Troubleshooting the GFP-tagging gene knockout (GGKO) method for
Contents
1. NL fakulteten SLU Sveriges lantbruksuniversitet Uppsala Sammanfattning Ett f rs k gjordes att GFP markera AvrLm och AvrLm4 7 proteinerna via GFP tagging gene knockout GGKO vektor systemet som utvecklats av Saitoh et al 2008 Syftet var att utr na om genprodukterna fran dessa gener terfinns inne i v rdv xten under infektionens gang Inga pETHG target KO vektorer genererades under projektets gang Via analys av resultat fran rutinm ssiga kontroller i experimentet samt tester av vissa steg begr nsades de potentiella kloningsproblemen till transformeringsteget med viss tvekan med avseende p om uppstr msflankerande regionen ligerades till pETHG eller ej P grund av ett misstag anv ndes fel vektor insert f rh llande i ligeringsreaktionen De rekommenderade 1 1 1 5 f rh llandena b r s ledes anv ndas F r att f rhindra den potentiella upptagningen av tomma pETHG under transformeringen kan pETHG behandlas tv g nger med restriktionsenzymen d rtill kan linj ra vektorer separeras fran obehandlade vektorer via gel extraktion Det senare kan ven utf ras p ligeringsprodukten Allm nna f rb ttringar innefattar Sekvensera PCR produkten samt avl gsna potentiella restriktionsenzym inhibitorer anv nda den maximala inkubationstiden f r restriktionsenzym ut ka koloni screeningen h ja spektinomycin koncentrationen samt testa olika bakteriestammar f r transformeringen Abstract An attempt was made to GFP2. The results for the DFRs are presented in Figure 4 As is evident the bands in the lanes of the putative pETHG target KO vectors are visibly larger than the empty pETHG vector Although all three bands are approximately of the same size despite differing insert sizes is explained by the fact that the size difference between the inserts is very small being at the largest circa 86 bp Hence the ligase enzyme appears to have been active For the UFRs the situation is more ambiguous For these inserts the test was performed a total of three times and each product analysed twice on 1 agarose gels without any results indicating the presence of vector at all in the ligation solutions In other instances the gel electrophoresis result was unreadable putatively due to unequal distribution of agarose in the gel Hence the success or failure of the UFR ligation cannot be ascertained and remains unclear Another important point is the amount of vector and molar ratio of insert The T4 DNA ligase Fermentas activity is optimal at a vector concentration of 1 5 ng ul adding up to 20 100 ng in a 20 ul solution and a molar ratio of 1 1 to 1 5 which for a vector of circa 4 kb and inserts with a size varying from circa 0 4 to 0 65 kb adds up to 2 10 ng or 3 25 16 25 ng of insert http www promega com techserv tools biomath calc06 htm In a 20 ul solution this is a concentration of 0 1 0 5 ng ul or 0 16 0 8 ng ul Due to mistaking the amount of
3. be absolutely certain as to the identity of the product or to determine if any mutations have occurred sequencing the PCR product could still be performed The specificity of the primers was tested on empty pETHG vectors using the same protocol as for the pJET1 2 vectors The PCR produced non specific products of sizes nearly or approximately corresponding to the sizes of AvrLm4 7 AvrLm6F and AvrLm4 7 F for the UFR and AvrLm6 AvrLm6F and AvrLm4 7F for the DFR data not shown Hence doubt as to their specificity for the pJET1 2 vectors is still warranted Figure 2 A PCR amplification of UFRs analysed on a 1 0 Figure 2 A PCR amplification of DFRs analysed on a agarose gel From left to right AvrLm6 AvrLm4 7 AvrLm6F 1 0 agarose gel From left to right AvrLm6 AvrLm6F and AvrLm4 7F M denotes the size marker and AvrLm4 7F M denotes the size marker GeneRuler 1 kb Plus DNA Ladder Fermentas GeneRuler 1 kb Plus DNA Ladder Fermentas Restriction Reaction The lack of product from the putative pETHG target KO vectors in the restriction digestion analysis could be a result of either or both instances of non functional restriction enzymes and non specific restriction digestion Whether or not these errors should be considered was tested on the pJET1 2 vectors as well as pETHG AvrLm4 7 DFR using the restriction protocol in Materials and Methods adding modified incubation times of 1 hr both vectors 8 hr and 16 hr only pETHG AvrL
4. of pellet in the remaining supernatant and cultivation on solid LB media 50 ug ul spectinomycin at 37 C for approx 24 hr Analysis Eight colonies per transformant were selected and cultivated as described in Stock Vector Preparation The vector DNA was analysed for inserts by a restriction digestion following the protocol in Restriction Enzyme Treatment Gel Electrophoresis All PCR products products of the restriction enzyme treatment and ligation reactions were analysed by gel electrophoresis at 90V for 30 min PCR and restriction products or 60 min ligation products on 1 agarose gels 10 GelRed Empty pETHG vectors were used as controls for the analytical restriction digestion and ligation analysis pETHG AvrLm4 7 DFR was included as a control for the UFRs Sequencing Sequencing was performed on vector material extracted from transformants at Macrogen Europe using M13F primers for UFRs and M13R primers for DFRs Results amp Discussion Cloning Strategy The principle of GGKO is to enable visual determination of spatial gene expression via exchanging a chosen gene or a part of it with a green fluorescencent protein GPF encoding sequence whilst maintaining native expression 14 It is based on the vector pair pETHG and pCAMBIA Bar Rfa The system uses the Upstreams Flanking Region UFR and the Downstreams Flanking Region DFR of the gene in question These regions contain promotors signal sequences and other moti
5. 750 07 Uppsala 20
6. B napus to L maculans range from hypersensitivity responses to the development of necrotic non sporulating lesions 1 AvrLm6 and AvrLm4 7 were the second and third avirulence genes respectively to be genetically outlined in L maculans 6 10 They are located in the gene clusters AvrLm1 2 6 and AvrLm3 4 7 9 which occur in AT rich gene poor and recombination deficient genomic regions AvrLm6 has an ORF and preprotein with predicted sizes of 435 bp and 144 aa including a 20 aa N terminal signal peptide 6 For AvrLm4 7 these are 432 bp 143 aa and 21 aa 10 Both gene products are as can be expected cysteine rich AvrLm6 having six and AvrLm4 7 eight residues Their expression peaks seven days post infection after which it slowly decreases measured in cotelydons relative to B tubulin Neither gene has significant matches for homology in public DNA sequence databases nor do they share homology with other fungal avirulence genes or with each other This is also a typical trait of fungal avirulence genes AvrLm6 corresponds to Rlm6 and AvrLm4 7 uniquely corresponds to both R m4 and Rlm7 6 10 The objective of this bachelor project was to determine whether the gene products of AvrLm6 and AvrLm4 7 are secreted into the plant during infection To determine this the GFP tagging gene knockout GGKO vector system developed by Saitoh et al 2008 was employed Knowledge of where the avirulence gene products are secreted would allow the determin
7. EX0689 Independent project degree project in Biology C 15 HEC Bachelor s thesis 2011 Biotechnology Bachelor programme ISSN 1651 5196 Nr 119 SLU Troubleshooting the GFP tagging gene knockout GGKO method for the Leptosphaeria maculans effectors AvrLm6 and AvrLm4 7 Ries Y y Bachelor degree project in biology Carl Fredrik Johnzon Department of Plant Biology and Forest Genetics 2011 06 08 Swedish University of Agricultural Sciences 2011 EX0689 Sj lvst ndigt arbete i biologi 15 hp Kandidatarbete 2011 grund C Carl Fredrik Johnzon ISSN 1651 5196 Nr 119 Lokalisera och avhj lpa fel i GFP tagging gene knockout GGKO metoden f r Leptosphaeria maculans effektorerna AvrLm6 och AvrLm4 7 Troubleshooting the GFP tagging gene knockout GGKO method for the Leptosphaeria maculans effectors AvrLm6 and AvrLm4 7 Keywords Leptosphaeria maculans AvrLm6 AvrLm4 7 GFP GGKO Cover picture Swedish Board of Agriculture Picture Archive Picture 50007 173 jpg Louis Vimarlund Year of publication 2011 Online publication http stud epsilon slu se Supervisor Hanneke Peele Department of Plant Biology and Forest Genetics Swedish University of Agricultural Science Uppsala Sweden Examiner Christina Dixelius Department of Plant Biology and Forest Genetics Swedish University of Agricultural Science Uppsala Sweden Institutionen for vaxtbiologi och skogsgenetik Genetikv gen 1 Box 7080 750 07 UPPSALA
8. GGTGGGTCTGGTTGAAAATAAGGTCTAGCCTAAGT TAGAATAGGTTGAAACTTGATTTGGGTGGGATAATGGTATAAAGAAGGGGAGGATCAT AGGAAAGAATGTTAGGCAACTCAACACTTAATTCTCCAAGATATCTTATTAATGGAAA TTTCTATCCCTTAATCTATTATTTAATCTAGTTTGTTTATCATAAGATACCCTATACTAA GACTTGCCCCTTACCCTTCTCCTTGTTTAAATGGATTACTCTCCTTAACAGTTCACTATA GCTCCCAATACTAATCCCTATACCTATGCGCTTATTATAACTCTAAAGTTACCTTTTAGT AGCAAATCTACCGCCTAAATTAGCGCTACTATAGGTATTTTACTACACAATATTAACTT AATCTATAGTAGAGCCTACTATTATAGCTTTAAGCAGAATTTA Full Gene UFR AATCTTAACGCTACTCGCTCTCTCTATCCCTACAATTAC AGCTTGTAGAGAGGCCTCAATATCTGGAGAAATTCGCTATCCTCAAGGCACTTGTCCCA CAAAGACTGAAGCTTTGAATGATTGTAACAAAGTAACGAAGGGCTTAATTGACTTTAG TCAATCGCATCAACGTGCCTGGGGTATAGATATGACGGCCAAAGTCCAATGTGCGCCC TGCATAACTACCGACCCTTGGGATGTAGTTCTTTGCACTTGCAAGATCACGGCGCATAG ATATCGAGAATTCGTTCCCAAAATTCCCTATAGCAGCTTTAGCTCAGCACCTGGAGTTA TATTTGGCCAGGAGACTGGTTTAGACCATGACCCTGAATGGGTTGTTAACGTAAGATTA AATATTCTACTAGGAACCTAAGACTAACTACAAATAGATGAAA Full Gene DFR CTATAGGCTTAGGTTAGGTTTAGGTTACATAGGCTATA GGCTTAGGGTAGGGTTAGGTTGCATAGACCTTAGGCTTAGGTTAGGTCTTACGTAAGTA GGTTAGGGTTAGGGTTAGGTTACACAGGCTATAGGCTTATGTTAGGTATAGGGTCTTAC GTAATCTACTTATAGTATATATATAATAGGCATGTATCTTAGGTATCTATTATAGGTGT AACAATAAGGTAGAATTGCCTGCCTATTATTCTATGCCAAGTTAGGCCTAATAAAGGC 18 CCGACTCACTAATATATATAGAGAGCAGCTCGCCTATAGTTAGGATAGGCATGTTCCTC TTATCCTTTTCTACAAGACCTATAAGTATAGGAATCTTATCCTTTTCTATA TAGAGGEGGE 19 ISSN 1651 5196 Nr 119 Uppsala 2011 Institutionen for vaxtbiologi och skogsgenetik Uppsala Biocenter SLU Box 7080 Genetikvagen 5
9. TCAAGCTAGCCCGTCTCAAGTGCGGCGAACCCAACTCTAGGTAGCCTAACAGG TATCTAACGTTGAATCTAGCGGCTTTATTATTTGCCTAGCATTTTCGCGAGTTCCTTAAT TATGTAGATAGAACTTTGACGAAAAGTGCTAATTAACGCAAGGTCGCGTAGCATTGAA CCTAAGCAGTCAAGAAATGACCCTAGATGTAAGATCGAAACGGAAAGGTTAGTGCAG CCTATCCACTGTTAGCCTGTGCTCC 17 AvrLm4 7 UFR GTATCTAGCAACCTTATGTATCTAGTAAGCTTATGTATCTAGTAAGCTTATGTATCTAG TAAGCTTACTATCGCATACCAAACATTAGGCAAAAGTAAACCCTATTACCCTACCCTAA TAAGTTAATATATATGGTGGGATATTAATTAGATATTAATATTGCGATACTTACTTATC TAGTAACCTTATGTATGTAAGCTTACTTAATAGCAACTAATATTCTTCTAGGTTATAATT AGCTTAATATCTATGTTATAAGCCTTACTTTACCTATATTAGTTAGTAACCTAGACCAA CCATATCTATATTTACGTGTGCGTAGTAGATAAGTAAGCTTACTAGAGTTAATGCCTAT TTTTGTAACACTATACTATACTTATTTGCTACACTAGATTATACTAAACTAGGTTAAAA TTAATTTGCATATACCAATTAAGTCCTATAAATCCAAGCGCTATCTCTATAATTATAAT TTAACCAGCTACCTTCTTCTATCGCTAAGCTTGCAAAACGCATTTAATAACCTAATTAC TACTACCTTGTTAATATTAGATATTGCTAAAATAAGCATGTAAGTTATATCTAATCTTA CAAGATAAGTAGCGCTAATAGGGAAAGCTACTCTACATGGAAGCTTACTAGATAAGCA ATCTTACTAGATAGGAGAACCCTACTAGATAAGTAAGCTTGCTAGATAAGTAATCTTA CTAGATAGAAGAACCCTGCTAGATAGGTAAGCTTACTTGATAAGTAATCCTACTAGAT AGGAGCACCCTACTAGTAAGAATAATTATTACATAGAGAAGTTCTATATAATGAGGAT ATAGAACAAAGATATTAAGACACAAGTTACAACGACAAGCTTATTTAACAATCAAGTT GTTTACTCCTATTTTTGTTATATCTAACTTACTTATTAATATCTTTACTTCCACCAAGTAT AAACCCTTTGACAGTTAACAACATGCCACTATCCCTCGAGATAATCTTAACGCTACTCG CTCTCTCTATCCCTACAATTACAGCTTGTAGAGAGGCCTC DER GCGGTTGATCCATCAGCCTAACTTCCTTGACCCACGCTT ATTTTAAAAGATATAGATAGTAATAGCAATAGTCTACATACTTAATCTTTTAGTATTTT TACTCTAATATTGTGCCTTGGCAT
10. TTGTTCTCGGTTAAATAGATACATTAGGTCTCACAATCTAAAGTTAAATAAGCC GCTAGTAGTAACCTGAACTAATCTAAATTATTTCTAGCTTTA AACTTTCATCGCATTTAATCTTCAATTTGTCTGTTCAAGTTATGGATATATATTAAACTT GATCCCACATATTCACTTCACATTCTTAACAATCTATAAACAATCTTCGCACGTTCCAA AGCCCTATTTATAACCTAGCATGGTGATTTACCTACCCCTATACCTTCTCGTCTTAGGA ATAGCGTACGTGTCTCTCTTAACGCTACACTAAACGCACTTTTAAACCCAATCTAGGAC TACCACGATTAGTCAGCCTCATT DER ACTACGGTTCAAAACTGGTTTACAGTTGCCATATTTATCT AAAGTAGACTAAGAAGTAGCTTAGGTAGAAGAAGTAAACCTAAATAGGGTTTACTATA CTATGTATTCTACTTTTACTTCTACCTCTATTAATCTACTAGTTTCCTACTAACTATTTAA GTATTTTACCCCTCCTTTCTTTAATCTTCTTTACCACCTCTATTACCACCTCTACCACTAC CTCTACCACCACCTCTATCACCACCACCACCTAAACAACCTCTATTATCACCACCTCCT ATTAGTAAAAATATTTAAACTTATTATTATGTTATATATGCGTATAGCATGAAGOTAAT Full Gene UFR TACCTTCTCGTCTTAGGAATAGCGTACGTGTCTCTCTTA ACGCTACACTAAACGCACTTTTAAACCCAATCTAGGACTACCACGATTAGTCAGCCTCA TTTGTTGTGCGCCTGCGAGAGCGGTAGACGTGATGGAGTTGACGATACCCGAACTTTG AAAGTTGTCAAAGGCACTGGAGGCAGATTTGTTTTTAGTATGTTACTAGATACAACCTA TCCTAAAATTTGCTAACACTCTAAGGCAGCAGATATTGGACAAAAGCCGAAGGCGCTC CGCACGAAGGCAACTATGTACTAGATCTGCTTCCTTTAATATATTCACTTTTTAACGCG TTCTAGGCTCATGCTATAAACGGCACTATTACGAAAAAAGGGACTAACATCCAAGCCC ATGACGATGGTCTCATCGGCGGAGAGGAGATGAACAGTTTATGTCCTGAACATTCCAC TTGCTTCTCGCCTAATCTTAAGGCCAAATCGACCCACTCCTGCGGTCCAGACGGGAAAT ATGGGTGCGTCAGCGCTTGGTTATCTGTTA Full Gene DFR GTTTATGCCGCTGAATTTGGGTGCCTAGCATAGACTGTA CTTGTGAAGAGCTCAGCTTGCTAGATAAGTACTTAGCGTGCTTGGTCGTTACCTATCAT ACTCTACGCATCCAGAAGACTAGCCATTGTCTTGTGTATAGTGTAGTAAGGGACATTTC CACCC
11. Van Der Hoorn R A L Terauchi R amp Kamoun S 2009 Emerging concepts in effector biology of plant associated organisms Molecular Plant Microbe Interaction 22 115 122 Li H amp Sivasithamparam K 2003 Breakdown of a Brassica rapa ssp sylvestris Single Dominant Blackleg Resistance Gene in B napus Rapeseed by Leptosphaeria maculans Field Isolates in Australia Plant Disease 87 752 Mendes Pereira E Balesdent M H Brun H amp Rouxel T 2003 Molecular Phylogeny of the Leptopshaeria maculans L biglobosa species complex Mycological Research 107 1287 1304 Parlange F Daverdin G Fudal I Kuhn M L Balesdent M H Blaise F Grezes Besset B amp Rouxel T 2009 Leptosphaeria maculans avirulence gene AvrLm4 7 confers a dual recognition specificity by the Rlm4 and Rlm7 resistance genes of oilseed rape and circumvents RIm4 mediated recognition through a single amino acid change Molecular Microbiology 71 4 851 863 Peele Hanneke Swedish University of Agricultural Sciences the Department of Plant Biology and Forest Genetics Personal Communication Rep M 2005 Small proteins of plant pathogenic fungi secreted during host colonization FEMS Federation of European Microbiological Societies Microbiology Letters 253 19 27 Rouxel T Grandaubert J Hane J K Hoede C van de Wouw A P Couloux A Dominguez V Anthouard V Bally P Bourras S Cozijnsen A J Ciuffetti L M De
12. arget KO DFR vector bands in Figure 4 The solution closest at hand to this problem is to ensure cleavage of all empty pETHG vectors during the restriction reaction However the restriction reactions were incubated for the maximum time of 16 hr recommended by the manufacturer incubation times longer than this risk losing or reducing enzyme specificity An alternative to a longer reaction time is a double reaction protocol whereby the product of an initial restriction reaction is purified with a PCR purification kit and subsequently treated with restriction enzymes a second time Larger volumes of 13 pETHG solution would be required to compensate for the loss of vectors during purification The drawback is the time required A far less time consuming alternative available is to perform a gel extraction of the vector DNA The GeneJET Gel Extraction Kit Fermentas was tested on both linear and circular pETHG vectors with subsequent successful transformation albeit with reduced colony yield compared to transformations using the vectors directly taken from the same stock solution data not shown The same gel procedure could also be used to separate ligated vectors from any remaining empty vectors Due to the reduced transformation efficiency working with higher volumes and concentrations are likely necessary Another improvement to the protocol would be to expand the colony screening from eight to as many colonies as possible depending on the n
13. ation of which host proteins they interact with and further our understanding of the resistance response pathway in B napus Materials and Methods Fungal Isolate and Bacteria Strains The French L maculans isolate IBCN74 alternative name PHW1245 was used All vectors were propagated in the E coli strain DB3 1 and transformations were performed using DHS a Table 1 Overview of flanking regions UFR DFR full genes pETHG vectors primers restriction enzymes buffers and buffer dilution used in this project Gene Size Vector Primers Enzymes Dilution UFR 360 bp pETHG UFR AvrLm6 BamHI Rv Sall BamHI 2X AvrLm4 AvrLm4 UFR AvrLm4 7 Sall Fw Yellow Tango 7 UFR 1635 bp 7 DFR UFR AvrLm4 7 BamHI Rv Sall BamHI 2X UFR 596 bp pETHG UFR 4vr m full BamHI Rv Sall BamHI 2X AvrLm4 UFR AvrLm4 7full Sall Fw 7F beska UFR AvrLm4 Yellow Tango UFR 493 bp pETHG 7full BamHI Rv Sall BamHI 2X DFR 387 bp pETHG DFR AvrLm6_ KpnI Rv Cfr421 KpnI Buffer Blue 1X DFR_ AvrLm6F AvrLm full_Cfr421_ Fw DER 473 bp pETHG DFR 4vr m full KpnI Rv _ Cfr421 Kpnl Buffer Blue 1X AvrLm4 DFR AvrLm4 7F 7full Cfr421 Fw DER 443 bp pETHG DFR 4vr m4 7full KpnI Rv Cfr421 KpnI Buffer Blue 1X Genetic Material amp Vectors The UFRs DFRs full genes primers restriction enzymes and buffers used in this bachelor project are summarised in Table 1 For primer sequences and t
14. ation the E coli strains DB3 1 pETHG target KO and DH5 a pCAMBIA target KO are used After transformation bacteria are grown on solid media Selection for positive transformants is based on antibiotic resistance For pETHG target KO specintomycin Spec is used and kanamycin Km for pCAMBIA target KO For the latter ccdB acts as a positive marker by killing bacteria carrying empty vectors thus only allowing growth of bacteria where ccdB has been inactivated by insertion ccdB is a lethal gene that prevents DNA replication by targeting DNA gyrase http openwetware org wiki CcdB Positive transformants are harvested propagated in liquid media analysed by restriction digestion and used for the subsequent steps pCAMBIA target KO can then be introduced into the Agrobacterium tumefaciens strain C58 via calcium chloride transformation and subsequently used to transform L maculans In successful transformants homologous recombination has occurred between the UFRs and DFRs of the vector and those in the genome of the wild type fungi thereby replacing them and the sequence inbetween If successfully performed the result is a GFP tagged by the N terminal signal peptide first construct or an effector protein GFP tagged at the C terminus second construct The knockout mutant is resistant against hygromycin HPT If the vector sequence is inserted at random into the genome the resulting ectotopic transformant will be resistant to both hygrom
15. elease to the development of lesions generally range from mid spring to late autumn 15 Crop yield losses incurred by blackleg epidemics vary in severity Documented losses of oilseed rape yield range from 100 4 8 to between 30 50 to lt 10 13 Host interaction with LZ maculans complies with the gene for gene concept 5 Resistance responses are elicited by direct or indirect interactions between resistance genes R m in B napus and the corresponding avirulence genes AvrLm in the pathogen 3 The avirulence genes are named after the corresponding resistance gene and vice versa Twelve R m genes Rlm1 9 LepR1 3 2 16 and nine AvrLm genes AvrLml 9 are known 3 These genes vary amongst cultivars and pathogen races 3 Avirulence gene products or effectors are known or are expected to be secreted into the host plant tissue Examples of fungal plant pathogen secreted effectors include the ToxA protein of Pyrenophora tritici repentis that is secreted into the host cell and the Avr proteins of Cladosporium fulvum which are secreted into the apoplast 7 The localisation of effectors from L maculans in B napus is currently unknown Effectors are characterised by their small size and ability to either facilitate infection virulence factor toxins or elicit resistance responses avirulence factor elicitor 7 the AvrLm genes have the latter function In ascomycetes they are usually cysteine rich 12 Resistance responses in
16. entas and deionised water see Table 1 for enzymes buffers and buffer dilution For each reaction the UFR and DFR concentration ranged between circa 85 120 ng ul The pETHG concentration was approx 210 ng ul The reaction conditions were 37 C for circa 16 hr followed by deactivation at 80 C for 20 min Prior to ligation pETHG were treated with 1 u of Shrimp Alkaline Phosphatase SAP for 30 min at 37 C followed by inactivation at 80 C for 15 min Ligation For the ligation reaction 2 ul of vector and 2 ul of UFRs or DFRs were used per reaction The reaction mixtures contained 16 ul per reaction 1 u of T4 DNA ligase 10X Ligation Buffer for T4 DNA ligase and deionised water The vector concentration was approx 21 ng ul The UFR and DFR concentration ranged between circa 25 35 ng ul In the total reaction the reaction buffer was diluted to 2X The reaction conditions were 22 C for approx 1 hr followed by deactivation at 65 C for 10 min Transformation 100 ul of liquid competent DB3 1 or DH5 a bacterial solution was added to 10 ul of the ligation reaction mixtures and incubated on ice for 30 min The mixture was subsequently heat shocked at 42 C for 1 min water bath mechanical mixing and immediately returned to the ice for 2 min 900 ul of SOC media 2 M MgCI2 2 M Glucose was added followed by incubation at 37 C on shaker for 1 hr 150 200 rpm This was followed by centrifugation at 5000 rpm for 5 min resuspension
17. erials and NISSAN ata 7 3 Res lts amp DISCUSSION Se 9 4 Rees Ez bi Goes ae 15 Appendix PS MANN 16 gt o Appendix AAA AS LASER SIA ows 17 Introduction The commercially important plant oilseed rape Brassica napus is susceptible to the disease stem canker or blackleg 15 caused by the ascomycete Leptosphaeria maculans http pir uniprot org taxonomy 5022 Different isolates of L maculans are classified into one of three pathogenicity groups based on their interactions with the B napus cultivars Wester Quinta and Glacier they are further subdivided into one of six races based on the cultivar Jet Neuf L maculans is thus said to be a species complex 3 The fungi occurs world wide 9 and its genome was recently published 13 The life cycle is complex with many regional and seasonal variations in regards to the length of the different stages Prior to infection the fungus is a sexually reproducing saprophyte living on plant debris Ascospores and conidia are infectious and germinate in humid or wet conditions As a pathogen it endophytically colonises the host plant after entering it through stomata or wounds Symptoms in the form of necrotic lesions arise during necrotrophic life stages that occur immediately after infection and up to 9 months later in the stem and pods In seedlings or severe infections lesions may completely sever the stem Seedlings are particularly susceptible to infection The period from ascospores r
18. fs related to gene expression and gene product localisation Figure 1 provides a schematic overview of the system and its application in this bachelor project In this project an attempt was made to produce two different constructs for each gene In the first the UFRs include the S UTR and a signal peptide sequence for AvrLm6 the signal peptide is divided into two exons separated by an intron The DFRs include the 3 UTR 11 In the second construct the UFR was replaced by the full AvrLm gene and the DFR by a downstream sequence in the genome The UFRs were provided with restriction sites for BamHI and Sall and the DFRs with restriction sites for Cfr421 and KpnI The pETHG vector contained the same restriction sites The inserts were cloned into pJET1 2 vectors introduced and propagated in bacteria PCR was then used to amplify the inserts Amplified inserts and pETHG are treated with the restriction enzymes and ligated together The UFRs and DFRs are cloned into the pETHG vector in this way separately both additions being followed by introduction and propagation in bacteria see below The resulting vector construct pETHG target KO is used in LR Gateway recombination with pCAMBIA Bar Rfa which generates the final vector construct pCAMBIA target KO This involves homologous recombination between attL1 and attL2 in pETHG target KO and attR1 and attR2 in pCAMBIA Bar Rfa pCAMBIA target KO is then introduced and propagated in bacteria For propag
19. grave A 1 Dilmaghani A 1 Duret L Fudal I Goodwin S B Gout L Glaser N Linglin J Kema G H J Lapalu N Lawrence C B May K Meyer M Ollivier B Poulain J Schoch C L Simon A Spatafora J W Stachowiak A Turgeon B G Tyler B T Vincent D Weissenbach J Amselem J Quesneville H Oliver R P Wincker P Balesdent M H amp Howlett B J 2011 Effect diversification within compartments of the Leptosphaeria maculans genome affected by Repeat Induced Point Mutations Nature Communications Article number 202 doi 10 1038 ncomms1 189 DIRECT SOURCE Saitoh K I Nishimura M Kubo Y Hayashi N Minami E amp Nishizawa Y 2008 Construction of a Binary Vector for Knockout and Expression Analysis of Rice Blast Fungus Genes Bioscience Biotechnology and Biochemistry 72 5 1380 1383 West J S Kharbanda P D Barbetti M J amp Fitt B D L 2001 Epidemiology and management of Leptosphaeria maculans phoma stem canker on oilseed rape in Australia Canada and Europe Plant Pathology 50 10 27 Yu F Lydiate D J amp Rimmer S R 2005 Identification of two novel genes for blackleg resistance in Brassica napus Theoretical and Applied Genetics 110 969 979 15 Appendix A Primer Sequences Legends v Higlighted Yellow Restriction site of SalI v Highlighted Green Restriction site of BamHI v Highlighted Red Restriction site of Cfr421 v Highlighted Bl
20. he location of restriction sites see Appendix A For UFR and DFR sequences and primer binding sites see Appendix B The UFRs DFRs and full genes were previously cloned into pJET1 2 vectors and one DFR for 4vrLm4 7 was introduced into pETHG Stock Vector Preparation Transformed stock DB3 1 E coli bacteria containing either of the two pETHG vectors were cultivated in 5 ml liquid LB media 50 ug ul spectinomycin at 37 C for no more than 16 hr The TM pp md i vectors were extracted and purified using the GeneJET Plasmid Miniprep Kit Fermentas Cells were harvested by centrifugation for 3 min subsequent centrifugations were carried out at 11050 g The kit was otherwise used according to the manufacturer s instructions PCR Amplification The PCR mixtures 45 ul reaction contained 5x Phusion Buffer 10ul Finnzymes 0 22 mM dNTPs 0 56 uM of each primer see Table 1 and 1 u of Phusion DNA Polymerase Finnzymes deionised water composed the remaining mixture For each reaction the pJET vector concentration ranged between circa 10 20 ng ul The cycling conditions were 94 C for 2 min and 30 s 30 cycles of 94 C for 30 s 55 C for 30 s and 72 C for 45 s followed by 72 C for 7 min Previously introduced by Hanneke Peele supervisor Restriction Enzyme Treatment The restriction digestion reaction mixtures 10 ul reaction contained 10 u of either restriction enzyme Fermentas 10X reaction buffer Ferm
21. hould be considered SSS 14 References 1 10 11 12 13 14 15 16 Balesdent M H Attard A Ansan Melayah D Delourme R Renard M amp Rouxel T 2001 Genetic control and host range of avirulence towards Brassica napus cvs Quinta and Jet Neuf in Leptosphaeria maculans Phytopathology 91 70 76 Balesdent M H Attard A K hn M L and Rouxel T 2002 New avirulence genes in the phytopathogenic fungus Leptosphaeria maculans Phytopathology 92 1122 1133 Balesdent M H Barbetti M J Li H Sivasithamparam K Gout L amp Rouxel T 2005 Analysis of Leptosphaeria maculans Race Structure in a Worldwide Collection of Isolates The American Phytopathological Society 95 9 1061 107 Fitt B D L Brun H Barbetti M J amp Rimmer S R 2005 World wide importance of phoma stem canker Leptosphaeria maculans and L biglobosa on oilseed rape Brassica napus European Journal of Plant Pathology 114 3 15 Flor H H 1971 Current Status of the Gene For Gene Concept Annual Reviews Phytopathology 9 275 296 Fudal I Ross S Gout L Blaise F Kuhn M L Eckert M R Cattolico L Bernard Samain S Balesdent M L amp Rouxel T 2007 Heterochromatin Like Regions as Ecological Niches for Avirulence Genes in the Leptosphaeria maculans genome Map Based Cloning of AvrLm6 Molecular Plant Microbe Interactions 20 4 459 470 Hogenhout S A
22. m4 7 DFR The results of these tests are presented in Figure 3 The restriction product bands are clearly visible for the Cfr421 and KpnI enzyme pair whilst those of BamHI and Sall are more diffuse but still clearly discernible The sizes of the bands correlate with the expected sizes of the UFRs and DFRs see Table 1 The presence of bands of the correct sizes suggests that the restriction enzymes worked and the absence of superfluous bands that they maintained specificity for both vectors However restriction reaction with an incubation time of 1 hr on pETHG AvrLm4 7 DFR vector did not produce any bands The 8 hr and 16 hr treatments did not produce different results It might therefore be reasonable to assume that even the empty pETHG vector requires longer incubation times at least for Cfr421 and KpnI The very weak bands for the products for BamHI and Sall suggest poor enzyme efficiency One reason could be that the buffer was The original protocol included Tag PCR analysis of transformant colonies this was discontinued and replaced the presented restriction digestion procedure for this reason 11 improperly diluted to 1X which gives SalI an efficiency of 0 20 100 for BamHI Another is that they exhibited the lowest possible efficiency of 50 in the 2X buffer dilution To increase the amount of digested UFR inserts it is possible to either use the longest possible incubation time 16 hr or to perform several reactions simultaneo
23. on a these colonies is sufficient evidence to prove 1 0 agarose gel From left to right AvrLm6 AvrLm6F and the transformation s success AvrLm4 7F M denotes the size marker GeneRuler kb Plus DNA Ladder Fermentas V denotes control empty pETHG Red arrows denote putative pETHG target KO vectors Purple arrows denote putative empty vectors In each and every transformation during the course of this bachelor project colonies were present for all transformants data not shown Nevertheless all analyses both the earlier Taq PCR colony analysis and the restriction digestion conducted on putative pETHG target KO vectors extracted and purified from the transformants were negative Assuming solely for the point of this discussion that pETHG target KO vectors were indeed present in the ligation mixture the error relate rather to the absorption of still empty vectors Empty vectors may still be present in the ligation mixture due to either incomplete cleavage of the vectors or failed SAP treatment and subsequent self ligation As empty vectors are more readily absorbed by bacteria in relation to vectors carrying inserts although it is debatable if the relatively minute size difference between pETHG and pETHG target kKO should cause any problems colonies resulting from a transformation using a mixed vector solution are more likely to contain empty vectors Bands that putatively correspond to empty vectors are visible above the pETHG t
24. rulence genes AvrLm6 and AvrLm4 7 are secreted into the host plant during infection No results to this effect were obtained as the inserts either failed to be cloned into the pETHG vectors or the pETHG target KO vectors failed to be introduced into the bacteria Hence no results will be presented The basis of this discussion is instead a combination of results derived from routine laboratory control procedures on one hand and tests performed to determine the functionality of different steps on the other The aim was to trouble shoot the experimental protocol see Materials and Methods 10 PCR In the initial PCR amplification the most significant errors could be the absence of amplification and non specific primer binding to the pJET1 2 vectors carrying the inserts Gel analyses of the PCR products were performed routinely to determine whether or not the amplification reaction worked The results of these for the UFRs and DFRs from the pJET1 2 vectors are presented in Figure 2 Bands of varying sizes are themselves evidence of amplification and of the absence of contamination and furthermore the bands correspond to the known sizes of the inserts see Table 1 The problem might be specificity The inserts in the pJET1 2 vectors were successfully identified by sequencing using the respective primers 11 Hence the problem of poor specificity is also solved Therefore mistakes in the PCR can be omitted from the list of possible errors Of course to
25. tag the effector proteins of AvrLm6 and AvrLm4 7 using the GFP tagging gene knockout method GGKO developed by Saitoh et al 2008 in order to determine whether or not they are secreted Successful pETHG target KO vectors were not generated The protocol was examined for potential errors Fatal errors were pinpointed to the ligation reaction and the transformation required to generate and propagate the desired vector pETGH target KO The Downstreams Flanking Region inserts were evidently successfully ligated into the pETHG vector but for the Upstreams Flanking Region inserts the results were highly ambiguous Due to a mistake too high vector insert ratios were used altering them to the recommended 1 1 1 5 is hence expedient It was reasoned that the bacteria possibly absorbed empty pETHG vectors instead of putative insert carrying pETHG target KO vectors during the transformation The procedure could be improved by digesting pETHG twice prior to ligation as well by separating linearised and uncleaved pETHG by gel extraction The latter could also be performed on the ligation product Suggested general improvements include Sequencing the PCR product and purifying it of potential restriction enzyme inhibitors use the maximal incubation time for the restriction enzymes expand the colony screening increase the spectinomycin concentration and test different bacterial strains in the transformation Table of Contents 1G SO OUCHOM A Ea 6 2 Mat
26. ue Restriction site of KpnI UFR_AvrLm6 UFR_AvrLm6_Sall_ Fw AA GCCCTCCTAGCACTAAACAA UFR AvrLm6 BamHI Rv AA GCTCTCGCAGGCGCACAACA UFR AvrLm4 7 UFR AvrLm4 7 Sall Fw AAG AAATCCAAGCGCTATCTCTA UFR_AvrLm4 7_BamHL Rv AAG GCGAATTTCTCCAGATAT UFR AvrLm full UFR AvrLm full Sall Fw AA ATGGTGATTTACCTACCCCT UFR AvrLm full BamHI Rv AAG TTGGATTTGTCCTTCCCAGT UFR 4vr m4 7 full UFR AvrLm4 7full Sall Fw AAG ATGCCACTATCCCTCGAGAT UFR AvrLm4 7full BamHI Rv AA GTCGCAACCACGAGTCCTTG DFR AvrLm DFR AvrLm Cfr42I Fw AAG GCCTTGGCTGTATTGCTACC DFR AvrLm6 KpnI Rv AAG GGGTAGAGAAGATTAGCTTC DFR AvrLm4 7 DFR AvrLm4 7 Cfr42I Fw AA TTCTTGCTACCGTCTTTGTT DFR AvrLm4 7 Kpnl Rv AAG CTTAGGAAGGAGTTTTAGTATAGG DER AvrLm full DFR 4vr m full_Cfr421_ Fw AAG TAGATTTAGCGGAGAACGTC DFR_4vr m full KpnI Rv AA ACCACAAATTATCGACGAAC DFR 4vr m4 7 full DFR 4vr m4 7full_Cfr421_Fw AA AACTACAAATTTTCGCATAGG DFR AvrLm4 7full KpnI Rv AAG GTATATAGGAGTGCGCGTCT Appendix B UFRs and DFRs Legends v Highlighted Yellow Forward Primer Binding Site v Highlighted Green Reverse Primer Binding Site v Underlined Signal Peptide Sequence AvrLm6 UFR TTACAATCTAAAGTTAAATAAGCCCTCTTGTGTTAATTATTCTCGGTCAAATAGATACA TTAGGTCTCACAATCTAAAGTTAAATAAGCCCTCCTATGTTAATTGTTCTCGGTTAAAT AGATACATTAGGTCTTACAATCTAAAGTTAAATAAGCCCTCCTGTGTTAATTATTCTCG GTCAAATAGATACATTAGGTCTCACAATCTAAAGTTAAATAAGCCCTCCTATGTTAATT ATTCTCGGTCAAATAGATACATTAGGTCTCACAATCTAAAGTTAAATAAGCCCTCCTAT GTCAA
27. umber of available colonies In order to reduce the number of colonies with innate spectinomycin resistance i e background growth the antibiotic concentration could be increased from 50 ug l to any level that is found not to be toxic to the pETHG carrying bacteria An hypothetical error source is the loss of inserts from successfully introduced pETGH target KO vectors during either of the two cultivation steps subsequent to the transformation One possible solution should that error need to be considered would be to use other suitable bacterial strains Summary The solutions and alterations suggested in the discussion above are summarised below Thus v Sequence PCR products from the pJET1 2 vectors v Purify the PCR product to ensure that no component inhibits the restriction enzymes v Use the longest possible incubation time for BamHI and Sall or perform several reactions simultaneously and pool the resulting product v Test different amounts of vector and molar ratios of inserts in the ligation to ascertain if any amount or ratio yields a better result Y Perform a double reaction on the pETHG to ensure that all vectors are cleaved v Alternatively cleaved pETHG can be separated from circular vectors by gel extraction The same can be done for ligated vectors Expand colony screening from eight to as many colonies as possible Increase the spectinomycin concentration If all the above fail switching to other bacterial strains s
28. usly and pool the result Another potential problem which was not tested for here is that some component of the PCR reaction mixture inhibits the enzymes Adding a PCR purification step should be considered just to preclude that possibility Another potential issue is a lack of structural support in the form of nucleotides upstream of the restriction site for the restriction enzymes If none is present the enzyme will be unable to bind to the DNA Two to four nucleotides should suffice according to one primer design guide http www iechs org staff Andrews files BTEC 202010 CHAPTER 6 Primer Design pdf In the primers used in this project three nucleotides were upstream of the restriction sites and hence a lack of support should not be an issue see Appendix A Figure 3 A The digested products of the pJET1 2 vectors analysed on a 1 0 Figure 3 B The digested agarose gel From left to right AvrLm6 UFR AvrLm4 7F UFR AvrLm4 7 UFR product of pETHG AvrLm4 7 AvrLm6 UFR AvrLm6 DFR AvrLm6F DFR and AvrLm4 7F DFR DFR analysed on a 1 0 M denotes the size marker GeneRuler 1 kb Plus DNA Ladder Fermentas agarose gel excised from a larger gel picture Ligation For the ligation reaction the most significant potential error is the absence of ligation due to a non active ligase enzyme Using the protocol in Materials and Methods the ligation reaction was tested on restriction enzyme treated UFRs DFRs and vectors
29. vector given in 12 the protocol for a concentration of ng ul the total amount of insert used in this project were much too high The intention was to have a ratio of circa 1 1 Table 2 presents the actual molar ratios used in this project Yet this seems to have scarcely mattered in the case of the DFRs which were evidently cloned into the pETHG vectors For the UFRs nothing can be said given that all the analyses failed Regardless another alteration to the protocol would be to dilute the PCR products so as to obtain the amounts recommended in the Fermentas protocol as well as to test different molar ratios to different vector concentrations to determine if any one gives a better result Table 2 The actual molar ratio used during the ligation reaction calculated with http www promega com techserv tools biomath calc06 htm Flanking region Full Molar ratio to gene vector AvrLm6 UFR 11 8 AvrLm4 7 UFR 6 8 AvrLm6F UFR 7 3 AvrLm4 7F UFR 9 1 AvrLm6 DER 17 4 AvrLm4 7 DFR 13 9 AvrLm6F DER 14 1 Transformation The potential error of foremost concern regarding the transformation is that the bacteria fail to absorb the vectors Considering the growth media selectant spectinomycin and resistance to that antibiotic expressed by any bacteria carrying pETHG or its derivative the presence of colonies on one hand and the extraction of the empty pETHG vectors from Figure 4 A The ligation product for the DFRs analysed
30. ycin and bialaphos Bar Mutants can thus be distinguished by cultivation on solid media containing hygromycin on one hand and hygromycin coupled with bialaphos on the other mRNA analysis can also be used to determine if the correct gene is knocked out Finally Brassica napus seedlings of both L maculans resistant and susceptible cultivars are infected Tissue samples are then analysed for GFP activity in light and fluorescence microscopes 1 SIGNAL PEPTIDE I AvrLm6 5 UTR gg INTRON gy AvrLm4 7 5 UTR TOS Full Gene AvrLm6 4 7 F Second Construct First Construct DFR Sall BamHI Ch421 Kpnl rr Caer kpal nm Introduced amp reproduced in DB3 1 LR Recombination 4 1 Introduced amp reproduced in DH5 a 2 Introduced into Agrobacterium tumefaciens Agrobacterium mediated Knockout mutant EI DER transformation Ectopic Transformant DEN Aries ENG Pope Bar H HO Der MT Figure 1 Overview of the GFP tagging gene knockout GGKO vector system and its application in this bachelor project 1 Restriction Reaction and Ligation DFRs not shown due to their simplicity 2 LR recombination between pETHG target KO and the destination vector pCAMBIA Bar Rfa 3 Agrobacterium tumefaciens mediated transformation of Leptosphaeria maculans Overview The objective of this bachelor project was to determine whether or not the gene products of the L maculans avi
Download Pdf Manuals
Related Search