DNA Sequencing Troubleshooting Guide
Contents
1. eurofins se MWg operon DNA Sequencing Troubleshooting Guide Copyright 2011 Eurofins MWG Operon Inc Table of Contents Successful DNA Sequencing Read Failed DNA Sequencing Reaction or Dirty Sequence Double Sequence Data Noisy Background Stuttering after Repetitive Sequences Mid Sequence Drop Off Top Heavy Sequences Spikes Early Peak Deterioration oO O Successful DNA Sequencing Read e Peaks are well formed and separated with good quality scores There is a small area at the beginning of the run before the chemistry stabilizes e Signal strength is high typically in the thousands Sita Cle gs idseq ab1 Dex dk View Finch Help gt a o OOO A fT Geosp a No _ Find Sequence 2 PACS wade rly hls ET HUE EEE EEE EEE EEE NAN ar nal nn atl PEE EEE EE EEE EEE EE EEE Ee GGCGACTCGCTGCTCGGCCACGACGCGATCGAATGAATGCTCGACCATTTICCTGACCGATCCGGGCGTCGGCGCGGTGACCGGC a A HA EE EH RATCCGCGCATCCGCACGCGCACGTCGC TGCTCGGCCGCATGCAGGTCGGCGAGTTICTCGTCGATCGTCGGGCTGATCAAGCGCAC Tuna HE EE EEE EEE EEE EEE EEE GCAGCAGGTGTACGGCCGCATCTTCACGGTATCGGGCGTGATCACGATGTTCCGCAAGACCGCGCTCGCCGACGTCGGATTCTGGA AE Vertical 9000 FinchTY Clean PC MER 200 Ele Edt Yew Foch Heb T B a 80032 Am cosa Base Nof Find Sequence ee eee HL rh Hs the Ha Lh Mitre Th Tin IN p RENE A A EEE A Reset Scale J lidad a al2. 111 Hi HALLE EEE ALELLA HE a EEE EEE EEE EEE NN Horizontal Scale Failed DNA Sequencing Reaction or Dirty Sequence Sequence Appearance e Chromatogram data looks messy or is mostly blank e Many N s in the sequence if bases are called at all e Blast search from seq or fasta file yields unexpected results e Raw data has signal intensity in the low hundreds RU F l wa a 1 i 1 8 1 s l 1 1 1 t a w I 14 Pissed siete gga Aan ane dE Sea aie gia CGA Tae Und cca 80 90 100 1 e llo ant cale AAA A 55108 gcgggncnnacgccgatncggntat 120 130 En 1 Hi arts Hans a ons ts nm a bnan nacasciagenaccegcanggccagecgi tettggge te raras a eA a ao aaa tJ 140 150 170 190 200 210 Lola Ni ali ha FinchTY Raw Data Display weak data MIE G AA halm IN il alla fers www sea ne re oe ere 1 Ra be fi ng SR 220 230 240 500 1000 1500 2000 2500 3000 3500 4000 4500 5000 Aa rr t on gaagacgcoccaaaacataaay 260 2 g AAAA M Malal AA Wa 1 laa i nnnnn hay I Mil j ik oi i il ry il We bi NA 14 l i Ji 9 i rat b Vertical AAN A a VIA Bae EISA wn ANN M O Y AA pda A A Va M nn A Aa pena NA ln i Reset Scales Horizontal Scale J Possible Causes It is difficult to pinpoint a specific cause for the failure when there are no data for review Common causes are e DNA Template concentration is too low Note meas
3. AE EA ee Erre terri AHL d AAACN NINOS TOCCAGOTOCATTAA CGGCC lola ab i Fe l HE EEE HHHH EEE EEE GGGGAG TCGGTCGTT 510 EN 530 sao so ES 570 Sol dalla t Possible Causes e The cause of spikes is not completely understood One possible explanation is that an impurity or micro bubble passes through the camera view of the sequencing instrument scattering light Treatment e The surrounding sequence should still be correct and accurate Please request your sample to be rerun if necessary Early Peak Deterioration Sequence Appearance e Peaks become broad or oddly shaped very early on in the sequence Example wads HE es I l li ea beh it TEACEE toetest s El THAT ETAATASOASoGATAGE AAC TET ET 190 LOUE inei TT OBAGE AAAA GA AA OA TATETITIAGT OR TACAATAGCAA TAA TNA CAC TNA CAA CAGTAA T6 NAA TAGCAGTAA 300 310 rro Run ha NY a rs fal a al ld al a a A a ol o LE bei nes a a da Han eu is ir D e dd a de a CR et Ut Ut NAN ATARCTATT ETES CT WHO NC TEN CNGN AN T T NN A NNTG C AGEN NAN N N A NOT A L 370 C Nour d ae ax O OA O XX XK Possible Causes e Salt or other impurities carried over from DNA isolation protocols especially home made protocols Treatment e Use a commercial desalting kit to further purify the DNA template before sequencing 2B24 1
4. ect that two different primers may have been added to the reaction repeat the reaction using the original stock primer solution in case your working solution is the source of the contamination e Check your PCR purification protocol and the solutions used in the clean up reaction e Check the primer sequence against the template sequence to ensure that there is a single binding site Where sequence is unknown you may need to switch to a different sequencing primer to eliminate the problem Stuttering after Repetitive Sequences Sequence Appearance e Sequencing data quality is poor after mononucleotide strectches or tandem repeats Example AR ES E 24414444444 040118 NNNN NNW poe N NNN NNN inp TAS GAN GN GNAGGGAGGGGTAGAGAGAAG Ne Scale la A GGGGG SOSS MAN EN RAS EG ENN NAT TTT TAA ANNNNNNCNC ANC NNNNCCCCNNNNN 70 120 LJ NNN GOGGGGGGGONNCNTITTINAAAAAANNNNTTTTTTTNNNNNNT ToCCeCCCOGGG CGC 130 170 190 all An j Fr AM lil An AAA at A Possible Causes e Polymerase slippage during DNA synthesis This is a recognized limitation of the Sanger method e Polymerase frameshift error during PCR amplification Treatment e Sequence from the reverse direction e Use a poly mononucleotide primer with a degenerate base wobble at the 3 end Mid Sequence Stop or Drop Off Sequence Appearance e The DNA sequence suddenly stops or peak intensity drops off substantially NOTE Many popular cloning vectors have palindrome
5. en clean and NN NN NN NN bill NNCT CoA EEES SE A STOT oAt c beari GCA GAATTENCC CTT INT O66 AGE AC becomes dirty as the sequence progresses AAN past the clone insertion site a a es e PCR template may be heterozygous Ai ie dre T ila Ml lil i ii MN i i il ih i or polyploid organism E Enaco 61 333 Re pares may havo boon misa aed A to the sequencing reaction OF e PCR products were not purified or the purification was not performed properly In this case residual PCR primers may participate in the sequencing reaction e Primer may also be binding to another area of the template with sufficient homology e Primer may have degraded Treatment e If clone contamination is expected please return to your clone resource and replate the bacteria onto selection media You may want to select up to 12 clearly separated clones for sequencing to ensure you find the actual clone of interest e Where PCR template heterozygosity is suspected examination of the dirty sequence may yield some indication of the area of heterozygosity Newly designed PCR primers that yield shorter products may allow you to discern where the troublesome area is Alternatively you may decide to redesign the sequencing primer close to the area where the problem first arises hoping to find a primer that will sequence one of the product species If the PCR product is large subcloning the template into shorter pieces ma
6. ossible Causes e Clone contamination in this case the beginning of the sequence is often clean and becomes dirty as the sequence progresses past the clone insertion site e PCR template may be heterozygous due to indels present in a diploid or polyploid organism e Two primers may have been mistakenly added to the sequencing reaction e PCR products were not purified or the purification was not performed properly In this case residual PCR primers may participate in the sequencing reaction e Primer may also be binding to another area of the template with sufficient homology Treatment e If clone contamination is expected please return to your clone resource and replate the bacteria onto selection media You may want to select up to 12 clearly separated clones for sequencing to ensure you find the actual clone of interest e Where PCR template heterozygosity is suspected examination of the dirty sequence may yield some indication of the area of heterozygosity Newly designed PCR primers that yield shorter products may allow you to discern where the troublesome area is Alternatively you may decide to redesign the sequencing primer close to the area where the problem first arises hoping to find a primer that will sequence one of the product species If the PCR product is large subcloning the template into shorter pieces may also provide a strategy for discerning the true sequence of the area of interest e If you susp
7. s flanking their linker and may show the drop off effect when sequenced This is a limitation of the Sanger method but many times it can be overcome with Power Read chemistry available from Eurofins MWG Operon Example dE e Pe hai adhd A w hil H HR e eE N TOCCICOCOOCGCOGCCAGOCCACCECCOTCCEGCCCCCCACECECCGOETO E 170 180 tunel hihi o Hi E tr sorte t hr loc TON ANNGTC HS Cec TCTGAGTTC TGNACATI IC ere eee COOOGATC STCCATCTICAGC GIGATC ACC SCN 190 200 210 220 230 240 250 260 270 Possible Causes e Secondary structures in the DNA template e g hairpin loops palindromes e GC or GT rich regions e Sample is an siRNA construct Treatment e Power Read technology yields excellent results with these template types 5 Top Heavy Sequences Sequence Appearance e Sequencing signal gradually drops off ADIDAS Za r E IIED Ai Possible Causes e Excess DNA template or primer e GC or GT rich template from bisulfide treated DNA for example e Long stretch of short tandem repeats Treatment e Carefully quantify your DNA template and primer prior to sequencing e Sequence from the reverse direction e Use a poly mononucleotide primer with a degenerate base wobble at the 3 end Spikes Sequence Appearance e Sharp high intensity multicolored peaks that randomly appear in the sequence Example cles ee GAGCCOGAAGCATAAAGT Ere a eg area GAGCTAACTCACH 350 html he
8. uring DNA concentration by UV absorption is often inaccurate and concentration is frequently overestimated Agarose gels are a better method to estimate quality and quantity of DNA samples e Wrong primer or no primer was added to the reaction binding between the DNA and the primer cannot occur in either of these instances Treatment e Check the concentration of your template by agarose gel to ensure that it falls with the ranges listed in the Sample Submission Guidelines e Check the primer sequence against the template sequence to ensure that there is a proper binding site e Improve the quality of the template prep a Prepare fresh stock solutions for template prep and dilution just prior to submitting samples for sequencing b Prepare plasmid DNA using a commercial mini prep kit a final ethanol precipitation after the prep may help ensure success Double Sequence Data Sequence Appearance Example OS peaks are not clean CO NA WM NRSR NSE STS SK HOE Ay CELL CORTE EEE SEC CRE EEE i aces dede daria im DA a bli min ul im st ull D F7 020 senta E sina UA wt lu h i La lg hi dl i LM his ml j yl indicating that the double peaks are not due to weak signal and or background noise AAGATGGTGCAGCCTGTCCGATGT n P li W la ve h de il oli dla site Possible Causes fl ke ui a lia NW LA ul lulu all bi e Clone contamination in this case the KE e z beginning of the sequence is oft
9. y also provide a strategy for discerning the true sequence of the area of interest e If you suspect that two different primers may have been added to the reaction repeat the reaction using the original stock primer solution in case your working solution is the source of the contamination e Check your PCR purification protocol and the solutions used in the clean up reaction e Check the primer sequence against the template sequence to ensure that there is a single binding site Where sequence is unknown you may need to switch to a different sequencing primer to eliminate the problem e Order new batch of sequencing primers Noisy Background Sequence Appearance e Background noise and odd peaks are present underneath the main sequence peaks e Raw data has signal intensity in the low hundreds Example A is Pl dd dr a de dl A de de oe ee oe A NNN NN NNN NNNN NNN N NNNNAA TN NN dle CN NNC CATE CN GC GTG AAC CARA T TAC TETTT Te GCACAAT CCAATAT GT t E EOt 14 0 1 1 1 1 1 BCANNT TAT TAC STTTTTC cA GARAT C ATC GAA AAC GGTAATIG GC SGACO ces ITTATOT TE SCOTT TTC SAG AT AC 1 Eu h inal wl per ull i i bl i 0 0 0 0 84 5 8 2 8 CAGTTC Ak CTATTETTC Teac react cTeTT GAG GT AC Srrrtred eT Tec SCA TAOTe Hr HAN CES lil Mu MN uiy nn luth ul 1000 2000 3000 4000 5000 6000 7000 8000 9000 10000 11000 12000 13000 14000 15000 16000 Al IA le y p Be ii qu UN ANDA ey ay SL Lat MRD rm ae a lv P
Download Pdf Manuals
Related Search