Ready-To-Glow™ Secreted Luciferase Reporter Systems User Manual
Contents
1. 12 PR922708 www clontech com Clontech Laboratories Inc ATakara Bio Company Ready To Glow Secreted Luciferase Reporter Systems User Manual IV Troubleshooting Guide Table I Troubleshooting the Ready To Glow Secreted Luciferase Reporter Assay Problem Explanation Solution O S Little or no signal Number of transfected Ensure that the transfection efficiency has been optimized by from transfected cells is too low using the supplied control vector as an internal positive control cells for luciferase expression Increase the number and or density or concentration of cells used in transfections Transfected cells are not If the signal from the positive control media from cells trans yet producing Metridia fected with the pMetLuc Control Vector is low incubate the luciferase transfected cells in media for a longer time before collecting supernatant samples Increase the time of transfection before starting the experiment Plate reader requires Refer to the instrument s instructions for methods to increase the adjustment sensitivity of light detection Signal quenches Although the signal inten Continue with your experiment as usual rapidly within a sity decreases over time few minutes of sub the overall fold induction strate addition remains the same for 30 min after substrate addi tion Part I Figure 3 Substrate stock Possibly due to partial oxi Ensure that the substrate is working properl2. Appendix A Transfections amp Experimental Controls A Transfections 1 Transfection Methods All Ready To Glow vectors can be transfected into mammalian cells by your standard transfection method of choice If you do not have an established transfection protocol or if you are working with a cell line for the first time we recommend comparing different protocols using the pMetLuc2 Control vector and monitoring the amount of secreted Metridia luciferase in the cell supernatant in order to determine efficiency and choose an appropriate protocol 2 Transfection Considerations a Perform each transfection in triplicate If cells are sampled in multiwell plates we recommend transfect ing one master stock and then transferring cells from this master stock into the wells of a multiwell plate to avoid variations that may occur if cells in each well were transfected separately b Normalize for transfection efficiency When monitoring the effect of promoter and enhancer sequences on gene expression it is critical to include an internal control that will distinguish differences in the level of transcription from variability in the efficiency of transfection Sambrook amp Russell 2001 This is easily done by cotransfecting a second plasmid that constitutively expresses another reporter that can be clearly differentiated from secreted Metridia luciferase The level of this second reporter can then be used to normalize the levels of luciferas
3. User Manual Ready To Glow Secreted Luciferase Reporter Systems User Manual O Clontech United States Canada 800 662 2566 Asia Pacific 1 650 919 7300 Europe 33 0 1 3904 6880 Japan 81 0 77 543 6116 PT3902 1 PR922708 ota Cat Nos 631729 631735 631742 ATakara Bio Company 631744 amp 631747 1290 Terra Bella Ave Mountain View CA 94043 Published 10 April 2009 Technical Support US E mail tech clontech com www clontech com Ready To Glow Secreted Luciferase Reporter Systems User Manual Table of Contents lo A AAA 3 A The Ready To Glow Reporter ASSY icon iria 3 B The Ready To Glow Reporter Vectors usina ca ice id i 4 C Characteristics of the Secreted Metridia Luciferase Sigraliisssisrsisriierisiisenoererssseni en anive 5 D The Ready To Glow Dual Secreted Reporter Assay ooooconconnonncnnnnnoncncnnncnronnnnn nono nannnn non onon on non ikenien 6 Il Additional Materials Required cccocmncononnccncnnncconononnnnnnncnnnnnnnnononnnnnnnnnnnnnrn nn nr nnnnnnnnnnns 8 A Microtiter Plates to Perform the Assay csssessesesseseeseseeseseeecseecaeeecaseecasecaesaeaeeaeaeaeeneaeeeaeeeeaeereneets 8 B Vectors to Normalize Transfection Efficiency scceseceseeseseesesseecsseeceeeseseeseseeseeeeseeeeaeeecaeecaeeecneeecneeeens 8 C E coli Competent Cells for Plasmid Propagation cccsesesesesseesesseseecseseececasseeeeseasseseeseessenseeeeeetaes 8 D Kits for Plasmid DNA Isola sisosc
4. 0 10 20 30 40 50 Time after addition of substrate min Figure 2 High signal intensity and stability of secreted Metridia luciferase CHO cells were plated into 96 well plates and transiently trans fected with CMV driven constructs encoding non secreted firefly luciferase non secreted Renilla luciferase and sequence optimized secret ed Metridia luciferase 24 hr after transfection luciferase activity in equivalent samples was analyzed by addition of the recommended sub strate The signal was measured at different time points over a period of 45 min following the addition of substrate neg negative control In order to further examine the stability of the Metridia luciferase signal we transiently transfected the pNF B Met Luc2 Reporter Vector into HeLa cells 24 hours later we induced the cells with TNF a to activate the NF B signaling pathway Six hours after that we detected response element activation by assaying the cell supernatant for secreted Metridia luciferase activity Although signal intensity after substrate addition decreased with time the calculated overall fold induction was the same even 30 minutes after substrate addition Figure 3 Haugwitz et al 2008 gt 3 O N TNF o TNF o 6 hr O N A A Q OW 1 10 30 Time after addition of substrate min Fold increase in reporter activity Figure 3 Monitoring promoter activation using the secreted Metridia luciferase reporter HeLa cells were transiently transfected
5. 20 C We do not recommend aliquoting the solution as this may induce oxidation 2 Prepare the 1X Substrate Reaction Buffer Dilute the 10X Substrate Stock Solution Step HI B 1 1 10 in Reaction Buffer To calculate the total volume of 1X Substrate Reaction Buffer needed in your experiment multiply the number of samples in your experi ment by a factor of 5 For example for 20 samples you would prepare 20 x 5 100 pl of 1X Substrate Reaction Buffer by diluting 10 pl of 10X Substrate Stock Solution in 90 pl of Reaction Buffer TO ENSURE CONSISTENT RESULTS prepare fresh 1X fresh Substrate Reaction Buffer every time without H introducing air bubbles Slowly pipet the Substrate Stock Solution or use the tip to stir the mixture gently Attention instead of using rigorous pipetting NEVER VORTEX THE SUBSTRATE OR SUBSTRATE REACTION BUFFER When the Substrate Stock is mixed with the colorless Reaction Buffer the resulting 1X solution is light yellow orange in color Allow the 1X Substrate Reaction Buffer to remain at room temperature for 10 min before use It can remain at room temperature for up to 1 hr before use 3 Transfer 50 pl of culture media from each sample Step III A 5 into one well of a 96 well plate please see Section II for a 96 well plate recommendation NOTE For statistical reasons we recommend assaying triplicates of each sample 4 Add 5 pl of 1X Substrate Reaction Buffer Step III B 2 to each sample
6. Glow Secreted Luciferase Reporter System is a versatile tool for the systematic analysis of eukaryotic promoters and enhancers The system uses secreted Metridia luciferase as a reporter molecule to monitor the activity of promoters and enhancers without the need for cell lysis by sampling media supernatant Each Ready To Glow system includes a pMetLuc Reporter Vector which contains either a specific promoter such as NF B or CRE or a multiple cloning site where you can clone in the promoter sequence you are interested in Transfect your cells of interest with the Reporter Vector and culture until you are ready to begin your experiment Then when you add an inducer the reporter molecule is expressed and secreted out of the cell into the supernatant Simply add the luciferase substrate to a sample of the media supernatant and monitor pMetLuc Reporter gene expression using a simple sensitive non lysis and non radioactive assay for secreted luciferase activity without the need for a cell lysis step Figure 1 You can perform the assay directly in the culture or to transfer an aliquot of supernatant to another plate to perform the assay In either case you will be left with live cells that can be used repeatedly either for multiple time point assays or for any other analysis on the cells Metridia secreted 1 Clone response element MCS luciferase promoter of interest into pMetLuc pMetLuc Reporter vector Reporter Vector
7. RLU 3 10 101 102 102 10 10 10 Metridia luciferase fg Figure 4 Limit of detection of recombinant Metridia luciferase activity Various amounts of recombinant Metridia luciferase were spiked into DMEM 10 FBS in a 96 well plate After addition of substrate the plate was analyzed using a Molecular Devices SpectraMax L plate reader D The Ready To Glow Dual Secreted Reporter Assay Multiplexing two different bioluminescent secreted reporters using different substrates provides even more informa tion on the cell state without sacrificing the cells and creates new advantages for experimental design and analysis For an extended discussion about the SEAP reporter system please refer to PT3057 1 the Great EscAPe SEAP Reporter System User Manual which can be found at www clontech com support manuals asp The Ready To Glow Dual Secreted Reporter Assay No 631734 uses two secreted reporters Metridia luciferase and Secreted Alkaline Phosphatase SEAP that can be detected and distinguished from each other by reporter specific substrates When cells are cotransfected with both reporters and stimulated to express and secrete Metridia luciferase or SEAP or both promoter specific activity can be detected in a sample of culture media by adding the relevant ES A gt ML Substrate gt TNF a gt NFxB RE Metridia luciferase aT SA E ES ZN gt Substrate
8. be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without written approval of Clontech Laboratories Inc CMV Sequence The CMV promoter is covered under U S Patent Nos 5 168 062 and 5 385 839 assigned to the University of lowa Research Foundation Metridia Luciferase Markova S V Golz S Frank L A Kalthof B amp Vysotski E S 2004 Cloning and expression of cDNA for a luciferase from the marine copepod Metridia longa A novel secreted bioluminescent reporter enzyme J Biol Chem 279 5 3212 3117 Living Colors Products AcGFP1 AmCyan AsRed mBanana mCherry DsRed HcRed mOrange mPlum mRaspberry mStrawberry tdTomato ZsGreen ZsYellow and their variants Not For Profit Entities Orders may be placed in the normal manner by contacting your local representative or Clontech Customer Service at 650 919 7300 At its discretion Clontech grants Not For Profit Entities a non exclusive personal limited license to use this product for non commercial life science research use only Such license specifically excludes the right to sell or otherwise transfer this product its components or derivatives thereof to third parties No modificati
9. gt Forskolin gt CRE SEAP AR SA Cell Cell Supernatant Y 8 7 E SEAP signal Secreted Metridia luciferase signal N 5 S 8 a 1 3 1 Fold increase in reporter activity L a 1 0 r TNFa TNka Forskolin forskolin Figure 5 Monitoring the activities of two promoters using the Ready To Glow Dual Secreted Reporter System to investigate potential cross talk between signaling pathways in the same cell HEK 293 cells cotransfected with pNF B TA MetLuc and pCRE SEAP constructs were treated with fresh media alone or with media containing either 1 000 ng mITNF a or 10 uM forskolin Media samples were collected from the transfected cells 7 hr later and each sample was tested in triplicate No cross talk was observed between the cAMP and NF B signaling pathways Protocol No PT3902 1 Version No 6 PR922708 www clontech com Clontech Laboratories Inc ATakara Bio Company Ready To Glow Secreted Luciferase Reporter Systems User Manual l Introduction continued enzyme specific substrate and measuring the resulting chemiluminescence Because the reporters are secreted and do not require cell lysis you will be left with live cells that can be used repeatedly either for multiple time point assays or for any other analysis on the cells Potential applications of the Ready To Glow Dual Secreted Reporter System include e Using one reporter as a tra
10. microtiter plate on aTurner BioSystems Veritas Luminometer For examples of how the Ready To Glow Secreted Reporter Systems can be applied to your promoter studies please see Appendix B Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3902 1 Version No PR922708 7 Ready To Glow Secreted Luciferase Reporter Systems User Manual ll Additional Materials Required A Microtiter Plates to Perform the Assay Bioluminescence detection of luciferase activity can be performed using either a tube or plate luminometer when reactions are carried out in microcentrifuge tubes or in multiwell microtiter plates Ready To Glow assays can be carried out either in 0 5 ml microcentrifuge tubes or multiwell microtiter plates The following type of microtiter plate is recommended e Microlite 1 Luminescence Microtiter 96 well plates Flat Bottom VWR Scientific Products Cat No 62403 124 These opaque white plates which contain flat bottom wells are recommended for bioluminescent assays and detection B Vectors to Normalize Transfection Efficiency The Ready To Glow Dual Secreted Reporter Vector Kit Cat No 631735 includes the pSEAP2 Basic and Control Vectors as well as the pMetLuc2 Reporter and Control Vectors and the respective assays The reporter vectors can be used as transcription reporters while the control vectors serve as positive controls for constitutive promoter activity in the SEAP a secre
11. origin of replication for propagation in E coli and an fl origin for single stranded DNA production A neomycin resistance cassette Neo allows stably transfected eukaryotic cells to be selected using G418 This cassette consists of the SV40 early promoter the neomycin kanamycin resistance gene of Tn5 and polyadenylation signals from the Herpes simplex virus thymidine kinase HSV TK gene A bacterial promoter pKan upstream of the cassette allows kanamycin resistance in coli The pMetLuc2 vectors also include a synthetic transcription blocker TB composed of adjacent polyadenylation and transcription pause sites located upstream of the pCMV promoter which reduces background transcription Eggermont amp Proudfoot 1993 C Characteristics of the Secreted Metridia Luciferase Signal 1 High Signal Intensity and Prolonged Stability of the Secreted Metridia Luciferase Signal Compared to non secreted luciferase reporters such as Renilla luciferase and firefly luciferase secreted Metridia luciferase exhibits a higher signal intensity and prolonged stability after substrate addition making it easy to handle multiple samples at the same time The signal is stable between 20 and 45 minutes after substrate addition Figure 2 Further more the presence of 10 FBS in the media supernatant does not compromise signal intensity Firefly Renilla gt Metridia oi Firefly neg Renillaneg Metridia neg 0 gt p
12. 2 Transfect host cell line Promoter activation leads to 5 6 expression of secreted luciferase o o Q Bs O e o a A protein in the medium gt o k Both y MN O Take sample of supernatant 3 At desired time points assay luciferase activity 000000000000 e Transfer media OOOOOO0000 sample to 96 well plate e Add substrate reaction buffer e Assay luciferase activity in a luminometer OOOOO900000 OOO0000 Add luciferase substrate QOOOOO00000 Secreted SS Iz l luciferase FANNS Product Detection by luminometer Figure 1 Flowchart of the Ready To Glow Secreted Luciferase Reporter Assay procedure The Ready To Glow Secreted Luciferase Re porter System combines the advantages of a live cell assay with the sensitivity of an enzyme based system all in a one step reaction which detects the activity of the secreted reporter enzyme in the supernatant of transfected cells without the need for cell lysis This flowchart describes the process for promoterless pMetLuc Reporter Vectors The procedure is identical for promoter specific pMetLuc Reporter Vectors except that Step 1 is eliminated Clontech Laboratories Inc ATakara Bio Company Protocol No PT3902 1 Version No PR922708 3 www clontech com Ready To Glow Secreted Luciferase Reporter Systems User Manual l Introduction continued The Metridia longa secreted luciferase gene was cloned from the marine copepod Metridia longa and enc
13. If you have many samples in a 96 well plate we recommend using a multichannel pipette in order to reduce the time between substrate addition and signal detection 5 Transfer the plate to a luminometer and record light signals according to the manufacturers recommended luminometer settings TIP We recommend reading the plate s immediately as well as 5 and 10 min after substrate addition If the as say was not performed in a luminometer compatible microtiter plate transfer the entire solution from each well to a suitable plate and place it in the instrument Protocol No PT3902 1 www clontech com Clontech Laboratories Inc Version No PR922708 ATakara Bio Company 10 Ready To Glow Secreted Luciferase Reporter Systems User Manual Ill Ready To Glow Protocols continued C Protocol for Automated Metridia Luciferase Assays 1 Prepare the 100X Substrate Stock Solution Protocol Number of Reactions Quantity of Substrate Buffer 15 min 1 000 rxns Cat No 631739 500 ul 5 000 rxns Cat No 631740 500 ul vial 2 5 ml in total for 5 vials NOTE DO NOT AGITATE or VORTEX the solution to dissolve the substrate The substrate is sensitive to oxidation in the presence of air bubbles caused by agitation A 15 min incubation at room temperature RT e as Attention can accelerate the reconstitution Store the 100X Substrate Stock Solution at 20 C We do not recommend aliquoting the solution as this may in
14. a 5 Figure 3 Monitoring promoter activation using the secreted Metridia luciferase reporter 0 sees 5 Figure 4 Limit of detection of recombinant Metridia luciferase activitY ococicononnnononnnnnnonnnnnnnrncn nono ncnnn nora 6 Figure 5 Monitoring the activities of two promoters using the Dual Secreted Reporter System 4 6 Figure 6 Similar secretion kinetics of Metridia secreted luciferase and SEAP coociccnnncncnononnconnnncnnncnncnnncnnnos 7 Figure 7 Use of secreted Metridia luciferase in an HTS application oococnonicnonnnnncononnnnnnnonononon nro nn caca nnnnno 16 Figure 8 Multiplexing bioluminescent secreted reporters and fluorescent reporters 17 List of Tables Table I Troubleshooting the Ready To Glow Secreted Luciferase Reporter Assay oooconcccocnonnnncanncnonacnonoso 13 Table II Troubleshooting the SEAP Assay Dual Secreted Reporter System Only ocicnnccicnnoniconinncnnnononos 14 Contact Us For Assistance Customer Service Ordering Technical Support Telephone 800 662 2566 toll free Telephone 800 662 2566 toll free Fax 800 424 1350 toll free Fax 650 424 1064 Web www clontech com Web www clontech com E mail orders clontech com E mail tech clontech com Protocol No PT3902 1 www clontech com Clontech Laboratories Inc Version No PR922708 ATakara Bio Company 2 Ready To Glow Secreted Luciferase Reporter Systems User Manual Introduction A The Ready To Glow Reporter Assay The Ready To
15. d to verify that your cells are secreting Metridia luciferase into the culture media To confirm the expression and secretion of functional luciferase in transfected cells perform the assay us ing 50 pl of culture medium from cells transfected with the pMetLuc2 Control Vector which contains the luciferase gene under transcriptional control of the constitutive CMV promoter Cells transfected with this plasmid should yield high activity within 12 36 hours often even earlier after transfection Normalizing Transfection Efficiencies It is critical to include an internal control in order to distinguish differences in the level of transcription from variability in the efficiency of transfection See Section A 2 b above or Sambrook amp Russell 2001 for more information Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3902 1 Version No PR922708 15 Ready To Glow Secreted Luciferase Reporter Systems User Manual Appendix B Example Applications A High Throughput HT Applications The Ready To Glow Secreted Luciferase System is a powerful tool for HT applications because it is easy to use eliminates cell lysis and guarantees high sensitivity and a broad linear range It has been used successfully in a 1 536 well format to visualize the expression of secreted Metridia luciferase even using a regular low sensitivity CCD camera Figure 7 In addition the assay can be performed in the presence o
16. duce oxidation 2 Prepare the 1X Substrate Reaction Buffer Dilute the 100X Substrate Solution Step III C 1 1 100 in Reaction Buffer To calculate the total volume of 1X Substrate Reaction Buffer needed in your experiment multiply the number of samples in your experiment by a factor of 50 For example for 100 samples you would prepare 100 x 50 5 000 pl of 1X Substrate Reaction Buffer by diluting 50 pl of 100X Substrate Stock Solution in 4 950 pl of Reaction Buffer TO ENSURE CONSISTENT RESULTS prepare fresh 1X fresh Substrate Reaction Buffer every time without y introducing air bubbles Slowly pipet the Substrate Stock Solution or use the tip to stir the mixture gently instead of using rigorous pipetting NEVER VORTEX THE SUBSTRATE OR SUBSTRATE REACTION BUFFER Attention When the Substrate Stock is mixed with the colorless Reaction Buffer the resulting 1X solution is light yellow orange in color Allow the 1X Substrate Reaction Buffer to remain at room temperature for 10 min before use It can remain at room temperature for up to 1 hr before use G 3 Transfer 50 pl of culture media from each sample Step III A 5 into one well of a 96 well plate please see ZK Section II for a 96 well plate recommendation NOTE For statistical reasons we recommend assaying triplicates of each sample 4 Add 50 pl of 1X Substrate Reaction Buffer Step III C 2 to each sample either by pipetting it into the wells manually o
17. e among different treatment groups and different transfections The Ready To Glow Dual Secreted Reporter Vector Kit Cat No 631735 includes the pSEAP2 Basic and Control Vectors as well as the pMetLuc2 Reporter and Control Vectors and the respective assays The reporter vectors can be used as transcription reporters while the control vectors serve as positive con trols for constitutive promoter activity in the SEAP a secreted form of human alkaline phosphatase and luciferase based assays respectively For both vector sets promoter activity can be directly correlated to the amount of reporter SEAP or luciferase secreted in the medium Other reporter proteins frequently used for normalization include SEAP the pSEAP2 Control Vector sold separately as Cat No 631717 E coli B galactosidase pCMVB Vector Cat No 631719 and fluorescent protein vectors such as the pacGFP1 N1 Vector Cat No 632469 or the pCMV DsRed Express Vector Cat No 632416 Proper Use of Controls 1 Negative Controls A negative control is necessary to measure the background signal associated with the cell culture media To determine the background level perform the assay using 50 pl samples of culture medium from mock trans fected cells without vector The values obtained from such controls should be subtracted from experimental results Positive Controls A positive control is necessary to confirm transfection and expression of exogenous DNA an
18. ell Line to monitor protea somal activity if the proteasomes are active only a very low level of green fluorescence is observed in the cytosol of this cell line However if the function of the cellular proteasomes is compromised there is a sharp rise in the fluores cent intensity in the cytosol of this stable cell line At the same time we used secreted Metridia luciferase to monitor NFkB based promoter activation Using these two reporters we were able to determine the importance of proteasomal activity in the NFkB dependent TNF a induced signaling pathway It has been shown previously that phosphorylation of IkB alone upon TNF a treatment is not sufficient to allow NF B induced promoter activation Haas et al 1998 Sun amp Carpenter 1998 Consistent with these findings our results show that phosphorylation of IkB must be followed by its proteasomal degradation in order to allow NFkB based promoter activation Figure 8 Haugwitz et al 2008 This experiment demonstrates the power of multiplexing bioluminescent and fluorescent reporters in a live cell assay we were able to detect two events simultaneously from the same well of a 96 well plate simply by collecting both fluorescent and bioluminescent signals using a multi mode plate reader Protocol No PT3902 1 Version No 16 PR922708 www clontech com Clontech Laboratories Inc ATakara Bio Company Ready To Glow Secreted Luciferase Reporter Systems User Manual Ap
19. f cells by adding the substrate directly to the culture media Figure 7 Use of secreted Metridia luciferase in a High Throughput Screening HTS application This is a screen shot of a 1 536 well plate containing stable CHO cells transfected with a forskolin responsive Metridia luciferase gene pASM Lu164 taken with a CCD camera 300 cells well were plated in a 1 536 well microtiter plate Cells were incubated with increasing concentrations of forskolin and the plate was incubated for 4 hr at 37 C Metridia substrate was added in increasing concentrations and the plate was visualized using a CCD camera system integration time 60 sec This pseudocolor image reflects luminescence intensity Near white and gray regions are the brightest while black regions are the least bright Courtesy of Bayer Health Care Germany B Multiplexing Bioluminescent Secreted Reporters amp Fluorescent Reporters Plate readers that can detect bioluminescent and fluorescent reporter activity at the same time in the same well create opportunities to develop new multiplex assays that are unlimited by the method of detection When multiplexing a secreted reporter and a fluorescent reporter there is no requirement to sacrifice the cells expanding the possibilities even more We used this type of multi mode multiplexing approach to determine the role of the proteasomes in TNF a induced NFkB dependent signaling We used the Living Colors Proteasome Sensor HEK 293 C
20. iment contributes to the signal e The assay is suitable for high throughput screening applications B The Ready To Glow Reporter Vectors Each Ready To Glow Reporter System includes one reporter vector and one control vector along with sufficient reagents to perform a minimum of 100 reactions The reporter vectors are e pMetLuc2 Reporter contains an MCS that allows promoter or promoter enhancer elements to be inserted upstream of the secreted Metridia luciferase MetLuc gene Activation of the promoter enhancer elements of interest drives the expression of secreted Metridia luciferase which is detected in the supernatant of the transfected cells pLVX MetLuc Vector contains an MCS that allows promoter or promoter enhancer elements to be inserted upstream of the secreted Metridia luciferase MetLuc gene Activation of the promoter enhancer elements of interest drives the expression of secreted Metridia luciferase which is detected in the supernatant of the transfected cells Lentiviral delivery allows you to study your promoter of interest in virtually any cell type including primary cultures dividing and nondividing cells stem cells terminally differentiated cells and neuronal cells pNFkB MetLuc2 Reporter contains the NFkB promoter element upstream of the secreted Metridia lu ciferase MetLuc gene It is designed to monitor NF B signal transduction pathways Adding TNF a IL 1 or lymphokine receptor stimulants to the cell cultu
21. imer not available from Clontech to sequence from the 5 region of the SEAP reporter gene region into the MCS 5 CCTCGGCTGCCTCGCGGTTCC 3 376 356 in pSEAP2 Control Protocol No PT3902 1 www clontech com Version No PR922708 8 Clontech Laboratories Inc ATakara Bio Company Ready To Glow Secreted Luciferase Reporter Systems User Manual lll Ready To Glow Protocols Idea PLEASE READ THROUGH THE ENTIRE PROTOCOL BEFORE BEGINNING A Sample Preparation 1 Transfect your cells of interest with the secreted Metridia luciferase reporter vector of your choice You can perform either a transient or stable transfection using your transfection method of choice For infor mation about transfections please see Appendix A Incubate your cells for the amount of time your transfection protocol recommends for optimal transfection efficiency Remove the culture media and split the cells to a multiwell plate following standard tissue culture protocols Alternatively you can leave the cells in the culture plate for your experiment At the beginning of your experiment i e when you begin your experimental treatment remove the culture media and replace it with fresh media containing the candidate promoter inducer inhibitor of your choice NOTE Changing the tissue culture media eliminates any background signal caused by the accumulation of secreted Metridia luciferase in the supernatant before the start of the experi
22. ment Collect 50 pl samples of media supernatant at different time points after starting the treatment How long you should wait before collecting samples depends on your particular experiment We recommend that you begin by collecting media samples 2 8 12 and 24 hours after the start of the experiment You can assay the media samples for secreted luciferase activity immediately or freeze them for later analysis If multiple samples are collected they can be transferred into a 96 well plate for further analysis See Section II for recommended plates Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3902 1 Version No PR922708 9 Ready To Glow Secreted Luciferase Reporter Systems User Manual lll Ready To Glow Protocols continued B Protocol for Non Automated Metridia Luciferase Assays 1 Prepare the 10X Substrate Stock Solution Dissolve the Lyophilized Secreted Luciferase Substrate by adding Substrate Buffer Protocol 13 min Number of Reactions Quantity of Substrate Buffer 100 rxns Cat No 631726 50 ul 500 rxns Cat No 631727 250 ul 1 000 rxns Cat No 631728 500 ul DO NOT AGITATE or VORTEX the solution to dissolve the substrate The substrate is sensitive to oxidation in the presence of air bubbles caused by agitation A 15 min incubation at room temperature RT can ac Attention celerate the reconstitution Store the 10X Substrate Stock Solution at
23. nsfection control for normalization purposes e Using one reporter as a positive constitutive control to monitor the functionality of the secretory pathway e Monitoring two different signal transduction pathways simultaneously This makes it possible to examine potential cross communication between intracellular signal transduction pathways For example we used secreted Metridia luciferase and secreted alkaline phosphatase SEAP to determine whether the cAMP and NF B signal transduction pathways are interrelated Figure 5 1 The Ready To Glow Dual Secreted Reporter Vectors The Ready To Glow Dual Secreted Reporter Vector Kit Cat No 631735 includes four vectors e g two vector sets It has been customized to work optimally with our Ready To Glow Dual Secreted Reporter Assay Cat No 631734 The reporter vectors are pMetLuc2 Reporter contains an MCS that allows promoter or promoter enhancer elements to be inserted upstream of the secreted Metridia luciferase MetLuc gene Activation of the promoter enhancer elements of interest drives the expression of secreted Metridia luciferase which is detected in the supernatant of the transfected cells e pSEAP2 Basic lacks eukaryotic promoter and enhancer sequences and has an MCS that allows putative promoter DNA fragments to be inserted upstream of the SEAP gene Enhancers can be cloned into either the MCS or unique downstream sites Activation of the promoter enhancer elements of interest dri
24. odes a 24 kDa protein containing a 17 amino acid N terminal signal peptide for secretion Markova et al 2004 This secreted lu ciferase gene has been sequence optimized by deleting possible cis acting sites splice sites and increasing the overall GC content to prolong mRNA half life It has also been human codon optimized to enhance expression in cell lines The naturally secreted nature of Metridia luciferase provides several advantages for use as a transcription reporter e Cell lysis is eliminated e Gene expression kinetics studies can be simplified by repeatedly collecting and assaying media from the same culture for multiple time points or multiple inducers The same set of cultures can be used both for the secreted luciferase assay and for further investigations such as DNA RNA protein or cellular analysis because the transfected cells are not disturbed by measuring luciferase activity in the media e Sample culture media collection can be automated by growing cultures and performing the assays in multi well plates e The assay is more sensitive than fluorescence based reporter assays or other cytosolic luciferase reporters e Guaranteed low background because the medium can be removed and replaced at the start of the actual promoter induction experiment A broad dynamic range because the reporter is secreted Since there are no proteases in the culture media every reporter molecule that is expressed during the exper
25. om 25 ul to 50 75 ul adjust the 1X Dilution Buffer volume accordingly Problem with assay Ensure that the assay conditions are correct and that the detection conditions method is working by assaying the positive control enzyme Ensure that the conditioned media does not contain an inhibitory activity by adding 2 ul of Positive Control Placental Alkaline Phosphatase to 25 ul of culture medium Plate reader requires Refer to the instrument s instructions for methods to increase the adjustment sensitivity of light detection Ensure that the diluted media samples are heated for the full 30 min at 65 C as specified in Step III D 2 c High background signal Decrease the volume of media assayed from experimental cultures Alternatively dilute your samples Note If diluting with fresh serum containing media please ensure heat inactivation of any endogenous alkaline phosphatase by incubation at 65 C for 30 min If possible after transfection grow cells in media containing min imal serum Serum levels gt 10 v v may increase background Decrease the volume of media assayed from experimental cultures Alternatively dilute your samples Note If diluting with fresh serum containing media please ensure heat inactivation of any endogenous alkaline phosphatase by incubation at 65 C for 30 min Perform a time course after induction by collecting and assaying media supernatant at different time points to find a suitable time poin
26. ons to the protein coding sequence may be made without express written permission from Clontech Any other use of this product requires a license from Clontech For license information please contact a licensing representative by phone at 650 919 7320 or by e mail at licensing clontech com For Profit Entities wishing to use this product are required to obtain a license from Clontech For license information please contact a licensing representative by phone at 650 919 7320 or by e mail at licensing clontech com Microlite is a trademark of Thermo Electron Corporation Molecular Devices and SpectraMax are registered trademarks of Molecular Devices now a part of MDS Analytical Technologies NucleoBond is a registered trademark of MACHEREY NAGEL GmbH 8 Co Veritas is a registered trademark of Turner BioSystems Clontech the Clontech logo and all other trademarks are the property of Clontech Laboratories Inc unless noted otherwise Clontech is aTakara Bio Company 2009 Clontech Laboratories Inc Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3902 1 Version No PR922708 17
27. pendix B Example Applications continued ES EE o No TNF o With aun a so 2 Active Proteasome ea Proteasome 2 _ O ZsProSensor 1 J ZsProSensor 1 A NFxB Response Element Metridia luciferase 50 000 ZsProSensor 1 45 000 RFU E Metridia 40 000 Secreted 35 000 Luciferase RLU 30 000 25 000 E 20 000 15 000 10 000 5 000 ALLN TNF ALLN TNF c ALLN TNF ALLN TNF 0 Figure 8 Multiplexing bioluminescent secreted reporters and fluorescent reporters to determine the requirement for active proteasomes in TNF 0 induced NFxB dependent signaling Panel A Inactive NFxB is sequestered in the cytoplasm by IxB IkB must be phosphorylated upon TNF a induction 1 and degraded by the proteasome 2 in order for NFxB to translocate to the nucleus and initiate signaling 3 Alternatively when the proteasome is inhibited by the peptide ALLN 4 IxB is not degraded and NFxB cannot translocate 5 The status of the proteasome active or inactive can be monitored based on ZsProSensor 1 levels Panel B NFxB activation by TNF a requires pro teasomal activity High levels of Metridia luciferase signal were only observed in the absence of ALLN and the presence of TNF a When the proteasomes were inactivated by ALLN indicated by increasing levels of ZsProSensor 1 fluorescence the NF B signaling pathway could not respond effectively to TNF a stimulation Notice to Purchaser Clontech products are to
28. r via an automatic injector system connected to your plate reader TIP Do not vortex the plate to mix the sample and substrate If you have many samples we recommend using a multichannel pipette in order to reduce the time between substrate addition and signal detection 5 Transfer the plate to a luminometer and record light signals according to the manufacturer s recommended luminometer settings TIP We recommend reading the plate s immediately as well as 5 and 10 min after adding the substrate Clontech Laboratories Inc www clontech com Protocol No PT3902 1 ATakara Bio Company Version No PR922708 11 Ready To Glow Secreted Luciferase Reporter Systems User Manual lll Ready To Glow Protocols continued D Chemiluminescent SEAP Reporter Assay Dual Secreted Reporter System Only For transient transfection assays using the pSEAP2 Control vector Sold as part of the Ready To Glow Dual Secreted Reporter Vector Kit Cat No 631735 the secreted form of human alkaline phosphatase SEAP is generally detected in the medium 12 18 hours after transfection with maximal levels detected between 48 72 hours Optimal times will vary depending on the cell type cell density and the particular experimental conditions Each construct should be transfected and assayed in triplicate 1 Prepare Reagents and Samples for the SEAP Assay a b Transfer 25 pl of cell culture medium from transfected cells or mock transfected cells in
29. re medium induces the binding of transcription factors to the enhancer element and drives transcription of secreted Metridia luciferase pCRE MetLuc2 Reporter contains the CRE promoter element upstream of the secreted Metridia luciferase MetLuc gene It is designed to monitor the activation of cAMP binding protein CREB and cAMP medi ated signal transduction pathways Adding cAMP or forskolin to the cell culture medium activates CREB or ATF to bind CRE and drives transcription of secreted Metridia luciferase Please visit our website at www clontech com support vectors asp for more information and for vector maps Each reporter vector comes with a pMetLuc control vector which is designed to function as a positive control It contains the secreted Metridia luciferase gene downstream of the constitutive immediate early promoter of the cyto megalovirus pCMV so cells transfected with this construct constitutively express and secrete Metridia luciferase Protocol No PT3902 1 Version No 4 PR922708 www clontech com Clontech Laboratories Inc ATakara Bio Company Ready To Glow Secreted Luciferase Reporter Systems User Manual l Introduction continued All of the pMetLuc vectors contain SV40 polyadenylation signals downstream of the MetLuc gene which direct proper processing of the 3 end of the MetLuc mRNA The vector backbone contains an SV40 origin of replication in mammalian cells expressing the SV40 T antigen a pUC
30. scoaieieesceateecavessaceecavausadacdavnsiscnacavetuasetdovescns cecaucacacesacdavevenseadedascnsas 8 A E E E ise ertoves Couevetutee eset 8 IN Ready To Glow Protocol s cccccccsssecceeesseeeeeesseaeeeeesseeeeeeeenseaeeceeesseaeeeesnsneaeeeeesseaeesenseneaes 9 A Sample Preparations sirenen EE NE oa ns 9 B Protocol for Non Automated Metridia Luciferase Assay s ccssccssescssesensesenseseeseseeeeseescneeseneeeeneeeentees 10 C Protocol for Automated Metridia Luciferase Assays scccssssessesessescnsesenseseeeseeeeseeeeaeeecneeecaeeeeneeeeneees 11 D Chemiluminescent SEAP Reporter Assay Dual Secreted Reporter System Only sses 12 IV Troubleshooting Guides i omic aaa 13 V References cnica rra ra rr 14 Appendix A Transfections 8 Experimental Controls ooooooccccnnnnocccononoccnccnnnncnanononnnannnononnnannnnnnns 15 As Trani CONS rare O A o EA EGR 15 Bi Proper Use of Controls vii lt a 15 Appendix B Example Applications oooocccccnnococinnnanoncnnncnonononononnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnrnnnnnnnnn 16 A High Throughput HT Applications romina nit a isis 16 B Multiplexing Bioluminescent Secreted Reporters 82 Fluorescent Reporters oociconononnononinnnnnonoconnnnnnnns 16 List of Figures Figure 1 Flowchart of the Ready To Glow Secreted Luciferase Reporter Assay procedure mocicoconoonnononos 3 Figure 2 High signal intensity and stability of secreted Metridia luciferase ooonicicnnnnoninnnnnnnnnrnconocrnrnne nor
31. t at which the signal falls in the linear range Signal exceeds the If in doubt about the linear range of the assay prepare and assay linear range of the a dilution series using the Positive Control Placental Alkaline assay Phosphatase For an extended discussion about the SEAP reporter system please refer to PT3057 1 the Great EscAPe SEAP Reporter System User Manual which can be found at www clontech com support manuals asp V References Eggermont J amp Proudfoot N 1993 Poly A signals and transcriptional pause sites combine to prevent interference between RNA polymerase II promoters EMBO J 12 6 2539 2548 Haas M et al 1998 Effect of proteasome inhibitors on monocytic IkB a and B depletion NF B activation and cytokine production Leukoc Biol 63 3 395 404 Markova S V et al 2004 Cloning and Expression of cDNA for a Luciferase from the Marine copepod Metridia longa J Biol Chem 279 5 3212 3217 Sambrook J amp Russell D W 2001 Molecular Cloning A Laboratory Manual Cold Springs Harbor Laboratory Press Cold Springs Harbor NY Sun L amp Carpenter G 1998 Epidermal growth factor activation of NF B is mediated through IkB a degradation and intracellular free calcium Oncogene 16 16 2095 2102 Protocol No PT3902 1 www clontech com Clontech Laboratories Inc Version No PR922708 ATakara Bio Company 14 Ready To Glow Secreted Luciferase Reporter Systems User Manual
32. ted form of human alkaline phosphatase and luciferase based assays respectively For both vector sets promoter activity can be directly correlated to the amount of reporter SEAP or luciferase secreted in the medium Alternatively any of the following vectors can be used to normalize transfection efficiency e Fluorescent protein vectors such as pAcGFP1 N1 Vector Cat No 632469 or pDsRed Express2 N 1 Vector Cat No 632537 e pSEAP2 Control Vector sold separately as Cat No 631717 e pCMVB Vector Cat No 631719 C E coli Competent Cells for Plasmid Propagation Either of the following competent E coli strains can be used for plasmid propagation e Fusion Blue Competent Cells Cat Nos 636700 amp 636758 e Supercharge EZ10 Electrocompetent Cells Cat No 636756 D Kits for Plasmid DNA Isolation For rapid high yield isolation of transfection grade plasmid DNA we recommend using NucleoBond Xtra Kits e NucleoBond Xtra Midi Plus Kits Cat Nos 740412 50 amp 740412 50 NucleoBond Xtra Maxi Plus Kits Cat Nos 740416 10 amp 740416 50 E Sequencing Primers e We recommend using the following primer not available from Clontech to sequence inserts cloned into the pMetLuc2 Reporter Vector This reverse primer can be used to sequence from the 5 region of the Metridia reporter gene region into the upstream MCS 5 CACGATGTCGATGTTGGGG 3 183 165 in pMetLuc2 Reporter Vector We recommend the following pr
33. triplicate to a 96 well microtiter plate If necessary the plate can be frozen at 20 C for future analysis NOTE We recommend Microlite 1 Luminescence Microtiter 96 well plates VWR Scientific Products Cat No 62403 124 Prepare 1X Dilution Buffer by diluting the 5X Dilution Buffer 1 5 with ddH20 2 Perform the SEAP Assay You may need to dilute some samples in order to stay within the linear range of the assay To determine the linear range assay a dilution series of your sample and a dilution series of recombinant human placental secreted alkaline phosphatase before you assay your samples a b C Allow the SEAP Substrate Solution to equilibrate to room temperature 22 25 C Add 75 pl of 1X Dilution Buffer to each sample from Step 1 a in the 96 well microtiter plate Seal the plate with adhesive aluminum foil or a 96 well plate lid and incubate the diluted samples for 30 min at 65 C using a heat block or water bath Cool the samples on ice for 2 3 min then equilibrate to room temperature Add 100 pl of SEAP Substrate Solution to each sample Incubate for 10 60 min 30 min recommended at room temperature before reading Use a 96 well plate reader luminometer to detect and record the SEAP signal Optimal readings will be obtained 10 60 min after substrate addition Refer to your plate reader s user manual for additional information regarding its performance and use Protocol No PT3902 1 Version No
34. ves the expres sion of SEAP which is detected in the supernatant of the transfected cells Each reporter vector comes with a control vector pMetLuc2 Control and pSEAP2 Control respectively which is designed to function as a positive control The control vectors serve as positive controls for constitutive promoter activity in the luciferase and SEAP based assays respectively 2 Metridia Luciferase and SEAP Secretion Kinetics Are Comparable The Metridia luciferase and SEAP reporters are secreted from stable or transiently transfected cells into the culture medium so you can sample repeatedly over time without sacrificing cells Since the secretion kinetics of both reporters are very similar Figure 6 the amount of either reporter in the cell culture medium accurately reflects its promoter s activity ES Y 120 EH pSEAP2 2 100 Control 80 Vector E 60 e 40 lt gt pMetLuc 5 20 Control 0 Vector 0 5 10 15 20 25 Time hr Figure 6 Similar secretion kinetics of Metridia secreted luciferase and SEAP enable accurate comparisons of the relative timing of pro moter activity HeLa cells were plated into 6 well plates and transiently transfected with either the pMetLuc Control vector or the pSEAP Control vector Media samples from the transfected cells were collected from 3 wells at each time point by removing enough media to run either the luciferase or the SEAP assay Each sample was tested in triplicate using a white bottom 96 well
35. with a vector construct containing the NFxB response element driving the expression of sequence optimized secreted Metridia luciferase 24 hr after transfection the media was removed and replaced by media with or without TNF a 100 ng ml to activate the NFB signal transduc tion pathway Six hr after addition of TNF a samples of the media were removed and analyzed for Metridia luciferase activity The fold induction was calculated for different time points following substrate addition Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3902 1 Version No PR922708 5 Ready To Glow Secreted Luciferase Reporter Systems User Manual Introduction continued 2 High Sensitivity amp Broad Linear Range of the Secreted Metridia Luciferase Signal We determined the sensitivity limit of detection of Metridia luciferase in standard mammalian cell culture conditions by spiking various amounts of purified protein into DMEM containing 10 FBS Upon addition of the luciferase substrate we were able to detect levels as low as 40 fg of recombinant Metridia luciferase per ml 2 fg per well in a 96 well plate This corresponds to approximately 46 000 molecules We then determined the linear range of Metridia luciferase activity by serial dilution of the recombinant protein followed by substrate addition Metridia luciferase activity is linear over a range of at least 6 logs Figure 4 Haugwitz et al 2008 108 Average
36. y using appropriate solution darkens dation of the substrate positive and negative controls before assaying experimental over time samples High background Decrease the volume of media assayed from experimental cul signal tures Alternatively dilute your samples Signal exceeds the Dilute your samples using the same media that was used to linear range of the culture the cells assay If you are in doubt about the linear range of the assay prepare and assay a dilution series using the positive control media from cells transfected with the pMetLuc Control Vector Clontech Laboratories Inc www clontech com Protocol No PT3902 1 ATakara Bio Company Version No PR922708 13 Ready To Glow Secreted Luciferase Reporter Systems User Manual IV Troubleshooting Guide continued Table Il Troubleshooting the SEAP Assay Dual Ready To Glow System Only Problem Explanation Solution 0 S Little or no signal Number of transfected Ensure that the transfection efficiency has been optimized by using from transfected cells is too low pSEAP2 Control as an internal positive control for SEAP expression sella Increase the number and or density or concentration of cells used in transfections Increase the post transfection interval prior to collecting media samples If background signals from negative controls i e cells transfected with pSEAP2 Basic are low increase the volume of media assayed from experimental cultures fr
Download Pdf Manuals
Related Search