Home

Knockout™ Inducible RNAi Systems User Manual

Contents

1. Trypsinize the cells and split about 1 3 into a single well of a 6 well plate The cells in this stock plate will be propagated depending upon the results of the screening assay Divide the remaining 2 3 of the cells into 2 wells of a6 well plate The following day ie once cells have attached transfect the cells with a 1 2 or 1 1 ratio of luciferase vector pSIREN RetroQ Tet Luc using the desired transfection method Change both plates to fresh media and incubate one of the wells in the presence of 1ug ml Dox After 48 72 hr assay for knockdown of luciferase activity knockdown with Inducer RLU without Inducer RLU Select clones with the highest knockdown lowest level of inducible RLU and lowest background highest level of uninducible RLU for propagation and further testing Expand and freeze stocks of each clone as soon as possible after expanding the culture Clontech Laboratories Inc www clontech com Protocol No PT3810 1 34 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual X Development of Double Stable Cell Lines A Screening pSIREN RetroO Tet shRNA Constructs It is recommended that you screen for functionality of your oligos prior to developing double stable cell lines with your recombinant pSIREN RetroO Tet shRNA constructs shRNA oligos can be screened using either the Knockout RNAi Clone and Confirm RetroO RNAI Platinum System Cat No 632456 or the Knoc
2. Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual l Introduction continued tTS System tTS tts NW WR ee binds TRE and suppresses transcription Pew V ter ENK d CMY KN in the absence of Dox Tc d REMOVE lt gt SD DOX Trans xfiption Transcription KNOCKDOWN TRE mod shRNA N TRE mod shRNA n DOX a Be jw Figure 3 Schematic of gene regulation in the inducible tTS system The suppressor tTS binds the tetO sequence in the TRE promoter region of the response plasmid suppressing shRNA expression In the presence of Dox the tTS dissociates from the TRE moa and allows activation of shRNA transcription from the downstream U6 promoter Please see Appendix and accom panying Vector Information Packets for maps and detailed vector information For this reason this inducible RNAi system is well suited for instances where the constitutive suppression of a particular gene is extremely potent or toxic to the host cell As with standard Tet systems used to control expression of mRNAs of interest the Knockout Inducible RNAi Systems have two components a regulatory protein and a Tet reponsive promoter the ac tivity of which is regulated by binding of the regulatory component In the case of the Knockout Inducible RNAi Systems the regulatory protein is
3. www clontech com Knockout Inducible RNAi Systems User Manual XII Analysis of Results and Troubleshooting Guide cont Wrong antibiotic or suboptimal antibiotic concentration not overgrow transformed cultures If planning an overnightculture inoculateas late as possibleinthe day using a 1 1 000 dilution offreshly grown stock Incubate with sufficient shaking to ensure good aeration 250 rpm and harvest the culture as early as possible the next day to prevent culture overgrowth Do notserially passageyour cultures In addition to keeping glycerol stocks of trans formed cells we highly recommend keeping DNA stocks of your pSIREN RetroO Tet constructs Verify the correct antibioticand its concentration by checking the Vector Information Packet that accompanies the pSIREN RetroO Tet vector B Poor transfection efficiency Transfection efficiency can be affected by plasmid purity or transfec tion conditions Alternatively an ineffective pSIREN construct can be misinterpreted as low transfection efficiency Poor purity of pSIREN DNA Ineffective transfection No detectable gene silencing Protocol No PT3810 1 Version No PR7Z2455 Ensure the purity ofrecombinant pSIREN RetroO Tet by isolating all plasmids for transfection using aNucleoBond Plasmid Midi Kit Cat No 635931 or by CsCl gradient The efficiency ofa mammalian cell transfection de pends primarily on the hostcellline Optimizing the transfecti
4. Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 5 Knockout Inducible RNAi Systems User Manual l Introduction continued dsRNA Cleavage of dsRNA by Dicer siRNAs AN RR RR siRNAs bind to nuclease complex Inactive RNA induced AN Silencing Complexes RISCs AN AN Unwinding of siRNA Active RISCs Ke Active RISC associates with target transcript TE ee mRNA WH WEEN mRNA Eanan mRNA Cleavage of target transcript wm nnn mRNA WM nnn mRNA WM nnn mRNA Figure 1 Mechanism of RNA interference RNAi Clontech Laboratories Inc www clontech com 6 Initiator step Effector step Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual l Introduction continued Target sense seguence Target antisense seguence Target sequence 5 GTGAAGATCAAGATCATTGCTTCAAGAGAGCAATGATCTTGATCTTCACTTTTTT 3 ds DNA 3 CACTTCTAGTTCTAGTAACGAAGTTCTCTCGTTACTAGAACTAGAAGTGAAAAAA 5 Hairpin loop Terminator Transcription of target Target sense sequence Target antisense sequence shRNA transcript 5 GUGAAGAUCAAGAUCAUUGCUUCAAGAGAGCAAUGAUCUUGAUCUUCACUU 3 Folding of shRNA transcript through cis base pairing uUc 5 GUGAAGAUCAAGAUCAUUGC 3 UUCACUUCUAGUUCUAGUAACG e GA shRNA Figure 2 Small hairpin RNAs shRNAs generated using an oligonucleotide DNA seguence ThisexampleshowsatargetsequencederivedfromthecodingregionoftheR
5. 2 x 105 1 x 10 and 5 x 10 b Incubate the cells for 5 14 days replacing the selective medium every 4 days Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual VIII Pilot Experiments continued c Examine the dishes for viable cells every 2 days For selecting stable transfectants use a plating density that allows the cells to reach 80 confluency before massive cell death begins atabout day 5 This isthe cell density at which cells should be plated for selection of stable transfectants For example in HeLa cells we have found 2 x 10 cells 10 cm dish to be a good plating density Recommended Test Potential Host Cells By Transient Transfection with ptTS Neo and pSIREN RetroO Tet Luc Tet expression systems have been established in numerous cell lines including HeLa MCF7 and HEK 293 However the system may not be compatible with every cell type Performing a transient expres sion assay with ptTS Neo pSIREN RetroO Tet Luc and a luciferase expression vector may provide a guick indication of whether or not the Inducible RNAi system will work in a particular cell line This pilot experiment is not necessary if you are working with a premadeTettTS cell line because it has already undergone testing and validation with our Knockout Inducible RNAi System You should transfect cells using varying ratios of ptTS Neo the appro priate pSIREN Re
6. Dox is required for complete activation 0 01 1 g ml Dox vs 1 2 ug mlTc In addition Dox has a longer half life 24 hr thanTc 12 hr Either antibiotic is used at concentrations far below cytotoxic levels seen for cell culture and transgenic studies OtherTc derivatives have been used successfully as the inducer inTet systems Gossen amp Bujard 1993 See Section I E of the Tet Off and Tet On Gene Expression Systems User Manual PT3001 1 for further discussion Characteristics of Premade Tet Cell Lines General cell culture conditions Premade Tet Cell Lines should be grown at 37 C in a humidified chamber with 5 10 CO See the PAC for details particular to each cell line Relative growth rates The incubation times in this User Manual are for cells such as CHO or HeLa with relatively rapid doubling times Other cell types will differ in their growth rates Selection in G418 and hygromycin or puromycin Maintain stable Tet tTS and double stable inducible RNAi cell lines in the ap propriate selective medium however the concentration of drug reguired for maintenance can be reduced from the levels used to select stably transfected clones See Section lll for suggested antibiotic concentrations You may wish to alternate between selecting and nonselecting conditions for optimal results Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 25 Knockout Inducible RNAi Systems User Manual V
7. E1A Kinsella amp Nolan 1996 Ory et al 1996 Pearet al 1996 Yang et al 1999 in these cells The self inactivating feature of the vector is provided by a deletion in the 3 LTR enhancer region U3 During reverse transcription of the retroviral RNA the inactivated 3 LTR is copied and replaces the 5 LTR resulting in inactivation of the 5 LTR CMV enhancer sequences This mechanism may reduce the phenomenon known as promoter interference Barton amp Medzhitov 2002 Emerman amp Temin 1984 and allow more efficient expression Viral infection of host cells with recombinant pSIREN RetroO TetH is the preferred delivery method Also included in the viral genomictranscriptarethe necessary viral RNA processing elements including the LTRs packag ing signal Psi and tRNA primer binding site RNAi Ready pSIREN RetroO TetH also contains a bacterial origin of replication and E coliAmp gene for propagation and selection in bacteria Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual Appendix Vector Information continued BamH 6538 EcoR I 2 P TREmod U6 Pray Puro yt RNAi Ready R pSIREN RetroQ TetP 6 6 kb CMV MSV 5 LTR Psvao SV40 ori ColE1 ori 7380 7390 10 20 30 40 5 TGTGGAAAGGACGAGGA CC shRNA oligo cloning site AATTCTACCGGGTAGGGGA GGCGCTTTTCCCAAGGCAGT 3 BamH EcoR 3 ACACCTTTCCTGCTCCT
8. optimal density determined in Section VIII A 4 Allowcellsto divide twice 24 48 hr then add G418 to 400 600 ug ml Note The exact concentration of G418 for selection and the optimal plating density may vary from cell type to cell type and with different lots of G418 See Section VIII A for details 5 Replace medium with fresh complete medium plus G418 every 3 4 days or more often if necessary After 4 6 days cellsthat have nottaken up the plasmid will start to die Split cells ifthey reach confluency before massive cell death begins 6 After 3 4 weeks isolated colonies should begin to appear Isolate large healthy colonies and transfer them to individual plates or wells Suspension cultures must be cloned by the limiting dilu Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual IX Development of Tet tTS Stable Cell Lines continued tion technigue When working with adherent cells at Clontech we generally isolate clones using cloning cylinders or cloning discs C Screening Tet tTS Stable Cell Lines The next step is to perform transient transfection assays with a lucif erase expression vector and pSIREN RetroO Tet Luc to identify G418 resistant clones that meet the criteria for stable tTS cell lines Pick clones and expand as needed for your particular cell line Screen clones once they reach 50 80 confluency in a 6 well plate
9. S 1994 Acceleration ofthe G1 S phase transition by expression of cyclins D1 and E using an inducible system Mol Cell Biol 14 1669 1679 Retro X O Vectors 2002 Clontechnigues XVII 3 13 14 Sambrook J Russell D W amp Sambrook J 2001 Molecular Cloning A Laboratory Manual 3rd Edition Cold Spring Harbor Laboratory Cold Spring Harbor NY Scherr M Battmer K Winkler T Heidenreich O Ganser A amp Eder M 2002 Specific inhibi tion of bcr abl gene expression by small interfering RNA Blood 101 4 1566 1569 Sedivy J M amp Dutriaux A 1999 Gene targeting and somatic cell genetics a rebirth or a coming of age Trends Genet 15 3 88 90 Sharp RA 2001 RNA Interference 2001 Genes Dev 15 485 490 Sui G Soohoo C Affar E B Gay F Shi Y Forrester W C amp Shi Y 2002 A DNA vector based RNAI technology to suppress gene expression in mammalian cells Proc Natl Acad Sci USA 99 8 5515 5520 Witzgall R O Leary E Leaf A Onaldi D amp Bonventre J V 1994 The Kruppel associated box A KRAB A domain of zinc finger proteins mediates transcriptional repression Proc Natl Acad Sci USA 91 10 4514 4518 Yang S Delgado R King S R Woffendin C Barker C S Yang Z Y Xu L Nolan G P amp Nabel G J 1999 Generation of retroviral vector for clinical studies using transient transfec tion Hum Gene Ther 10 1 123 132 Yao F Svenjo
10. T Winkler T Lu M Eriksson C amp Eriksson E 1998 Tetracycline repressor tetR rather than the tetR mammalian cell transcription factor fusion derivatives regulates inducible gene expression in mammalian cells Hum Gene Ther 9 1939 1950 Yin D X amp Schimke R T 1995 Bcl 2 expression delays drug induced apoptosis but does not increase clonogenic survival after drug treatment in HeLa cells Cancer Res 55 4922 4928 Yu J Y DeRuiter S L amp Turner D L 2002 RNA interference by expression of short interfering RNAs and hairpin RNAs in mammalian cells Proc Natl Acad Sci USA 99 9 6047 6052 Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual Appendix Vector Information Bam 7391 EcoR I 2 P TREmod U6 Pray d Hyg wt RNAi Ready ON pSIREN RetroQ TetH 7 4 kb CMV MSV 5 LTR dee SV40 ori ColE1 ori 7380 7390 10 20 30 40 5 TGTGGAAAGGACGAGGATCC shRNA oligo cloning site CAATTCTACCGGGTAGGGG AGGCGCTTTTCCCAAGGCAGT 3 BamH EcoR 3 ACACCTTTCCTGCTCCTAGG shRNA oligo cloning site GATGGCCCATCCCCTCCGCGAAAAGGGTTCCGTCA 5 Figure 9 Restriction map and cloning site of the RNAi Ready pSIREN RetroO TetH Ret roviral Vector Unigue restriction sites are in bold RNAi Ready pSIREN RetroO TetH is a self inactivating retroviral expression vector designed to express a ds sho
11. This should not contain a consecutive run of 3 or more thymidine residues which can po tentially cause premature termination of transcription e A 7 9 nucleotide hairpin loop sequence We typically use 5 TTCAAGAGA 3 see Sui et al 2002 Lee et al 2002 Paddison et al 2002 Brummelkamp et al 2002 and Paul et al 2002 for other effective loop seguences e The 19 base oligonucleotide antisense sequence target anti sense seguence of the shRNA target site ensure proper orienta tion for correct formation of the hairpin structure see Figure 2 Important The target antisense seguence should not contain a consecutive run of 3 or more thymidine residues which can po tentially cause premature termination of transcription A RNA Pol lll terminator sequence consisting of a 5 6 nucleotide poly T tract e Optional but recommended Aunique restriction site immediately downstream of the terminator sequence for restriction digest analysis to confirm the presence of the cloned insert A typical oligonucleotide has 5 bases for the restriction site at the 5 end when digested with BamH I 19 bases of sense strand 7 9 bases of hairpin loop 19 bases of antisense strand 6 bases of terminator 6 bases ofa unique restriction site and 1 base for the restriction site at the 3 end when digested with EcoR l resulting in an oligonucleotide of 63 65 bases See Table for examples of sense and antisense sequences designed for selec
12. actingene Harborth et al 2001 This target sequence is cloned downstream of a Pol lll promoter in an expression vector for gene silencing in mammalian cells A hairpin loop sequence is located between the sense and antisense sequences on each complementary strand The shRNA behaves as an siRNA like molecule capable of carrying out gene specific silencing This mechanism is employed by all members of the pSIREN vector family turn initiate RNAi Brummelkamp et al 2002 These vectors represent a definite improvement in initiating RNAI in cells however not all cell types are easy to transfect using these vectors D Overview of the Knockout Inducible RNAi System The Knockout Inducible RNAi Systems combinetighton off control of an shRNA with efficient and cost effective sh RNA delivery to many cell types This system is a modified form of the tightly regulated Tetracyline controlled gene expression system described by Gossen amp Bujard 1992 and Gossen et al 1995 The system is designed so that expression of an shRNA is induced when either tetracycline Tc or doxycycline Dox aTc derivative is added to the culture medium of an appropriately engi neered cell Figure 3 Induction ofthe shRNA then results in suppression of the gene targeted by the shRNA through RNAi Thus the system allows for tight regulation of the expression of an shRNA and the gene that the shRNA targets in response to varying concentrations ofTc or Dox
13. hygromycin or G418 For puromycin add the drug at O 0 5 1 1 5 3 and 6 ug ml Note Our premade HEK 293Tet tTS cell line is especially sensitive to hygro mycin test a concentration range with a midpoint of 25 ug ml b Incubate the cells for 10 14 days replacing the selective medium every 4 days or more often if necessary c Examine the dishes for viable cells every 2 days For selecting stable transformants use the lowest concentration that begins to give massive cell death in 5 days and kills all the cells within two weeks For HeLa and CHO cells we have found 400 ug ml G418 and 200 ug ml hygromycin to be optimal In mammalian cells the optimal level of puromycin is typically around 1 ug ml Determine optimal plating density Once you have determined the optimal drug concentration deter mine the optimal plating density by plating cells at several different densities in the presence of a constant amount of drug If cells are plated at too high a density they will reach confluency before the selection takes effect Optimal plating density is dependent on population doubling time and cell surface area For example large cells that double rapidly have a lower optimal plating density than small cells that double slowly a Plate cells atseveral different densities in each of six 10cm tissue culture dishes containing 10 ml of the appropriate selective medium Suggested densities cells 10 cm dish 5 x 10 1 x 108 5 x 105
14. inducible RNAI cell lines Extensive online tools to assist you with shRNA oligo seguence design can be found at http bioinfo2 clontech com rnaidesigner Clontech Laboratories Inc www clontech com Protocol No PT3810 1 10 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual l Introduction continued E Advantages of the Knockout RNAi Inducible Systems The Knockout Inducible RNAi Systems have several advantages over oth er regulated gene expression systems that function in mammalian cells e Extremely tight on off regulation Background or leaky expres sion of shRNA in the absence of induction is extremely low with constructs such as pSIREN RetroO Tet vectors With any inducible RNAi system tight regulation is crucial because even low levels of leaky shRNA expression can result in significant suppression of the target gene e Fastresponsetimes and high levels of induction With our Inducible RNAI system knockdown of atargetcan be seen within 24 hrs of Dox addition Typically maximal knockdown is seen by 48 hrs post Dox addition In contrast other systems for inducible expression exhibit slow induction up to several days and in transient transfections require pretreatment with Dox for 1 2 days prior to transfection to ensure that repression is fully alleviated This can result in incomplete induction compared to repressor free controls Additionally such repressor based systems may require high amoun
15. interference issues described above Barton etal 2002 Emerman et al 1984 Additionally retroviral infection allows you to introduce your shRNA into virtually any mitotically active cell with high efficiency A detailed discussion of the advantages of retroviral delivery of RNAi constructs can be found in Section of the Retroviral Gene Transfer and Expression User Manual PT3132 1 The Retroviral User Manual also provides protocols for packaging recombinant pSIREN RetroO Tet constructs into infectious replication incompetent particles Additional information can be found on our Retroviral Gene Expression Resource at www clontech com expression retro index shtml Furthermore each RNAi system contains a control pSIREN RetroO Tet Luc vector for silencing luciferase gene expression when tested in cells expressing luciferase from a suitable vector This control vector can be used to quickly and easily monitor the consecutive steps leading to the generation of a double stable inducible RNAi line because it is a highly effective knockdown regulatory construct that has been quantitatively validated This User Manual provides protocols for generating your own inducible RNAI system through shRNA oligonucleotide sequence design anneal ing of shRNA oligonucleotides ligation of annealed oligonucleotides into pSIREN RetroO Tet vectors delivery of pSIREN RetroO Tet shRNA constructs into cell lines and establishing stable Tet tTS and double stable
16. luciferase activity in the presence of Dox These gualities can be tested by transient cotransfection with a luciferase expression vector and pSIREN RetroO Tet Luc as described in Section IX C Because the level of expression of tTS is profoundly af fected by the site of integration we recommend that you isolate and analyze as many clones as possible when screening in Steps B 6 and C 6 In general test at east 30 clones We typically screen 30 clones to obtain one that exhibits both suitably high shRNA induction with the addition of Tc or Dox and low background in the absence of inducer When we screen stable Tet tTS clones by the methods described in Section IX C at Clontech we find that a high percentage of clones exhibit gt 5096 knockdown activity 95 and 78 for HeLa and MCEF7 cells respectively A Transfection with ptTS Neo and Selection Figure 7 The efficiency of a mammalian transfection procedure is primarily dependent on the host cell line Therefore when working with a cell line for the first time we recommend you compare the efficiencies ofseveral transfection protocols After choosing amethod oftransfection optimize cell density usually 60 80 confluency the amount and purity of the DNA media conditions and transfection time For transfecting HEK 293 cells we recommend the CalPhos Mammalian Transfection Kit Cat No 631312 If a transfection method is already established for your cell line model proceed with
17. of any kind as to the Tet Technology patents or products All others are invited to request a license from TET Systems Holding GmbH amp Co KG prior to purchasing these reagents or using them for any purpose Clontech is required by its licens ing agreement to submit a report of all purchasers of the Tet controllable expression system to IP Merchandisers Inc For license information please contact Hans Peter Kneubuehl TET Systems Holding GmbH amp Co KG Im Neuenheimer Feld 582 69120 Heidelberg Germany Tel 49 6221 588 04 00 Fax 49 6221 588 04 04 eMail kneubuehl tet systems de or use our electronic licensing request form via http www tetsystems com main_inguiry htm The CMV promoter is covered under U S Patent Nos 5 168 062 and 5 385 839 assigned to the University of lowa Research Foundation Use of the IRES seguence is covered by U S Patent No 4 937 190 and is limited to use solely for research purposes Any other use of the IRES seguence reguires a license from Wisconsin Alumni Research Foundation Retroviral Vectors are sold under license from the Fred Hutchinson Cancer Research Center Rights to use this product are limited to research only No other rights are conveyed Inguiry into the availability of a license to broader rights or the use of this product for commercial purposes should be directed to Fred Hutchinson Cancer Research Center Technology Transfer Office 1100 Fairview Avenue North J6 200 Seattle WA 9
18. the tetracycline controlled transcriptional suppressor tTS April 1999 Clontechniques tTS is a fusion of the Tet repressor protein TetR and the KRAB AB silencing domain of the Kid 1 protein SD a powerful transcriptional suppressor Freundlieb et a 1999 Witzgall et al 1994 By virtue of theTetR moiety tTS can bind tightlyTet opera tor seguences tetO in the absence ofTc or Dox The KRAB AB domain then acts as a potent suppressor of transcription from any promoter downstream of the tetO seguences Clontech Laboratories Inc www clontech com Protocol No PT3810 1 8 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual l Introduction continued The response plasmid in this system contains aTet responsive U6 pro moter which is used to drive expression of the shRNA This promoter Prpemoaue consists of the Tet response element TRE seven direct repeats of the tetO 19 mer upstream of a minimal U6 promoter The TRE derives from the Pign Promoter used in the standardTet response plasmid pTRE TIGHT April 2002 Clontechnigues In the absence of Dox tTS binds the tetO sequence within the TRE and actively silences transcription of the shRNA from the minimal U6 promoter Figure 3 As Dox is added to the culture medium tTS dissociates from the TRE relieving transcriptional suppression and allowing transcription to proceed from the hybrid TRE U6 promoter The ultimate goal in setting up a functional and
19. those conditions It is important to keep optimized parameters con stant to obtain reproducible results For transfecting other cell lines with ptTS Neo we recommend using your transfection method of choice with the following protocol 1 Grow cells to 80 confluency in complete medium or to a density appropriate for your transfection method Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 31 Knockout Inducible RNAi Systems User Manual IX Development of Tet tTS Stable Cell Lines continued Neo a d TS OR Neo e Transfect infect host cell line with regulator plasmid Y SH ptTS Neo or pOC tTS IN e Select in presence of G418 d e Isolate at least 30 G418 resistant clones e Screen by transient transfection with pSIREN RetroO Tet Luc and luciferase vector for clones with Low background high luciferase activity without Dox or Tc High shRNA induction low luciferase activity with Dox or Tc Tet tTS stable cell line Expand and freeze stocks of Tet tTS stable cell line Figure 7 Flow chart for developing Tet tTS stable cell lines Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual IX Development of Tet tTS Stable Cell Lines continued 2 Transfect the ptTS Neo Vector by the desired method Note If desired the regulator plasmid can be linearized by digestion wi
20. top strand and the bottom strand at a 1 1 ratio This mixture will ultimately yield 50 uM of ds oligo assuming 100 theoretical annealing 3 Heat the mixture to 95 C for 30 sec to remove all secondary structure Note Heating to 95 C ensures that the internal hairpin of each oligonucleotide is disrupted and promotes intermolecular annealing 4 Heat at 72 C for 2 min 5 Heat at 37 C for 2 min 6 Heat at 25 C for 2 min 7 Store on ice The annealed oligonucleotide is now ready for ligation into the pSIREN RetroO Tet vector Alternatively the annealed oligonucleotide can be stored at 209C until ready to use B Ligating the ds Oligonucleotide Into pSIREN RetroQ Tet Vectors 1 Dilute the annealed oligo from Step A 7 with TE buffer to obtain a concentration of 0 5 uM Note To ensure good ligation efficiency it is necessary to dilute the oligo so that it is only in moderate excess Using an excess of the oligo will inhibit ligation 2 Assemble a ligation reaction for each experimental annealed oligonucleotide For each ligation combine the following reagents in an Eppendorf tube 1 ul RNAi Ready pSIREN RetroQ Tet Vector 50 ng ul 1 ul Diluted annealed oligonucleotide 0 5 uM 1 5 ul 10XT4 DNA ligase buffer 0 5 ul BSA 10 mg ml 10 5 ul Nuclease free H O 0 5 ul _ T4 DNA ligase 400 U ul 15 ul Total volume Note If desired a control ligation can be assembled using 1 ul of nuclease free H O instead of annealed oli
21. www clontech com Clontech Laboratories Inc Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual VI Cloning into pSIREN RetroQ Tet Vectors continued 10 Once a positive clone has been identified inoculate a large scale liquid culture to prepare greater quantities of recombinant pSIREN RetroQ Tet shRNA vector To ensure optimal purity of the DNA isolate all plasmids for transfection using a NucleoBond Plasmid Maxi EF Kit Cat No 635953 or by CsCl density gradient purifica tion Sambrook et al 2001 Clontech Laboratories Inc www clontech com Protocol No PT3810 1 24 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual VII Cell Culture Guidelines A General Information The protocols in this User Manual provide only general guidelines for mammalian cell culture techniques Perform all steps involving cell culture using sterile technique in a suitable hood For those requiring more information on mammalian cell culture we recommend the fol lowing general references e Culture of Animal Cells Fourth Edition ed by R Freshney 2000 Wiley Liss NY e Current Protocols in Molecular Biology ed by F M Ausubel et al 2003 Wiley amp Sons B Tetracycline vs Doxycycline The Knockout Inducible RNAi system responds equally well to either tetracycline Tc or doxycycline Dox However we recommend that you use Dox in part because a significantly lower concentration of
22. 8109 Purchase of this product does not grant rights to 1 offer the materials or any derivatives thereof for resale or 2 to distribute or transfer the materials or any derivatives thereof to third parties NucleoSpin and NucleoBond are registered trademarks of MACHEREY NAGEL GmbH amp Co KG Clontech the Clontech logo and all other trademarks are the property of Clontech Laboratories Inc unless noted otherwise Clontech is aTakara Bio Company 2007 Clontech Laboratories Inc Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 53
23. AGG shRNA oligo cloning site GATGGCCCATCCCCTCCGCGAAAAGGGTTCCGTCA 5 Figure 10 Restriction map and cloning site of the RNAi Ready pSIREN RetroO TetP Ret roviral Vector Unique restriction sites are in bold RNAi Ready pSIREN RetroO TetP is a self inactivating retroviral expression vector designed to express a ds short hairpin RNA shRNA under the control of the modified Tet responsive promoter Prremoaue derived from the Pipemog Promoter and the human U6 promoter Pje RNAi Ready pSIREN RetroO TetP is provided as a linearized vector digested with BamH and EcoR I It is used for targeted and inducible gene silencing when a DNA oligonuceotide encoding an appropriate shRNA is ligated into the vector shRNA expression is controlled by the tetracycline transcriptional repressor ptTS Freundlieb et al 1999 Prremog contains a modified Tet response element TRE a which consists of seven direct repeats of a 36 bp sequence that contains the 19 bp tet operator sequence tetO You can transfect your pSIREN RetroO TetP construct as a plasmid expression vector or upon transfection into a packaging cell line this vector can transiently express or integrate and stably express a viral genomic transcript containing the Piremoaus Promoter and the shRNA The vector contains a puromycin resistance gene Puro under the control of the murine phosphoglycerate kinase PKG promoter Pc for the selection of stable transfectants This retroviral
24. Another method for eliminating gene expression takes advantage of the phenomenon of post transcriptional gene silencing PTGS Specifi cally the cellular process of RNA interference RNAi has been used to effectively silence gene expression Figure 1 RNAi is activated by introducing a double stranded ds RNA whose sequence is homolo gous to the target gene transcript The exogenous RNA is digested into 21 23 nucleotide nt small interfering RNAs siRNAs which bind a nuclease complex to form an RNA induced silencing complex RISC The RISC then targets endogenous gene transcripts by base pairing and cleaving the mRNA Hammond et al 2001 Sharp 2001 Huntvagner amp Zamore 2002 and Nykanen et al 2001 In contrast to traditional knockout methods specific gene silencing is achieved quickly and easily in both animal and cell line models The Knockout Inducible RNAi Systems allow you to quickly express functional hairpin siRNA molecules with tight on off regulation in mammalian cells forthe purpose of silencing target genes These systems contain RNAi Ready pSIREN RetroO TetandtTS expression vectors that use the cell s own RNA Polymerase lll Pol Ill to transcribe a specifically designed small hairpin RNA shRNA under the control of a hybrid pro moter that contains aTet responsive element andthe human U6 promot er The human U6 promoter provides a high level of expression in many celltypes Kunkel amp Pederson 1989 resulting
25. Cat No 631714 Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 15 Knockout Inducible RNAi Systems User Manual IV Protocol Overview PLEASE READ ENTIRE PROTOCOL BEFORE STARTING Figure 4 shows an overview of the procedure described in this User Manual which provides protocols for shRNA oligonucleotide seguence design an nealing of sh RNA oligonucleotides ligation of annealed oligonucleotides into pSIREN RetroO Tet vectors delivery of these constructs with transfection or infection into target cells and establishing double stable inducible RNAi cell lines Extensive online tools to assist you with shRNA oligonucleotide sequence design can be found athttp bioinfo2 clontech com rnaidesigner shRNA Oligonucleotide Design Section V e The success of your experiment depends on choosing the proper target sequence within your gene of interest and the proper design of the shRNA oligonucleotides In addition we highly recommend that you test more than one shRNA sequence per gene of interest e PAGE purification of your designed oligonucleotides ensures that a higher percentage of the oligonucleotides will be full length and therefore increases the chance of cloning a complete and functional insert When using PAGE purified oligonucleotides we typically achieve 80 90 of clones with the correct insert e Whentesting your pSIREN RetroQ Tet construct for functionality you will need a ge
26. E S Z Si Bm o UU Knockout Inducible RNAI Systems User Manual Clontech United States Canada 800 662 2566 re Cat Nos 630925 630926 Eu PT3810 1 PR7Z2455 483 0 3904 8880 Published 14 December 2007 Japan 81 0 77 543 6116 Clontech Laboratories Inc ATakara Bio Company 1290 Terra Bella Ave Mountain View CA 94043 Technical Support US E mail tech clontech com www clontech com Knockout Inducible RNAi Systems User Manual Table of Contents l Introduction 4 A Summary 4 B Mechanism of RNAi 5 C Establishing RNAi in Mammalian Cells 5 D Overview of the Knockout Inducible RNAi System 7 E Advantages of the Knockout Inducible RNAi Systems 11 ll List of Components 12 lll Additional Materials Required 13 IV Protocol Overview 16 V shRNA Oligonucleotide Design 19 A Selecting Target Sequences 19 B Designing Oligonucleotides 19 VI Cloning into pSIREN RetroQ Tet Vectors 22 A Annealing the Oligonucleotides 22 B Ligating the ds Oligonucleotide Into pSIREN RetroO Tet 22 Vectors C Transforming Fusion Blue Competent Cells 23 with Recombinant pSIREN RetroO Tet Vectors VII Cell Culture Guidelines 25 A General Information 25 B Tetracycline vs Doxycycline 25 C Characteristics of Premade Tet Cell Lines 25 D Starting Tet Cell Cultures From Frozen Stocks 26 E Preparing Frozen Stocks of Inducible RNAi Cell Lines 26 VIII Pilot Experiments 28 A Titrating G418 Hygromycin and Puro
27. II Cell Culture Guidelines continued D Starting Tet Cell Cultures From Frozen Stocks Note Frozen cells should be cultured immediately upon receipt or as soon thereafter as possible Increased loss of viability may occur after shipping if culturing is delayed Thawvial of cells rapidly in a 37 C water bath with constant agitation Immediately upon thawing wipe the outside of the vial with 70 EtOH Transfer the contents of the vial to a 10 cm dish T25 or T75 flask containing 1 ml of medium without antibiotics Mix gently Add an additional 4 ml of medium to the flask dish and mix gently Add additional medium to the culture as follows T25 flask or 10 cm dish add 5 ml for a total volume of 10 ml T75 flask add 10 ml for a total volume of 15 ml Mixthe cell suspension thoroughly Gently rock or swirl the dish flask to distribute the cells evenly over the growth surface and place it in a 37 C humidified incubator 5 10 CO as appropriate Alternative method The cells can also be rinsed prior to incuba tion If rinsing is desired perform Steps 1 and 2 in a 15 ml conical centrifuge tube Centrifuge at 125 x g for 10 min and resuspend in complete medium for culturing This step removes the cryopreser vative and can be beneficial when resuspending in small volumes However this step can damage fragile cell membranes The next day examine the cells under a microscope If the cells were not rinsed u
28. ach transformation on selective medium containingtheappropriateconcentrationofantibiotic Incubateat379C Notes e Both cell competency and ligation efficiency affect the outcome of the transfor mation We suggest plating different amounts on separate plates to identify the optimal volume for determining transformation efficiency and isolating colonies e Plating is accomplished by spreading cells on selective medium e g LB agar Ampicillin 50 100 pg ml Please see the Vector Information Packet that ac companies the pSIREN RetroO Tet Vector for details 8 Inoculate a small scale liquid culture with a single well isolated colony We recommend you set up 4 8 such cultures to ensure you obtain at least one positive clone After overnight incubation isolate plasmid DNAusing any standard method Forsmall scale purification lt 20 ug plasmid DNA we recommend our NucleoSpin Plasmid Kit Cat No 635987 9 Identify the desired recombinant plasmid by restriction analysis using the unique restriction site within the shRNA oligonucleotide sequence If desired verify your insert by sequencing Note Since there is always a chance for mutations in the oligo due to synthesis errors we strongly recommend that you sequence at least two clones to verify the correct oligo sequence Because hairpin sequences are difficult to sequence inform your sequencing facility so that sequencing conditions can be adjusted accordingly Protocol No PT3810 1
29. atories Inc Version No PR7Z2455 13 Knockout Inducible RNAi Systems User Manual lll Additional Materials Reguired continued e 2X HEPES buffered saline 2X HBS pH 7 1 Final Conc To prepare 100 ml Na HPO 1 5 mM 0 018 g NaCl 280 mM 1 64 g HEPES 50 mM 1 19 g Dissolve components in 100 ml of distilled H O Adjust to pH 7 1 with 0 5 N NaOH Pass through 0 22 micron filter Store in 5 ml aliqouts at 20 C e Phosphate buffered saline PBS pH 7 4 Final Conc To prepare 2 L Na HPO 58 mM 16 5 g NaH PO 17 mM 41g NaCl 68 mM 8 0 g Dissolve components in 1 8 L of distilled H O Adjust to pH 7 4 with 0 1 N NaOH Add ddH 0 to final volume of 2 L Autoclave Store at room temp e Antibiotics for clonal selection Prior to use determine the optimal concentration of each antibiotic for selection as described in Section VIII A eG418 for selection of tTS stable cell lines G418 is available in powdered form from Clontech Cat No 631307 Note that the effective weight is about 0 7 g per gram of powder Make a 10 mg ml stock solution by dissolving 1 g of powder in approximately 70 ml of DMEM or alpha MEM without supplements Filter sterilize and store at 4 C Recommended working concentration Maintenance 100 ug ml Selection HeLa or CHO cells 400 500 pg ml acceptable range 50 800 pg ml eHygromycin for selection of pSIREN RetroO TetH Cell Lines Hygromycin is available from Clontech Cat No 631309 Recomm
30. ble Stable Cell Lines continued After 2 4 weeks hyg resistant or pur resistant colonies will begin to appear 6 Isolate large healthy colonies and transfer them to individual plates or wells Isolate as many clones as possible C Screening Double Stable Inducible RNAi Cell Lines 1 Test isolated resistant clones for Tet regulated gene silencing by dividing a suitable number of cells in half and testing for Gene X silencing in the absence and presence ofTc or Dox You should generally choose the cell line that gives you the highest overall shRNA expression and therefore highest suppression of Gene X in the presence of Dox and lowest background shRNA ex pression and highest expression of Gene X in the absence of Dox 2 Allow the cells to grow for at least 48 hr then assay each sample for shRNA expression via Gene X suppression using one of the methods described in Section X A 3 Optional Confirm the presence of integrated pSIREN RetroO Tet shRNA by performing PCR on chromosomal DNA using primers that will amplify an internal portion of the plasmid 4 Once you have developed a suitable double stable inducible RNAi cell line prepare frozen aliquots to ensure a renewable source of the cells Section VII E Clontech Laboratories Inc www clontech com Protocol No PT3810 1 38 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual XI Working with Double Stable Inducible RNAi Cell Lines The Tetrac
31. chart for developing double stable inducible RNAi cell lines Figure 9 Restriction map and cloning site of the RNAi Ready pSIREN RetroO TetH Retroviral Vector Figure 10 Restriction map and cloning site of the RNAi Ready pSIREN RetroO TetP Retroviral Vector Figure 11 Restriction map of the ptTS Neo Vector Figure 12 Restriction map of the pOC tTS IN Vector 35 35 37 38 39 39 39 40 43 46 21 30 32 36 46 47 48 49 Protocol No PT3810 1 www clontech com Clontech Laboratories Inc 3 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual l Introduction A Summary The human genome project has generated the sequences of thousands of genes Aaronson etal 1996 Hillier et a 1996 allowing researchers to focus on the question of gene function in biology A key approach to determining gene function has been the targeted knockout of specific genes gene inactivation is accomplished by disruption of the target gene s coding sequence and then introduction of the altered gene into embryonic stem cells Animal models carrying heterozygous and homozygous gene knockouts allow the determination of whether a particular gene is essential and what functions are perturbed by its loss However the amount of time and labor required to generate animal knockout models is quite extensive In addition achieving such models in somatic cell lines has proven difficult Sedivy amp Dutriaux 1999
32. d sequences arecorrect To ensure a highamount of dsDNA inthe annealing reaction mix an equal ratio of top and bottom strands It may be necessary to increase the denaturation temperature Section VI A to increase the yield of annealed oligonucleotide Verify oligonucleotide size using a 12 native poly acrylamide gel Order PAGE purified oligonucle otides to ensure a higher percentage of full length oligonucleotides and increase the chance of clon ing acomplete and functional insert Verify the concentration of the annealed oligonucle otide used for ligation Too little or too much oligo nucleotide can affect ligation To improve ligation efficiency perform arange of 5 or 10 fold dilutions ofthe annealed oligonucleotide for use in ligation Check your ligase and ligase buffer for activity using a different vector and insert Replace the ligation reagents if they prove inactive Transform Fusion Blue Competent Cells using the providedTest Plasmid Calculate the number of cfu ug to determine the cells competency Handle competentcells gently during transformation and plating Perform the heat shock step Step VI C 4 for pre cisely 45 sec Extending this time will drastically reduce cell viability We have not observed loss or mutation of the annealed oligonucleotides when cloned into pSIREN RetroOQ Tet vectors and propagated using the recommendedconditions To ensure integrity do Protocol No PT3810 1 Version No PR7Z2455
33. e for the Tet Systems The following reagents are sufficient for 40 ligations into either the pSIREN RetroO TetH or pSIREN RetroO TetP vectors Knockout Tet RNAi System H Cat No 630925 2 ug RNAi Ready pSIREN RetroQ TetH Vector linearized 50 ng ul e 20 ug ptTS Neo Vector 500 ng ul e 20 ug pOC tTS IN Vector 500 ng ul 20 ug pSIREN RetroQ TetH Luc Vector 500 ng ul e 50 ml Tet System Approved Fetal Bovine Serum RNAi Ready pSIREN RetroO TetH Vector Information Packet PT3811 5 ptTS Neo Vector Information Packet PT3813 5 pOC tTS IN Vector Information Packet PT3822 5 Knockout Tet RNAi System P Cat No 630926 2 ug RNAi Ready pSIREN RetroQ TetP Vector linearized 50 ng ul e 20 ug ptTS Neo Vector 500 ng ul e 20 ug pOC tTS IN Vector 500 ng ul 20 ug pSIREN RetroQ TetP Luc Vector 500 ng ul e 50 ml Tet System Approved Fetal Bovine Serum RNAi Ready pSIREN RetroO TetP Vector Information Packet PT3812 5 ptTS Neo Vector Information Packet PT3813 5 pOC tTS IN Vector Information Packet PT3822 5 Clontech Laboratories Inc www clontech com Protocol No PT3810 1 12 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual lll Additional Materials Reguired The following materials are reguired but not supplied For cloning of shRNA oligonucleotides into pSIREN RetroO Tet vectors e T4 DNA ligase New England Biolabs Cat No M0202S 10X T4 DNA Ligase Buffer
34. ection marker Julius etal 2000 Upon transfection into a packaging cell line this vector can transiently express or integrate and stably express a viral genomic transcript containing the CMV immediate early promoter tTS IRES and the neomycin resistance gene Neo tTS and the neomycin resistance gene are cotranslated via the internal ribosome entry site IRES from a bicistronic message in mammalian cells Adam etal 1991 Gattas et a 1991 The tTS is a fusion of theTet repressor protein TetR and the KRAB AB silencing domain of the Kid 1 protein SD a powerful transcriptional repressor Freundlieb et al 1999 Witzgall et al 1994 In the absence of Dox tTS binds to the tetO seguence in the Prngmoa Of aTet response plasmid pSIREN RetroO TetH or pSIREN RetroO TetP and suppresses expression of the shRNA As Dox is added to the culture medium the tTS dissociates from the P remoa relieving transcriptional suppression This vector incorporates unique features including optimization to remove promoter interference and self inactivation The hybrid 5 LTR consists of the cytomegalovirus CMV type enhancer and the mouse sarcoma virus MSV promoter This construct drives high levels of transcription in HEK 293 based packaging cell lines due in part to the presence of adenoviral E1A Kinsella amp Nolan 1996 Ory et al 1996 Pear et al 1996 Yang et al 1999 in these cells The self inactivating feature of the vector is provid
35. ed by a deletion in the 3 LTR enhancer region U3 During reverse transcription of the retroviral RNA the inactivated 3 LTR is copied and replaces the 5 LTR resulting in inactivation of the 5 LTR CMV enhancer sequences This mechanism may reduce the phenomenon known as promoter interference Barton amp Medzhitov 2002 Emerman amp Temin 1984 and allow more efficient expression Also included in the viral genomic transcript are the necessary viral RNA processing elements including the LTRs packaging signal Psi and tRNA primer binding site pOC tTS IN also contains a bacterial origin of replication and E coliAmp gene for propagation and selection in bacteria as well as a neomycin gene for the selection of stable transfectants Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 9 Knockout Inducible RNAi Systems User Manual Notes Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual Notes Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual Notes Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose
36. ed by Dr Bujard Up to date information on theTet system technology and licensing issues can be found at the site maintained by TET Systems Holding GmbH amp Co KG at www tetsystems com Please note that Clontech is not responsible for the information on or the maintenance of these sites Aaronson J S Eckman B Blevins R A Borkowski J A Myerson J Imran S amp Elliston K O 1996 Toward the development of a gene index to the human genome An assessment of the nature of high throughput EST sequence data Genome Res 6 829 845 Ausubel F M Brent R Kingston R E Struhl K Benson Chanda V Moore D M Seidman J G eds 2003 Current Protocols in Molecular Biology John Wiley amp Sons NY Baron U Freundlieb S Gossen M amp Bujard H 1995 Co regulation of two gene activities by tetracycline via a bidirectional promoter Nucleic Acids Res 23 3605 3606 Baron U Gossen M amp Bujard H 1997 Tetracycline controlled transcription in eukaryotes novel transactivators with graded transactivation potentials Nucleic Acids Res 25 2723 2729 Barton G M amp Medzhitov R 2002 Retroviral delivery of small interfering RNA into primary cells Proc Natl Acad Sci USA 99 23 14943 14945 Bernstein E Caudy A A Hammond S A amp Hannon G J 2001 Role for a bidentate ribo nuclease in the initiation step of RNA interference Nature 409 363 366 Brummelkamp T R Bernard
37. ended working concentration Maintenance 100 ug ml Selection HeLa or CHO cells 200 ug ml acceptable range 50 800 pg ml ePuromycin for selection of pSIREN RetroO TetP Cell Lines Puromycin is available from Clontech Cat Nos 631305 amp 631306 Recommended working concentration Maintenance 0 5 pg ml Selection acceptable range 0 5 5 ug ml Clontech Laboratories Inc www clontech com Protocol No PT3810 1 14 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual lll Additional Materials Reguired continued Cell Freezing Medium with or without DMSO Sigma Cat Nos C6164 amp C6039 e Cloning cylinders PGC Scientific Cat Nos 62 6150 40 62 6150 45 62 6151 12 amp 62 6151 16 Antibiotics for Tet Induction e Doxycycline Cat No 631311 Dilute to 1 2 mg ml in H O Filter sterilize aliquot and store at 20 C in the dark Use within one year e Tetracycline hydrochloride Sigma Cat No T3383 Dilute to 1 2 mg ml in 70 ethanol Filter sterilize aliquot and store at 20 C in the dark Use within two months For delivery of pSIREN RetroQ Tet and tTS vectors e Clonfectin Transfection Reagent Cat No 631301 e CalPhos Mammalian Transfection Kit Cat No 631312 e Retro X Universal Packaging System Cat No 631530 For luciferase assays e Luciferase expression vector We recommend the pGL2 Control Vector from Promega Cat No E1611 e Luciferase Reporter Assay Kit
38. est at least 4 shRNAs per gene It may help to choose shRNA targets that are distributed along the length of the gene sequence to reduce the chance of targeting a region that is either highly structured or bound by regulatory proteins Note You will need to design a gene specific assay to test for the suppression of Gene X if you have not already done so See Sec tion IV for additional information B Designing Oligonucleotides It is necessary to synthesize two complementary oligonucleotides a top strand and a bottom strand for each shRNA target site Figure 5 illustrates the overall structure of the prototypical oligonucleotide Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual V shRNA Oligonucleotide Design continued seguences for use in pSIREN RetroO Tet vectors The seguences of the oligonucleotides should include A 5 BamH restriction site overhang on the top strand and a 5 EcoR restriction site overhang on the bottom strand These restriction sites will enable directional cloning of the annealed oligonucleotides into the pSIREN RetroO Tet vector e A guanine G residue added upstream of the 5 end of the shRNA sense strand if the target sequence does not start with a purine preferred as Pol Ill transcription start site e The 19 base oligonucleotide sense sequence target sense sequence of the shRNA target site Important
39. gner amp Zamore 2002 and Nykanen et al 2001 An amplification step has also been proposed to explain the potency of the RNAI process the exogenous RNA is copied many times either before or after the generation of the siRNAs Ham mond et al 2001 Sharp 2001 and Huntvagner amp Zamore 2002 RNAI then can serve as a powerful tool in the field of functional ge nomics By simply designing and introducing a dsRNA seguencethatis complementary to a region of a target gene transcript loss of function phenotypes can be generated guickly and easily C Establishing RNAi in Mammalian Cells A number of groups have designed plasmid expression vectors to generate sustained production of siRNAs by transient or stable transfection Some of these vectors have been engineered to ex press small hairpin RNAs shRNAs which are processed in vivo into siRNA like molecules capable of carrying out gene specific silencing Brummelkamp et al 2002 Paddison et al 2002 Paul et al 2002 and Yu et al 2002 After construction is complete these vectors contain a DNA seguence that encodes the shRNA cloned between a Pol lll promoter and a transcription termination site comprising 4 5 thymidine residues The transcript is terminated at position 2 of the termination site and then folds into a stem loop structure with 3 UU overhangs Figure 2 The ends of the shRNAs are processed in vivo converting the shRNA into 21 nt siRNA like molecules which in
40. gonucleotide 3 Incubate the reaction mixture for 3 hr at room temperature Note Do not let the ligation reaction go longer than 3 hr If you are unable to im mediately perform the transformation after this step store the completed ligation at 209C until ready to use Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual VI Cloning into pSIREN RetroQ Tet Vectors continued C Transforming Fusion Blue Competent Cells with Recombinant pSIREN RetroQ Tet Vectors Fusion Blue Competent Cells are an E coliK 12 strain that provides high transformation efficiency The strain carries recA and endA mutations that make it a good host for obtaining high yields of plasmid DNA We routinely use this strain for our shRNA cloning 1 Thaw the required number of tubes of cells on ice for 10 min Tap gently to ensure that the cells are suspended 2 Add 2 ulofthe ligation mixture from Step B 3 directly to 50 ul of cell suspension Mixgentlyto ensureeven distribution ofthe DNAsolution 3 Incubate the transformation mixture DNA cells on ice for 30 min 4 Heat the tubes for precisely 45 sec in a water bath at 42 C without shaking 5 Remove the tubes from the water bath and place them directly on ice for 1 2 min 6 Add 950 pl room temperature SOC medium to each tube Incubate at 37 C for 60 min while shaking at 250 rpm 7 Plate 20 150 ul from e
41. guence shown is one of many functional loop seguences used to generate shRNAs Termination is signaled using a poly T tract Including a unigue restriction site Test RE site allows confirmation ofthe cloned insert after the ligation and transformation reactions 5 BamH I and 3 EcoR I overhangs are necessary for directional cloning into pSIREN RetroO Tet vectors SeeTable I for examples of target sense and antisense seguences for selected genes TABLE I EXAMPLES OF PUBLISHED TARGET SEOUENCES Gene Target sequence Sense sequence Antisense sequence Reference B actin AATGAAGATCAAGATCATTGC TGAAGATCAAGATCATTGC GCAATGATCTTGATCTICA Harborth et al 2001 Bcr abl AAGCAGAGTTCAAAGCCCTT GCAGAGTTCAAAGCCCTT AAGGGCTTTGAACTCTGC Scherr etal 2002 hRad9 AAGTCTTTCCTGTCTGTCTIT GTCTTTCCTGTCTGTCTIT AAAGACAGACAGGAAAGAC Hirai amp Wang 2002 Sequences are shown for top strand oligo design All sequences shown 5 to 3 Bottom strand oligo design not shown is the complementary sequence to the top strand gt Identified from gene coding sequence Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual VI Cloning into pSIREN RetroQ Tet Vectors A Annealing the Oligonucleotides For convenience Steps 3 6 can be performed in a thermal cycler 1 Resuspend each purified oligonucleotide in TE buffer to a final concentration of 100 uM 2 Mix the oligos for the
42. including but not limited to use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without written approval of Clontech Laboratories Inc Use of the Tetracycline controllable expression systems the Tet Technology is covered by a series of patents including U S patents 5 464 758 and 5 814 618 which are proprietary to TET Systems Holding GmbH amp Co KG Academic research institutions are granted an au tomatic license with the purchase of this product to use the Tet Technology only for internal academic research purposes which license specifically excludes the right to sell or otherwise transfer theTetTechnology or its component parts to third parties Notwithstanding the above academic and not for profit research institutions whose research using the Tet Technology is sponsored by for profit organizations which shall receive ownership to all data and results stemming from the sponsored research shall need a commercial license agreement from IP Merchandisers in order to use the Tet Technology In accepting this license all users acknowl edge that the Tet Technology is experimental in nature TET Systems Holding GmbH amp Co KG makes no warranties express or implied or of any kind and hereby disclaims any warranties representations or guarantees
43. inducible RNAI sys tem is to create a double stable cell line that stably expresses both the regulatory and response plasmids To accomplish this you can either make use of the response and regulatory vectors provided in the kit to develop a cell line specific to your interest or you can start from one of the premade Tet tTS stable regulatory cell lines available separately and introduce your shRNA into it under control of the re sponse element The two response vectors provided in this kit are the RNAi Ready pSIREN RetroO TetH and pSIREN RetroQ TetP vectors These are inducible retroviral shRNA expression vectors The vectors are provided linearized and ready for ligation with a dsDNA oligonucle otide encoding an shRNA The pSIREN RetroO TetH vector contains a hygromycin resistance gene for the selection of stable transformants while the pSIREN RetroO TetP vector contains a puromycin resistance gene Both vectors are self inactivating expression vectors designed to express the target shRNA without the risk of promoter interference from the upstream LTR in the integrated provirus July 2002 Clontech niques Julius et al 2000 In addition to the response plasmids the system provides two version of the regulator tTS construct The first ptTS Neo is a plasmid vec tor which can be used to transfect target cells of interest The second pOC tTS IN is a retroviral vector that can be used to generate stable tTS expressing cell lines by retr
44. intarget gene suppression For maps and detailed information on the pSIREN RetroO TetH Vec tor and pSIREN RetroO TetP Retroviral Vectors see the Appendix or the Vector Information Packet s provided with your product Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual l Introduction continued B Mechanism of RNAi The current model of the RNAi mechanism includes both initiator and effector steps for reviews see Hutvagner amp Zamore 2002 Hammond et al 2001 and Sharp 2001 The initiator step involves the digestion of the input dsRNA into siRNAs 21 23 nt in length These siRNAs are produced by the action of an enzyme known as Dicer which belongs to the RNAse lll family of dsRNA specific ribonucleases and is evolu tionarily conserved in worms plants fungi and mammals Bernstein et al 2001 The cleavage of input dsRNA by Dicer is accomplished in a processive ATP dependent manner eventually generating 19 21 bp siRNA duplexes with a 3 overhang of 2 nt Figure 1 The effector step occurs when these siRNA duplexes bind to a nucle ase complex and form the RISC Figure 1 RISC is activated by the ATP dependent unwinding of the siRNA duplex Active RISC then targets the native homologous transcript by base pairing and subsequently cleaving the mRNA at approximately 12 nt from the 3 end of the siRNA Hammond etal 2001 Sharp 2001 Huntva
45. ions near the start codon within 75 bases as these may be richerin regulatory protein binding sites Elbashir et a 2001 UTR binding proteins and or transla tion initiation complexes may interfere with binding of the RISC Do not select sequences that contain a consecutive run of 3 or more thymidine residues a poly T tract within the sequence can potentially cause premature termination the shRNA transcript 2 Calculate the GC content of the selected 19 base oligonucleotide sequence The GC content should be between 40 and 60 a GC content of approximately 45 is ideal 3 Sequences that have atleast 3A orT residues in positions 15 19 ofthe sense sequence also appear to have increased knockdown activity 4 Check the 19 base oligonucleotide for secondary structure and long base runs both of which can interfere with proper annealing Eliminate candidate sequences that display these characteristics 5 Compare the remaining candidate sequences to an appropriate genome databasetoidentify sequencesthatare specific forthe gene of interest and show no significant homology to other genes Candidate sequences that meet these criteria are potential shRNA target sites To optimize gene silencing we highly recommend that you test more than one shRNA target sequence per gene We provide enough pSIREN RetroO Tet vector to perform 40 ligations which allows you to screen for functional shRNA sequences within your gene of interest You should t
46. irm RetroO RNAi Core System or transienttransfection of your pSIREN RetroO Tet shRNA into a stableTet tTS cell line Section X A Tc contamination in media Use Tet System Approved FBS Check your serum by performing a dose response curve Section XI B D Loss of inducible regulation Insufficient suppression leaky background Viral promoter inactivation Clontech Laboratories Inc Tc contamination in media See Section C above Switching off or methylation of the promoter may occur It is recommended that you subclone and freeze stocks of your cells at all stages www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual XIII References You can access extensive technical resources and information including bibliographies on the RNAi and Tet Systems from their respective product pages at www clontech com Clontech also offers extensive online tools to assist you with shRNA oligonucleotide sequence design at http bioinfo2 clontech com rnaidesigner Clontech s Tet Systems were developed in cooperation with Dr Bujard and his colleagues at the Center for Molecular Biology in Heidelberg ZMBH Additional background information onTet regulated gene expression systems is available at the site maintained by Dr Bujard s laboratory http www zmbh uni heidelberg de bujard homepage html In addition IP Merchandisers TET Systems Holding GmbH amp Co KG was found
47. is provided with the enzyme e Bovine serum albumin BSA 10 mg ml e Nuclease free H O e Fusion Blue Competent Cells Cat No 636700 e NucleoSpin Multi 8 Plus Plasmid Kit Cat No 635976 e NucleoBond Plasmid Maxi EF Kit Cat No 635953 For cell culture e Tissue culture plates and flasks available from BD Discovery Labware www bdbiosciences com discovery_labware e Dulbecco s Modified Eagle s Medium DMEM Sigma Cat No D5796 Alpha Minimal Essential Medium Eagle alpha MEM RPMI 1640 or other specified medium e Fetal bovine serum FBS It is critical that the FBS in your tissue culture media not inhibit Tet responsive expression You can eliminate Tc contamination problems by using the Clontech s Tet System Ap proved FBS that has been functionally tested in the Tet Systems to ensure against possible Tc contamination Each Inducible RNAi System includes 50 ml of Tet System Approved FBS Additional FBS is available for purchase in a wide variety of sizes Cat Nos 631105 631101 631107 amp 631106 For more details about FBS andTc contamination please see Section VII A of the Tet Off and Tet On Gene Expression Systems User Manual PT3001 1 200 mM L Glutamine Sigma Cat No G7513 e Solution of 10 000 units ml Penicillin G sodium and 10 000 ug ml Streptomycin sulfate Sigma Cat No P0781 Trypsin EDTA VWR Hyclone Cat No 16777 166 Protocol No PT3810 1 www clontech com Clontech Labor
48. kout RNAi Clone and Confirm RetroO RNAI Core System Cat No 632476 These kits pro vide you with a simple and efficient way to generate candidate shRNA expression cassettes SECs for functional screening SECs are ready to transfect PCR fragments generated by one round of PCR with your vector The yield of SEC from a single PCR reaction is sufficient for at least 10 transfections For details on these kits please see the Knockout RNAI Clone and Confirm PCR Kits User Manual PT3779 1 Alternatively you can transiently transfect pSIREN RetroO Tet shRNA DNA generated in Section VI C into a stable tTS cell line or a premade Clontech tTS Cell Line and screen for effective knockdown This screening can be performed after 48 hrs of induc tion We recommend that you use the Clone and Confirm System for screening because transfection of pSIREN RetroO Tet vectors creates an environment more prone to promoter interference due to the presence of the LTRs on the plasmid If the gene you are silencing does not contain a tag you will need to design a gene specific assay to test for its knockdown Examples of gene specific assays that can be used include e Western blot with an antibody to Protein X e RT PCR using Gene X primers Be sure you can discriminate PCR products generated from genomic DNA from true RT PCR products e Northern blot with Gene X probe Functional assay for Protein X ProLabel Screening Kits Ourscreening kits allow fast a
49. lements from the CMV promoter on the regulator construct can induce basal expression of the TRE U6 promoterontheresponseconstruct Furthermore cotransfection prevents comparison of multiple clones since differences in induction or abso lute expression could be due to clone to clone variation in expression of tTS and or pSIREN RetroO Tet vectors In contrast consecutive introduction of the regulator and response plasmids has several advantages Most importantly the response plasmid generally will not cointegrate with the regulator allowing you to select a double stable inducible RNAi cell line that gives very low to no background expression of your shRNA Furthermore once you have developed a suitable inducible RNAi cell line it provides a proven genetic background into which you can introduce many differ ent response plasmids Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual V shRNA Oligonucleotide Design This section describes the process of identifying target seguences within a gene ofinterestand designing the corresponding oligonucleotides to generate the shRNA Comprehensive online tools to assist you with shRNA oligonucle otide design can be found at http bioinfo2 clontech com rnaidesigner A Selecting Target Sequences 1 Choose a region of 19 nucleotides Do not select sequences within the 5 and3 untranslated regions UTRs norreg
50. mination Additional FBS can be purchased separately Cat Nos 631105 631101 631107 amp 631106 If you observe a sudden loss of responsiveness check your serum by performing a dose response curve as described in Section VII A of the Tet Off and Tet On Gene Expression Systems User Manual PT3001 1 You can also try replating and washing the cells 3 hr later to remove any residual antibiotic that may be interfering with induction control Rennel amp Gerwins 2002 Loss of regulation can also be due to switching off or methylation of the viral promoter It is recommended that you subclone and freeze stocks of your cells at various stages to mitigate this risk Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual XII Analysis of Results and Troubleshooting Guide A Poor transformation efficiency Low transformation efficiency can be the result of a problem with the oligonucleotides ligation and or transformation Incompatible ends Confirm that the ends of the annealed oligo on the insert Ineffective oligo annealing Oligos are not full length Suboptimal oligo concentration in ligation Inactive ligase and or ligase buffer Suboptimal competent cells Clontech Laboratories Inc nucleotide contain 5 BamH and 3 EcoR overhangs for proper ligation into pSIREN Ret roQ Tet vectors Verify that the top and bottom stran
51. mycin Kill Curves 28 B Test Potential Host Cells by Transient Transfection 29 with ptTS Neo and pSIREN RetroO Tet Luc IX Development of Tet tTS Stable Cell Lines 31 A Transfection with ptTS Vector and Selection 31 B Infection with pOC tTS IN Vector and Selection 33 C Screening Tet tTS Stable Cell Lines 34 Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual Table of Contents continued X Development of Double Stable Cell Lines A Screening pSIREN RetroO Tet shRNA Constructs B Infection with pSIREN RetroO Tet Construct and Selection of Double Stable Cell Lines C Screening Double Stable Inducible RNAI Cell Lines XI Working with Double Stable Inducible RNAi Cell Lines A Determination of Effective Concentrations of Dox B Loss of Regulation XII Analysis of Results and Troubleshooting Guide XIII References Appendix Vector Information List of Figures Figure 1 Mechanism of RNA interference RNAI Figure 2 Small hairpin RNAs shRNAs generated using an oligonucleotide DNA sequence Figure 3 Schematic of gene regulation in the inducible tTS system Figure 4 Overview of the Knockout Inducible RNAi Systems procedure Figure 5 shRNA oligonucleotide sequence design Figure 6 Dox dose response curve for analyzing knockdown by transient transfection Figure 7 Flowchart for developing Tet tTS stable cell lines Figure 8 Flow
52. nd quantitita tive chemiluminescent measurement ofthe expression levels of any gene fused to the ProLabel tag The kits are supplied in two formats a Creator format for genes already cloned into the Creator back bone Cat No 631542 and an In Fusion format for PCR cloning of precise directional constructs Cat No 631724 For more details please see the ProLabel Screening Kit User Manual PT3789 1 Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 35 Knockout Inducible RNAi Systems User Manual X Development of Double Stable Cell Lines continued e Insert shRNA oligo into pSIREN RetroOQ Tet vector pSIREN RetroO Tet e Generate recombinant pSIREN RetroQ Tet shRNA 4 e Infect tTS stable cell line with recombinant virus gt pSIREN RetroQ Tet shRNA e Select in presence of hygromycin or puromycin mm o e Isolate at least 30 hygromycin or puromycin resistant clones GE Geen GE GE OPTIONAL Confirm presence of integrated shRNA in clones by PCR e Screen by a gene specific assay for clones with Low background of shRNA Dox Tc High induction of shRNA Dox Tc v Possible assays Double stable inducible RNAi Western blot using an antibody to Protein X cell line RT PCR using Gene X primers Northern blot with Gene X probe Functional assay for Protein X Prolabel Screening Kits Expand and free
53. ne specific assay to test for the suppression of Gene X Examples of assays that can be used include Western blot with an antibody to Protein X RT PCR using Gene X primers Be sure you can discriminate between PCR products generated from true RI PCR products and those from genomic DNA Northern blot with specific probe to Gene X Functional assay for Protein X ProLabel Screening Kits Our screening kits allow fast and quantititative chemiluminescent measurement of expression levels of any gene fused to the ProLabel tag The kits are sup plied in two formats a Creator format for genes already cloned into the Creator backbone Cat No 631542 and an In Fusion format for PCR cloning of precise direction al constructs Cat No 631724 For more details please see the ProLabel Screening Kit User Manual PT3789 1 Clontech Laboratories Inc www clontech com Protocol No PT3810 1 16 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual IV Protocol Overview continued INTRODUCE GENERATE REGULATOR CONSTRUCT RESPONSE CONSTRUCT shRNA sequence design Section V Y Anneal complementary shRNA oligonucleotides Section VI A Ligate annealed oligonucleotides into pSIREN RetroO Tet vector Section VI B Transfect target cells Infect target cells Transform E coli with ptTS Neo _with pOC tTS IN with pSIREN Retro0 Tet shRNA Section DA Section IX B and PT3132 1 Section VI C Aw Establi
54. ner at 20 C for 1 2 hr Transfer to 80 C overnight Remove vials from styrofoam container or cryo containers the following day and place in liquid nitrogen or ultralow temperature freezer 150 C for storage 7 Two or more weeks later Plate a vial of frozen cells to confirm viability Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual VIII Pilot Experiments A Titrating G418 Hygromycin and Puromycin Kill Curves Prior to using G418 hygromycin or puromycin to establish stable and double stable cell lines it is important to titrate your selection agent stocks to determine the optimal concentration for selection with the par ticular hostcell line being tested This is also important because of lot to lot variation in the potency of these drugs Therefore you should titrate each newlotof antibiotic to determine the optimal concentration We rec ommendthat you perform two experiments for each drug 1 atitration to determine the optimal drug concentration and 2 an experiment to determine the optimal plating density This step is recommended even if you are using one of our premadelettTS cell lines see Related Products 1 Titrate at fixed cell density a Plate 2x 10 cells in each of six 10 cm tissue culture dishes con taining 10 ml of the appropriate complete medium plus varying amounts 0 50 100 200 400 800 ug ml of
55. ochem Sci 18 471 475 Gossen M Bonin A L Freundlieb S amp Bujard H 1994 Inducible gene expression systems for higher eukaryotic cells Curr Opin Biotechnol 5 516 520 Gossen M amp Bujard H 1992 Tight control of gene expression in mammalian cells by tetra cycline responsive promoters Proc Natl Acad Sci USA 89 12 5547 5551 Gossen M amp Bujard H 1993 Anhydrotetracycline a novel effector for tetracycline controlled gene expression systems in higher eukaryotic cells Nucleic Acids Res 21 4411 4412 Gossen M amp Bujard H 1995 Efficacy of tetracycline controlled gene expression is influenced by cell type Bio Techniques 89 213 215 Gossen M Freundlieb S Bender G Muller G Hillen W amp Bujard H 1995 Transcriptional activation by tetracycline in mammalian cells Science 268 5218 1766 1769 Gupta S Schoer R A Egan J E Hannon G J amp Mittal V 2004 Inducible reversible and stable RNA interference in mammalian cells Proc Natl Acad Sci USA 101 7 1927 1932 Hammond S M Caudy A A amp Hannon G J 2001 Post transcriptional gene silencing by double stranded RNA Nature Rev Gen 2 110 119 Harborth J Elbashir S M Bechert K Tuschl T amp Weber K 2001 Identification of essential genesin cultured mammalian cells using small interfering RNAs J Cell Science 114 4557 4565 Hillen W amp Berens C 1994 Mechanisms underlying expres
56. on parameters for each cell type is crucial to obtaining consistently successful transfections Therefore foreach celltype you planto use perform preliminary experiments to determine the optimal 1 amountoftransfection reagent 2 amountand pu rity of DNA 3 ratio of transfection reagentto DNA 4 cell density 5 transfection incubation time and 6 media conditions If you are using Clonfectin Transfection Reagent see the User Manual for more information You should test a minimum of 3 4 pSIREN RetroO Tet constructs per gene to optimize gene silencing We provide enough pSIREN RetroO Tet vector in each kit to perform 40 ligations which allows you to screen for functional shRNA sequences within your gene of interest www clontech com Clontech Laboratories Inc Knockout Inducible RNAi Systems User Manual XII Analysis of Results and Troubleshooting Guide cont C Poor knockdown efficiency Poor knockdown efficiency can be the result of a problem with the host cell line target sequences or insufficient suppression Unsuitable host cell line Target sequence not optimal Insufficient suppression leaky background Cell system may not be compatible with the Tet expression system Perform atransienttransfection assay with ptTS Neo pSIREN RetroO Tet Luc and a luciferase expression vector to ensure function ality in your cell system Section VIII B Screen your shRNA oligos by using the Knockout Clone and Conf
57. oviral infection Both plasmids contain the neomycin resistance gene to allow for the end point selection of double stable cell lines containing both the tTS and your recombinant pSIREN RetroO Tet shRNA vector Both pSIREN RetroO Tet constructs can either be transfected directly into target cells as plasmids or be used to generate virus by transfec tion into a_ suitable packaging line The virus produced can then be used to infect a broad range of mitotically active target cells of interest Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 9 Knockout Inducible RNAi Systems User Manual l Introduction continued The retroviral vector is optimized to eliminate promoter inferference through self inactivation The hybrid 5 LTR of both vectors consists of the cytomegalovirus CMV type enhancer and the mouse sarcoma virus MSV promoter This construct drives high levels of transcription in HEK 293 based packaging cell lines that peaks 48 hr after transfection The self inactivating feature of the vector is provided by a deletion in the 3 LTR enhancer region U3 During reverse transcription ofthe retroviral transcript in the infected cell the inactivated 3 LTR is copied and re places the 5 LTR resulting in inactivation of the 5 LTR CMV protomer Although pSIREN RetroQ Tet constructs can be introduced by either transfection or infection we recommend the latter in orderto avoid pro moter
58. pon thawing Step 5 centrifuge cells if suspension cultures aspirate the medium and replace with fresh prewarmed complete medium without antibiotics 7 Expand the culture as needed Note The appropriate selective antibiotic s may be added to the medium after 48 72 hr in cul ture E Preparing Frozen Stocks of Inducible RNAi Cell Lines Once you have started growing aTet system cell line either a premade one from Clontech or one of your own cell lines prepare frozen ali guots to ensure a renewable source of cells 1 2 3 4 Trypsinize the desired number of flasks Pool cell suspensions together count cells and calculate total vi able cell number Centrifuge cells at 125 x g for 10 min Aspirate the supernatant Resuspend the pellet at a density of at least 1 2 x10 cells ml in freezing medium Freezing medium can be purchased from Sigma Cat Nos C6164 amp C6039 or freeze cells in 70 90 FBS 0 20 medium no additives and 10 DMSO Clontech Laboratories Inc www clontech com Protocol No PT3810 1 26 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual VII Cell Culture Guidelines continued 5 Dispense 1 ml aliguots into sterile cryovials 6 Freeze slowly 1 C per min Nalgene makes cryo containers Nalgene Cat No 5100 forthis purpose if a specialized freezer is not available freeze at 80 C overnight Alternatively place vials in a thick walled styrofoam contai
59. ptTS Neo P 6 2 kb Col E1 ori Pc Xbal 2211 spKid 1 Hind lll 4233 Figure 11 Restriction map of the ptTS Neo Vector The ptTS Neo Vector is an expression vector designed to express the tetracyline controlled transcriptional suppressor tTS The tTS is a fu sion of theTet repressor protein TetR and the KRAB AB silencing domain of the Kid 1 protein SDKi 1 a powerful transcriptional repressor Freundlieb et al 1999 Witzgall et al 1994 In the absence of Dox tTS binds to the tetOseguence in the Prpemog Of aTetresponse plasmid pSIREN RetroO TetH or pSIREN RetroO TetP and suppresses expression of the shRNA As Dox is added tothe culture medium thetTS dissociates from the Paco relieving transcriptional suppression ptTS Neo also contains a bacterial origin of replication and E coli Amp gene for propagation and selection in bacteria as well as a neomycin gene for the selection of stable transfectants Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual Appendix Vector Information continued CMV MSV 5 LTR pOC tTS IN SV40 8 2 kb ori Stu 5918 cA 5 Sequencing Primer Xho 4661 Figure 12 Restriction map of the pOC tTS IN Vector The pOC tTS IN Retroviral Vector is a bicistronic expression vector designed to express the tetracyline controlled transcriptional suppressor tTS along with the neomycin sel
60. ration of destabilized enhanced green fluorescent protein as a transcription reporter J Biol Chem 273 34970 34975 Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual XIII References continued Nykanen A Haley B amp Zamore P D 2001 ATP reguirements and small interfering RNA structure in the RNA interference pathway Cell 107 309 321 Ory D S Neugeboren B A amp Mulligan R C 1996 A stable human derived packaging cell line for production of high titer retrovirus vesicular stomatitis virus G pseudotypes Proc Natl Acad Sci USA 93 21 11400 11406 1 Paddison P J Caudy A A Bernstein E Hannon G J amp Conklin D S 2002 Short hairpin RNAs shRNAs induce seguence specific silencing in mammalian cells Genes amp Dev 16 948 958 Paul C P Good P D Winer amp Engelke D R 2002 Effective expression of small interfering RNA in human cells Nature Biotechnol 20 505 508 Pear W S Nolan G P Scott M L amp Baltimore D 1993 Production of high titer helper free retroviruses by transient transfection Proc Natl Acad Sci USA 90 18 8392 8396 pTRE Tight Vectors 2003 Clontechnigues XVIII 2 10 11 Rennel E amp Gerwins P 2002 How to make tetracycline regulated transgene expression go on and off Anal Biochem 309 79 84 Resnitzky D Gossen M Bujard H amp Reed
61. rt hairpin RNA shRNA under the control of the modified Tet responsive promoter Pragsogue derived from the Prpemog Promoter and the human U6 promoter Pjs RNAi Ready pSIREN RetroO TetH is provided as a linearized vector digested with BamH I and EcoR I It is used for targeted and inducible gene silencing when a DNA oligonucleotide encoding an appropriate shRNA is ligated into the vector shRNA expression is controlled by the tetracycline transcriptional suppressor ptTS Freundlieb et al 1999 Prremog contains a modified Tet response element TRE moa which consists of seven direct repeats of a 36 bp sequence that contains the 19 bp tet operator sequence tetO You can transfect your pSIREN RetroQ TetH construct as a plasmid expression vector or upon transfection into a packaging cell line this vector can transiently express or integrate and stably express a viral genomic transcript containing the Prremogus Promoter and the shRNA The vector contains a hygromycin resistance gene Hyg under the control of the murine phosphoglycerate kinase PKG promoter P5 for the selection of stable transfectants This retroviral vector is optimized to eliminate promoter interference through self inactivation The hybrid 5 LTR consists of the cytomegalovirus CMV type I enhancer and the mouse sarcoma virus MSV promoter This construct drives high levels of transcription in HEK 293 based packaging cell lines due in part to the presence of adenoviral
62. s R amp Agami R 2002 A system for stable expression of short interfering RNAs in mammalian cells Science 296 550 553 ChenY Stamatoyannopoulos G amp Song C Z 2004 Down regulation of CXCR4 by inducible small interfering RNA inhibits breast cancer cell invasion in vitro Canc Res 63 4801 4804 Cunningham S M Cunningham M D Zhu L amp Kain S 1997 Determination and correlation of expression levels of luciferase and EGFP using the tetracycline controlled gene expression system and fluorescence imaging Neuroscience Abs 23 647 Elbashir S M Lendeckel W amp Tuschl T 2001 RNA interference is mediated by 21 and 22 nucleotide RNAs Genes Dev 15 2 188 200 Emerman M amp Temin H M 1984 Genes with promoters in retrovirus vectors can be independently suppressed by an epigenetic mechanism Cell 39 3 pt 2 449 467 Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual XIII References continued Freshney R I 2000 Culture of Animal Cells Fourth Edition Wiley Liss NY Freundlieb S Schirra Muller C amp Bujard H 1999 A tetracycline controlled activation repression system with increased potential for gene transfer into mammalian cells J Gene Med 1 4 12 Gossen M Bonin A amp Bujard H 1993 Control of gene activity in higher eukaryotic cells by prokaryotic regulatory elements Trends Bi
63. sh tTS stable line Viral packaging of by G418 selection pSIREN RetroQ Tet shRNA DNA Section IX C See PT3132 1 Infect tTS stable line INTRODUCE with pSIREN Retro0 Tet shRNA virus RESPONSE CONSTRUCT Section X B and PT3132 1 Establish double stable line ESTABLISH We EEN KNOCKOUT INDUCIBLE RNAi 5 iy couple ee CELL LINE with G418 and Hyg Pur selection Section X C Retroviral Gene Transfer and Expression Systems User Manual PT3132 1 Figure 4 Overview of the Knockout Inducible RNAi Systems procedure This procedure illustrates the primary steps to generate an inducible RNAi cell line using two consecutive introductions of recombinant DNA the regulator construct and the response construct Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 17 Knockout Inducible RNAi Systems User Manual IV Protocol Overview continued Plasmid DNA purity for transfections Section VI To ensure DNA purity isolate all plasmids for transfection using a NucleoBond Plasmid Maxi EF Kit Cat No 635953 or by CsCl density gradient purification Sambrook et al 2001 Important note on simultaneous versus consecutive transfections In general we recommend that you do not attemptto save time by coin troducing using either transfection or viral delivery methods the regula tor and response plasmids Cotransfected plasmids tend to cointegrate into the chromosome and enhancer e
64. sion ofTn10 encoded tetracycline resistance Annual Rev Microbiol 48 345 369 Hillier L et al 1996 Generation and analysis of 280 000 human expressed sequence tags Genome Res 6 807 828 Hirai H amp Wang H G 2002 A role of the C terminal region of human Rad9 hRad9 in nuclear transport of the hRad9 checkpoint complex J Biol Chem 277 28 25722 25727 Hutvagner G amp Zamore P D 2002 RNAi nature abhors a double strand Curr Opin Genet ics amp Development 12 225 232 Julius M A Yan O Zheng Z amp Kitajewski J 2000 O Vectors Bicistronic retroviral vectors for gene transfer Bio Techniques 28 4 702 707 Kinsella T M amp Nolan G P 1996 Episomal vectors rapidly and stably produce high titer recombinant retrovirus Hum Gene Ther 7 18 1405 1413 Kozak M 1987 An analysis of 5 noncoding regions from 699 vertebrate messenger RNAs Nucleic Acids Res 15 8125 8148 Kunkel G R amp Pederson T 1989 Transcription of a human U6 small nuclear RNA gene in vivo withstands deletion of intragenic sequences but not of an upstream TATATA box Nucl Acids Res 17 7371 7379 Lee N S Dohjima T Bauer G Li H Li M J Ehsani A Salvaterra P amp Rossi J 2002 Expression of small interfering RNAs targeted against HIV 1 rev transcripts in human cells Nature Biotechnol 20 500 505 Li X Zhao X Fang Y Jiang X Duong T Huang C C amp Kain S R 1998 Gene
65. ted genes Our comprehensive online designer tool at http bioinfo2 clontech com rnaidesigner can design the required oligonucleotides for any sequence inputted See Section IV for our recommendation to use PAGE purified oligonucleotides It is possible to clone without PAGE purification but it is likely that the overall ligation efficiency and the number of correct clones will decrease due to the presence of incomplete oligonucleotide extensions If the oligonucleotides are PAGE Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual V shRNA Oligonucleotide Design continued purified order them at the 200 nmol scale There is no need to order phosphorylated oligonucleotides pSIREN RetroO Tet Vectors have not been dephosphorylated after linearization thus ligation will proceed smoothly using unphosphorylated oligonucleotides In fact use of phosphorylated oligonucleotides may reduce your cloning efficiency Test RE BamH If Target sense sequence Hairpin loop Target antisense sequence Terminator site Top strand 5 GATCCGNNNNNNNNNNNNNNNNNNNTTCAAGAGANNNNNNNNNNNNNNNNNNNTTTTTT NNNNNN G 3 Bottom strand 3 GCNNNNNNNNNNNNNNNNNNNAAGTTCTCTNNNNNNNNNNNNNNNNNNNAAAAAA NNNNNN CTTAA 5 EcoR I Figure 5 shRNA oligonucleotide seguence design The arrow denotes the purine residue reguired for RNA Pol lll to initiate transcription The hairpin loop se
66. th a restric tion enzyme 3 Plate transfected cells in ten 10 cm culture dishes each containing 10 ml of the appropriate complete medium at the optimal density determined in Section VIII 4 Allowcellsto divide twice 24 48 hr then add G418 to 400 500 ug ml Note The exact concentration of G418 for selection and the optimal plating density may vary from cell type to cell type and with different lots of G418 See Section VIII A 5 Replace medium with fresh complete medium plus G418 every four days or more often if necessary After about five days cells should start to die Split the cells if they reach confluency before massive cell death begins After 2 4 weeks isolated colonies should begin to appear 6 Isolate large healthy colonies and transfer them to individual plates or wells Suspension cultures must be cloned using the limiting dilution technique When working with adherent cells at Clontech we generally isolate clones using cloning cylinders or cloning discs B Infection with pOC tTS IN and Selection Figure 7 1 Grow cells to 80 confluency in complete medium or to a density appropriate for your infection method 2 Infect cells with pOC tTS IN retroviral vector using methods detailed in SectionVII A of the Retroviral GeneTransfer and Expression User Manual PT3132 1 3 24 hr post infection plate infected cells in ten 10 cm culture dishes each containing 10 ml of the appropriate complete medium at the
67. troO Tet Luc control vector and a luciferase vector As a starting point you can try the following ratio of the constructs ptTS Neo _ pSIREN RetroO Tet Luc luciferase vector 2 ug 1 ug 1 Ug 2 ug 2 ug 1 Ug When using HEK 293 cells plated at 1 x 10 per well roughly 60 70 confluent and transfected with the 2 1 1 ratio of ptTS Neo pSIREN Ret roO TetP Luc pCMV Luc we consistently observe a 60 75 knockdown of luciferase activity with 48 hr of 1 ug ml Dox induction as shown in Figure 6 When using MCF7 or HeLa cells we observe a 60 75 knock down of Luciferase activity within 72 hr of 1 ug ml Dox induction Important Note Knockdown levels are almost always lower in tran sient assays than in properly screened stable and double stable cell lines since the amount of plasmid in the cell may titrate out the tTS to some degree Therefore an apparent lack of induction response in the transient assay should not be the sole reason for aborting your experiments in a particular cell line In this case titration of the input plasmids may help to give better induction profiles Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 29 Knockout Inducible RNAi Systems User Manual VIII Pilot Experiments continued 35000 aS 30000 EE 25000 SE lt gt 20000 B cs 15000 S 10000 5000 0 0 0 001 0 01 0 1 1 0 2 0 Doxycycline pg ml Figure 6 Dox dose response cur
68. ts of Dox 2 5 ug ml to ensure full removal of the repressor We have found the tTS based system to be sensitive to as little as 10 ng ml Dox see Figure 6 e Other inducible RNAi systems rely solely on direct steric hin drance of polymerase binding through the action of repressor proteins such as TetR alone Such repression based systems require very high and difficult to attain levels of repressor to ensure 100 occupancy of the regulatory sites Even if suitably high levels of repressor can be obtained the presence of high repressor levels makes it difficult to achieve rapid high level induction Yao et al 1998 In the system described here regula tion of the promoter is an active process controlled by the action of a transcriptional suppressor tTS In contrast to other regula tory systems for inducible expression of shRNAs the tTS protein actively suppresses polymerase activity at the promoter rather than simply blocking the binding of the polymerase to the TATA box in a passive manner Thus the system does not require such high level expression of the suppressor making induction faster and more tightly controlled Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual ll List of Components Store all components at 20 C Visit our Tet Systems product page at www clontech com for a current list of cell lines and products availabl
69. ve for analyzing knockdown by transient transfection HEK 293 cells plated at 1 x 10 per well were transiently transfected with ptTS Neo pSIREN RetroO TetP Luc and pCMV Luc in a 2 1 1 ratio A dose response curve exhibits a 75 knockdown in relative light units RLU of luciferase activity with 48 hr of 1 ug ml Dox induction Similar knockdown results were obtained with HeLa cells data not shown Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual IX Development of Tet tTS Stable Cell Lines PREMADE Tet tTS CELL Le The following protocols describe the development of Tet cell lines stably expressing the tTS regulator plasmid You must optimize the protocol for each cell type The parameters most likely to need adjustment include plating densities delivery method G418 concentrations for selection and incubation and growing times The tTS regulatory protein can be delivered by either transfection or infection methods Introduction by transfection is accomplished with the plasmid vector ptTS Neo as outlined in Step A If you are delivering the tTS regulatory construct via infection this method requires the retroviral vector DOC tTS IN and is outlined in Step B Regardless of the cell type and delivery method the goal is to generate a Tet cell line that gives both high expression of luciferase activity in the absence of Dox and high knockdown of
70. vector is optimized to eliminate promoter interference through self inactivation The hybrid 5 LTR consists of the cytomegalovirus CMV type I enhancer and the mouse sarcoma virus MSV promoter This construct drives high levels of transcription in HEK 293 based packaging cell lines due in part to the presence of adenoviral E1A Kinsella amp Nolan 1996 Ory et al 1996 Pearet al 1996 Yang et al 1999 in these cells The self inactivating feature of the vector is provided by a deletion in the 3 LTR enhancer region U3 During reverse transcription of the retroviral RNA the inactivated 3 LTR is copied and replaces the 5 LTR resulting in inactivation of the 5 LTR CMV enhancer sequences This mechanism may reduce the phenomenon known as promoter interference Barton amp Medzhitov 2002 Emerman amp Temin 1984 and allow more efficient expression Viral infection of host cells with recombinant pSIREN RetroO TetP is the preferred delivery method Also included in the viral genomictranscript are the necessary viral RNA processing elements including the LTRs packag ing signal Psi and tRNA primer binding site RNAi Ready pSIREN RetroQ TetPalso contains a bacterial origin of replication and E coliAmp gene for propagation and selection in bacteria Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 7 Knockout Inducible RNAi Systems User Manual Appendix Vector Information continued
71. yline controlled system has been established successfully in many cell types as well as transgenic mice rats plants and yeast The key in generating successful stable cell lines is to pick and screen carefully reasonable number of clones we usually pick at least 30 clones at each step Clonal variation in expression of both the integrated tTS construct and the shRNA construct can be caused by the integration site and by down regulation through for example methylation Such clonal specific variation is readily mitigated simply by screening more clones A Determination of Effective Concentrations of Dox The concentrations of Dox listed throughout this protocol are approximate The optimal concentration may vary with different cell lines and with different antibiotic lots In general full activation of shRNA expression with stable cell lines can be obtained with 100 ng 1 ug ml Dox Perform a dose response curve similar to the experiment shown in Figure 6 Section VIII B Loss of Regulation On occasion well characterized double stable cell lines can lose their responsiveness to Dox This can occur after changing lots of calf or fetal bovine serum and appears to be due to contamination of some lots of serum with Tc You can eliminate Tc contamination problems by using the Clontech sTet System Approved FBS provided with the Inducible RNAi System This serum has been functionally tested in the Tet Systems to ensure against possible Tc conta
72. you grow and analyze as many clones as possible We typically screen 30 clones to obtain one that exhibits suitably high induction and low background 1 Grow stableTet tTS cells to 80 confluency in complete medium or to a density appropriate for your infection method 2 Infect with pSIREN RetroQ Tet using methods detailed in Section VII A of the Retroviral Gene Transfer and Expression User Manual PT3132 1 3 At 24 hr post infection plate infected cells in ten 10 cm culture dishes each containing 10 ml of the appropriate complete medium at the optimal density determined in Section VIII A 4 Allow cells to divide twice 24 48 hr then add the appropriate selec tion agent hygromycin or puromycin to the optimal concentration determined in Section VIII A For hygromycin the range is generally 200 400 ug ml and for puromycin it is 0 5 3 ug ml Note The exact concentration of antibiotic for selection and the optimal plating density may vary from cell type to cell type and with different lots See Section VIII A for details 5 Replace medium with fresh complete medium containing the se lection antibiotic hyg or pur every 4 days After about 3 5 days cells in selection media should start to die Split cells ifthey reach confluency before massive cell death begins Protocol No PT3810 1 www clontech com Clontech Laboratories Inc Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual X Development of Dou
73. ze stocks of double stable inducible RNAi cell lines Figure 8 Flow chart for developing double stable inducible RNAi cell lines Clontech Laboratories Inc www clontech com Protocol No PT3810 1 Version No PR7Z2455 Knockout Inducible RNAi Systems User Manual X Development of Double Stable Cell Lines continued Important Note Knockdown levels are likely to belowerintransient assaysthan in properly screened stable and double stable cell lines since the amount of plasmid in the cell may titrate out the tTS to some degree Therefore an apparent lack of induction response in the transient assay should not be the sole reason for aborting your experiments in a particular cell line In this case titration of the input plasmids may help to give better induction profiles B Infection with pSIREN RetroQ Tet Construct and Selection of Double Stable Cell Lines Figure 8 The next step is to stably introduce your pSIREN RetroQ Tet construct into the stable or premade Tet tTS cell line The goal is to generate a double stable cell line that gives both low background and high inducible expression of your shRNA Both expression levels and induction of your shRNA can be profoundly affected by the site of integration Insertion near an enhancer may result in high basal expression of the shRNA whereas other insertion sites may resultin suboptimal induction To find the clone with the highest induction and lowest background we recommend that

Download Pdf Manuals

Related Search

Related Contents

Breville BT320 Toaster User Manual  Click here for manual  Manuel d`utilisation iroha Mikazuki & Minamo  Philips 8718291794158 energy-saving lamp  Olympus C-50 Reference Manual  

Copyright © All rights reserved. Failed to retrieve file