Home
AA Navigator User Guide
Contents
1. 51 SProNav enhanced GPS navigation fer the professional driver Map Colour Scheme 2 Distance to next turn 250 yds 11 45 0 46 22 6 mi j L Spring Gardens J paapa A4 to A4 Map Colour Scheme 3 Distance to next turn 250 yds 11 48 0 46 22 6 mi Spring Gardens A4 to A4 52 SProNav enhanced GPS navigation for the professional driver Map Colour Scheme 4 a N poun oe Suffolk Place Warwick House m Cockspur Court Distance to next turn 250 yds 11 51 0 46 22 6 mi Spring Gardens AA to A4 Distance to next turn 250 yds 11 54 0 46 22 6 mi Spring Gardens A4 to A4 53 AN ProNav enhanced GPS navigation for the professional driver Voice Select from the available voices by tapping the box next to your selection Volume Use the and buttons to adjust the volume to your desired level Volume can also be adjusted via the Drive Options screens see page 42 54 AN ProNav enhanced GPS navigation for the professional driver Safety Cameras Your ProNav software also comes with safety camera warning software This will provide you with both audible and visual alerts for fixed safety cameras along your route How the safety camera software works The software will automatically provide intelligent audible alerts based on the speed that you are traveling when you are approaching a speed camera
2. Ee 7 N in H A gt i 2 gt J JJF a m ZZ KE W i Distance to next turn 250 yds 11 26 0 46 22 6 mi A4 to A4 These are 1 When approaching a safety camera at a speed below the known speed of the camera then an audible sonar ping will sound every five seconds up to and through the camera zone 55 AN ProNav enhanced GPS navigation for the professional driver 2 When approaching a fixed safety camera at a speed above the known speed of the camera a sharper ping warning will sound a preset number of seconds up to and through the camera zone along with the visual warning shown above The warning will tell you the type of camera ahead if Known along with the speed of the camera if known the camera distances and the bearing on where the safety camera is located approximately on the road If you reduce your speed to below that of the known speed of the camera the sonar ping will replace the sharp ping noise IMPORTANT Some camera types such as mobile or variable limit safety cameras do not have speed limits associated with them so you might receive an audible warning for those even if you are driving below the speed limit Understanding the Safety Camera Warning Camera Speed Distance to Camera Camera Type 56 SProNav enhanced GPS navigation fer the professional driver Setting the Options for Safety Cameras There are
3. fee Attribute Pair Device SProNa enhanced GPS navigation fer the professional driver Pairing Your Phone NOTE You should refer to use mobile phones operating instructions on how to pair Bluetooth enabled devices however the following instructions might help 1 Open up the Bluetooth function on your mobile phone and start a search for Bluetooth devices 2 Tap the Pair button on your ProNav and you will have sixty seconds to search for it 3 When your mobile phone finds MyPvDevice select to pair and choose pair 4 Enter the passcode on your mobile phone which is Pair Device preset to 8888 5 Your phone should now be paired with your ProNav 6 To check that your phone is paired tap the Pair Device button and you will see your phone in the list SProNav enhanced GPS navigation fer the professional driver Making a Phone Call To make a phone call click on the Keypad icon and using the keyboard and dial your preferred telephone number and tap the green button to dial While on a call you can adjust the volume by tapping the or 00 00 00 button To hang up the call press the red button ul 10086 Tapping the keyboard button will bring up the keyboard should you lt lt need to enter any numbers during the call ProNav enhanced GPS navigation for the professional driver Launching your ProNav Software Tap the Navigation icon
4. LA ProNav enhanced GPS navigation for the professional driver Navigation Software User Manual Models ProNav PNN 200 amp ProNav Europe PNN 200E ProNav G enhanced GPS navigation for the professional driver Contents WHATS IN THE BOX i vauvnnnnnnvnnnvnnnnnnnnnnvnnnnenevnnvnennennnnevnenunne 7 HARDWARE OVERVEIW ennnnnnnnnnnnnnnnnnnvnnvnennnnnnnnnnnnennennnnnr 7 HARDWARE SYSTEM SETTINGS ccccecscecceeseeceeeseeeeeeeeeeees 8 Battery Level rrrrnnrrrnrnnrnrnnnnnnrrnnnnnnvnvnnnnrnnnnnnsennnnnne 8 Power Button umatmasnmrasidiarnimansgmesivas nn 8 Reset Button rrannrnnnnnnnnnnvnnnnnnnnnnnnnennnnnnennnnennnnennene 8 NO TNS a cisccecrcariapustiencanttanieaatueonaadianntaadeutnestseudteatenenniannse 9 EAC 6 ES 10 Date Time amp Timezone rrnarnnnnnnnnnnnnnnnnnnnnnnvnennnnunnr 10 Power Status rrnrnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnennnnnennnnenne 10 Screen Calibration ccccccecccecceccecceccecceseeseaseaees 11 BLUETOOTH SETTINGS 0 ccccceccecceececceececeeeeeeeeeeeeaeeneens 12 Pairing your Phone mnnnnnnnnvnnnnnnnnnnnnnrvnnnnnrennnnnnennnnn 13 Making Call EN 14 LAUNCHING YOUR PRONAV SOFTWARE onasan 15 PRONAV SETUP ENTERING VEHICLE DETAILS 16 ProNav Enabled cccccccceececcecceceececcecceeeeceeeeeaes 17 SNOW ICONS on Map ccccccseeeeeeeeeeeeeeeeeeeeeeeeeeeeas 18 Preffered HGV Routes rnrrnnnnnnnnnnnnnnnnnnnnnnvnnnnnnenne 19 Gross Weight A
5. AN ProNav enhanced GPS navigation for the professional driver Select Place Screen This screen allows you to define your start and end locations Select Place Recent Browse Map mr Favourites Town Street Postcode 4 Recent Tapping this button displays a list of the 20 most recent selected locations Tap on one of the buttons to use that location as a start via or end point 26 SProNav enhanced GPS navigation fer the professional driver ve Tapping this button displays a list of your selected favourites You can add to this list from the Plan Route menu by tapping the add to favourites button small star if available If you wish to change one of the entries tap the Change button which takes you to a new page called Add Favourites You then have the ability to delete entries by tapping the Remove button or add a new favourite by selecting a place from the Recent Browse Map Town Street or More Places options This will then save to your favourites Favourites ye he w Browse Map Selecting this option allows the user to explore the map and search for locations as previously described on page 24 Town Street Tapping this button will take you to the Town Street selection page You can then enter a city town or suburb and as you type the name the software will start selecting the most relevant matches from the ProNav software database Enter
6. journey just each leg at a time To start driving your first leg of your journey press the Drive button and the ProNav software will calculate the route to your first destination and commence navigation When you have reached your first destination tap the Drive Screen to open the Drive Options Screen see page 42 for more information and tap Stop Drive You will then be presented with a confirmation if you wish to go to the next leg of your journey 34 SProNa enhanced GPS navigation fer the professional driver Navigator Please confirm you wish to move to the next leg Start Ann St Brisbane Destination 3 Alfred St Gympie If you select No you will return to the Plan Route screen If you select Yes you will then go to the Plan Options screen At this point your ProNav software has been designed that if you turn off your PND using the power button located on the top of the unit the next leg of your route will be stored When you are ready to continue to your next location turn the PND back on and when the Plan Options screen is displayed tap the Drive button The ProNav software will now calculate the route to your next destination and commence navigation Repeat this process throughout your journey 35 AN ProNav enhanced GPS navigation for the professional driver Plan Options In the Plan Route screen once a start point has been entered or a GPS location is
7. GPS navigation fer the professional driver ProNav enhanced GPS navigation for the professional driver Guide mode no mapping but with text instructions is optional 39 SProNav enhanced GPS navigation fer the professional driver Customising Map Mode Display In both 2D and 3D map modes a variety of route information can be displayed in the information boxes Apart from the box directly below the turn direction indicator shows turn icons you can choose which information to display in any box by tapping the centre of a box When the screen is tapped in any box area a new screen appears titled Select Info From this screen you can choose what information to display in each box by selecting it from the list 3 Side Boxes image shown e Speed amp Direction e GPS Satfix e Estimated Time of Arrival e Estimated Journey Time e Distance to go Road Information Bar display road name e Current Road e Next Road e Current Road to Next Road 40 SProNav enhanced GPS navigation fer the professional driver Battery Level Indicator This is shown on the Drive Screen so you can monitor the status of the battery i 66 Power 33 Power Remaining Remaining External Power 100 Charged Battery Critical When the battery reaches critical the battery icon with the exclamation mark will be shown on all ProNav menu screens You should try and charge the battery as soon as possible Please Note stored in
8. Once in the Plan Route menu if you wish to plan the journey from the current position you do not need to change the Start point To change your start or end location tap the Start or End button You can also add via destinations by tapping the Add Via button This takes you to the Select Place screen which has several options for selecting a start or end point If you wish to save a location as a favourite just tap the star button next to the locations name ga Sp Ors p Browse Map Tapping the Browse Map button will take you to the map screen At the side of the screen are four buttons the first two are for adjustment of the map scale allowing you to Zoom In and Zoom Out It is also possible to pan around the map by dragging the map across the screen using your finger or the stylus Next there is the 24 AN ProNav enhanced GPS navigation for the professional driver Magnifying Glass button which takes you to the Locate on Map screen and allows you to zoom to a Town Street recent destination favourite location or POI The Back button takes you back to the previous screen You can also press and hold the stylus on the map to bring up an options menu You can then set a start or end point or add a favorite directly from the map Points of Interest will also appear on the map when you zoom in to a suitable scale Setup Please see the Setup section on page 47 of this guide 25
9. a number of options available when using the speed camera software and these are located under Setup Safety Cameras in the Full Navigation mode The options available are Enabled Disabled This will turn the safety camera software on or off Please note that if this is set to Disabled you will not receive any visual or audible alerts for any safety cameras on your route Tap the button to change Warn At 5 Secs This will allow you to change the time that you receive the first warning before you reach a safety camera The options are No Warning Warn at 5 Seconds Warn at 10 Seconds Warn at 15 Seconds and Warn at 20 Seconds Smart Warnings When set to ON this will warn you about safety cameras on your side of the road only When set to OFF the safety camera software will warn you about cameras on both sides of the road Show on Map When this is enabled the safety camera icon depicting the location of a safety camera will be shown on your map while you drive To disable please tap the button to select Don t Show on Map Warning Sounds This will turn the audible alerts on or off Tapping the button will change it accordingly 57 SProNav enhanced GPS navigation fer the professional driver View Info This will tell you when your subscription is due to expire and the date that your safety camera database was created For information on buying a safety camera d
10. on your PND s start up screen 2009 11 17 01 47 54 B Navigation Bluetooth Player on d Po p i System Tools The first time you use your ProNav software you will be presented with an End User License Agreement that you will need to read and tap the Accept button if you agree with all of the terms and wish to continue You will only have to do this once and tapping the Accept button will result in this screen not being presented to you again If you do not agree with the terms of the license then tap Decline and you will exit the software Upon tapping the Accept button the ProNav setup screen will be displayed 15 SProNav enhanced GPS navigation fer the professional driver ProNav Setup Entering your Vehicle s Details ProNav ProNav Enabled Yes Show Icons on Map Yes Favour Preferred HGV Routes Yes Vehicle Class LGV 26 38t Gross Weight 32 00 ton Axle Weight 8 00 ton Height 16 0 ProNav requires information about your vehicle in order to compare it to the physical and legal road restrictions it holds in its database This helps the ProNav software determine the most appropriate route for your vehicle to take The settings are as follows Save Load Settings ProNav allows you to save unlimited truck profiles so if you have a fleet of trucks you do not need to keep entering all the vehicle details each time you move from one truck to the other Once you have en
11. acquired and an end point has been set tap the Options button This will take you to the Plan Options screen Plan Options Pro Route Map jemo Drive 4g Route Text Clear Route y Route Map By tapping Route Map an overview map appears showing your route indicating the start and end points This map can be zoomed and panned around If you wish to adjust the start or end point press and hold the stylus on the map at the desired location This will then bring up a menu allowing you to set a new start or end point 36 AN ProNav enhanced GPS navigation for the professional driver mi a lin Route Text The Route Text button will show a simple text list showing an accumulative mileage on the left with direction arrows a road number and name on the right Use the up and down arrow buttons to read the full route Demo Mode If the Demo button is tapped a demonstration of the route starts Tapping on the map will bring up the Drive Options menu see Drive Options on page 49 for more information gt Clear Route This allows the user to clear an existing route 37 The Drive Screen 3D map display is the default view pl Suffolk Place Distance to next turn 250 yds Spring Gardens 2D map display is optional Warwick House Street Whitcomb Street Cartton House Terrace Distance to next turn Cockspur Court 260 yds Spring Gardens SPro enhanced
12. apping the appropriate button You will only be required to do this once but you can change your selection later if you wish You have now completed setup of your ProNav software and the Full Navigation Menu will now be displayed 22 AN ProNav enhanced GPS navigation for the professional driver Full Navigation Menu s Pro pe Je er AT Follow Map Plan Route Drive To Browse hap This is a more advanced menu that provides you with a number of advanced options including route planning browse map and storing favourite locations When you first start your software the Full Navigation Menu is the default setting but you can easily change which navigation menu you require by following the instruction in Setup on page 47 A og Follow Map Tapping the Follow Map button will automatically show a map with the location of the vehicle in the center of the screen Note the GPS may take a couple of minutes to establish your location 23 AN ProNav enhanced GPS navigation for the professional driver Drive To Tapping the Drive To button takes you to the Select Place menu This allows you to set your end point destination See Select Place on page 35 When an end point has been selected and a GPS signal received your route will be calculated automatically a Plan Route Tapping this button takes you to the Plan Route menu From this menu you can plan a route with or without the GPS connected
13. atabase updates please go to www pronav co uk Click OK to return 58 SProNav enhanced GPS navigation fer the professional driver Frequently Asked Questions I can t find an address Please make sure you have correctly spelt your entry If you do not know how an address is spelt correctly simply enter the first few letters of the address you know of sure e g Lon for London Then browse the results list and look for the address Also make sure the city in which you are looking for an address is correct Sometimes the official postal address differs from the address you are looking for In that case search for a known address nearby and browse the map lam experiencing problems getting a GPS fix If you have problems getting a satellite fix with GPS you can see how many satellites are being received by going to the main menu and selecting GPS receiver please make sure you are outside and the GPS antenna has good visibility to the open sky Why are some bridge heights and other restrictions not shown ProNav uses the most comprehensive transport data available however there are still a number of sites that have not yet been surveyed Please be patient the free map and transport data updates we are providing with ProNav should in most cases fix any issues in time 59 SProNav enhanced GPS navigation fer the professional driver Where can get technical support Please visit www pronav co uk for further su
14. creen and options before starting your journey For safety reasons DO NOT interact with your device until you have reached your destination or you have pulled over and it is safe to do so All routing suggestions are advisory and may not take account of all temporary or permanent traffic control measures or restrictions Disregard any suggestion that is hazardous or does not comply with posted road signs or is otherwise illegal Keep your eyes on the road and comply with all traffic laws at all times Your personal judgment and common sense should always prevail over any instruction received through the use of this device Navevo Ltd cannot be held responsible for any loss damage or harm direct or otherwise caused as result of using the software or placing any reliance on the information provided to you while using the software SProNav enhanced GPS navigation fer the professional driver Prohibited Areas Do not operate your PND in hospitals or near any electrical medical equipment Do not operate your PND on an aircraft Do not operate your PND while sat in a gas station forecourt Battery Your PND uses a Li ion battery Do not use it in humid wet or corrosive environments Do not operate or store your PND in high temperatures gt 60 Degrees or in direct sun light Do not pierce or break the battery casing Failure to follow these cautions will invalidate the warranty and may cause the battery to leak acid become hot explode o
15. creen to set the date time and timezone Click or icon to adjust the up or down SProNav enhanced GPS navigation for the professional driver Battery Level D E lt always on gt Backlight Backlight lt always on gt 4 Date Time Date Time 12 25 57 Date 9 2009 01 01 Time Zone 9 GMT Greenwich Mean Time Dublin Edinburgh AN ProNav enhanced GPS navigation for the professional driver Language Language Click to change the system language Click or icon to scroll through and select the available languages Language System Info TE am Click to view information about the system By clicking the calibration button you can also reset the ee se eee the calibration of the touch screen if it becomes unaligned processor RFA oe km h RAM Total 64 MB version 090317 3060 0C21 5200 Serial 5434583048485f30 Screen Calibration If your touch screen becomes misaligned buttons not working ven nese ofthe ae properly then you will need to recalibrate your system Using the stylus not your finger press firmly on each cross as it appears on the screen to recalibrate the screen Ea SProNa enhanced GPS navigation fer the professional driver Bluetooth Settings Tap the Bluetooth icon on your PND s start up screen to access the systems Bluetooth system settings Bluetooth Disconnect a a T J Keypad Diaklast fm
16. cting this option will allow you to set the international time zone that you are located in 47 SProNav enhanced GPS navigation fer the professional driver If the software is set to GPS Time it will acquire its date and time information automatically from the GPS satellite Switching it to Trust Device Time means that you will need to set the date and time yourself and you should refer to the hardware guide for instructions ProNav This will allow you to change the ProNav settings and your vehicle details Please see page 16 for more details Language This will allow you to change the language of the ProNav software Upon selecting a different language the menu text and voice instructions will change accordingly About Provides the software version information Tap the down arrow on the right of the screen to view more options Route Options Route Type Select required type of routing Fastest Route Tapping this box provides the fastest route 48 SProNav enhanced GPS navigation fer the professional driver Prefer Main Roads Tapping this box provides a route which prefers use of motorways and main roads Avoid Highway Tapping this box provides a route which avoids Motorways Shortest Distance Tapping this box provides the shortest route measured by driving distance Interface Mode Allows you to select either the Easy or Full menu modes Avoid Tolls Avoid Tolls Tap this box to avoid toll roads on your route Ig
17. e professional driver s Volume Tap the Volume button if you wish to change the volume Use the and buttons to adjust the volume to your desired level Please Note Even with Mute selected the safety camera warning will still provide audible warnings To turn off safety camera audible warnings completely please see page 57 for details Map key The map key will provide you with detailed information about the icons used for restrictions warnings and parking Tap the back arrow button to return to the Drive Options screen 46 SProNav enhanced GPS navigation fer the professional driver Setup Tapping the Setup button takes you to the Setup main menu which has several options GPS Selecting this option displays GPS signal status Current Position Selecting this option will provide you with information relating to you current position including road heading and coordinates You can give this information to your breakdown service provider and they might be able locate you more easily as a result POI Selecting this option allows you to enable which POI types are shown as Your Favourites Only POI s you have selected as Favourites will be displayed on the mapping You can select any POI as a favorite simply by tapping it to tick the box and deselect it by tapping it again When you exit the POI section your changes will be saved Safety Cameras See page 55 for more details Time Sele
18. e selected your street name you will be given the option to choose a House Number or POI near that street To select a house number just enter the number using the numeric keyboard and when it appears press the relevant GO button If you do not require a house number just tap the Space button and then tap the empty GO button above For a POI near the street just tap the POI button to open the POI Library see page 29 ot Point of Interest POI Tapping this button will bring up the POI Library which lists all of the Points of Interest available A comprehensive point of interest library is provided so you can easily locate POI s based on the type of business service or facilities available 29 AN ProNav enhanced GPS navigation for the professional driver POI Library Favountes icv Petrol Stations Loading Bays London Cafes ruck Stops Other POI s Airports When the POI library opens you will see a list of POI types that are available They are listed with your favourite POl s first with other POI s listed further down Use the up and down arrow to scroll through the list Please Note Only POIs that have been designated as your Favourites will be displayed on the mapping For more information on how to set up your Favourite POI s please go to Setup on page 47 Select from the list the desired POI type Once the POI type has been selected a list of
19. etermining your route These routes are identified by the following icon Preferred HGV Routes When set to No these roads might still be used when determining your route but not necessarily in preference to other roads Vehicle Class This is the class of vehicle you are driving Tap the button to select the most appropriate class from the list provided SProNav enhanced GPS navigation fer the professional driver Gross Weight Tap the button to enter the gross weight of your vehicle Enter your gross weight by using the keyboard and enter your information just like you would at an ATM For example for 32 00 tons enter 3200 on the keyboard Once entered tap the GO button with the weight of your vehicle displayed on it Axle Weight Tap the button to enter the axle weight of your vehicle Enter your axle weight using the keyboard as you did for Gross Weight and tap the GO button with the weight of your vehicle displayed on it Height Tap the button to enter the height of your vehicle Enter your height using the keyboard For example for 11 9 just enter 1190 on the keyboard and tap the GO button with the height of your vehicle displayed on it Note You are required to use the down arrow button to see the following menu items Length Tap the button to enter the length of your vehicle Enter your length using the keyboard and tap the GO button with the length of your vehicle displa
20. formation such as settings recent and favorite locations will not be lost if the unit loses total power as these are stored on the memory card Sometimes following full power loss the GPS takes slightly longer to acquire a signal similar to the first time you used your unit This is normal 41 AN ProNav enhanced GPS navigation for the professional driver Drive Options The Drive Options screen can be accessed by tapping on the top two thirds of the map on the Drive Screen Drive Options Pro gt More Alternate Options 4g Route Text Stop Drive 3 Point of Interest POI Tapping this button will allow you to find a POI close to your current location 42 AN ProNav enhanced GPS navigation for the professional driver y Route Map By tapping Route Map an overview map appears showing your route indicating the start and end points This map can be zoomed in out and panned around le Jun Route Text The Route Text button will show a simple text list showing an accumulative mileage on the left with direction arrows a road number and name on the right Use the up and down arrow buttons to read the full route JE Alternate Tapping this button takes you to a further screen called Avoid Alternate which displays the following options 1 Mile This button can only be used when a route has been calculated and when tapped allows the user to avoid the current road within a mile of p
21. hen using Power Off Mode the battery will hold its charge for much longer however when you turn the device back on it will take longer to obtain a GPS signal in this mode For a faster GPS signal performance use Sleep Mode by pushing the on off button down for only a second or two In Sleep Mode the PND will obtain a faster GPS fix however the battery will discharge at a lot quicker than in Power Off Mode even when the PND is off Reset Button If the software freezes or the PND becomes unresponsive you might need to reset your device The reset button is located at the back of the PND Remove the stylus from the side and gently press the reset button for a few seconds to reset the device Hardware System Settings ProNav enhanced GPS navigation for the professional driver Tap the System icon on your PND s start up screen to access hardware system settings 2009 11 17 01 47 54 Date Time Language SysInfo Volume Click or icon to increase or decrease the speaker volume You can choose to hear sounds for taps by pressing the button Sahl tl Volume ta COSCO o Enable sounds for taps Enable the especial voice Power Status The bar shows current battery power level Click or icon to set the auto power off time Backlight Click or icon to set brightness level Click or icon to set the auto light off time Date amp Time Tap each icon on the s
22. ing more characters increases the probability of selecting the correct place If required the suggested options can be ignored and the full place name typed in If there are a number of places with the same name you can use the buttons on the right to scroll up and down the list until you find your required location 27 SProNav enhanced GPS navigation fer the professional driver When your destination is listed tap the GO button containing the destinations name You are then taken to a second screen titled Street which allows you to select whether you would like to either enter a Street Name Route to a Town Centre or Route to a POI Street Bla lack St av Blaxland St Delete Street If you know the name of the street use the keyboard to start typing the name of the street in much the same way as described above for the town selection screen When the street is listed tap the GO button containing the street name required 28 SProNav enhanced GPS navigation fer the professional driver Note If you are searching for a street which has a direction as part of the name e g North 49 Street start your search only with the street name 49 Street and when the results appear you will be giving the option to choose either the North or South version of the street Long streets may be broken up into several sections and so appear more than once in the list House Number Once you hav
23. nnnnnnonnnnnnene 43 2D 3D Map Display ccccsseceeesseseeeeeeeeeeaeeeeeens 45 Night Mode rrrrennrnnnnrvonrrnnnnnronnnnnnnnennnrnnnnnennnnnnsnee 45 NTE 46 Map INC EEE EEE 46 SET seco ee casts ane stecnsavacuea ats E EAN E A E ES 47 Route Options rrrrnrrnnnrrvvvvrnnnnnvrnnnnnnnrsvnnnnnnnnsnnnnnnn 48 Avoid Ignore Tolls rrrnnnnrnnrnnnnnnvnnnnnnnnnennnnnnnnvennnnnn 49 Colour Schemes rrrnnnnnnnnnnnnnnnnnnnnonnnnnnsnnnnnnnennnnene 51 SAFETY CAMERA ALERTS ccc sssececeeeesseeeeeeeeseeeeeseeeees 55 How the Safety Camera Alerts Works 068 55 Safety Camera Settings cccccceessssssseeeeeeeeeeeaes 57 FAQ S AND SUPPORT INFORMATION ccccccssseeeeeeeeeeeeeaes 77 LA ProNav nihanced GPS navigation for the professional driver IMPORTANT SAFETY NOTICE PLEASE READ CAREFULLY BEFORE COMMENCING USE OF YOUR PRONAV NAVIGATION SOFTWARE Do not place your ProNav Personal Navigation Device PND where it may strike the driver or passengers if the vehicle turns sharply or stops abruptly Your PND should be installed securely so it will not move and cause a distraction Cables and hardware should not interfere with driving and use of normal vehicle controls Try to locate the PND as close to your normal line of sight as possible without obscuring your normal view of the road Safe control of your vehicle is of paramount importance Program your destination and configure your chosen drive s
24. nore Tolls Tap this box to allow routing on all toll roads Warn on Toll Tap this box and the system will give you the choice of whether to avoid or allow tolls at the point of route calculation This is the default option 49 SProNav enhanced GPS navigation fer the professional driver Show key roads Tapping this box lists all the classified roads the route will take after your route is calculated Map Drive Options 2D 3D Select the preferred view Miles and KM Tap the appropriate box to select whether you would like your distances shown in miles or km Road Names and Numbers Select whether you prefer to see road names or road numbers on the mapping or in text directions The default is set to road names Hide Help Tips Your ProNav software is equipped with an on screen help guide to give tips when you input an address When you first use your ProNav software the help feature is disabled Simply un tick the box to enable help tips Favourites Please see page 36 for more information 50 SProNav enhanced GPS navigation fer the professional driver Colour Scheme There are five colour schemes for you to choose from Just tap the button and choose from the list to enable the colour scheme you require The current colour scheme that is being used is displayed on the Colour Scheme button Map Colour Scheme 1 Distance to next turn 250 yds 11 26 0 46 22 6 mi y4 i wa Spring Gardens A4 to A4
25. pport information and more detailed FAQ s Telephone Support Operating 9am 6pm Monday to Friday Saturday 10am 6pm Closed Sundays and Bank Holidays 0844 4994 554 Calls charged at 5 pence per minute Email Support Ssupport navevo com 60
26. r ignite and cause injury or damage If you come into contact with leaked battery acid wash the contact area thoroughly and seek medical attention The Li ion battery contained in this unit must be recycled or disposed of properly Do not dispose of in household waste or burn Please fully charge and discharge the battery two or three times on first use to assure a longer battery life SProNav enhanced GPS navigation fer the professional driver What s in the Box Please check that you have all the items listed below ProNav Personal Navigation Device PND In vehicle charger e USB cable Windscreen mounting kit User manual If you have any of the items missing please contact the support line or your retailer Hardware Overview LCD Touch Screen On Off Button Headphone Jack SD MMC Card Slot Mini USB Power Port Stylus OOOO G enhanced GPS navigation for the professional driver Hardware Basic Charging Power On Off Reset Battery Please fully charge the PND the first time you it You can use the in vehicle adapter provided in the box to charge the PND in the car The LED indicator located next to the Mini USB Power Port no 5 above will be coloured red during charging and it will turn green when the battery is fully charged Power Off Mode amp Sleep Mode Pushing the on off button on the top of the PND firmly for around three or four seconds will turn the PND on or off Power Off Mode W
27. relevant POI s is provided in order of distance nearest to the location 30 AN ProNav enhanced GPS navigation for the professional driver POI Library Pro Fie s Cafe Bar Kilburn High Road 020 7377 1240 Continental High Gate Road 020 7267 0020 Double Six Cafe Eversholt Street 020 7387 0262 Use the up and down buttons to the right of the list to find and tap the desired POI Once selected you will start navigating 31 SProNav enhanced GPS navigation fer the professional driver D A Postcode By tapping this button you can enter a postcode Entering more characters increases the probability of selecting the correct place Choose the postcode you require by tapping on the relevant GO button Delete Back Button Pressing the button with the arrow on it on the left of the screen will return you to the previous menu screen 32 SProNav enhanced GPS navigation fer the professional driver Multistop A feature of your ProNav software is that you can input a number of destinations as part of a journey This saves you time by allowing you to input an unlimited number of via locations between your start and end point Multistop can only be accessed via the Full Navigation Menu and the Plan Route button Multistop is dependant on you knowing the sequence of destinations you wish to visit and inputting those in sequence in Plan Route Plan Route s Start s Via gt Via a End 2 Bu
28. resent GPS position if possible to do so for example to avoid congestion or road works 43 AN ProNav enhanced GPS navigation for the professional driver 5 miles This button is as above but the radius for an alternative route is increased to 5 miles of the current point if possible to do so Named roads This button when tapped displays all the road names on your route The user then has the option to select a particular road that they wish to avoid and the software will then recalculate the route avoiding the selected road Original This button allows the user to return to the original route that was calculated if the user has selected any of the alternate options above A Stop This stops the Drive Mode and returns the user to the main menu Additional options can be accessed using the More Options button 44 AN ProNav enhanced GPS navigation for the professional driver Drive Options Pro gt Bw fe es More 2D display Guide Mode Options le Might Colours Volume Map Key 2D 3D Display You can select the map view to display in either 2D or 3D map mode Tap on the display button to change Guide Mode Map Mode This button allows you to change the navigation screen between Map Mode and the Guide Mode Night Colors This changes the background colour of the map and guide screen for better visibility at night It also reduces glare 45 AN ProNav enhanced GPS navigation for th
29. rnett Ln Brisbane Ann St irisbane 3 Alfred St Gympie Maryborough St Bundaberg If your previous route is still being displayed tap the Clear button to start a new route Next enter your start and end destinations first Then tap the Add Via button to enter the first location you wish to visit on your journey 33 SProNav enhanced GPS navigation fer the professional driver You can select your locations using Town Street POI Recent Favourites or Postcode buttons however the Browse Map feature will not support a selection of a Multistop location To keep adding more locations repeat this process If once you have made your selections you wish to change any of the locations just tap the relevant Via button next to the location you wish to change and select a new location If you wish to delete a location in the list just tap the Del Via button and then tap the Via button next to the location you wish to delete The location will then be removed from the list Once you have added three locations you will need to use the up and down arrows on the right of the screen to access the Add Via and Del Via buttons and to see other subsequent via locations you have added When you have finished entering all your locations tap the Options button to access the Plan Options screen You can use any of the options to show the first leg of your journey The ProNav software will not show your entire
30. tered all your vehicles details tap the Save Load Settings button and the following screen appears 16 SProNav enhanced GPS navigation fer the professional driver To save a profile tap the Save Current button and using the keyboard assign a name for the profile and once entered tap the GO button To load an existing profile just tap a Load name button ProNav Enabled When set to Yes all of the other settings that you have specified in the ProNav setup screen height weight amp width etc will be taken into consideration when determining your route When set to No the ProNav software will operate as normal car navigation by ignoring all of the other settings you have specified in ProNav setup Tapping the button allows you to easily switch between the two modes SProNav enhanced GPS navigation for the professional driver Shows Icons on Map When set to Yes any restriction that relates to your vehicle will be displayed as an icon on the mapping When set to No restriction icons will not be shown on the mapping The icons used are as follows Height Width Weight Weight Per Axle No Trucks Allowed Flammable Explosive Goods AN ProNav enhanced GPS navigation for the professional driver Favour Preferred HGV Routes The ProNav database also includes roads that are preferable for use by trucks When set to Yes these routes will be used in preference when d
31. xle Weight amp Height 0 20 Length Width amp Explosive Flammable Load 21 CHOOSE YOUR STATE rrnnrnvnnnnnnnevnnnnennensvnnnnennenennennenenenn 22 FULL NAVIGATION MENU cccececececcececececcccececececeececes 23 De Ko sne 24 Plan Route araravaravanavanananavenansnasenenenenssasssesenenenenene 24 Browse Map 0 ialnca tenia barcdaeets ou ccdennshcntatnnamensalauntdetatesanecays 24 SELECT PLACE e neravannanannsnansuvnnsunavnnnenansunansavnnsunavensensnene 26 Favourites 0 0 cccccececececececececccecececeuauacacauuaeauaeaenenenes 27 Town Street HOUSE arnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnsnnnnnnnnnn 27 PFOS 2 29 110 6 TOP qcoctsccncumenecorcssaadecn taiabanueaneatanendesmeseioasecnsedeued 33 PLAN OPTIONS esrsnanvannneananennavannavennsnesrsnannananennaneunavannene 36 Route Map eatincsnaiinenitaniienasdnxendnantdueraetieasidaiiexenmiinans 37 Route Text ccccccecececececececececacacacacauauauauauaenenenenes 37 Demo Mode cccccecececccecececcccccececucacaececscauacuececes 37 DRIVE SCREEN AND MAP OPTIONS eccececcececceceeeecess 38 Customising Map Display rrrrnnrrrrvrnnnnrrvrnrnnnnnrenn 40 Battery Level Indicator rrrnnnrnnnnnnnrvrnnnnrervnnnnennnnn 41 DRIVE OPTIONS rarnnvnrnvrnvnernvnennnnennnnennnnennnnnnennenennenenuenee 42 ProNav G enhanced GPS navigation for the professional driver Alternative Avoid rrrnrrnrrnnnnorrnnnnnonrnnnnen
32. yed on it 20 SProNav enhanced GPS navigation fer the professional driver Width Tap the button to enter the width of your vehicle Enter your width using the keyboard and tap the GO button with the width of your vehicle displayed on it Explosive Flammable Load Tap the button and select Yes if you are carrying explosive or flammable goods to avoid any legal restrictions that apply to this type of hazardous material Select No if you are carrying any other type of goods Once you have completed the ProNav setup tap the return button in the bottom right hand corner of the screen to complete navigation setup IMPORTANT You will be shown the ProNav setup screen each and every time you start the software Please check carefully that the details displayed in the ProNav setup screen match that of the vehicle you are driving Any failure to do so could mean that an incorrect route is determined for your vehicle 21 SProNav enhanced GPS navigation fer the professional driver ProNav Setup State Options Read the Safety Notice Please read the safety instructions and if you accept the terms and conditions tap the Accept button to go to the Country Selection screen Selecting Decline will result in the software exiting Please Note You will be required to accept the safety notice each and every time that use your ProNav software Choose your State Finally select the State you require by t
Download Pdf Manuals
Related Search
Related Contents
スマートフォンは、 Manual de Usuario de Bellator Samsung SMART CAMERA EX2F Manuel de l'utilisateur Audiovox PR-130 User's Manual Manuel d`utilisation Caméra Ethernet pour les Aastra Telecom 55I IP Telephone User Manual precaución - Hannspree Copyright © All rights reserved.
Failed to retrieve file