User Manual For Assembly PCR Oligo Maker
Contents
1. available for your platform from Sun Microsystems at http java sun com Mac users be aware It is inherent to Mac OS that all menus appear at the top of the screen The File and the Help menus for the Assembly PCR Oligo Maker are therefore found at the top of the screen as shown on the screenshot below in Figure 2 instead of being located above the application window Safari File Edit View tory Bookmarks Window Help E A E228 Wed startrek ccs yorku ca pjohnson AssemblyPCRoligomaker html ucting Long DNA Molecules leotides for the PCR based construction of long of DNA molecules that are to be used for the input for Assembly PCR Oligo Maker is either the program first determines the DNA sequence the sequences of all the oligodeoxynucleotides ecule The output oligodeoxynucleoide sequences f overlap outside of the desired priming regions Output E GATTGCGAGACCCGCAATCGACGGAGTC1 CCCAAGCTTAGCTTGCATGCCGGCAGTTG Figure 2 A Mac OS screenshot of Assembly PCR Oligo Maker depicting the location of the menu Assembly PCR Oligo Maker 1 4 GETTING STARTED Interface overview INTERFACE OVERVIEW Assembly PCR Oligo Maker s interface is simple and composed of the input and the output as shown in Figure 3 The input has only two choices the type of DNA template or RNA product and the order of the input 5 3 or 3 5 For the output DNA sequence assembly oligos flan2. PCR ta b c Figure 1 The assembly PCR method for constructing long DNA molecules a In the first PCR step a pool of oligodeoxynucleotides anneal and are b elongated to produce a full length DNA molecule In addition to the full length product a host of shorter molecules also results c In the second PCR step the desired full length molecule is selectively amplified from the mixture using primers specific for the desired product In the first step of assembly PCR multiple oligodeoxynucleotides that contain overlapping regions anneal and the DNA polymerase extends the primers and fills in the regions between the primers A range of products of different lengths results from the different possible annealing combinations that involve less than all the oligodeoxynucleotides In the second PCR step a pair of primers that is specific for the full length oligodeoxynucleotide is introduced and the full length product is selectively amplified from the mixture Assembly PCR Oligo Maker 1 3 GETTING STARTED System requirements SYSTEM REQUIREMENTS Assembly PCR Oligo Maker is a Java Applet version 1 1 It is compatible and has been tested with a variety of browsers Netscape IE Mozilla Firefox etc on different platforms Microsoft Windows Linux and Mac and should not require any Java plug ins However if you have difficulty running the program you should download the latest Java Runtime Environment JRE
3. PCR Le ee ee ee ee ee ee ee ee ee The construction of long DNA oligonucleotides such as synthetic genes is useful for a number of reasons For protein expression it is possible to improve the yield of a desired protein by optimizing codon usage to reflect the relative codon abundance in the host organism used for protein production Additionally oligodeoxynucleotides can be used to produce large amounts of RNA for structural or biochemical studies by 7 vitro transcription methods Many RNA molecules studied to date are under 100 nucleotides in length and the DNA oligonucleotides needed for their production are readily synthesized and are commercially available up to 100 150 nucleotides long As larger RNA molecules are studied and if methods such as the use of cis3 and or 5 ribozymes to facilitate RNA production or RNA based affinity tags to aid in RNA purification are used it is not possible to purchase DNA oligonucleotides of sufficient length to encode the desired RNA product To produce these long DNA molecules over 120 150 nucleotides it is necessary to use techniques originally developed for gene synthesis such as assembly PCR The polymerase chain reaction PCR is a commonly used method to amplify DNA sequences PCR methods can be used to construct a synthetic gene through the use of a two step PCR method referred to as assembly PCR Figure 1 Assembly PCR Oligo Maker 1 2 GETTING STARTED Polymerase chain reaction
4. ee ee ee ee ee ee ee ee Enter an RNA product that is at least 40 nucleotides long Since there is no point determining oligos for a such short RNA product the program s algorithm will not accept such a short input Assembly PCR Oligo Maker 3 17 A acceptable melting temperature for overlapping 8 assembly annealing temperature 8 assembly PCR method 3 B browsers 4 C clear all fields 6 credits 10 customize 7 D DNA template 12 E error messages 14 H help 9 I in vitro synthesis 1 interface 5 M Mac OS 4 maximum oligonucleotide length calculated 8 melting temperature method 9 O output in groups of 3 nucleotides 9 P PCR 2 polymerase chain reaction 2 protein expression 2 R RNA product 11 S save results 13 synthetic genes 2 system requirements 4 T T7 RNA polymerase 1 Y yield 2 Assembly PCR Oligo Maker 1 18
5. section in chapter 1 for more information The error window is shown in Figure 1 bn oligo has a corresponding matching sequence amp within itself Use the Show All Results option in the File menu to find the matching regions enclosed in Dividing the DNA template into smaller oligos might solve this problem See help for more details Figure 1 The Error window A PRIMER HAS A CORRESPONDING MATCHING SEQUENCE WITH A DUPLEX Ce ee ee During oligo determination if the program finds a region in one oligo that could possibly anneal to a region in the duplex this could be troublesome during a PCR reaction To correct this situation reduce the acceptable melting temperature for overlapping or reduce the maximum oligonucleotide length calculated Refer to the Customizing Assembly PCR Oligo Maker section in chapter 1 for more information The error window is shown in Figure 2 Assembly PCR Oligo Maker 3 14 ERROR MESSAGES A primer has a corresponding matching sequence with the other primer by primer has a corresponding matching sequence with a duplex Java Applet Window Figure 2 The Error window A PRIMER HAS A CORRESPONDING MATCHING SEQUENCE WITH THE OTHER PRIMER During oligo determination if the program finds a region in one primer that could possibly anneal to a region in another primer this could be troublesome during a PCR reaction To correct this situation reduce the acceptabl
6. User Manual For Assembly PCR Oligo Maker Table of Contents 1 Getting Started 1 1 Assembly PCR Oligo Maker 1 1 Target audience 1 2 Polymerase chain reaction PCR 1 2 System requirements 1 4 Interface overview 1 5 Clearing fields 1 6 Customizing Assembly PCR Oligo Maker 1 7 Acceptable melting temperature for overlapping 1 8 Assembly annealing temperature 1 8 Maximum oligonucleotide length calculated 1 8 Melting temperature method to be used 1 9 Output in groups of 3 nucleotides 1 9 Getting help 1 9 Viewing credits 1 10 2 Making Oligos 2 11 Calculating an RNA product 2 11 Calculating a DNA template 2 12 Saving results 2 13 3 ErrorMessages 3 14 An oligo has a corresponding matching sequence within itself 3 14 A primer has a corresponding matching sequence with a duplex 3 14 A primer has a corresponding matching sequence with the other primer 3 15 Invalid DNA template Invalid nucleotide in 3 16 Invalid RNA product Invalid nucleotide in 3 16 Some oligo has a corresponding matching sequence in another oligo 3 17 The DNA template must be longer than 40 nucleotides in order to calculate oligos 3 17 The RNA product must be longer than 40 nucleotides in order to calculate oligos 3 17 Assembly PCR Oligo Maker i GETTING STARTED ASSEMBLY PCR OLIGO MAKER MODNONONNNONNNONNNNNNNONNNONONNONONNONONNONNNNNNNNNONNNONONNONNOONOOA Assembly PCR Oligo Maker has been created to automate the design of oligodeox
7. cleotides for both steps of the two step assembly PCR synthesis method By default the program only determines assembly oligodeoxynucleotide sequences for DNA targets longer than 40 nucleotides The program works by dividing the target DNA into an even number of segments with a user defined maximum length To customize your program before determining oligos see section Customizing PCR Oligo Maker in chapter 2 1 Select DNA temp ate in the input section of the program 2 Select the order 5 3 or 3 5 of you DNA template 3 Type or copy and paste the input into the input textbox Allowable input for an DNA template is as follow e c or C for cytidine e a or A for adenosine g or G for guanosine e t or T for thymidine Nucleotides can be separated by spaces 4 Click the Determine Oligos button 5 Choose Yes if you want to add the Top17 sequence 5 TATAGTGAGTCGTATTA 3 to the beginning of your DNA sequence No does not add the Top17 sequence Assembly oligos flanking primers assembly melting temperature and flanking melting temperature will be displayed in their appropriate boxes Any warnings or errors will be displayed with popup boxes Refer to the Error section to find the meaning of an error message Assembly PCR Oligo Maker 2 12 MAKING OLIGOS Saving results SAVING RESULTS You may want to save the results obtained during a calculation All the results obtained in the outpu
8. e melting temperature for overlapping or reduce the maximum oligonucleotide length calculated Refer to the Customizing Assembly PCR Oligo Maker section in chapter 1 for more information The error window is shown in Figure 3 A primer has a corresponding matching sequence with the other primer E Java Applet Window Figure 3 The Error window Assembly PCR Oligo Maker 3 15 ERROR MESSAGES Invalid DNA template Invalid nucleotide in INVALID DNA TEMPLATE INVALID NUCLEOTIDE IN Enter a DNA template Valid nucleotides are c or C for cytidine a or A for adenosine g or G for guanosine and t or T for thymidine Nucleotides can be separated by spaces The error window is shown in Figure 4 The invalid nucleotide will be placed in parenthesis as shown in Figure 5 Invalid DNA template Invalid nucleotide in Java Applet Window Figure 4 The Error window CCCCCCCCIWICCCGGCGATCGTAGGGAAAAAAAAAAAT P Figure 5 Figure displaying an invalid nucleotide W which is placed between parenthesis INVALID RNA PRODUCT INVALID NUCLEOTIDE IN MODNONONNONONONNONNNANNONNNONONNNONNNONNONNNONNNONONNONNNONONNONNOONOOA Enter a valid nucleotide for an RNA product Valid nucleotides are c or C for cytidine a or A for adenosine g or G for guanosine and u or U for uridine Nucleotides can be separated by spaces The error windo
9. ecules Assembly PCR Oligo Maker has been created to automate the design of oligodeoxynucleotides for the PCR based construction of long DNA molecules It has been designed specifically to aid in the design of DNA molecules that are to be used for the production of RNA molecules by in vitro synthesis with T7 RNA polymerase The input for Assembly PCR Oliao Maker is either the desired DNA v q gt Java Applet Window Figure 7 The Help window Assembly PCR Oligo Maker 1 9 GETTING STARTED VIEWING CREDITS Viewing credits This option shows the information about the version of the program and its authors 1 Click Help gt About to display the credits window as shown in Figure 8 Assembly PCR Oligo Maker was designed and written by Roman Rydzanicz amp under the supervision of Professor Philip Johnson for CHEM4000 3 0 at York University in Toronto Canada Also special thanks to x Sharon Zhao for all her help All the rights belong to the author The program was conceived durina the winter semester of 2004 Java Applet Window Figure 8 The About window Assembly PCR Oligo Maker 1 10 MAKING OLIGOS CALCULATING AN RNA PRODUCT The simplest use of the program is to determine the DNA sequence needed to produce a particular RNA molecule First the program determines the target DNA sequence to be produced and then it computes the necessary oligodeoxynucleotides for both steps of the two step assembly PCR
10. imum oligonucleotide length calculated Choose the length of the oligonucleotides to be calculated The default value is 70 When you choose a smaller nucleotide length more nucleotides will be obtained 2 Choose from 40 50 60 or 70 nucleotides in length Assembly PCR Oligo Maker 1 8 GETTING STARTED Getting help Melting temperature method to be used Choose this method for melting temperature calculations 2 Choose either the Basic or the Nearest Neighbour method The formulae for each method used are shown below Basic Tm C 2 A T 4 G C Nearest neighbour Tm C 1000AH AS RIn DNA 4 273 15 Nearest neighbour 3 Type the monovalent cation concentration a value between 0 and 10 M The default value is 50 0 nM Also type in the DNA concentration a value between 0 and 1 M The default value is 0 5 mM Output in groups of 3 nucleotides Choose whether to display the nucleotides in groups of 3 s separated by a space 2 Check the Output in Groups of 3 Nucleotides checkbox to display the nucleotides in groups of 3 s If you don t check this box the output oligos will not be separated by a space every 3 nucleotides GETTING HELP Ce ee ee eee eee ee ee ee This option displays a non searchable text version of this manual 1 Click Help gt Help again to open the help window as shown in Figure 7 Assembly PCR Oligo Maker A Tool For Designing Oligodeoxynucleotides For Constructing Lang DNA Mol
11. king primers the assembly melting temperature and flanking primer melting temperatures will be displayed once the green Determine Oligos button is pressed sembly PCR Oligo Maker Figure 3 The Assembly PCR Oligo Maker interface Assembly PCR Oligo Maker 1 5 GETTING STARTED Clearing fields Figure 4 shows the File menu which includes Clear all fields Customize Show all results and Exit Clear all fields Customize Show all results Exit Clears all textboxes and resets all radio buttons to default Allows the user to customize Assembly PCR Oligo Maker Displays all results in a text box so you can copy and paste them into another application Closes the program and returns to the web browser Assembly PCR Oligo Maker gif Help Clear all fields Customize Show All Results Exit Figure 4 The Assembly PCR Oligo Maker s interface depicting the File menu Figure 5 shows the Help menu which includes He p and About Help About Displays help Shows the information about the version of the program and its authors Assembly PCR Oligo Maker File EY Help About Type Figure 5 The Assembly PCR Oligo Maker s interface depicting the Help menu CLEARING FIELDS This option resets all radio buttons to default values and clears all textboxes of input and output You should use this option when you want to erase all previous input and output in order to avoid co
12. nfusion 1 Click File gt Clear all fields Assembly PCR Oligo Maker 1 6 GETTING STARTED Customizing Assembly PCR Oligo Maker CUSTOMIZING ASSEMBLY PCR OLIGO MAKER Whenever you want to design oligodeoxynucleotides outside normal PCR conditions you should use this option to input your reaction conditions You can customize Assembly PCR Oligo Maker in the following ways e select the acceptable melting temperature for overlapping select the assembly annealing temperature e select the maximum oligonucleotide length e select the melting temperature method to be used in its calculations e select the output in group of 3 nucleotides The window that allows you to customize Assembly PCR Oligo Maker is shown in Figure 6 1 Click File gt Customize Customize DNAoligo Properties Figure 6 Assembly PCR Oligo Maker s customize dialog box Assembly PCR Oligo Maker 1 7 GETTING STARTED Customizing Assembly PCR Oligo Maker Acceptable melting temperature for overlapping To ensure the success of assembly PCR it is necessary that the oligodeoxynucleotides only anneal where desired If an oligodeoxynucleotides can anneal in multiple ways in either an intramolecular or intermolecular fashion the subsequent PCR reactions would produce a host of undesired products The Assembly PCR Oligo Maker program tests the oligodeoxynucleotides calculated for both PCR reactions for regions of overlap outside of the desired location If a
13. reated by the program This option is not available in the other programs You thus have the option of choosing to create fewer but longer oligodeoxynucleotides than determined by other programs Working with fewer oligodeoxynucleotides means that the process of dissolving and diluting them and setting up the assembly PCR reaction is simplified and that fewer opportunities for human error are available during the experiment Finally the output of Assembly PCR Oligo Maker is very clear it lists the oligodeoxynucleotides needed for the assembly PCR reaction and the two oligodeoxynucleotides needed for the second PCR reaction as well as providing Assembly PCR Oligo Maker 1 1 GETTING STARTED Target andience the predicted melting temperature values All the oligodeoxynucleotides in the output are listed 5 to 3 which is a form that is suitable for cutting and pasting the sequences into an email or a web form for ordering oligodeoxynucleotides from the vendor of your choice TARGET AUDIENCE Ce ee ee eee ee ee ee The intended audience of this user manual is any person wishing to synthesize a DNA template or an RNA product for research purposes and wants to simplify the work by using a computer application such as Assembly PCR Oligo Maker Assembly PCR Oligo Maker is freely available at http publish yorku ca pjohnson AssemblyPCRoligomaker html It is assumed you have prior knowledge of biology and DNA POLYMERASE CHAIN REACTION
14. stretch of nucleotides is found to overlap at a region outside of the desired site the program calculates a Tim value for this region of overlap If the Tm value of the overlapping region detected is greater than the defined Tm threshold a warning appears notifying you that an undesired overlapping region was detected The region is also flagged in the results window You can then make changes to the sequence of the desired PCR product or ignore this warning and go ahead and attempt the PCR reaction despite the presence of an unwanted overlap region Alternately upon detection of an undesired region of overlap you can choose to calculate oligodeoxynucleotides with a smaller or greater maximum length in order to try to break up the region of unwanted overlap Choose the acceptable melting temperature for overlapping between the oligonucleotides the primers and the duplex Allowable input is an integer between 30 and 45 C inclusive The default value is 40 C 2 Type an integer between 30 and 45 inclusive The program will not accept values outside this range and will display an error Assembly annealing temperature Choose the assembly temperature during which the PCR reaction will occur For optimal results the PCR reaction must be performed between 50 and 60 C inclusive The default value is 55 C 2 Type in an integer between 50 and 60 inclusive The program will not accept values outside this range and will display an error Max
15. synthesis method By default the program only determines assembly oligodeoxynucleotide sequences for DNA targets longer than 40 nucleotides The program works by dividing the target DNA into an even number of segments with a user defined maximum length To customize your program before determining oligos see section Customizing PCR Oligo Maker in chapter 2 1 Select RNA productin the input section of the program 2 Select the order 5 3 or 3 5 of your RNA product 3 Type or copy and paste the input into the input textbox Allowable input for an RNA product is as follow e c or C for cytidine e a or A for adenosine e g or G for guanosine e u or U for uridine Nucleotides can be separated by spaces 4 Click the Determine Oligos button 5 Choose Yes if you want to add the Top17 sequence 5 TATAGTGAGTCGTATTA 3 to the beginning of your DNA sequence No does not add the Top17 sequence DNA sequence assembly oligos flanking primers assembly melting temperature and flanking melting temperature will be displayed in their appropriate boxes Any warnings or errors will be displayed with popup boxes Refer to the Error section to find the meaning of an error message Assembly PCR Oligo Maker 2 11 MAKING OLIGOS Calculating a DNA template CALCULATING A DNA TEMPLATE You can also use the program to synthesize a DNA template Assembly PCR Oligo Maker computes the necessary oligodeoxynu
16. t section of the program are shown in a textbox for you to copy and paste into your favourite application Also a visual representation of assembly oligos is shown at the bottom of the window as shown in Figure 1 Input DNA template 5 IAGTGGAATTCATAATAC GACTCACTATAGGGAGAGTGTGACGCTCCTGATGAGTCCGTGAGGACGAAACGGTATCTAGA 2 assembly oligos 5 AGTGGAATTCATAATACGACTCACTATAGGGAGAGTGTGACGCTCCTGATGAG 3 ength 53 5 GACGGTATCTAGATACCGTTICGTCCTCACGGACTCATCAGGAGCGTCACAC 3 ength 52 Flanking primers 5 AGTGGAATTCATASTACGACTCACTATAG 3 ength 29 5 GACGGTATCTAGATACCGTTTCG 3 enath 23 x Visual Representation Of Assembly Oligos 5 AGTGGAATTCATAATACGACTCACTATAGGGAGAGTGTGACGCTCCTGATGAG 3 E CACACTGCGAGGACTACTCAGGCACTCCTGCTTTGCCATAGATCTATGGCAG 5 E Java Applet Window Figure 1 Assembly PCR Oligo Maker window displaying all the results in one single textbox Also a visual representation of assembly oligos beneath Assembly PCR Oligo Maker 2 13 ERROR MESSAGES AN OLIGO HAS A CORRESPONDING MATCHING SEQUENCE WITHIN ITSELF During oligo determination if the program finds a region in one oligo that could possibly anneal to a region in the same oligo this could be troublesome during a PCR reaction To correct this situation reduce the acceptable melting temperature for overlapping or reduce the maximum oligonucleotide length calculated Refer to the Customizing Assembly PCR Oligo Maker
17. w is shown in Figure 4 The invalid nucleotide will be placed in parenthesis as shown in Figure 5 Assembly PCR Oligo Maker 3 16 ERROR MESSAGES Some oligo has a corresponding matching sequence in another oligo SOME OLIGO HAS A CORRESPONDING MATCHING SEQUENCE IN ANOTHER OLIGO During oligo determination if the program finds a region in one oligo that could possibly anneal to a region in another oligo this could be troublesome during a PCR reaction To correct this situation reduce the acceptable melting temperature for overlapping or reduce the maximum oligonucleotide length calculated Refer to the Customizing Assembly PCR Oligo Maker section in chapter 1 for more information The error window is shown in Figure 6 Eome oligo has a corresponding matching sequence in another oligo Use the Show All Results option in the File menu to find the matching regions enclosed in Those overlapping regions have a melting temperature of 44 25 C Dividing the DNA template into smaller Y oe Java Applet Window Figure 6 The Error window THE DNA TEMPLATE MUST BE LONGER THAN 40 NUCLEOTIDES IN ORDER TO CALCULATE OLIGOS Enter a DNA template that is at least 40 nucleotides long Since there is no point in determining oligos for such a short DNA template the program s algorithm will not accept such a short input THE RNA PRODUCT MUST BE LONGER THAN 40 NUCLEOTIDES IN ORDER TO CALCULATE OLIGOS ee ee ee ee ee ee ee ee
18. ynucleotides for the PCR based construction of long DNA molecules This application is designed specifically to aid in the design of DNA molecules that are to be used for the production of RNA molecules by 7 vitro synthesis with T7 RNA polymerase The input for Assembly PCR Oligo Maker is either the desired DNA sequence to be made or an RNA sequence If RNA is the input the program first determines the DNA sequence necessary to produce the desired RNA molecule The program then determines the sequences of all the oligodeoxynucleotides necessary for a two step assembly PCR based synthesis of the desired DNA molecule The output oligodeoxynucleotide sequences are designed to have a uniform melting temperature and are checked for regions of overlap outside of the desired priming regions necessary for the PCR Assembly PCR Oligo Maker has several advantages over similar applications that are currently available These advantages are in addition to the ability of Assembly PCR Oligo Maker to handle RNA as an input and add the top17 sequence to determine the DNA sequence needed for RNA production While this is a trivial process the use of Assembly PCR Oligo Maker does remove the human element from this task which can inadvertently introduce sequence errors into the final product The major advantage of using Assembly PCR Oligo Maker is that you have the option of determining the maximum length of oligodeoxynucleotides for assembly PCR that are c
Download Pdf Manuals
Related Search