4 Effect of co culturing intestinal epithelial cells with adipocytes on adipocytes differentiation Caco 2 cells were co cultured with SGBS cells for 24 h Gene expressions of adipocyte differentiation markers was measured by qP
96. ues with astarisks are significantly different p 0 05 as estimated by Dunnett s test following One way ANOVA B and C Caco 2 CM 3T3 L1 3T3 L1 12 Figure 8A 3T3 L1 CM Caco 2 CM 3T3 L1 24 Figure 8B A Murine 3T3 L1 adipocytes x400 Day 1400 Leptin 1200 1000 T 800 E 600 400 200 Leptin concentration 0 10 20 50 100 Caco 2 cell CM 96 Figure 8 Effect of the CM from human intestinal epithelial cells on the secretion of adipokine by murine adipocytes Chart A Morphological changes in murine 3T3 L1 adipocytes Chart B 3T3 L1 cells were cultured in the CM from human intestinal epithelial Caco 2 cells for 24 h
97. ure 13 Effect of intestinal tissue homogenates on the secretion of adipokine by adipocytes 3T3 L1 cells were cultured in jejunal ileal colonic or liver tissue homogenate of C57BL 6J JmsSlc B6 mice for 24 h Leptin A and adiponectin B concentration in the medium was measured by ELISA The result are expressed as the mean SEM of three independent experiments Mean values with astarisks are significantly different p 0 05 as estimated by Dunnett test following One way ANOVA KK 8T3 L1 KK B6 8T3 L1 B6 KK Figure 14AB x aH 33 A 400 200 Adiponectin Leptin conc
98. uzawa Y Matsubara K cDNA cloning and expression of a novel adipose specific collagen like factor apM1 AdiPose Most abundant Gene transcript 1 Biochem Biophys Res Commun 1996 221 2 286 9 45 Waki H Yamauchi T Kamon J Ito Y Uchida S Kita S Hara K Hada Y Vasseur F Froguel P Kimura S Nagai R Kadowaki T Impaired multimerization of human adiponectin mutants associated with diabetes Molecular structure and multimer formation of adiponectin J Biol Chem 2008 278 41 40352 63 Maljaars PW Peters HP Mela DJ Masclee AA Ileal brake a sensible food target for appetite control A review Physiol Behav 2008 95 3 271 81 Masuzaki H Ogawa Y Isse N Satoh N Okazaki T Shigemoto M Mori K Tamura N Hosoda K Yoshimasa Y et al Human obese gene expression Adipocyte specific expression and regional differences in the adipose tissue Diabetes 1995 44 7 855 8 Matsuzawa Y Funahashi T Nakamura T Molecular mechanism of metabolic syndrome X contribution of adipocytokines adipocyte derived bioactive substances Ann N Y Acad Sci 1999 892 146 54 Moon B Kwan JJ Duddy N Sweeney G Begum N Resistin inhibits glucose uptake in L6 cells independently of changes in insulin signaling and GLUT4 translocation Am J Physiol Endocrinol Metab 2003 285 1 E106 15 Mueller WM Gregoire FM Stanhope KL Mobbs CV Mizuno TM Warden CH Stern JS Havel PJ Evidence that glucose metabolism regulates leptin secretion from
99. w B Sanan DA Raber J Eckel RH Farese RV Jr Obesity resistance and multiple mechanisms of triglyceride synthesis in mice lacking Dgat Nat Genet 2000 25 1 87 90 Steppan CM Brown EJ Wright CM Bhat S Banerjee RR Dai CY Enders GH Silberg D G Wen X Wu GD Lazar MA A family of tissue specific resistin like molecules Proc Natl Acad Sci U S A 2001a 98 2 502 6 Steppan CM Bailey ST Bhat S Brown EJ Banerjee RR Wright CM Patel HR Ahima RS Lazar MA The hormone resistin links obesity to diabetes Nature 2001b 409 6818 307 12 Sugihara H Yonemitsu N Miyabara S Yun K Primary cultures of unilocular fat cells characteristics of growth in vitro and changes in differentiation properties Differentiation 1986 31 1 42 9 Sugihara H Yonemitsu N Miyabara S Toda S Proliferation of unilocular fat cells in the primary culture J Lipid Res 1987 28 9 1038 45 Tartaglia LA Dembski M Weng X Deng N Culpepper J Devos R Richards GJ Campfield LA Clark FT Deeds J Muir C Sanker S Moriarty A Moore KJ Smutko JS Mays GG Wool EA Monroe CA Tepper RI Identification and expression cloning of a leptin receptor OB R Cell 1995 83 7 1263 71 49 Tilg H Moschen AR Kaser A Obesity and the microbiota Gastroenterology 2009 136 5 1476 83 Traber MG Kayden HJ Rindler MJ Polarized secretion of newly synthesized lipoproteins by the Caco 2 human intestinal cell line J Lipid Res 1987 28 11 135
Download Pdf Manuals
Related Search