Home

Spectrophotometer User Guide

image

Contents

1. CALIB RATE Use this screen to set up the MiniSipper for the required analysis These parameters are saved with any data produced by the software To reach this screen press Accessories from the Home screen then select Sipper and press Enter To change a parameter setting select the parameter and press Enter See Parameter Entry for more information Item Function Sipper Turns the MiniSipper on and off Mode Selects the run mode for the MiniSipper Sip Sets the system to fill the flow cell Sip amp Run Sets the system to fill the flow cell and automatically perform a measurement The current method is used to produce the result e g if Fixed is current then the sample will be scanned using the Fixed method as programmed Continuous Sets the system to pump continuously to waste Alternate switch presses will start and stop pumping The instrument will not process any key presses while the MiniSipper is pumping in continuous mode AutoSam Configures the Sipper to operate with an autosampler Air Gap Enter value between 0 and 500 cm Sets the gap between the trailing meniscus of the current sample and the leading meniscus of the next sample The gap is measured to the nearest centimeter For best results set the airgap to gt 8 cm from the flow cell Sample Vol Enter a value between 0 5 and 10 000 ml Sets the volume of sample to be pumped MiniSipper Calibration Item Sample Low Vol Function
2. sample volume DNA concentration IA All Az Ares fal Dr Protein concentration A2 Aret f3 Ai Aret fa Di Ratio A Aret A Aref None Default Parameters A 260nm A2 280nm Aret 320nm optional f 50 5 0 fs 1552 fa 757 3 dil vol 0 smp vol 1 A 260nm A 230nm Aret 320nm optional f 50 5 0 f 183 f4 75 8 dil vol 0 smp vol 1 Start wavelength 230nm Stop wavelength 330nm Displayed Units DNA ug ml Protein ug ml Ratio no units DNA ug ml Protein ug ml Ratio No units None Spectrophotometer User Guide 165 Test Name DNA Protein concentration and DNA Purity 260 230 with SCAN Direct UV ssDNA Direct UV RNA Test Types Absorbance Difference Absorbance Ratio Scan Scan Absorbance Absorbance Difference Absorbance Ratio Scan Factor Factor Direct UV DNA RNA Factor 166 Spectrophotometer User Guide Calculation s Dilution Factor D diluent vol sample vol sample volume DNA concentration Ai Alf Az Aref Di Protein concentration Ao Areslfs Ar Are fa Di Ratio A Aret A Aref None Dilution Factor D diluent vol sample vol sample volume DNA concentration Ai Areslfi Az Alf Di Protein concentration Ao Areslfs A1 Aree fa Di Ratio A1 Aret A2 5 Aret
3. 0 5 25 mg l 10 mm Rectangular mg l PO P 14729 14729P10 FXD 1 5 75 0 mg l mg l PO4 H E 2 e cy ba zZ Phosphorus VM 0 5 25 0 mg l 16 mm Round mg l PO P 14546 14546P16 FXD 1 5 75 0 mg l mg l PO4 0 5 15 0 mg l 20 mm Rectangular mg l PO4 P 14546 14546P20 FXD 1 5 45 0 mg l mg l PO 1 0 30 0 mg l 10 mm Rectangular mg l PO P 14546 14546P10 FXD 3 0 90 0 mg l mg l DO 0 5 15 0 mg l 20 mm Rectangular mg l PO P 14842 14842P20 FXD 1 5 45 0 mg l mg l DO 1 0 30 0 mg l 10 mm Rectangular mg l PO4 P 14842 14842P10 FXD 3 0 90 0 mg l mg l DO m 50 500mgl _flommRoud ek use Kecnere 5 0 50 0 mg l 20 mm Rectangular mg l K 14562 14562P20 FXD 5 0 50 0 mg l 10 mm Rectangular mg l K 14562 14562P10 FXD 0 005 0 750 mg l 50 mm Rectangular mg l Si 14794 14794P50 FXD 14794 14794P20 FXD 0 1 5 00 mg l 10 mm Rectangular mg l Si 14794 14794P10 FXD Silver 0 05 2 50 mg l 20 mm Rectangular mg l Si 1 0 50 3 00 mg l 0 mm Rectangular mg l Ag 14831 14831P10 FXD ch 0 25 1 50 mg l 20 mm Rectangular mg l Ag 14831 14831P20 FXD Sulphate 5 250 mg l 16mm Round mgl SO 14548 14548P16 FXD 5 250 mg l 20 mm Rectangular mg l SO 14548 14548P20 FXD 5 250 mg l 10 mm Rectangular mg l SO 14548 14548P10 FXD 2 Sulphide 0 020 0 500 mg l 50 mm Rectangular 3 de o N 14779 14779P50 FXD Spectrophotometer User Guide 91
4. Manual Cell changer can be operated manually Use the right left arrow keys to position a cell Run amp Step Measures the current cell and automatically moves to the next cell Auto Cell changer operates automatically measures each cell in order The number of cells measured maximum of 7 depends on the value of the Last Cell parameter Off Turns off the Cell Changer The instrument behaves as if it has a single cell only Note For the BioMate 6 Mode can only be set to On or Off Ref Mode Toggles the Reference mode on and off When On assigns cell number 1 as the Reference position and performs a zero or baseline measurement on that cell This is true for all Mode settings above Note This parameters is not available for the BioMate 6 Last Cell Defines the last cell to be measured in a sequence Can be set from 1 to 7 Note This parameters is not available for the BioMate 6 Cell Cycles When Mode is set to Auto this parameter defines the number of measurements cycles performed on each cell up to 300 For example set Cell Cycles to 4 to measure each cell four times according to the current method Note This parameters is not available for the BioMate 6 Speed Sets the Cell Changer speed of rotation High Medium or Low Function key Description Initialize Resets the Cell Changer and places cell number 1 in the sample beam Spectrophotometer User Guide 135 SuperSipper The SuperSipper is an optio
5. p Dimethylamino benzaldehyde AccuVac PD Molybdate Salicylate TNT 0 50 0 mg l 42465 H2465 QNT Spectrophotometer User Guide 95 E c E Salicylate PP or AccuVac e H e Vi gt E E Monochloramine and free ammonia Nitrogen Nitrate 0 0 50 mg l 2515 C A O z c 8 Jj C Ei E 6 jmd o 5 Cadmium Reduction 0 5 0 mg l 2520 Nitrogen Nitrite 0 0 3000 mg l Nitrogen Total Titanium Reduction TNT 0 25 0 mg l Inorganic i Persulphate Digestion UNT 0 25 mg l i i 0 250 mg l 2525 2530 2535 2511 2610 2620 2630 2600 2550 2410 2558 d d B Z gt e d o d p Z NEN NN 8 ES s es LA D 3 e 3 o gt e e 2 G 3 ier Q lt lt 9 E o Es 2 5 g F o E e c MAS E B CH 2850 H 0 0 200 mg l 2900 0 2 50 to 0 125 mg l 2950 Phosphorus Reactive 0 2 500 mg l 43025 PhosVer 3 AccuVac 96 X Spectrophotometer User Guide GIE ule SIE x8 Ulm o Z H2515 QNT H2525 QNT H2530 QNT H2511 QNT H2550 QNT H2410 QNT H2558 QNT H2850 QNT H2900 QNT H2950 QNT H3025 QNT H3030 QNT H3035 QNT H3010 QNT H3015 QNT H3020 QNT H3036 QNT Phosphorus Acid Ascorbic Acid TNT 0 5 00 mg l 3037 H3037 QNT Hydrolyzable N N Dimethyldithiooxamide 0 10 g l H3150 QNT Quaternary Ammonium Dire
6. Default Parameters 540 nm Standard concentrations of 0 2 4 6 8 10 280 nm Factorzgo 1 dil vol 0 smp vol 1 205nm Factor 31 dil vol 0 smp vol 1 A 280nm A 260nm fi 1 55 f2 0 76 600nm Displayed Units mg ml mg ml mg ml mg ml Abs Calculation Name of bases GC content Molecular weight Absorptivity Factor Calculation of Tr Oligos up to 40 mers in length Calculation of Te DNA DNA hybrids BioMate Oligo Calculator Entry Parameters Repetitive sequence of A T or U G and C Use AT U GC sequence entered above units A 7 units T units G units C units U units A 7 units T units G units C units U N A units A units T units G units C units U units A units T units G units C M molarity of Na GC percentage of G and C form formamide in the solution L of base pairs P mismatching Formula Count of total of bases entered GC of G C bases x 100 total of AT or U JGC If entry does not include U MW 312 2 x A 303 2 x T 329 2 x G 289 2 x C 18 02 If entry does include U MW 329 2 x A 306 2 x U 345 2 x G 305 2 x C 18 02 If entry does not include U 20 15 200 x A 8 400 x T 12 010 x G 7 050 x C If entry includes U 25 15 200 x A 9 900 x U 12 010 x G 7 050 x C Molec
7. Parameter Function Load Loads the selected method or displays the selected results Rename Displays the Save Rename screen so you can save the file with a different file name and description Save to Library Copies the selected file to the instrument library Delete Removes the selected file from the installed USB memory device Spectrophotometer User Guide 107 UVcalc Quantitative analytical procedures are built around two fundamental principles measurement of the parameter and subsequent calculations based on these measurements In UV Visible spectrophotometry and many other mature analytical techniques the science associated with the measurement of the parameter is well developed There are fully validated test kits available from the leading chemical suppliers in the key areas of bio chemical and environmental water chemistry In addition most laboratories also have their own fully developed internal procedures With defined procedures many standard methods document the final calculation in the form of an algebraic formula UVcalc allows these formulae to be entered into the software method together with the control limits UVealc provides automatic calculation of results from measurements using user defined equations The measurement is obtained from the spectrometer in the form of a reading at a specific wavelength in Scan methods and individual results in Fixed and Quant methods Spectrophotometer U
8. STANDARDS 8 UNITS ug ml ID O OFF o LOW HIGH LIMITS 9999 9999 STATISTICS OFF AUTOPRINT OFF USER I L 4 CALIB PRINT SAVE STORED VIEW RATE TEST TEST TESTS RESULTS Coomassie Bradford Standard test parameters Preparing and running a standard curve l Display the appropriate protein parameter screen and then select Standards and press Enter 2 Edit any changed concentration values and press Accept Spectrophotometer User Guide 63 Editing a standard curve Measuring protein 64 Spectrophotometer User Guide 3 When all the parameters are correct press Calibrate 4 Follow the on screen instructions to start the calibration by inserting a blank or standard at each prompt and pressing Run After the instrument has measured the last standard the Calibration screen shows the absorbance of each standard along with the equation of the calculated standard curve You may re measure any standard on a standard curve delete specific y y points from a curve or select a different curve fit To edit a standard 1 Press Standards on the Calibration screen 2 Press Edit Std on the Standards Results screen 3 Select the standard you want to edit by entering its number in the pop up entry box A pop up menu appears Select the option to remove the standard from the calibration restore a previously ignored value or remeasure the standard s absorbance and follow the o
9. library refers to an area of instrument memory called the instrument library and any USB memory device that is formatted as a library You can save files to both types of libraries from the method or results screen of any Local Control Software application Instrument Library screen To display the instrument library screen select Library on the Home screen and press Enter The instrument displays the file name file type and description of each library file Here are some examples LIBRARY TYPE TEST NAME FILENAME M QUANT UV123 AB123B QNT M FIXED UV146 DE146G FXD D QUANT UV146 TEST QNT M FIXED IX2 THRIB FXD 76 LIBRARY SPACE REMAINING HIGHLIGHT A FILE AND PRESS ENTER SMART PRINT FORMAT COPY VIEW START DIR LIBRARY ALL USB MEM Instrument library screen for all instruments except the BioMate 6 i I I I I I I I I I I I I I D FIXED UV146 TEST2 FXD I I I I I I I I I I I J ere Spectrophotometer User Guide 103 LIBRARY TYPE TEST NAME FILENAME D SCAN TEST SCN M BIO OLIGOS CALC 1A 01 NAM M BIO BCA MICRO2A BC2 PRM 76 LIBRARY SPACE REMAINING HIGHLIGHT A FILE AND PRESS ENTER ALL PRINT FORMAT COPY VIEW FILES DIR LIBRARY ALL USB MEM Instrument library screen for the BioMate 6 i I I I M BIO BRADFORD MICROO2A B2 PRM I I I Use the arrow keys to display the next or previous
10. DNA with scan Records absorbance scan between 260 nm and 280 nm or between 260 nm and 230 nm and determines concentration and purity based on the absorbance ratio and absorbance difference DNA RNA Conc Measures absorbance at 260 nm and calculates concentration based on the absorbance and concentration factor RNA Measures absorbance at 260 nm and calculates concentration based on the absorbance and concentration factor Oligonucleotides Measures absorbance at 260 nm and calculates concentration based on either the absorbance and concentration factor or the absorbance and concentration factor determined by the oligo calculator application Several of these categories include multiple tests that are similar For example the parameters are the same for the Direct UV measurement of ssDNA and RNA tests but the factor used to convert absorbance to concentration is different Similarly the parameters for the Direct UV measurement of oligonucleotide tests are also the same but the factors used to convert absorbance to concentration are different Screen images are provided as examples but are not comprehensive For a complete list of all parameters and calculations for each test refer to the appendices To change a parameter setting highlight the parameter and press Enter See Parameter Entry for more information DNA tests This group includes two tests that function almost identically the only difference is in the wavelength
11. Dilution Factor D diluent vol sample vol sample volume Conc F X Axel Dilution Factor D diluent vol sample vol sample volume Conc F X Axel Dilution Factor D diluent vol sample vol sample volume Default Parameters A 260nm A2 280nm Aret 320nm optional f 50 5 0 fz 1552 fa 757 3 dil vol 0 smp vol 1 Start wavelength 230nm Stop wavelength 330nm A 260nm A 230nm Aret 320nm optional f 50 LD f 183 f4 75 8 dil vol 0 smp vol 1 260nm Factorasona 33 dil vol 0 smp vol 1 260nm Factorsspnay ssRNA 40 dil vol 0 smp vol 1 260n m Fa cto lssDNA ssRNA 50 dil vol 0 smp vol 1 Displayed Units DNA ug ml Protein ug ml None DNA pg ml Protein ug ml ug ml ug ml ug ml Test Name Direct UV oligos w base calculator Direct UV oligos Protein Tests Coomassie Bradford standard Coomassie Bradford micro Lowry standard Pierce Modified Lowry micro BCA Bicinchoninic Acid standard Pierce Micro BCA Test Types Factor Factor Standard Curve Standard Curve Standard Curve Standard curve Standard Curve Standard Curve Calculation s Conc F X Axel Dilution Factor D diluent vol sample vol sample volume Conc F x Acel F factor calculated by Oligo Calculator Diluti
12. Oligo calculator blank if no base sequence entered calc value if base sequence entered Warburg Christian 1 55 280 0 76 260 1 1 00 99999 X XX XX XX XXX X XXXX XXXXX One Off NA NA 0 001 to 99999 0 001 to 99999 X XXX XX XX 0 0FF 1 999 Integer Spectrophotometer User Guide 161 Parameter Low High Limits Number of Bases Number of Samples Number of Standards Ref Wavelength Ref Wavelength Correction Sample Positioner Sample Volume Scan Start Scan Stop Description Lowest amp highest acceptable results outside of which the result is flagged as Low or High Number of bases contained in sample Number of samples to be measured in the whole test if cell changer installed Number of standards to be measured for calibration curve Internal Reference wavelength for each reported measurement measures analytical wavelength amp reference wavelength Reported measurement abs analytical WL abs Reference WL Turns internal zeroing on or off Manual moved by buttons Auto 6 Ref auto moved Rei 2 3 4 5 6 7 Auto 7 auto moved 1 2 3 4 5 6 7 Total volume of sample Start wavelength for scan Final wavelength for scan 162 Spectrophotometer User Guide Initial Default Values 9999 9399 empty not an entry 1 Bradford micro Lowry Biuret 6 BCA Bradford std 8 Pierce Lowry 9 DNA 320 Off Auto 6 Ref if
13. PROTEIN CONC 1111 1 ug ml PRINT SAVE TEST CLEAR LIST DATA PAGE RESULTS DNA 260 280 test results This group includes two tests that function almost identically the only difference is in the wavelengths range used for the measurements one measures absorbance between 260 nm and 280 nm the other between 260 nm and 230 nm The example below shows the parameters for the DNA with scan 260 280 test For the DNA with scan 260 230 test Wavelength 2 is set to 230 nm DNA WITH SCAN USER I TEST NAME DNA WITH SCAN WAVELENGTH 1 260 0 nm WAVELENGTH 2 280 0 nm REF WAVELENGTH OFF CORRECTION DNA FACTOR A1 50 00 DNA FACTOR 42 0 000 DISPLAY PROTEIN NO DILUTION MULTIPLIER 1 00 UNITS ug ml ID O OFF o AUTOPRINT OFF SETUP PRINT SAVE STORED VIEW SCAN TEST TEST TESTS RESULTS DNA with scan 260 280 test parameters Measuring DNA using scans 1 Display the appropriate DNA parameter screen and enter the initial sample number ID 2 Place the blank in the cell holder 3 Press Zero Base to measure the blank A Place the unknown sample in the cell holder 5 Press Run to start the measurement The DNA measurement screen is displayed The instrument scans the sample and displays a graph of the scan along with the sample ID DNA ratio DNA concentration and protein concentration Here is an example TEST NAME DNA W
14. Sulphite 0 05 3 00 mg l 50 mm Rectangular mg l SO 14394 14394P50 FXD 0 5 15 0 mg l 20 mm Rectangular mg l SO3 14394 14394P20 FXD D a 1 0 25 0 mg l 10 mm Rectangular mg l SO 14394 14394P10 FXD 1 0 25 0 mg l 16 mm Round 14394 14394P16 FXD 0 05 2 0 mg l 16 mm Round mg l MBAS 14697 14697P16 FXD oO o 6 10 mm Rectangular mg l Sn 14622 14622P10 FXD Zin 0 050 0 500 mgl 50 mm Rectangular lmg Za seo 16 mm Round mg l Zn 14566 14566P16 FXD 10 mm Rectangular mg l Zn 14832 14832P10 FXD 0 05 3 00 mg l 0 0 20 5 00 mg l 20 5 00 mg l 20 5 00 mg l 05 2 50 mgl 92 Spectrophotometer User Guide Hach Bro Cad Chonn ee es pezewer e bg o P P on mi m DPD TNT 0 5 00 mg l 1480 DPD AccuVac 0 2 00 mg l MET 0 1 00 mg l Chiron Hoan 1 5 Diphenylearbohydrazide 0 000 mgl 1560 1 5 Diphenylcarbohydrazide 0 0 700mg l 1570 H1570 QNT bidimetric AccuVac D D D Chlorine Total DPD 0 2 00 mg l D Diphenylcarbohydrazide Spectrophotometer User Guide 93 GOD Oxygen Demand zw rear Chemical mee emen en Geen Color True and Platinum Cobalt 0 500 units 1670 H1670 QNT Apparent Platinum Cobalt 0 500 units H1680 QNT Hardness Calcium or Calmagite Colorimetric 0 4 00 mg l H2020 QNT Mg 94 Spectrophotometer User Guide TS
15. To reset a parameter select the parameter and press Enter to display a pop up entry box Type the new value and press Enter When you are finished setting parameters press Accept to save the new settings or Cancel to exit without saving Press Setup Page to return to the Setup screen Printer menu options Select this option to set up a printer The Printer Type is displayed and is set to the currently selected printer To change the selected printer press Enter A pop up menu is displayed with a list of supported printers Select a printer and press Enter PRINTER HP LASERJET HP INKJET 120 Spectrophotometer User Guide Note Environment screen Menu Option Description HP LaserJet HP LaserJet Series with PCL 3 only HP InkJet HP InkJet Series with PCL 3 only Function key Description Setup Page Displays the Setup screen Printers designed to work only in a Windows environment may not be compatible with Local Control software 4 Before you attempt to print at any point during operation of the instrument make sure the printer is ready to print i e power is on printer is on line paper is loaded Failure to do so will result in an error condition Press ESC to clear the error message Then correct the problem with the printer and try again Use this screen to turn the beeper on and off and set the date format the language used for the software and the default file type used to save results Yo
16. have a name and associated concentration entered To define the standards select a standard and press Enter The Text Entry screen is displayed Enter the name of the standard and press Accept The instrument returns to the Standards screen and the concentration field is highlighted for the current standard Press Enter to display the pop up entry box Use the numeric keys to enter the concentration of the standard and press Enter The Standards screen is displayed with the next standard highlighted Up to 20 standards can be specified with up to 10 standards per page Press Std11 Std20 to display page 2 or Std1 Std10 to display page 1 When Measure Stds is set to No press Enter to display the Library screen Use the Library functions to select and load the file for each standard in sequence Use the Multi A function available from the Fixed application to build a library of standards for your multi component analysis If you do that make sure you use the same method every time you run your standards and those conditions will be used in your MCA automatically A The same method must be used for each Multi result and will be used for the MCA analysis When the first Multi file is loaded the current MCA method is changed to that used to obtain the Multi A result Standards can thus be used in any combination without having to recalibrate for each new mixture Function key Description Std1 Std10 Toggles between page 1 and pag
17. iced tette uscire Eva ae aeta ieu du RU pc 68 Measuring eelere 68 Olivo calculator functions oe uu ea EEN 69 Er 69 Using the oligonucleotide calculator 5 3 ice reete 69 AquaMate Methode 70 How to run an Aqua Mate method auae une usum disent 71 Loadinga method EE 71 Saving a method to the DIDfagysu aseo Etui tees uhi eee rats 72 About the method results 14 aee tud etra dde 72 Disk 1 Merck Spectroquane methods 222i ente een 73 scii Me 73 Se UN Cs a ED TE 74 Disk 2 Hach test kit E 75 FXD method filesinin aa tas donde 75 ON Tmietliod Bes neren steel da Mel utu E a 77 Disk 3 Dr Lange cuvette and pipette test kit methods 80 RE 80 MCSE CSUN tai GFK Saas ate Sains A cae eI dee 80 Disk 4 CHEMetrics Vacu Vial methods ess 82 RE 82 RK EE 82 AquaMate method descriptions tr ceo ien retos 84 IVI c M RSEN 84 la e 93 anger M 98 GEHTEMGEDES ies tient etie tine reete Pena cord NEUE ene FERE EN Persae sus 101 EDITI e 103 Instr ment Library E 103 Working with files stored in the instrument library 105 USB Memory Device Library E 106 Working with files stored on a USB Memory device 107 L7 108 IEN 109 Operati Dessi nao aa bets ur w
18. 00 mg l mg l NO Et ee 14537 DEE ee iN 14537 E EE 14537 ES EEN 14694 0 Q o Ed E 6 Eg E S R 6 SS e Z e KoA 3 gs N 3 3 kel CH o CT ES 3 E m o N Nn 5 Aa S a ON zz z SEES 3 d e eu WG E p D D ii fee a Ke Ke e 3 ge 2 CH D S S da 5 12 5 12 0 mg l 20 mm Rectangular mg l O2 14694 14694P20 FXD 0 5 12 0 mg l 10 mm Rectangular mg l O2 14694 14694P10 FXD 0 10 2 50 mg l mg l phenol 14551 14551P16 FXD i 14551 14551P50 FXD 0 10 2 50 mg l 20 mm Rectangular mg l phenol 14551 14551P20 FXD 0 10 2 50 mg l 10 mm Rectangular mg l phenol 14551 14551P10 FXD Phosphorus PMB 0 01 1 00 mg l 50 mm Rectangular mg l PO P 14848 14848P50 FXD 0 05 3 00 mg l mg l DO 0 03 2 50 mg l 20 mm Rectangular mg l PO P 14848 14848P20 FXD 0 10 7 50 mg l mg l PO 0 05 5 00 mg l 10 mm Rectangular mg l PO P 14848 14848P10 FXD 0 2 15 0 mg l mg l DO 0 05 5 00 mg l 16 mm Round mg l PO4 P 14543 14543P16 FXD 0 2 15 3 mg l mg l PO4 0 03 2 50 mg l 20 mm Rectangular mg l PO4 P 14543 14543P20 FXD 0 10 7 50 mg l mg l PO 0 05 5 00 mg l 10 mm Rectangular mg l PO P 14543 14543P10 FXD 0 2 15 0 mg l mg l DO 0 5 25 mg l 16 mm Round P 14729 14729P16 FXD 90 Spectrophotometer User Guide 1 5 75 0 mg l Trei PO4
19. 20 mm Rectangular 10 mm Rectangular 50 mm Rectangular 20 mm Rectangular 14785 10 mm Rectangular mg l Ni 14785 Nitrogen Ammonia 0 01 2 00 mg l 16 mm Round mg l NH N 14739 14739P16 FXD 0 01 2 60 mg l mg l NH 0 01 2 00 mg l 10mm Rectangular mg l NH4 N 14739 14739P10 FXD 0 01 2 60 mg l mg l NH4 0 20 8 00 mg l 16 mm Round mg l NH4 N 14558 14558P16 FXD 0 30 10 00 mg l mg l MH 0 20 8 00 mg l 10 mm Rectangular mg l NH4 N 14558 14558P10 FXD 0 30 10 00 mg l mg l MH 0 5 16 0 mg l 16 mm Round mg l NH N 14544 14544P16 FXD 0 6 21 0 mg l mg l NH 0 5 16 0 mg l 10 mm Rectangular mg l NH4 N 14544 14544P10 FXD 0 6 21 0 mg l mg l NH 4 0 80 0 mg l 16 mm Round mg l NH4 N 14559 14559P16 FXD 5 0 100 0 mg l mg l MH 4 0 80 0 mg l 10 mm Rectangular mg l NH4 N 14559 14559P10 FXD 5 0 100 0 mg l mg l MH 0 010 0 500 mg l 50 mm Rectangular NH4N 14752 14752P50 FXD 0 010 0 650 mg l mg l NH 0 03 1 50 mg l 20 mm Rectangular mg l NH4 N 14752 14752P20 FXD 0 04 1 90 mg l mg l NH4 0 05 3 00 mg l 10 mm Rectangular mg l NH4 N 14752 14752P10 FXD 0 06 3 90 mg l mg l NH4 88 Spectrophotometer User Guide mg l Ni mg l Ni mg l Ni iS T N o E 5 3 de Q o 6 Nitrogen Nitrate Nitrogen Nitrite 0 11 3 40 mg l 16 mm Round mg l NO3 N 0 5 15 0 mg l mg l NO 0 05 1 50 mg l 2
20. M1 4 88 The factors entered are those documented by Merck however the values of these factors may be affected by local conditions In all cases we recommend that you check the factors using standard solutions appropriate to your laboratory and modify the equation accordingly Note that the Merck methods do not use timers You can easily add them if desired by referring to the Timer parameter description in the Fixed section of this manual Disk 2 Hach test kit methods FXD method files Operation Note The Hach test kit includes two types of method files e FXD measures absorbance at up to 20 fixed wavelengths e QNT compares measured absorbance values against a concentration curve to determine sample concentration Instructions for running the Hach methods on the AquaMate are stored in PDF format on this CD The FXD files have the following format Hxxxx FXD where XXXX Hach program number FXD Fixed application in software If the Hach method indicates that timers are required then a number between 1 and 4 will appear next to the Timer s option on the Fixed screen Load the method see Loading a method for instructions Follow the Hach procedure until the first timer is required Then continue with the steps below 1 Press Run to start the first timer Some procedures require a zero measurement before the timer sequence is activated In this case insert the blank and press Zero Base to me
21. Method screen to set data collection and analysis parameters When you are finished setting parameters press Zero Base to perform a baseline scan with the current method When you are ready to start the analysis place the sample cell in the sample holder and press Run The spectrophotometer performs the measurement and displays the result on the MCA Results screen After all the results have been collected save the data Use this screen to set instrument and analysis parameters for performing a multi component analysis To change a parameter setting highlight the parameter and press Enter See Parameter Entry for more information MCA TEST NAME MEASURE STDS YES STANDARDS oi UNITS WAVELENGTH S 1 BANDWIDTH 2 0 nm INTEGRATION 1s DELAY TIME 00 00 LAMP CHANGE 325 nm USER i i CALIB PRINT SAVE VIEW VIEW gt RATE METHOD METHOD RESULTS CALIB Spectrophotometer User Guide 48 Item Test Name Measure Stds Standards Units Wavelength s Bandwidth Integration Delay Time Function Displays the Text Entry screen used to enter a descriptive name for the quant method The Test Name is saved with the method and any results produced by the method Toggles between internal calibration Yes and external calibration No Choose Yes to measure the standards with the run All fields remain editable Choose No to load standards from a Library or
22. USB memory device The Wavelength s Bandwidth Integration Delay time Lamp change and User Name are also loaded with the standards and cannot be edited Any attempt to do so causes the prompt Change method by loading MCA standards to appear and no action is taken Displays the Standards screen for entering concentrations values for up to 20 method standards See MCA Standards screen for details Displays the Text Entry screen used to enter the concentration unit for the standards Specify up to 20 wavelengths for measuring the samples Each wavelength can be between 190 nm and 1100 nm or 325 and 1100nm for the AquaMate Vis If the selected wavelength requires the deuterium lamp the lamp will activate automatically Note The current data will be lost if the wavelength is changed This parameter is fixed at 2 0 nm Defines the integration time for which the result is measured Enter a value between 1 and 9999 seconds Specifies a delay between pressing Aun and the start of the measurement Enter a value from 0 to 99 minutes and 59 seconds Use a decimal point to separate minutes and seconds e g 99 59 The number of seconds must always be entered explicitly Note This field is only available if U l ca c is installed Spectrophotometer User Guide 49 50 Spectrophotometer User Guide Note Note Note Item Lamp Change User Function key View Results View Stds Save Method Print Me
23. displayed with the following options Stop Interrupts the measurement and displays the Fixed Results screen Zero Takes a baseline measurement Proceed Continues to the next task in the measurement sequence After the last timer is completed the system proceeds to the next measurement task 34 Spectrophotometer User Guide This screen lists the standards for the Quant method Before the system can be calibrated each standard must have a concentration entered To enter the concentration values of the standards select a standard and press Enter to display the concentration entry box Enter the concentration of the standard and press Enter The Standards screen is displayed with the new value displayed and the next standard highlighted Up to 20 standards can be specified When all the standards have been entered press Accept to return to the Quant Method screen with the new list of standards or Cancel to return leaving the old list unchanged If a calibration has been done the correlation coefficient and the equation are displayed If a calibration has not been done pressing Run causes the warning prompt CANNOT RUN WITHOUT CALIBRATION to appear Otherwise it takes a sample measurement and switches to the Quant Results screen Pressing Zero Base starts a zero using the current method Function key Description View Calib Displays the Quant Graph screen if valid calibration exists View Results Displays the Q
24. is displayed along with the coefficient e Make sure you save the method file to the Library or USB memory device by pressing Save Method The program is now ready to use for measuring samples Spectrophotometer User Guide 77 Operation 78 Spectrophotometer User Guide Note Load the method see Loading a method for instructions Follow the Hach procedure until the first timer is required Then continue with the steps below 1 Press Run to start the first timer Some procedures require a zero measurement before the timer sequence is activated In this case insert the blank and press Zero Base to measure the baseline Then press Run to activate the first timer a The screen shows the action to be carried out and the time remaining Here is an example SHAKE REMAINING TIME 02 46 The instrument beeps to indicate the end of the time period and a Timer Finished menu box is displayed with the following options Proceed starts the next timer Zero takes a baseline measurement e Stop cancels the operation To start the next timer select Proceed and press Enter At the end of this timer the same Timer Finished menu box is displayed If the method requires a zero measurement insert the blank select Zero and press Enter The instrument measures the baseline and displays a menu box with options to Proceed or Stop Insert the sample into the cell holder and select Proceed The inst
25. key View Calib Calibrate Function Automatically set to Waste After measurement the sample is pumped through the flow cell to waste by the act of pumping the next sample Automatically set to Off Pumping time is set to maintain the correct air gap for a standard internal diameter 4 0 mm uptake tube Description Displays the Sipper Calibration screen Starts the Sipper calibration procedure Sipper Calibration screen Calibration adjusts the MiniSipper for variations in pump and uptake tubing and sample viscosities During calibration you enter the volume you want to extract from the sample and the system performs several sips using the appropriate solvent The software uses the entered volume to calculate a calibration factor The system uses the factor to adjust the pumping time to ensure that the correct sample volume is always used Details of the calibration used are displayed on the Sipper Calibration screen This screen displays the current sipper calibration information To alter the calibration press Calibrate SIPPER CALIBRATION 25 10 08 16 47 I I I NOMINAL VOL 1 000 ml NO SIPS DONE 5 TOTAL VOL SIPPED 5 100 ml TUBING CAL 1 020 i j VIEW CALIB CALIB RATE Spectrophotometer User Guide 143 Calibrate Sipper screen 144 Spectrophotometer User Guide Function key Description View Calib Displays the Sipper calibration results Ca
26. measure sample absorbance values at fixed wavelengths and compare them to known standards measured at the same locations The majority of files have the following format The methods determine sample concentration by measuring sample absorbance and then comparing to standards measured at fixed wavelength locations i e the Fixed application or a concentration curve i e the Quant application 14xxxPyy FXD where 14xxx Merck Catalog Number yy Pathlength of cell in nm FXD Fixed application in software In some cases the Merck catalog number is of the format 10xxxx In this case the AquaMate files have the format OxxxxPyy FXD A Prepare the sample and blank according to the instructions supplied with the test kit 1 Load the method see Loading a method for details 2 Place the blank in the cell holder and press Zero Base to measure the baseline 3 Insert the prepared sample into the cell holder and press Rzz to measure the sample The Fixed Results screen appears 4 To measure another sample insert the sample and press Run Spectrophotometer User Guide 73 Test results 74 Spectrophotometer User Guide In all but one method 14825P50 FXD the relationship between absorbance and concentration is linear over the specified measurement range and takes the general form C A x FACTOR Therefore the UVcalc equation typically takes the following form Method 14566P16 FXD Zi nc Equation
27. of diluent added prior to measurement Initial Default Values 0 empty not an entry Off empty field unless sequence entered previously 0 050 Std Curve Linear Bradford Standard Quadratic Bradford micro Quadratic Lowry Standard Quadratic Pierce Lowry micro Quadratic BCA Standard Quadratic Pierce Modified BCA Quadratic Biuret Linear Through Zero 1 100 Integer NA 1 100 Integer Onooff 40 characters max 0 001 9999 Linear Linear Through Zero Quadratic Quadratic Through Zero 0 999 Integer Spectrophotometer User Guide 160 Parameter Dilution Multiplier Display Protein DNA e 260 DNA Mol Wt Factor ID Description Factor used to correct for sample dilution Indicates whether results should appear as units of protein concentration Extinction coefficient Molecular weight of DNA contained in sample See individual calculations for usage Numeric Identifier autoincrements during test until reset or test is exited Initial Default Values 1 00 Off empty not an entry empty not an entry DNA 260 280 DNA with Scan 260 280 DNA Factor 260 50 DNA Factor 280 0 Protein Factor 260 757 3 Protein Factor 280 1552 DNA 260 230 DNA with Scan 260 230 DNA Factor 260 50 DNA Factor 230 0 Protein Factor 260 75 8 Protein Factor 230 183 ssDNA 50 RNA 40 Direct UV Oligos 33 Direct UV 280 1 Direct UV 205 38
28. page Note There may be a short delay while the instrument loads the next section of the directory 4 Parameter Function Type Describes the file and the type of information it contains Here are some examples M Scan Scan method D Scan Spectrum data and method M Fixed Fixed wavelength method D Fixed Fixed wavelength results and method M Quant Quant method including calibration D Quant Quant results including method and calibration M Rate Rate method D Rate Rate graphics data and method M MCA MCA method D MCA MCA results M Bio BioMate test D Bio BioMate test and results Type is assigned automatically depending on the application used to create the file and the file s contents Test Name Shows the descriptive name that was entered when the file was saved see Test Name in the method screen for any Local Control Software application Filename Shows the DOS compatible file name used by the instrument or computer You can edit or rename the file See Working with Files Stored in the Instrument Library for details 104 Spectrophotometer User Guide Function key View USB MEM Copy All Format Library Print Dir Smart Start All Files Results Only Description Displays the directory for the USB memory device that is currently in the drive Copies all files from the instrument library to the installed USB memory device Note Before you select this option install a compatible USB memory devic
29. speed i e the opposite of the one you are currently using Deletes all the markers and the data from the Track Table Prints the displayed data including markers and x and y axis values using the selected printer Displays the Scan Graph screen Track screen function keys Press ESC to delete markers in sequence starting with the marker that has the highest assigned number RESCALE AUTO GRAPH HIGH GRAPH LOW GRAPH START GRAPH STOP PROCEED Spectrophotometer User Guide 19 Compare Mode 20 Spectrophotometer User Guide Menu Option Auto Graph High Graph Low Graph Start Graph Stop Proceed Function Displays the Scan Graph screen with the x and y axes rescaled so that the spectrum fills the screen Pops up a window to enter the Graph High limit Pops up a window to enter the Graph Low limit Pops up a window to enter the required start wavelength Pops up a window to enter the required stop wavelength Used after Graph High Graph Low Graph Start or Graph Stop to return to the Scan Graph screen with the graph rescaled using the new parameters This option allows you to display a reference spectrum for comparison When selected Compare goes to the Library screen and displays a list of scan data files Select a reference file and press Enter The reference spectrum appears as a dotted trace The reference spectrum remains on the screen and is printed with all subseq
30. standards in the CVC These values are loaded into the spectrophotometer memory during setup Serial Number Shows the serial number of the calibration standards in the CVC Calibration Date Shows the original calibration date of the standards in the CVC Carousel Calibration data for the standards in the installed CVC read by the spectrophotometer when you initialize Serial Number Shows the serial number of the installed CVC Function key Description Initialize Reads the serial number of the installed carousel and initializes the carousel Load Data Loads calibration data from installed USB memory device into the spectrophotometer memory Setup Page Displays the instrument Setup screen 146 Spectrophotometer User Guide Automatic CVC calibration You can set up the instrument to calibrate automatically on start up if the CVC is installed To set this up display the Setup screen select Environment and set Automatic Cal Val to On When you start the instrument the system automatically waits for the warm up period 60 minutes and then performs tests 1 2 and 3 or tests 1 and 2 for the AquaMate Vis spectrophotometers To cancel automatic calibration press ESC Installing the CVC carousel Notice 1 Remove the cover from the motor drive 2 Remove the single cell holder or other accessory from the sample compartment 3 Install the CVC carousel Place the carousel on the motor shaft of the Smart base unit
31. the native file type of the Local Control Software This is the only file type that can be saved in the instrument library CSV Comma separated variable JCAMP DX JCAMP data exchange format Use the simulated keyboard or the numeric keypad to enter a descriptive name for the data and then press Accept See Text Entry screen or details Select a destination for the data file Press rterto toggle the Drive setting between Library saves the file in the instrument library Only Normal file types are accepted USB Memory saves the file on the Library USB memory device installed in the USB Memory Device port on the front of the instrument Saves all file types Description Stores your entries and displays the data screen Cancels the Save operation and displays the data screen Scan Select the Scan application on the Home screen to collect and analyze data at all points in a defined wavelength range Use the Scan Method screen to set data collection and analysis parameters When you are finished setting parameters press Zero Base to perform a baseline scan with the current method When you are ready to analyze the first sample place the sample cell in the sample holder and press Run The spectrophotometer performs the scan and displays the result on the Scan Graph screen From there the spectrum can be manipulated and saved to a Library or USB memory device Spectrophotometer User Guide 13 Scan Met
32. you enter the wrong password an error message appears and User Log On remains set to Off When User Log On is enabled each time the instrument is powered up the system prompts the user to log on by entering the correct user name and password This allows access only to functions that are enabled for each user by the system administrator At the close of a session the user logs off by pressing Log Offon the Home screen and choosing whether to Proceed or Stop When Proceeds selected the system waits for the next user to enter his or her name Every user can access all the functions available for the instrument Spectrophotometer User Guide 125 Change Users screen Note Notice 126 Spectrophotometer User Guide Function key Change Users Description Available only when User Log On is set to On Allows the system administrator to set up a user name and password and define access for each user E EDIT METHODS C CALIBRATIONS F DELETE FILES CURRENT USERS PASSWORD PRIVILEGES ECFIHLB ADMIN DEER H HISTORY FILE L RESET LIFETIMES B DEFAULT BASELINE I INITIALISATIONS USERS 11 20 CANCEL ACCEPT The system administrator can use this screen to add up to 20 names to the user list Each user must have an associated password Use the Privileges columns to enable each user access to the available functions Each function has an assigned letter ID the available functions are listed at th
33. 0 mm Rectangular mg l NO3 N 0 25 6 50 mg l mg l NO 0 10 3 00 mg l 10 mm Rectangular mg l NO3 N 0 5 13 0 mg l mg l NO 1 0 50 0 mg l 16 mm Round mg l NO3 N 4 220 mg l mg l NOs 1 0 50 0 mg l 10 mm Rectangular mg l NO3 N 4 220 mg l mg l NO 0 5 18 0 mg l 16 mm Round mg l NO3 N 2 0 80 0 mg l mg l NO 0 02 10 0 mg l 20 mm Rectangular mg l NO3 N 1 0 45 0 mg l mg l NO 0 5 20 0 mg l 10 mm Rectangular mg l NO3 N 2 0 90 0 mg l mg l NO 0 5 25 0 mg l 16 mm Round mg l NO3 N 2 110 mg l mg l NOx 0 25 12 5 mg l 20 mm Rectangular mg l NO3 N 1 0 55 0 mg l mg l NO 0 5 25 0 mg l 10 mm Rectangular mg l NO3 N 2 110 mg l mg l NOx 0 2 10 0 mg l 20 mm Rectangular mg l NO3 N 1 0 45 0 mg l mg l NO 0 5 20 0 mg l 10 mm Rectangular mg l NO3 N 2 0 90 0 mg l mg l NO 0 020 1 000 mg l 0 100 3 00 mg l 0 020 0 610 mg l 16 mm Round mg l NO N 0 05 2 00 mg l mg l NO 010 0 500 mg l 20 mm Rectangular mg l NO N 0 03 1 60 mg l mg l NOx 10 mm Rectangular mg l NO2 N mg l NOz 0 005 0 200 mg l 50 mm Rectangular mg l NO N Program AquaMate File Name 14776P50 FXD 14556 14556 14556 14764 14764 14542 14542 14542 14563 14563 14563 14773 14773 14547 14547 14547 14776 Spectrophotometer User Guide 89 e Fer mg l NO Wee 0 03 1 60 mg l mg l NOx 002 00 1 L0 xta Rectangules 14776 0 10 3
34. 7 Cell Changer fitted Not displayed if Single Cell Holder fitted 225 0nm 325 0nm 9999 NA 1 999 Integer 1 20 Integer 190 1100 On Off Auto 7 Auto 6 Ref Manual 7 for 7 Cell Changer no choice for Single Cell Holder 1 999 Integer 190 0 1100 0 190 0 1100 0 Parameter Standard Concentrations Statistics Test Name Description Concentration of standards used to generate standard curve for the test Turns statistics function on or off if ON calculates average and Std Dev of results Defined by user to identify stored tests Initial Default Values Range Coomassie Bradford Std 25 125 0 000 9999 250 500 750 1000 1500 2000 Bradford micro 2 5 10 15 20 25 Lowry Std 0 100 200 500 1000 2000 Lowry micro 1 5 25 125 250 500 750 1000 1500 BCA Std 25 125 250 500 750 1000 1500 2000 BCA micro 0 0 5 1 2 5 10 20 40 200 Biuret 0 2 4 6 8 10 Off Onooff DNA 260 280 up to 19 characters DNA 260 230 DNA WITH SCAN ssDNA RNA DNA RNA 260 OLIGOS FACTOR OLIGOS CALC COOMASSIE BRADFORD STD COOMASSIE BRADFORD MICRO LOWRY STANDARD PIERCE MODIFIED LOWRY BCA STANDARD PIERCE MICRO BCA BIURET DIRECT UV 280 DIRECT UV 205 WARBURG CHRISTIAN CELL GROWTH Spectrophotometer User Guide 163 Parameter Description Tm values Predicted melting point temperatures Units Labels concentration results Wave
35. 8 Spectrophotometer User Guide Setup screen Setup Use the Setup function key on the Home screen to access general instrument parameters Select a parameter in the list and choose Enter To change a parameter setting select the parameter and press Enter See Parameter Entry for more information SETUP CLOCK PRINTER ENVIRONMENT WAVELENGTH INITIALIZE WHITE LIGHT CVC RECORDER ACCES SORIES LAMPS Parameter Function Clock Sets the internal time and date Printer Selects the printer type Environment Wavelength Initialize White Light CVC Recorder Sets language date format file type autosave autoprint and user log on options Used for wavelength recalibration Defines instrument initialization and default baseline Sets zero order for alignment of sample holders Loads CVC calibration data Allows analog data output Spectrophotometer User Guide 119 Function key Description Accessories Displays a pop up menu to access parameters for accessories such as the Cell Changer or sipper Lamps Shows lamp status and energy levels turns lamps on and off and resets lamp hours See Lamps screen for more information Clock screen CLOCK TIME HOURS 16 MINS 32 DATE DAY 25 MONTH 12 YEAR 08 L I SETUP CANCEL ACCEPT Select this option to set the instrument s internal time and date
36. AY TIME 00 00 LAMP CHANGE 325 nm USER UVcalc o i i PRINT SAVE VIEW METHOD METHOD RESULTS For Zeta Omega Evolution 160 UV 10 BioMate 6 models Spectrophotometer User Guide 25 FIXED MODE ABS I I TEST NAME SELECT SINGLE WAVELENGTH S 550 0 nm BANDWIDTH 2 0 nm INTEGRATION 1s TIMER S o LAMP CHANGE 325 nm USER UVcalc 0 PRINT SAVE VIEW METHOD METHOD RESULTS For AquaMate models Parameter Function Mode Selects a format for displaying the data ABS Absorbance T 96 Transmittance Test Name Displays the Text Entry screen used to enter a descriptive name for the scan method The Test Name is saved with the method and any results produced by the method Select Selects the number and sequence of wavelengths measured for each sample Single Measures each sample at a single wavelength which is the same for each sample Multi Allows each sample to be measured at up to 20 wavelengths which are the same for each sample Serial Allows a single wavelength measurement to be made at a different wavelength for each sample for up to 9 samples Wavelength s Specifies the wavelength values Single A Enter the required wavelength at the prompt and press Enter Multi Select the first wavelength and press nterto display a pop up entry box Enter the wavelength and press Enter The instrument displays the Multi screen with the
37. BOTH THE SAMPLE AND REFERENCE BEAMS if double beam instrument ARE CLEAR BEFORE SWITCHING ON THE INSTRUMENT Failure to do so will produce abnormal results Low lamp energy values can be caused by leaving cells in the sample and or reference beams during energy measurement ALWAYS CHECK THAT BOTH THE SAMPLE AND REFERENCE BEAMS if double beam instrument ARE CLEAR BEFORE MEASURING LAMP ENERGIES Abnormal results will be produced if a sample is left in the beam when Zero Base is pressed ALWAYS ENSURE THAT THE SAMPLE IS REMOVED AND THAT BOTH THE SAMPLE AND REFERENCE BEAMS if double beam instrument ARE CLEAR OR CONTAIN THE APPROPRIATE ZERO REFERENCES BEFORE ZEROING THE INSTRUMENT OR PERFORMING A BASELINE SCAN VERY OFTEN POOR INSTRUMENT PERFORMANCE OR FAILURE CAN BE ATTRIBUTED TO SIMPLE FAILURE OF THE TUNGSTEN LAMP THEREFORE REPLACE AS BELOW USING THE SPARE LAMP PROVIDED BEFORE SEEKING FURTHER ASSISTANCE If any fault occurs including the above lamp failure these are reported by the system as an Error condition and an Exxxx number is generated Descriptive text is also included with this message Spectrophotometer User Guide 152 Error Codes Detailed below are the error codes produced if Symptom Error Codes The tungsten lamp fails or is poorly aligned E3010 E3011 E3104 E3015 E3030 The deuterium lamp fails E3003 E3004 E3005 E3006 E3007 E3008 E3009 E3012 E3013 E3022 E3029 E3044 E3045 The be
38. Chlorine 50itim Rectangular Impl CL 84 Spectrophotometer User Guide Chlorine Chlorine Dioxide 0 01 1 00 mg l 50 mm Rectangular mg l Cl 14732 14732P50 FXD amp Ozone S 20 mm Rectangular 14732P20 FXD 10 mm Rectangular ii 005 200mgl leen bad net COD Oxygen Demand 4 0 40 0 mg l 16 mm Round mg l COD 14560 14560P16 FXD Chemical A Vi Vi N A WN WN N A N Vi oo Spectrophotometer User Guide 85 Units 3 o EE S 14678 14821 14821P10 FXD 14683 mg l CN e Nn N WN 8 Ke N iS 8 8 CN o Pt o Oo E f N mg l CN ES N ES S d ES Vi 8 8 CN Q CT fo Oo E f 8 O N S D Nn S N i94 8 Oo N S 3 8 GO Q o o 5 Oo E Ei N mg l CN em N e ES ES d Ke WN S 8 3 F LC CT 5 ij Oo E N S iS nN S N A S d N S 3 vs Q CH qe 5 gg E Ei N N nN Nn 3 Oo Nn 3 3 kel Q o et Ro 3 gg E Ei 3 Oo esl E A iS ES 8 eie re c Mn ON Ke Zeg E 0 010 0 500 mg l 10 mm Rectangular 0 1 10 0 mg l 10 mm Rectangular mg HCHO 0 02 1 50 mg l 50 mm Rectangular mg l HCHO TE TU a R 0 002 0 100
39. ELENGTH 280 0nm FACTOR 1 000 DILUTION MULTIPLIER 1 00 UNITS mg ml SAMPLE POSITIONER AUTO 6 REF NUMBER OF SAMPLES 1 ID 0 OFF o LOW HIGH LIMITS 9999 9999 STATISTICS AUTOPRINT Running Direct UV measurements of proteins 1 With the appropriate Direct UV parameter screen displayed enter the initial sample number ID 2 Place the blank in the cell holder 3 Press Zero Base to measure the blank 4 Place the unknown sample in the cell holder 5 Press Run to start the measurement When the instrument is finished measuring the absorbance of the sample it displays the ID absorbance and concentration Here is an example TEST NAME DIRECT UV 280 ID ABS CONC 280 0nm mg ml 0 234 2345 6 999 0 121 123 45 1 2 0 345 345678 PRINT SAVE TEST CLEAR LIST DATA PAGE RESULTS 66 Spectrophotometer User Guide Warburg Christian test The Warburg Christian test uses an absorbance difference measurement at 280 and 260 nm to determine the concentration of protein in an unknown sample WARBURG CHRISTIAN I TEST NAME WARBURG CHRISTIAN WAVELENGTH 1 280 0 nm WAVELENGTH 2 260 0 nm PROTEIN FACTOR A1 1 550 PROTEIN FACTOR 42 0 760 DILUTION MULTIPLIER 1 00 UNITS mg ml ID O OFF o LOW HIGH LIMITS 9999 9999 STATISTICS OFF AUTOPRINT OFF USER PRINT SAVE STORED VIEW TEST TEST TESTS RESULTS Warburg Christian test paramet
40. ID 2 Place the blank in the cell holder 3 Press Zero Base to measure the blank A Place the unknown sample in the cell holder 68 Spectrophotometer User Guide 5 Press Run to start the measurement When the instrument is finished measuring the absorbance of the sample it displays the sample number and absorbance on the screen Oligo calculator functions Specifying a base sequence The oligonucleotide calculator determines the following data for a base sequence that you enter Number of bases e Percent GC content Molecular weight e Absorptivity e e Conversion factor to be used in Oligonucleotide measurements Twn for oligos up to 20 mers DNA DNA hybrids DNA RNA hybrids and RNA RNA hybrids You must enter a base sequence before you can run the oligonucleotide calculations 1 Display the Base Sequence screen and select the required base 2 Press Enter to add the base to the sequence Repeat these steps until you have specified the entire base sequence The displayed number of bases percent GC content molecular weight absorptivity and conversion factor will be updated as each new base is added to the sequence Using the oligonucleotide calculator To view the Melting Point calculator display the Base Sequence screen and press T Calc Set the parameters as desired see Parameter Entry for details When you have finished setting parameters the relevant set of melting point pred
41. ITH SCAN Graph of scan with data at 260 nm and 280 nm marked if Ref wl On ID DNA RATIO DNA PROTEIN 99 1 7 254 6 ug ml 18 1 ng ml RESCALE PRINT SAVE TEST CLEAR ALL DATA PAGE RESULTS DNA with scan test results Direct UV measurements of nucleic acids This group includes e DNA RNA tests e RNA tests e Oligonucleotide tests using an entered factor Spectrophotometer User Guide 59 All of these tests use similar test parameters For example the Factor used to convert absorbance to concentration for the direct UV measurement of ssDNA is 50 see the example below The Factor is 40 for the direct UV measurement of RNA and 33 for the direct UV measurement of oligonucleotides TEST NAME WAVELENGTH FACTOR DILUTION MULTIPLIER UNITS SAMPLE POSITIONER AUTO 6 REF NUMBER OF SAMPLES 1 LOW HIGH LIMITS 9999 9999 STATISTICS OFF IDs 0 OFF o AUTOPRINT OFF Direct UV measurement of dsDNA test parameters Running Direct UV measurements of nucleic acids 60 Spectrophotometer User Guide 1 Display the appropriate Direct UV parameter screen and enter the initial sample number ID 2 Place the blank in the cell holder 3 Press Zero Base to measure the blank 4 Place the unknown sample in the cell holder 5 Press Run to start the measurement The Direct UV measurement screen is displayed When the instrument is finished measuring the absorbance of the sample it displays the ID absorban
42. LINEAR MEASURE STDS YES TIMER S o LAMP CHANGE 325 nm USER UVcalc 0 CALIB PRINT SAVE VIEW VIEW gt RATE METHOD METHOD RESULTS CALIB For AquaMate models Option Test Name Wavelength Bandwidth Integration Standards Replicates Units Function Displays the Text Entry screen used to enter a descriptive name for the quant method The Test Name is saved with the method and any results produced by the method Specify a wavelength for measuring the samples Enter a value between 190 0 nm and 1100 0 nm or between 325 and 1100nm for the AquaMate Vis If the selected wavelength requires the deuterium lamp the lamp will activate automatically Note The current data will be lost if the wavelength is changed This parameter is fixed at 2 0 nm Defines the integration time for which the result is measured Enter a value between 1 and 9999 seconds Displays the Standards screen for entering concentrations values for the method standards See Standards screen in the next section for details Defines the number of times each standard will be measured 1 3 All values are used in the calibration Displays the Text Entry screen used to enter the concentration unit for the standards Spectrophotometer User Guide 31 32 Spectrophotometer User Guide Option Curve Fit Measure Stds Timer s for AquaMate models only Function Selects the curve fit algorithm used
43. Press Run to measure STD1 is displayed Place the first standard in the beam and press Run Continue until all standards have been measured The results for each standard are stored in the Calibration Results Table the data for each standard is displayed on a new page Use the arrow keys to display the next or previous page When you have finished measuring the standards place the first sample in the beam and press Run see the next section for more information When a calibration has been performed or loaded with the method the MCA application is ready to use To measure a sample place the sample in the beam and press Run from the MCA Method or Results screen The instrument measures the absorbance of the sample at each of the wavelengths specified in the method and compares it with the absorbance values of the standards at these wavelengths The concentration of each component is calculated and displayed on the Results screen The results for each sample are displayed on a new page Use the arrow keys to display the next or previous page Spectrophotometer User Guide 53 54 Spectrophotometer User Guide Function key Clear Results MCA Page Save Data Print List Description Clears the Results Table Displays the MCA Method screen Displays the Save screen for saving data to the Library or a USB memory device Prints the data using the selected printer Note BioMate applications Bio Tests This section a
44. Ratio Calculates the ratio Ai 2 Corr Ratio Calculates the ratio A 3 A2 A3 Pk Height Calculates the peak maximum relative to a local baseline Spectrophotometer User Guide 21 Smoothing Original Track Table screen 22 Spectrophotometer User Guide This option displays a pop up menu that can be used to apply a Savitzky Golay smoothing algorithm to the spectrum You can smooth with a low medium or high number of data point In each case data points are lost from both ends of the spectrum Smoothing No of Points Used Points Lost at Each End None 0 0 Low 9 4 Medium 17 8 High 33 16 Use this option to remove any manipulation and display the spectrum as originally collected and specified by the scan method It also clears any reference spectrum that was added with the Compare option The screen lists the y axis values of the spectrum for the wavelengths marked using Track To access this screen press the View Table function key from the Track screen The format of the measured values ABS T Intensity or 1 2 4 3 4 derivative depends on the current setting for the Mode parameter in the Manipulate menu The track markers are saved with the spectrum and will be displayed when the spectrum is reloaded Function key Description View Graph Displays the Track Graph which can be used to add or delete markers LIMS Export Sends the results via the RS 232 port Print List Prints the information in the tabl
45. Section Use the arrow keys to move the cursor vertical line across the screen The cursor always moves to a data point regardless of the displayed scales Pressing Enter places a marker at the current time To delete a marker place the cursor on the marker and press Clear The x axis values are used to recalculate the rate of change of Absorbance between the new start and stop times Results are listed on the Rate Results screen Up to four discrete pairs of cursors can be placed on the graph Arrows are placed on the cursors and results are displayed on the Rate Results screen for those parts of the graph indicated by the arrows The minimum interval between Track cursors is one second Selecting Section will remove the Track markers Function key Description View Results Displays the Rate Results screen Fast Slow Toggles between two cursor speeds In Fast mode the cursor jumps 5 of the graph or to the next data point whichever is greater In Slow mode the cursor jumps to the next data point or the next display pixel whichever is greater The function key label shows the deselected speed i e the opposite of the one you are currently using Clear All Deletes all the markers from the Track Graph Print Prints the displayed data using the selected printer Rate Graph Displays the Rate Graph screen Track screen function keys Use the arrow keys to move the cursor vertical line across the screen The cursor always moves
46. Spectrophotometer User Guide SCIENTIFIC The information in this publication is provided for reference only All information contained in this publication is believed to be correct and complete Thermo Fisher Scientific shall not be liable for errors contained herein nor for incidental or consequential damages in connection with the furnishing performance or use of this material All product specifications as well as the information contained in this publication are subject to change without notice This publication may contain or reference information and products protected by copyrights or patents and does not convey any license under our patent rights nor the rights of others We do not assume any liability arising out of any infringements of patents or other rights of third parties We make no warranty of any kind with regard to this material including but not limited to the implied warranties of merchantability and fitness for a particular purpose Customers are ultimately responsible for validation of their systems 2008 Thermo Fisher Scientific Inc All rights reserved No part of this publication may be stored in a retrieval system transmitted or reproduced in any way including but not limited to photocopy photograph magnetic or other record without our prior written permission AccuVac and Hach are either trademarks or registered trademarks of Hach Company and its subsidiaries in the United States and or other count
47. accordingly DNT method files Calibration The QNT files have the following format Hxxxx QNT where XXXX Hach program number QNT Quantapplication in software ONT files are set up for methods that require a calibration graph for each new batch of reagent Calibrations have been prepared for most of the Hach Quant methods These methods are ready for use as soon as they have been loaded However these calibrations may be affected by local conditions In all cases we recommend that you recalibrate with standard solutions appropriate to your laboratory and store the method with a new file name In a few cases new calibrations are required for each reagent batch or plating bath formulation You must calibrate these methods before you use them General instructions for performing a calibration follow below Specific instructions and details of standard preparation are included in the PDF file for the method e To view the standards to be prepared select Standards from the Quant screen and press Enter Compare these standards to those detailed on the Hach procedure sheet If the preparation of standards requires the same timers as the samples run the timers by selecting the 7zmer s option from the Quant screen and pressing Run Timers When the standards are ready for measurement press Calibrate Follow the on screen instructions to measure the standards After all standards have been measured the calibration graph
48. am s is blocked on initialization E3027 E3056 The Cell Changer is stalled in use or fails to initialize E3001 E3002 E3054 E3055 E3082 E3084 The sample compartment is open E3053 E3062 E3068 E3069 E3071 A comprehensive list of these codes is available in the service manual for these products Generation of a code not related to replacement of either the tungsten or deuterium lamps usually requires you to contact technical support Spectrophotometer User Guide 153 Routine maintenance Very little maintenance is required to keep the spectrophotometer in good working condition The interior should be kept as dust free as possible and the sample compartment cleaned regularly wipe off spilt chemicals immediately Replacement sample compartment liners are available Cleaning the instrument exterior A Caution 154 Spectrophotometer User Guide The exterior of the instrument can be cleaned periodically as follows Do not allow moisture to leak into the instrument a 1 Turn off the spectrophotometer and disconnect it from the main power supply 2 Wipe the outside surface of the instrument as necessary with a clean lint free cloth dampened with a weak solution of detergent and water 3 Wipe the same areas with a cloth dampened with plain water 4 Dry the surface with a clean dry cloth Removal and replacement of the tungsten halogen lamp A Warning A Caution Avoid shock hazard Turn off and
49. asure the baseline Then press Run to activate the first timer a The screen shows the action to be carried out and the time remaining Here is an example SHAKE REMAINING TIME 02 46 Spectrophotometer User Guide 75 Test results 76 Spectrophotometer User Guide The instrument beeps to indicate the end of the time period and a Timer Finished menu box is displayed with the following options e Proceed starts the next timer Zero takes a baseline measurement Stop cancels the current operation 2 When you are ready to start the next timer select Proceed and press Enter At the end of this timer the same Timer Finished menu box is displayed 3 If the method requires a zero measurement insert the blank select Zero and press Enter The instrument measures the baseline and displays a menu box with options to Proceed or Stop 4 Insert the sample into the cell holder and select Proceed The instrument measures the sample and displays the Fixed Results screen 5 To measure another sample insert the sample and press Run In all cases the relationship between absorbance and concentration takes the general form C A x FACTOR Therefore the UVcalc equation typically takes the following form Method H1310 FXD Bromine Equation Ml 2 25 The factors entered are generic In all cases we recommend that you check the factors with standard solutions appropriate to your laboratory and modify the equation
50. ation EE 139 ee eege eege 139 Mini S ET SIDDEE SCRE ergeet Ae 142 EE Cabbratiofi coo antea te cnet od ats 143 Sipper Calibration screen uae asc ce isabel eges 143 Calibrate Sipper screen eet id a ise ed denn 144 Calibration Verification Carousel ecce eere eee ecce 145 CIV C SBEHD uoi deserta ardent uota eir odia teca apa oorr nn Le 145 EE 146 Automatic CVC calibrationoss nea diet ipee dile ir be in tr e os 147 Installing the EE 147 CVC Etgen 148 EE 149 Removing the CVC carousel EE 149 Analog Data a KE COTE CELON Gee a a toti Dire tonii N O ARAR 150 Maintenance eee e eese ooo denota no eere euo aei n SEENEN Eege g ee gege LD2 Error i e 153 Routine mantenabce tusteso eder ee EE 154 Cleaning the instrument exterior NEEN deed 154 Removal and replacement of the tungsten halogen lamp 155 Removal and replacement of the deuterium lamp 157 BioMate 6 Test Parameters cccccsssscccsssssscccssssscccssssssccssssssscessees LOO Calculations for BioMate 6 Tests scccccsccssssssssssssccccccccsscccsssseeee LOS BioMate Oligo Calculator cscisicssesicccsssssscssesssesssecssscenesocsesotsssetesosecees L69 Note Introduction This manual explains how to operate the following spectrophotometers e Helios Zeta e UV 10 Helios Omega e AquaMate Vis e Evolution 160 e AquaMate Plus UV Vi
51. ation screen This screen displays the current sipper calibration information To alter the calibration press Calibrate SIPPER CALIBRATION 25 10 08 16 47 NOMINAL VOL 1 000 ml NO SIPS DONE 5 I TOTAL VOL SIPPED 5 100 ml TUBING CAL 1 020 i I VIEW CALIB EG CALIR RATE Function key Description View Calib Displays the Sipper calibration results Calibrate Starts the calibration procedure and displays the Calibrate Sipper screen Calibrate Sipper screen This screen is displayed when you press Calibrate from the Sipper Calibration screen Using the solvent and tubing that will be used for the sample solutions bring a measuring cylinder filled to the highest gradation to the sipper uptake tube and press the switch plate CALIBRATE SIPPER NOMINAL VOL 1 000 ml NO SIPS DONE 5 SIPPER SCREEN The sipper pumps a sample and the spectrophotometer issues a beep Withdraw the measuring cylinder to allow the sipper to pump the air gap The values used for sample volume and air gap are those set on the Sipper screen Spectrophotometer User Guide 139 Repeat this process for a number of cycles up to a maximum of 10 and then press Enter Measure the total volume taken from the measuring cylinder and enter this value The calibration appears Function key Description Sipper Screen Displays the Sipper screen and cancels the cali
52. ays the file name file type and description of each library file Use the arrow keys to display the next or previous page Note the directory 4 Parameter Type Test Name Filename Function key View Library Read USB Mem Print Dir Copy All 106 Spectrophotometer User Guide There may be a short delay while the instrument loads the next section of Function Describes the file and the type of information it contains See Instrument Library screen for examples Type is assigned automatically depending on the application used to create the file and the file s contents Shows the descriptive name that was entered when the file was saved see Test Name in the method screen for any Local Control Software application Shows the DOS compatible file name used by the instrument or computer You can edit or rename the file See Working with Files Stored on a USB Memory Device for details Description Displays the directory for the instrument library Refreshes the directory for the installed USB memory device Prints the directory for the installed USB memory device Copies all files from the installed USB memory device to the instrument library Working with files stored on a USB Memory device To perform an operation on a library file select the file and press Enter The USB Library pop up menu is displayed TESTFILE FXD LOAD RENAME SAVE TO LIBRARY DELETE Select an option and press Enter
53. bration 140 Spectrophotometer User Guide MiniSipper The MiniSipper is an optional accessory that enables samples to be drawn into a flow cell for automatic measurement The MiniSipper works with any kind of flow cell After the measurement is complete the sample is sent to a waste receptacle A continuous pumping mode can be used to wash the system with solvent when required e g between applications This section describes how to use Local Control Software to operate the MiniSipper For complete installation and operating instructions for this accessory see the corresponding manual on the documentation CD To operate the MiniSipper install the accessory as described in the operating manual Present the sample to the MiniSipper and press the switch to draw the required sample volume into the tubing When the system beeps remove the sample to allow the system to draw in the required air gap When the measurement is completed press the switch again to empty the flow cell The sample is pumped to a waste receptacle When the sipper is connected a status box appears on the right side of every method screen The status box indicates the presence of the MiniSipper and its status Spectrophotometer User Guide 141 Sipper screen 142 Spectrophotometer User Guide SIPPER SIPPER OFF MODE SIP AIR GAP 50cm SAMPLE VOL 1 000 ml SAMPLE WASTE LOW VOL OFF I i VIEW CALIB
54. ce and concentration Here is an example Direct UV measurement of ssDNA test results Oligonucleotide measurement calculated factor The Oligonucleotide test with a calculated factor measures absorbance at 260 nm and uses a calculated factor to convert absorbance to concentration The instrument uses the molecular weight and the extinction coefficient to calculate the factor OLIGOS CALC TEST NAME OLIGOS CALC WAVELENGTH 260 0 nm DILUTION MULTIPLIER 1 00 UNITS pg ml pmol ul IDs O OFF o BASE SEQUENCE ATCGTCGATTGAGCATCAGCATGACTAGAGATCAGAA TCGCG BASE SEQUENCE FACTOR 26 68 I I i l I I I I I I I I I AUTOPRINT OFF I I I I I I I I I I I I I I 1 BASE PRINT SAVE STORED VIEW SEQ TEST TEST TESTS RESULTS Oligonucleotide test parameters calculated factor Spectrophotometer User Guide 61 Measuring oligonucleotides using a calculated factor 1 Enter a base sequence With the Oligos calc factor parameter screen displayed press Base Seq to view the Base Sequence screen and then follow the instructions in the Oligo calculator functions section of this manual to specify the sequence 2 Enter the initial sample number ID 3 Place the blank in the cell holder 4 Press Zero Base to measure the blank 5 Place the unknown sample in the cell holder 6 Press Run to start the measurement The Oligos calc factor measurement screen is displayed When the inst
55. creen to set up the SuperSipper for the required analysis These parameters are saved with any data produced by the software To reach this screen press Accessories from the Home screen then select Sipper and press Enter To change a parameter setting select the parameter and press Enter See Parameter Entry for more information Item Function Sipper Sets the Sipper status On Off or Standby Mode Selects the run mode for the SuperSipper Sip Sets the system to fill the flow cell If Sample is set to Return then alternate switch presses will fill and empty the flow cell In this mode instrument operation is completely independent of the SuperSipper Sip amp Run Sets the system to fill the flow cell and automatically perform a measurement If Sample is set to Return then alternate switch presses will fill and empty the flow cell The current method used to produce the result e g if Fixed is current then the sample will be measured using the Fixed method as programmed Continuous Sets the system to pump continuously to waste Alternate switch presses will start and stop pumping In this mode instrument operation is completely independent of the SuperSipper AutoSam Configures the Sipper to operate with an autosampler Air Gap Enter value between 0 and 500 cm Sets the gap between the trailing meniscus of the current sample and the leading meniscus of the next sample The gap is measured to the nearest centimet
56. ct Binary Complex 0 5 00 mg l 3200 H3200 QNT Compounds mwar a VoadeAdd Kate kee be anon Spectrophotometer User Guide 97 Lange BOD Oxygen demand biological 0 5 12 mg l BOD5 11 mm Round LCK554 K554CT FXD 5 day Carbonate Carbon dioxide 55 550 mg l LCK 388 K388CT FXD Chon eegent emod kees kuerz Chlorine Total 0 05 1 5 mg l mg l Cb 11mm Round LCW 510 JW510RC FXD 0 05 1 5 mg l mg 1 O 0 03 0 4 mg l 50 mm Rectangular E E 0 03 0 4 mg l Chromium 0 03 1 0 mg l 11 mm Round LCK 313 K313CT FXD GOD Oxygen Demand seit filmm Roud exui RSIACTIND sei 11 mm Round LCK 614 kaacren sei oe Round LCK 114 eniro sei 11 mm band poxsu enero JICOD i1 mm Rod Lesen Keucrex mgllCOD i mm Roud LCK 529 essere mgICOD Kannt LCK329 KCT XD mel iimm Roud Leer encre mgICN Kan Round poke kieren De ban Recanguar LCW 017 worzrso o 1 2 0 mg l DE 10 mm Rectangular LCW 017 W017P10 FXD Formaldehyde 0 01 1 0 mg l 50 mm Rectangular LCK 325 K325P50 FXD 0 5 10 0 mg l 11 mm Round LCK 325 K325CT FXD 0 01 2 0 mg l mg l NH 10 mm Rectangular LCW 025 W025P10 FXD 0 01 1 0 mg l mg l Fe LCK 521 t Q x LA e A Nn cc VA i Qo m j Mn E ey sla B ga ga e Zeg ga S Chemical nN 1 Qs Ke 01 1 0 mg l 1 8 0 mg l e Te Cette leese cl 1 1 o S Se el E S ds a9 nr s ms Detergen
57. ct Recorder and press Enter to display the Recorder Setup screen RECORDER I I L I CHART LOW ABS 0 3000 CHART HIGH ABS 6 0000 CHART LOW T 0 0001 CHART HIGH T 100000 0000 L I I I CHART LOW I 0 0000 CHART HIGH I 99 9999 The Chart High and Chart Low parameters set the full scale deflection on the analog chart recorder output for each of the available measurement modes Absorbance Transmittance and Intensity On startup these limits are set to the maximum measurement ranges shown above To reset a limit select the parameter and press Enter to display a pop up entry box Enter the new value and press Enter Spectrophotometer User Guide 150 Note For best results set Chart Low ABS to a small negative value e g 0 1 A if you are working with absorbance values that are close to zero a To operate the recorder select the appropriate method insert a blank sample and press Zero When the instrument has finished zeroing adjust the chart recorder so that its baseline is at the required position Note The chart recorder may be driven off scale while the instrument is zeroing A Spectrophotometer User Guide 151 Maintenance The information in this section deals only with those parts of maintenance or service which can be safely carried out by the user Work other than that detailed must be carried out by a service engineer ALWAYS ENSURE THAT
58. d Uude adeb ws BRA 109 Defining a formula ii dide tesi ad ned Pede buta 110 Setting up a Scan EE ei de th dH E ec 111 Setting up a Fixed calculation dae ce agence p es 113 Setting up a WE 114 Modifying an equation by adding parameters 115 Modifying an equation by adding constants sess 116 UN cic Error Messages nias ret eed at mde tntet o Sete ere 117 SUID M AQ 119 SEU SCREEN ieunes a ete castnvceathan tet a a a vat Ea 119 Clock curs 120 Printet menu OPTIONS tee ege Eeer 120 Ener 121 ET 122 Sun M PET 122 Date Potfndt ecco qudd tauris a endet 122 Automatic Cal Val E 122 Default File Lype 3 pecie dettes aetate tale bct di 123 LIMS SUP PORE M 123 DseSample Iss a ener ep bet e bote ena 123 E 124 AutoPrint enee 125 EE EE 125 History EN 127 Wavelength Calibration E 128 Optical Initialization EE 129 KE 130 Setup CV E E 130 WAITS scree E 130 Spectrophotometer User Guide _ iii iv Spectrophotometer User Guide Cell Changer ssstssecsasssacesuossiecansseadssansvintassouncasesstarsnsdeoncuivassivieatoerceiaes LOZ Installing and removing the Cell Changer ees 132 Installing the Cell EEN 132 Removing the Cell Changer caecis test una oa oae 133 Operating the Cell Changer seo ead files tos SE 133 KT E EE ER e ee ee 137 S perSipper libration sss cee ass seit o ep qe dc die 138 Sipper Calibr
59. disconnect the spectrophotometer from the main power supply and allow the lamp to cool for at least 15 minutes before proceeding A 1 Turn off the spectrophotometer power and unplug the power supply from the wall outlet or power strip Allow at least 15 minutes for the instrument to cool before removing covers A 2 Remove the back corner cover Turn the fastener one quarter turn counterclockwise and slide the cover up to remove it 3 Remove the metal housing Grab the sides of metal housing and pull upwards A Remove the burned out bulb from its socket a Remove spring clip b Lift the bulb straight up Spectrophotometer User Guide 155 A Caution 156 Spectrophotometer User Guide Note Never touch a bulb with your fingers Oil from your skin will cause the bulb to burn out quickly or explode a 5 Use clean finger cots or a clean laboratory tissue to pick up the bulb and insert the pins into the socket These lamps are manufactured to very high tolerances However to ensure optimum energy throughput align the lamp filament exactly as shown in the diagram with the white line on the lamp base facing towards the front of the instrument A 6 7 Replace the spring clip Replace metal housing and rear cover Plug in the spectrophotometer power cord and turn on the power switch Use the Local Control Software to reset the Lamp hours and energy if applicable Removal and replacement of th
60. e If the silica envelope becomes contaminated clean with a powerful degreasing solvent such as absolute alcohol before the lamp is switched on 4 5 Hold the new lamp and locate the notch in the mounting plate 6 Position the lamp so that the notch points towards the lamp change mirror 7 Use the provided key to tighten the locating screws 8 Re connect the new lamp at the in line connector 9 Replace the rear cover 10 Connect the spectrophotometer to the mains supply and turn it on 11 Allow half an hour for the instrument to warm up 12 Use the Local Control Software to reset the Lamp hours Spectrophotometer User Guide 159 Parameter Formamide GC Mismatched Auto Print Base Sequence Cation Molarity Curve Fit Date Standards Measured Diluent Volume BioMate 6 Test Parameters The following table lists the parameters for the BioMate Tests The list includes a brief description of each parameter the applicable range and the initial default values Use this list as a reference when setting up tests Description Percentage of formamide contained in the sample Percentage of GC pairs contained in the sample Percentage of mismatched bases in the sample Turns automatic printout on or off Sequence of bases contained in the sample Molarity of cation Na contained in the sample Type of Line fit calculation Date when standards were last measured with this instrument Volume
61. e operator to input the factor before the first scan If you subsequently move from the Results Graph screens back to the main menu the one off factors will be reset and must be re entered before the next run A This example shows how to set up the following Scan calculation A1 A2 F 1 Display the Scan method parameters For this example set Start to 400 nm and Stop to 600 nm 2 Select UVcalc and press Enter 3 Select Equation 1 and press Enter 4 Select Formula and press Enter 5 Select A and press Enter 6 Enter 450 for the first wavelength and press Enter 7 Select and press Enter 8 Select A and press Enter 9 Enter 500 and press Enter 10 Select and press Enter 11 Select F and press Enter A pop up menu is displayed with the following options e Fixed Factor e Variable Factor 12 Select Variable Factor and press Enter 13 14 15 16 17 18 19 20 Enter a suitable ID and press Accept The formula displayed at the top of the screen should look like this FORMULA AI1 A2 F1 Press Accept to complete the formula Select Title enter a descriptive name to be displayed in the UVCALC Equations screen and press Accept Select Units enter appropriate units for the equation and press Accept Press Accept again to complete the equation The new equation is displayed in the Equations screen MY CALC A1 A2 F1 Press Accept again to return to the Scan parameters screen Insert the sa
62. e 2 of the Standards screen Std11 Std20 Accept Accepts any changes made to the Standards list and displays the MCA Methods screen Cancel Deletes any changes made to the Standards list and displays the MCA Methods screen MCA Standards function keys Spectrophotometer User Guide 51 MCA Wavelength screen This screen lists the wavelengths to be measured You can measure up to 20 wavelengths You must enter at least one wavelength for each standard To enter the wavelengths select a wavelength and press Enter The wavelength entry box is displayed Enter the wavelength and press Enter You do not need to enter them in numerical order however the analysis will be faster if you do The Wavelength screen is displayed with the new value displayed and the next wavelength highlighted When all wavelengths have been entered press Accept to return to the MCA method screen with the new list of wavelengths or Cancel to return leaving the old list unchanged Alternatively wavelengths may be entered directly from a scan Clear the beam s and press Zero Base to perform a baseline scan then put the sample in the cell holder and press Scan Graph The instrument performs a scan using the method currently entered in the Scan Parameters screen Move the vertical cursor to a suitable wavelength and press Enter to mark it Repeat until all required wavelengths have been marked Marks can be removed using Clear or Clear All When all required
63. e beams 4 From the Wavelength Calibration screen press Calibrate 5 When calibration is complete turn off the instrument 6 Turn on the instrument 7 Turn on the deuterium lamp and wait for it to warm up 8 Run Default Baseline see Optical Initialization screen Optical Initialization screen Use this screen to reset the instrument and define its initialization and default baseline These procedures ensure the optimum performance of the spectrophotometer INITIALIZE i i INITIALIZATION TYPE OPTICS INITIALIZE WITH D2 ON 1 i i L J SETUP INIT PAGE _ GE Option Description Initialization Type Initialize with D2 Function key Initialize Selects the initialization type Optics During initialization the instrument performs simple hardware checks calculates data tables and measures the dark current The filter wheel is then initialized before the instrument drives to the default wavelength and performs an autozero Baseline During initialization the instrument re measures the default baseline This process takes about one hour to complete Measure the default baseline after you change a source lamp or perform wavelength calibration and when the instrument is working at temperatures significantly different from 25 C Note Before you measure the baseline make sure both lamps are on and the spectrophotometer is fully warmed up Selects wheth
64. e bottom of the screen We strongly recommend that you enter a new user name and password for the system administrator as soon as you activate User Log On 4 Only the Administrator listed as ADMIN in the user list can change passwords edit the Current Users Screen and reset User Log On to Off Resetting User Log On to Off clears the list of users and resets the default User Name and Password to ADMIN a History File History file menu options Toggles the History File option on and off When this option is On the system automatically logs changes to the instrument in the history file The following changes are logged with the date time and user e Changes to default baselines e Wavelength calibrations Sipper calibrations e CVC tests Maintenance operations recorded by our service engineers When History File is set to On the History File function key appears on the Environment screen unless User Log On is enabled and the system administrator has not granted History File access to the current user The History File function key displays the History File pop up menu HISTORY FILE SAVE HISTORY ON USB MEMORY CLEAR HISTORY PRINT HISTORY Item Save History on USB Memory Clear History Print History Function Prompts for a file name and saves the instrument history in CSV format which may be read by a compatible spreadsheet or text editor Clears the instrument history to make room for
65. e deuterium lamp A deuterium lamp is included with all instrument models except the AquaMate Vis A Warning Avoid shock hazard Turn off and disconnect the spectrophotometer from the main power supply and allow the lamp to cool for at least 15 minutes before proceeding 4 A Warning UV radiation from a deuterium lamp can be harmful to the skin and eyes Always view the lamp through protective glasses that will absorb UV radiation Avoid looking directly at the deuterium arc Do not expose the skin to direct or reflected UV radiation A 1 Turn off the spectrophotometer power and unplug the power supply from the wall outlet or power strip Caution Allow at least 15 minutes for the instrument to cool before removing covers A 2 Remove the back corner cover Turn the fastener one quarter turn counterclockwise and slide the cover up to remove it Spectrophotometer User Guide 157 Notice 158 Spectrophotometer User Guide Inline connector Mounting Locating screws 3 Disconnect the lamp at the in line connector Using the key provided loosen the three locating screws rotate the lamp assembly counterclockwise and lift the lamp out of the instrument When installing the deuterium lamp avoid handling the silica envelope Finger marks become burnt on and cannot be removed after the lamp is switched on This can affect the light output characteristics Handle only the base of the lamp or the mounting plat
66. e software calculates the instrument and lamp hours and lamp energies and displays them on the appropriate screen as each test is run Function key Description Save Results Displays the Save screen which allows you to save the current set of test results in the instrument library or a library USB device Files are saved with a TST extension Print Summary Prints the summary of results as shown on the screen Print All Prints the summary of results plus full details of each test result Tests 1 3 Selects the first three tests in the list tests 1 and 2 for the or Tests 1 2 AquaMate Vis Press Aunto run the selected tests in sequence All Tests Selects all the tests in the list Press Aunto run the tests in sequence 148 Spectrophotometer User Guide Each time you run a test the instrument reads the CVC serial number and records it with the test result If the serial number of the installed CVC does not match the serial number of the calibration data stored in instrument memory the system reports error E3083 Serial Numbers do not match Results screens Each test result includes the following information The test number and name The expected values and the measured values e The differences tolerances etc as appropriate The pass fail status of the test e The spectrophotometer and CVC serial numbers The instrument hours lamp hours and lamp energies The following function keys are availab
67. e that has available space DELETES all files from the instrument library Prints the directory for the instrument library Available on all instruments except the BioMate 6 Select a file to be displayed in the start up menu and press Enter The start up menu will appear when the instrument is turned on instead of the default Home screen Press Home to see the new start up screen From the start up screen press General Tests to display the default Home screen Available on BioMate 6 models only Toggles between two display formats methods and results combined or results only Working with files stored in the instrument library To perform an operation on a library file select the file and press Enter The Instrument Library pop up menu is displayed DATA1 FXD LOAD RENAME DELETE SAVE TO USB MEM Select an option and press Enter Menu Option Load Rename Save to USB MEM Delete Function Loads the selected method or displays the selected results Displays the Save Rename screen where file name can be changed Copies the selected file to the installed USB memory device Removes the selected file from the instrument library Spectrophotometer User Guide 105 USB Memory Device Library screen To display the library screen for the installed USB Memory Device insert the device display the Instrument Library screen and select View USB Mem The instrument displ
68. e using the selected printer Scan Graph Displays the Scan Graph screen Track table function keys Peak Table screen Ratio Table screen The screen lists the positions and values of the peaks found by the previous peak search To display this screen press the View Results function key from the Peaks Valleys Pks amp Valleys or Zero Cross option in the Peaks menu The format of the found peaks ABS T Intensity or 1 2 4 3 4 derivative depends on the current setting for the Mode parameter in the Manipulate menu The list is sorted by wavelength Each marker is identified as a peak valley or zero crossing Function key Description LIMS Export Sends the results via the RS 232 port Print List Prints the information in the table using the selected printer Scan Graph Displays the Scan Graph screen Peak Table function keys The screen shows the positions and values of the wavelengths and the ratio as selected by the Ratio or Corr Ratio functions To display this screen press the View Table function key from the Ratio or Corr Ratio option in the Peaks menu Function key Description View Graph Displays the Scan Graph screen LIMS Export Sends the results via the RS 232 port Print List Prints the information in the table using the selected printer Scan Graph Displays the Scan Graph screen Ratio Table function keys Spectrophotometer User Guide 23 Peak Height screen This screen shows the locations and m
69. e wavelengths for the numerator and denominator at the prompts and press Enter Peak Height Allows the height of a peak to be calculated relative to a drawn baseline rather than y 0 Enter the Baseline 1 Peak Baseline 2 wavelengths at the prompts and press Enter Note After the wavelengths have been entered go back to the Scan method screen and save the method 16 Spectrophotometer User Guide Parameter Graph High Graph Low Smoothing Lamp Change User UVcalc Function key View Results View Graph Save Method Print Method UVcalc Results Function Sets the upper graph limits on the Scan Graph screen Select from range Graph Low 0 01 to 6 00 Graph High must be 0 01 greater than Graph Low Sets the lower graph limits on the Scan Graph screen Select from range 0 3 to Graph High 0 01 Graph Low must be 0 01 less than Graph High Applies No Low Medium or High modified improved Savitzky Golay smoothing to the spectrum Selects the wavelength at which the source is changed between the tungsten W and deuterium D2 lamp Select from 315 320 325 330 335 340 D2 W Note Selecting D2 or W manually overrides the Lamp Change setting and the selected lamp will be used regardless of the wavelength set Note This parameter is not available for the AquaMate Vis Use the Text Entry screen to enter a user name The user name is saved with the method and any spectra produced by the method N
70. easure Each Run Measures this value each time Defines a factor Each factor can be fixed or variable can be entered by the user at run time UVcalc result from preceding equations Can be used to group terms and operands Adds the corresponding operand add subtract multiply divide to the formula Adds a space to the formula Description Clears the last character in the formula Toggles the cursor between the formula and the simulated keyboard Stores the entered settings Displays the Equations screen without storing your entries To clear the entire formula press C To store the formula as displayed press Accept The Equations screen is displayed with the new formula listed in the next available line Setting up a Scan calculation Up to 9 different measurements may be specified for each Scan UVcalc equation These are denoted by 1 9 The wavelengths at which these measurements are made can be specified in one of 2 ways They can be entered numerically before the scan or they can be entered after the scan using a peak picking process This appears as an extra parameter on the equation parameter screen Use Tracking The selected wavelengths will then be fed into the method so that the subsequent final result will be calculated automatically Spectrophotometer User Guide 111 112 Spectrophotometer User Guide Note If a factor is used only once in a calculation the instrument prompts th
71. easured values of the peaks selected with the Pk Height function To display this screen press the View Table function key from the Pk Height option in the Peaks menu Function key Description View Graph Displays the Scan Graph screen LIMS Export Sends the results via the RS 232 port Print List Prints the information in the table using the selected printer Scan Graph Displays the Scan Graph screen Peak Height function keys 24 Spectrophotometer User Guide Fixed Select the Fixed application on the Home screen to measure absorbance values at up to 20 fixed wavelengths Use the Fixed Method screen to set data collection and analysis parameters When you are finished setting parameters press Zero Base to perform a baseline scan with the current method When you are ready to analyze the first sample place the sample cell in the sample holder and press Run The spectrophotometer performs the measurements and displays the results on the Fixed Results screen After all the results have been collected save the data Fixed method parameters Use this screen to set instrument and analysis parameters for measuring and reporting absorbance values at up to 20 fixed wavelengths To change a parameter setting highlight the parameter and press Enter See Parameter Entry for more information FIXED MODE ABS TEST NAME SELECT SINGLE WAVELENGTH S 550 0 nm BANDWIDTH 2 0 nm INTEGRATION 1s DEL
72. een The formula displayed at the top of the screen should look like this FORMULA M1 50 F1 F2 Press Accept twice to display the Fixed parameters screen Insert the sample and press Run Enter a factor at the prompt and press Accept Modifying an equation by adding constants 116 Spectrophotometer User Guide This example shows how to add constants to an equation e g adds a second constant to M1 50 M2 M1 50 0 where MI becomes a once only constant M2 measure with each run Display the Fixed method parameters select UVcalc and press Enter Select Equation 1 and press Enter The equation prepared above is displayed MI 50 0 Select Formula and press Enter The cursor moves to the end of the existing formula Press Switch Fields to select the formula move the cursor to M1 and press Enter Change the selection to Once Only Constant and press Enter Press Switch Fields to select the simulated keyboard Select and press Enter 10 11 12 13 14 UV ca c Error Messages Select M press Enter select Measure with each RUN and press Enter C c Select minus and press Enter Press Switch Fields and move the cursor to the Press Switch Fields again select and press Enter Press Accept The formula displayed at the top of the screen should look like this FORMULA M2 M1 50 Make appropriate entries for Title and Units Press Accept twice to display the Fixed
73. een Insert the sample and press Run The instrument measures the sample and displays the actual absorbance value and the result of the calculation You can specify up to 9 different measurements These measurements may be a standard S1 S6 measured as part of the normal calibration process or a sample X 114 Spectrophotometer User Guide Note One off factors will be cleared if you select Clear Results from the results screen or if you return to the main menu A Modifying an equation by adding parameters This example shows how to add parameters to the end of an equation e g adds a weight correction to M1 50 10 11 12 13 M1 50 0 F1 F2 where F1 Nominal weight Fixed Factor F2 Actual weight Variable Factor Display the Fixed method parameters select UVcalc and press Enter Select Equation 1 and press Enter The equation prepared above is displayed MI 50 0 Select Formula and press Enter The cursor moves to the end of the existing formula Select and press Enter Select and press Enter Select F and press Enter Select Fixed Factor and press Enter Enter a suitable ID for the factor and press Accept Select and press Enter Select F and press Enter Select Variable Factor and press Enter Enter a suitable ID for the factor and press Accept Select and press Enter Spectrophotometer User Guide 115 14 15 16 17 Press Accept to display the main UVcalc scr
74. er For best results set the airgap to gt 8 cm from the flow cell Spectrophotometer User Guide 137 SuperSipper Calibration Item Function Sample Vol Enter a value between 0 2 and 10 000 ml Sets the volume of sample to be pumped Sample Selects from Waste or Return Waste After measurement the sample is pumped through the flow cell to waste by the act of pumping the next sample Return After measurement the pump direction is reversed and the sample is returned to the sample vessel Low Vol Toggles on or off Automatically adjusts the pumping time to maintain the correct air gap for narrow uptake tubing Off Use standard internal diameter 1 1 mm uptake tube On Use narrow internal diameter 0 8 mm uptake tube Function key Description View Calib Displays the Sipper Calibration screen Calibrate Starts the Sipper calibration procedure 138 Spectrophotometer User Guide Calibration adjusts the SuperSipper for variations in pump and uptake tubing and sample viscosities During calibration you enter the volume you want to extract from the sample and the system performs several sips using the appropriate solvent and tubing The software uses the entered volume to calculate a calibration factor The system uses the factor to adjust the pumping time to ensure that the correct sample volume is always used Details of the calibration used are displayed on the Sipper Calibration screen Sipper Calibr
75. er the instrument will initialize with or without the deuterium lamp When this option is On the instrument automatically strikes the deuterium lamp during initialization Note This option is unavailable for the AquaMate Plus UV Vis model Description Performs the selected initialization type optics or baseline Spectrophotometer User Guide 129 White Light screen Setup CVC screen Lamps screen 130 Spectrophotometer User Guide Use this option to align the grating so the zero order diffraction white light passes through the sample compartment You can see the beam when you place a white card or similar item in the light path The visible beam can be helpful for aligning optical accessories in the sample compartment In double beam instruments the action of the chopper causes the light to alternate between the sample and reference beams To realign the grating press Initialize When alignment is completed press Szop to return the grating to its normal position To display the Setup screen press Setup Page Use this option to access the options available for setting up and running the Calibration Verification Carousel CVC See the CVC section of this manual for more information The Lamp functions can be accessed from the Setup screen or from the Home screen if User Log on is not in use The Lamps screen shows the energy level and status On Off or Failed of the available lamps deuterium and or tungsten haloge
76. ers Running the Warburg Christian test 1 With the Warburg Christian parameter screen displayed enter the initial sample number ID 2 Place the blank in the cell holder 3 Press Zero Base to measure the blank Place the unknown sample in the cell holder 5 Press Run to start the measurement When the instrument is finished measuring the absorbance of the sample it displays the sample ID its absorbance at 280 and 260 nm and its protein concentration Here is an example Spectrophotometer User Guide 67 TEST NAME WARBURG CHRISTIAN ID ABS A1 ABS A2 280 0 nm 260 0 nm 999 0 123 0 456 PROTEIN CONC 1111 1 mg ml 1 1 234 1 567 PROTEIN CONC 33 8 mg ml PRINT SAVE TEST CLEAR LIST DATA PAGE RESULTS Warburg Christian test results Cell growth test The cell growth test uses absorbance at 600 nm to indicate the progress of cell growth in a sample The instrument does not perform any calculations or graphing for the data CELL GROWTH TEST NAME CELL GROWTH WAVELENGTH 600 00 nm SAMPLE POSITIONER OFF ID 0 OFF o LOW HIGH LIMITS 9999 9999 STATISTICS OFF AUTOPRINT OFF USER i j PRINT SAVE STORED VIEW TEST TEST TESTS RESULTS Cell growth test parameters Measuring cell growth 1 Display the cell growth parameter screen and enter the initial sample number
77. es in Absorbance Positive Select this option if Absorbance increases with time Positive Select this option f Absorbance decreases with time Note This parameter appears only when ABS DISPLAY is set to RELATIVE This sets the graph y axis Enter a number in the range between 0 and 3 A Enter a number slightly larger than the expected change in Absorbance Note This parameter appears only when ABS DISPLAY is set to RELATIVE Enter the factor for Activity as a number in the range between 0 001 and 9999 999 Displays the Text Entry screen used to enter the units of Activity Enters the required description or units of Activity up to 11 alphanumeric characters Selects the wavelength at which the source is changed between the tungsten and deuterium lamps Select from 315 320 325 330 335 340 D2 W Note Selecting D2 or W manually overrides the Lamp Change setting and the selected lamp will be used regardless of the wavelength set Note This parameter is not available for the AquaMate Vis Spectrophotometer User Guide Menu Item User Chart High Chart Low Number of Samples Measure Cycles Function key View Results View Graph Save Method Print Method Function Displays the Text Entry screen to enter a user name The user name is automatically saved with the method and any data produced by the method Changing the user name will not cause the current data to be lost Note If User Log on is in operati
78. eter User Guide 29 Quant Select the Quant application on the Home screen to measure absorbance values and compare them to a concentration curve in order to determine sample concentration Use the Quant Method screen to set data collection and analysis parameters When you are finished setting parameters press Zero Base to perform a baseline scan with the current method When you are ready to analyze the first sample place the sample cell in the sample holder and press Run The spectrophotometer performs the measurement and displays the result on the Quant Results screen After all the results have been collected save the data Quant method parameters Use this screen to set instrument and analysis parameters for performing quantitative measurements To change a parameter setting highlight the parameter and press Enter See Parameter Entry for more information QUANT TEST NAME WAVELENGTH 550 0 nm BANDWIDTH 2 0 nm INTEGRATION 2s STANDARDS 01 REPLICATES 3 UNITS CURVE FIT LINEAR LAMP CHANGE 325 nm USER UVcalc 0 MEASURE STDS YES CALIB PRINT SAVE VIEW RATE METHOD METHOD RESULTS CALIB PS For Zeta Omega Evolution 160 UV 10 and BioMate 6 models Spectrophotometer User Guide 30 I TEST NAME WAVELENGTH 550 0 nm BANDWIDTH 2 0 nm INTEGRATION 25s STANDARDS o REPLICATES 3 UNITS CURVE FIT
79. f the selected test appears at the top of the screen Spectrophotometer User Guide 71 Saving a method to the Library Note About the method results 72 Spectrophotometer User Guide To save a method to the Library select Save To Library You can delete the 20 preinstalled methods found in the library to make space for your preferred methods These 20 methods are also included on the Merck Hach methods USB memory device in case you need them in the future a Each time you use an AquaMate method to measure a sample the Fixed Results or Quant Results screen appears depending on the file type of the method file with the following information e absorbance of the sample concentration of the analyte e Pass Fail result The Pass Fail result indicates whether the recorded concentration of the sample falls within the measurement range of the test The Pass Fail result has three possible states Result Meaning Solution Pass Analyte concentration of the sample Save the result is within the measurement range of the selected test Fail Analyte concentration in the sample Select a different method with an is too low appropriate range FAIL Analyte concentration is too high Select a different method with an appropriate range or dilute the sample to fit within the measurement range of this method Disk 1 Merck Spectroquant methods Operation Note All the Merck Spectroquant methods are Fixed FXD files which
80. has been tracked the Initial and Final Absorbance with the Initial and Final Time will reflect those chosen by the two cursors Function key Description View Graph Displays the Rate Graph Rate Page Displays the Rate Method screen Save Data Displays the Save screen for saving methods and data to a USB memory device Print Prints the Rate Graph and Rate Results using the selected printer LIMS Export Sends the results via the RS 232 port Rate Results function keys Parallel Rate measurements using the Cell Changer The 7 Cell Changer can be used in conjunction with the Rate software to measure between 2 and 7 cells in parallel For the Cell Changer to be used it must be On with Mode set to Auto The Rate Method setup and Manipulate functions are exactly the same except that the Measure Time now sets the time between each cycle i e the length of time between measurements on the first cell The number of measurements taken on each cell is set by the Cell Cycles parameter on the Cell Changer screen The total time over which the measurements are made is the result of the time between measurements Measure Time and the number of measurements Cell Cycles For example an analysis using four cells with Measure Time set to 15 seconds and Cell Cycles set to 20 would give a total measurement time of 5 minutes 46 X Spectrophotometer User Guide Note To set up a parallel rate method following these steps 1 Set up the method as n
81. he Text Entry screen Enter a base filename up to 5 characters and press Accept File Number Displays a pop up entry box Enter the number 0 to 999 you want to assign to the first sample file and press Enter The number is appended to the filename and incremented automatically after each run Off Sample results are not saved automatically Use Save Data where applicable to save a measurement 124 Spectrophotometer User Guide AutoPrint Results Toggles the AutoPrint option on and off Option On Off Function Prints sample results automatically after each run Does not print results automatically Note Before you attempt to print at any point during operation of the instrument make sure the printer is ready to print i e power is on printer is on line paper is loaded Failure to do so will result in an error condition Press ESC to clear the error message Then correct the problem with the printer and try again A User Log On Toggles the User Log On option on and off When User Log On is set to On the system administrator controls what each user can do with the instrument Note We recommend that you activate User Log On if you have a multi user environment A Option On Off default Function Displays the Text Entry screen Enter the correct password to set up administrative access to the software and press Accept The default password is ADMIN password is case sensitive Note If
82. hod parameters and the standards table using the selected printer Displays the Standards screen The current data will be lost if the integration time is changed a Changing the standards will cause any current data to be lost A Changing the curve fit will cause the existing calibration to be recalculated Any results associated with the previous calibration will be lost A Any current data will be lost if the lamp changeover wavelength is changed a Spectrophotometer User Guide 33 Timer function keys Quant Standards screen Function key Description Change Mode Sets the operating mode for the timers Single Use Runs all timers before the first measurement only Multiple Use Runs all timers before each measurement Run Timers Runs the timers without initiating a measurement sequence for example when collecting standards for a method that uses timers Accept Stores the timer settings and displays the Fixed Method screen Cancel Cancels the timer settings and displays the Fixed Method screen If one or more timers are defined in a method the first timer starts when you press Run The system shows the remaining time for the current timer If you need to stop the timer press Stop If you allow the timer to continue and no user prompt is defined after the delay time has passed the system automatically proceeds to the next task in the measurement sequence If the timer includes a user prompt the prompt is
83. hod screen Use this screen to set instrument and analysis parameters for collecting and analyzing spectra To change a parameter setting highlight the parameter and press Enter See Parameter Entry for more information SCAN SCAN TYPE STANDARD TEST NAME TEST 1 MODE ABS START 400 0 nm STOP 600 0 nm BANDWIDTH 2 0 nm SPEED 1200 nm min DATA INTERVAL 1 0 nm PEAK TABLE OFF GRAPH HIGH 2 000 GRAPH LOW 0 000 SMOOTHING NONE LAMP CHANGE 325 nm USER USER 1 UVCALC 0 UV CALC PRINT SAVE VIEW VIEW RESULTS METHOD METHOD GRAPH RESULTS Note The current spectrum will be lost if you change any of the Scan method parameters except the user name User a Parameter Function Scan Type Sets scan speed and data interval Standard mode Allows you to manually set the scan speed and data interval Intelliscan mode Sets the data interval automatically and varies the scan speed according to the absorption of the sample Test Name Use the Text Entry screen to enter a descriptive name for the method The Test Name is saved with the method and any spectra produced by the method 14 Spectrophotometer User Guide Parameter Mode Start Stop Bandwidth Speed Data interval Function Selects the format used to measure and display the collected spectrum ABS Absorbance vs Wavelength T Transmittance vs Wavelength Light Beam Intensity mode v
84. ictions is displayed Spectrophotometer User Guide 69 AquaMate Methods This section applies to the AquaMate spectrophotometers only The AquaMate models include a variety of methods to measure specific compounds The methods determine sample concentration by measuring sample absorbance and then comparing to standards measured at fixed wavelength locations i e the Fixed application or a concentration curve i e the Quant application The tests are provided on a USB memory device Descriptions of the tests including the analyte measurement range program and file number are provided at the end of this section Spectrophotometer User Guide 70 How to run an AquaMate method Loading a method This section gives general information about How to load one of the provided AquaMate methods How to save a method to the Library The method results For information about running a specific method such as one of the Hach or Merck methods see the chapter with that name below To load an AquaMate method from the Methods USB memory device l Insert the device into the drive 2 Display the Home screen and select USB MEM 3 Select Load and press Enter To run an AquaMate method from the Library 1 Display the Home screen and select Library 2 Select a test and press Enter After you select a test the Fixed or Quant screen appears depending on the file type of the selected file ONT or FXD The file name o
85. in the calibration Linear Performs a linear calibration At least two standards are required Linear to 0 Performs a linear calibration forced through zero Quadratic Performs a quadratic fit on the data At least three standards are required Quad to 0 Performs a quadratic fit with the data forced through zero At least two standards are required Toggles between internal calibration Yes and external calibration No Choose Yes to measure the standards and calibrate using the concentrations entered on the Standards screen When ready press Calibrate At the prompt insert the first standard in the beam and press Aun Repeat for the remaining standards in order Choose No to specify absorbance values for the standards from an external calibration When ready press Ca ibrate Enter the absorbance value of the first standard at the prompt and press Enter Repeat for the remaining standards in order Allows you to add up to 4 timers in a method for specific purposes For each timer define the following Title Select a name that indicates the purpose of the timer Timer Wait Shake Invert Swirl Boil or Heat Duration Specify a delay time from 1 to 100 seconds in digital format with a period separator e g 00 01 to 99 59 Action Select whether to display a user prompt when the delay time has passed Choose Pause to display a user prompt with three choices Stop Zero or Continue Choose Conti
86. inal Another Cell This option toggles the graphical display between the Absolute Values and Relative Values settings Absolute Values Plots the measured absorbance values in Absorbance vs Time Relative Values Plots the measured absorbance values relative to the first measurement subtracts the first measured absorbance value from all subsequent measurements This causes the plot to start at the 0 0 coordinate change in Absorbance vs Time This option displays a pop up menu that can be used to apply a Savitzky Golay smoothing algorithm to the data You can smooth with a low medium or high number of data point A moving point average is performed on the data and in each case data points are lost from both ends of the data Smoothing No of Points Used Points Lost at Each End None 0 0 Low 9 4 Medium 17 8 High 37 18 Use this option to remove any manipulation and display the rate graph as originally specified by the rate method If you used the Cell Changer to run more than one rate in parallel use this function to select and display the results from any cell in the run Enter the number of the cell you wish to display Spectrophotometer User Guide 45 Rate Results screen This screen displays the Initial and Final Absorbance Initial and Final Time the change in absorbance per minute calculated Activity Correlation Coefficient of the best fit line and the smoothing parameter used If the rate curve
87. ion Defines the time period over which the sample will be measured Enter a value in the range between 00 05 seconds and 99 59 seconds in steps of 1 second If the Cell Changer is On the measurement time sets the time between individual measurements on the first cell i e the time for each cycle Sets the time between pressing Aun and the start of the measurement Enter a value in the range between 00 05 and 99 59 seconds in steps of 1 second Toggles the graphical display between the Absolute Values and Relative Values settings Absolute Values Plots the measured absorbance values in Absorbance vs Time When Abs Display Absolute the Graph High and Graph Low parameters appear on the Rate Method screen Relative Values Plots the measured absorbance values relative to the first measurement subtracts the first measured absorbance value from all subsequent measurements This causes the plot to start at the 0 0 coordinate change in Absorbance vs Time When Abs Display Relative the Slope and Range parameters appear on the Rate Method screen Sets the maximum y axis value on the displayed graph Enter a value from 0 010 to 3 000 Note This parameter appears only when ABS DISPLAY is set to ABSOLUTE Sets the minimum y axis value on the displayed graph Enter a value in the range between 0 010 and 2 990 Note This parameter appears only when ABS DISPLAY is set to ABSOLUTE Sets the graph to display positive or negative chang
88. ixed method parameters aas diet e be adii 23 Fixed Results screen c cccccccecessesensccececececsssenecacceceeecsesssenceeceeceecsessnenacess 29 O uantanernod Daratmstel suae quias dote up eaa M P ex D CDM E 30 Quant Standards SCEBEI ccs ndis cdi tee deiude ated Gnd am rera 34 Quant Calibration screen via ceo Tbe od thea Hose pa ced used du dues 35 Q ant EE 36 Spectrophotometer User Guide i Spectrophotometer User Guide Rate Method sciens sssini Prentice dE 38 Bate EE 4 Manipulate menu options 2 cos erasa Ren trip darn reote serta ER eren 42 reegen 46 Parallel Rate measurements using the Cell Changer 46 Multicomponent Analysis MCA eere entente tnnt 48 NICA Method Screbtbo scias etse f HEP de ete 48 MCA Standards SCESElTo onde teet sit se feti a e e da que 51 MCA Wavelength sereen o o coder de cuti nhe esie access Seales 52 MCA Calibration screen acean qi aar pr oe EUER Ges De Re RETO QUA 53 ET 53 MET 55 BioMate EE 55 Nucleic acid measurements utn tti diae Rede 56 Direct UV measurements of nucleic acids E 59 Oligonucleotide measurement calculated factor 61 Protein measurements Standard Curve method 63 Direct UV eege teat tteceactn 65 Warburg Christian test deii ec Hee repaid o tasas d dese dun dotis 67 Running the Warburg Christian st 2 ete tre decret ettet erp 67 Cell growth test
89. l Phosphorus Total 0 01 0 50 mg l 50 mm Rectangular LCK349 K349P50 FXD 0 03 1 50 mg l 0 02 1 20 mg l 0 05 1 50 mg l 11 mm Round LCK349 K349CT FXD 0 15 4 50 mg l 0 15 3 50 mg l 0 5 5 0 mg l 11 mm Round LCK 348 K348CT FXD 1 5 15 0 mg l 1 2 11 5 mg l LCK 350 K350CT FXD 4 P20 SE ageet fk itm Round Loes koaron Silicic Acid 50 mm Rectangular JLCW 028 W028P50 FXD i 11 mm Round W028CT FXD 0 4 10 mg l i 20 100 mg l i Silver Ag 11 mm Round LCK 355 K355CT FXD 400 2500 mg l brum forenet vrs marem 100 Spectrophotometer User Guide CHEMetrics 0 11mg l Chromate Diphenylcarbazide 0 3 5mg l Diphenylcarbazide mm 0 7mg l 0 7mg l Bathocuproine Isonicotinic barbituric acid Iron Phenanthroline Phenanthroline Nitrate Cd Reduction Chromotrophic Acid 0 14mg I 0 0 4mgl 0 2mg l 0 8mg l 0 10mg l 0 3mg l C6923 FXD Cd Reduction Chromotrophic Acid Cd Reduction Chromotrophic Acid 0 60mg l CO 0 0 8mg l 0 150mg l D M MEL MU Sie O ENS c ed lo z O ot Sa J PO TE ARI E iz P2 9 gt gt 0 o gt EM J Kei ei a o D Oxygen Demand Reactor Digestion 0 1500mg l Spectrophotometer User Guide 101 102 Spectrophotometer User Guide Library The Local Control Software stores methods and data files in a library The term
90. l or Heat Duration Specify a delay time from 1 to 100 seconds in digital format with a period separator e g 00 01 to 99 59 Action Select whether to display a user prompt when the delay time has passed Choose Pause to display a user prompt with three choices Stop Zero or Continue Choose Continue to skip the user prompt After the delay time has passed the system automatically proceeds to the next task in the measurement sequence Note Timers can be used with a sipper accessory that is in Auto mode You cannot use a timer with a cell programmer in Auto mode See Timer Function Keys for more information Selects the wavelength at which the source is changed between the tungsten and deuterium lamps Select from 315 320 325 330 335 340 D2 W Note Selecting D2 or W manually overrides the Lamp Change setting and the selected lamp will be used regardless of the wavelength set Note This parameter is not available for the AquaMate Vis Displays the Text Entry screen to enter a user name The user name is automatically saved with the method and any data produced by the method Note If User Log on is in operation the user name cannot be changed Displays the UVcalc screen Description Displays the Fixed Results screen Displays the Save screen which allows the method to be saved to a USB memory device Prints the current method parameters using the selected printer Note Ifthe selected wavelength re
91. le from each Test Results screen Function key Description Test Screen Displays the Test home screen Save Results Displays the Save screen which can be used to save the test results to a USB memory device Print Result Prints the test result using the selected printer Stop Cancels the current test This option is available only while a test is running After you press Stop any results obtained from the test up to that point are discarded Removing the CVC carousel L Hold the carousel firmly and turn the central screw counterclockwise until the carousel is released 2 Lift the carousel off the motor shaft Store the CVC in its protective box 3 Replace the cover on the motor drive unless you plan to install the Cell Changer Spectrophotometer User Guide 149 Analog Data Output Our spectrophotometers have an analog output which can be used to provide a signal for a chart recorder This section explains how to connect and set up a recorder Connection Use the Recorder Lead to connect the recorder to the REC port on the spectrophotometer rear panel This lead is used for both 0 10 mV and 0 1 V full scale deflection fsd chart recorders Use the blue plug for 0 10 mV or the red plug for 0 1 V Note If your chart recorder operates in either voltage range we recommend that you use the 0 1 V setting with the appropriate plugs red and black 4 Setup Press Home and then press Setup On the Setup screen sele
92. length values Values for the analytical wavelengths 164 Spectrophotometer User Guide Initial Default Values Range empty not an entry NA DNA Ratio ug ml for DNA A Protein Up to 9 characters DNA Scan pg ml for DNA amp Protein ssDNA ug ml RNA ug ml Oligos ug ml Bradford Protein ug ml Lowry Protein ug ml BCA Standard Protein mg ml BCA micro ug ml Biuret Protein mg ml Direct UV Protein mg ml Warburg Christian mg ml DNA 260 280 260 230 190 0 1100 0nm dsDNA ssDNA RNA 260 DNA scan 225 325 Oligos entered factor 260 Oligos calc factor 260 Bradford Standard amp micro 595 Lowry Standard 550 Lowry micro 750 BCA Standard amp micro 562 Biuret 540 Direct UV 280 Direct UV 205 Warburg Christian 260 280 Cell Growth 600 Test Name Nucleic Acid Tests DNA Protein concentration and DNA Purity 260 280 DNA Protein concentration and DNA Purity 260 230 DNA Protein concentration and DNA Purity 260 280 with SCAN Test Types Absorbance Difference Absorbance Ratio Absorbance Difference Absorbance Ratio Scan Absorbance Calculations for BioMate 6 Tests Calculation s Dilution Factor D diluent vol sample volume sample volume DNA concentration A Al A2 Ares fal Dr Protein concentration A Arer f3 Ai All D Ratio Au Aref A2 z Aref Dilution Factor D diluent vol sample volume
93. librate Starts the calibration procedure and displays the Calibrate Sipper screen This screen is displayed when you press Calibrate from the Sipper Calibration screen Using the solvent that will be used for the sample solutions bring a measuring cylinder filled to the highest gradation to the sipper uptake tube and press the switch CALIBRATE SIPPER i i NOMINAL VOL 1 000 ml NO SIPS DONE 5 4 4 SIPPER SCREEN The sipper pumps a sample and the spectrophotometer issues a beep Withdraw the measuring cylinder to allow the sipper to pump the air gap The values used for sample volume and air gap are those set on the Sipper screen Repeat this process for a number of cycles up to a maximum of 10 and then press Enter Measure the total volume taken from the measuring cylinder and enter this value The calibration appears Function key Description Sipper Screen Displays the Sipper screen and cancels the calibration CVC Setup Note Notice Note Calibration Verification Carousel The Calibration Verification Carousel CVC measures fundamental operating parameters to ensure the spectrophotometer is operating according to specifications The CVC replaces the standard cell carousel in the spectrophotometer sample compartment Calibration values for the CVC are provided on a PC format USB memory device which are loaded during setup The calibration process of the CVC waveleng
94. lign the carousel with the spectrophotometer Notice This step is important to ensure correct operation of the Cell Changer We recommend that you initialize the Cell Changer each time you use it a Removing the Cell Changer To remove the Cell Changer 1 Operating the Cell Changer Hold the carousel firmly and turn the central screw counterclockwise until the carousel is released Lift the carousel off the motor shaft Replace the cover on the motor drive When the Cell Changer is installed a status box is displayed indicating the presence of the accessory and its current position If the status box is displayed you can use the right left arrow keys to manually move the Cell Changer The software tracks the number of times the arrow keys are used For example press the right arrow key 5 times to advance the Cell Changer exactly 5 positions PROG i CELL i CELL POS 1 MODE MANUAL REF MODE OFF LAST CELL 7 CELL CYCLES 5 SPEED HIGH i i INIT IALIZE For all instrument models except the BioMate Spectrophotometer User Guide 133 134 Spectrophotometer User Guide CELL CELL POS 1 MODE ON SPEED HIGH i i INIT E cont E DEAE e For the BioMate 6 Item Function Cell Pos Shows the current position of the Cell Changer Use the right left arrow keys to move the Cell Changer Mode Selects the Cell Changer run mode
95. mg l 0 Kelte Fl onds Betz 0 10 1 50 sel po pun tee mgt EE SECH EROR Ee EE SE nel EHO Ee te o 3 3 Re 3 Oo 8 gs T Q T O B eS N Es e S Hj Ge g 14683 N E 3 8 GO CH eo Di Oo E fo E Ke e f S S 3 5 S e da e e Q OIO e AJ A ONG ONS ON co oo LA CG Lu m esi s N cou Bees tes Ew sl ier PS rS x 9 Ig t Cell Type 10 mm Rectangular 86 Spectrophotometer User Guide ei Ki o g 5 m amp 6 er o Z 5 5 S Spectrophotometer User Guide 87 5 Nn Ese S 5 3 Oo Nn S 8 3 ze Q o Las 5 Kei EN 2 0 20 0 mg l 10 mm Rectangular mg l HO 0 05 4 00 mg l 16mm Round mg l Fe 0 03 2 50 mg l 20 mm Rectangular mg l Fe 0 05 5 00 mg l 10 mm Rectangular mg l Fe 0 03 2 50 mg l 20 mm Rectangular mg l Fe s e m MA gt e ES 8 WN e 3 3 za CH eo Sar d 5 ie Oo E 8 Oo kel CH A A A A A A A co M l M Vi Vi N Mo ON CON CON A A LA GN Mo Mo Units T 14785P50 FXD Manganese 0 01 2 00 mg l 50 mm Rectangular mg l Mn 0 25 5 00 mg l 20 mm Rectangular mg l Mn 0 50 10 00 mell 10 mm Rectangular mg l Mn Nickel 0 10 6 00 mg l 16 mm Round mg l Ni mg l Ni
96. more entries The History File contains a maximum of 400 entries When the number of entries reaches 390 a warning message appears The Administrator or a user with the History File privilege should save and or print the existing history file and then clear the file s contents Prints the instrument history using the selected printer Note Make sure the printer is connected and turned on before you select this option Spectrophotometer User Guide 127 Wavelength Calibration screen Notice Notice 128 Spectrophotometer User Guide This option is not available for the AquaMate Plus UV Vis model Select this option to optimize the instrument s wavelength calibration WAVELENGTH CALIBRATION i CALIBRATION USING D2 LAMP i i i SETUP CALIB PAGE RATE Calibration measures the deuterium lamp emission line at 656 1 nm and adjusts the calibration accordingly Calibrate oz y when the instrument no longer achieves its quoted wavelength accuracy specification Do not attempt to recalibrate the instrument unless you are absolutely sure you need to do so If you have questions contact our technical support A Clear the sample and reference beams before you recalibrate A The calibration takes at least 10 minutes Follow these steps 1 Make sure the deuterium lamp is On 2 Wait until the instrument is fully warmed up 3 Clear the sample and referenc
97. mple and press Run Enter a factor at the prompt and press Accept The instrument scans the sample and displays the results of the calculation Setting up a Fixed calculation Up to 9 different measured results may be specified for each UV cale equation These measurements will comprise a combination of up to 9 different one off measurements measured at the start of the run only and one measurement which will be re measured each time Ruz is pressed This example shows how to set up the following Fixed calculation 1 2 M1 50 0 Display the Fixed method parameters select UVcalc and press Enter Select Equation 1 and press Enter Spectrophotometer User Guide 113 10 11 12 Setting up a Quant calculation Select Formula and press Enter Select M and press Enter The instrument displays a pop up menu with the following options e Once only constant e Measure each RUN Select Measure each RUN and press Enter Select and press Enter Enter 50 and press Accept The formula displayed at the top of the screen should look like this FORMULA M1 50 Select Title enter a descriptive name to be displayed in the UVCALC Equations screen and press Accept Select Units enter appropriate units for the equation and press Accept Press Accept to complete the equation The new equation is displayed in the Equations screen MY CALC M1 50 Press Accept again to return to the Fixed parameters scr
98. n The Lamps screen function keys differ depending on the instrument model LAMPS TUNGSTEN ON HOURS 239 ENERGY 10 i i D2 OFF HOURS 55 ENERGY 0 L SWITC D2 W RESET RESET H ENERG ENERGY D2HRS WHRS For AquaMate Plus BioMate 6 Omega Evolution 160 and UV 10 spectrophotometers TUNGSTEN LAMPS ON HOURS 239 I ENERGY 1096 i i D2 OFF HOURS 55 ENERGY 096 Ww RESET ENERGY WHRS For AquaMate Vis spectrophotometer Parameter Tungsten Hours Energy D2 Hours Energy Function key Reset W HRS or Reset D2 Hrs W Energy Function Shows the status of the tungsten halogen lamp On Off or Failed Shows the total hours the tungsten lamp has been used Replace the lamp after 2000 hours of use and then reset the hours to zero see Reset W Hrs function key Shows the energy level of the tungsten lamp 50 100 Shows the status of the deuterium lamp On Off or Failed Shows the total hours the deuterium lamp has been used Replace the lamp after 1000 hours of use and then reset the hours to zero see Reset W Hrs function key Shows the relative energy level of the deuterium lamp 50 100 Description Resets the hours for the selected lamp W Tungsten D2 Deterium Note Allow the lamp at least 10 minutes to warm up before resetting its hours A pop up menu appears with tw
99. n screen instructions To select a different fit for a standard curve 1 Press Standards on the Calibration screen 2 Press Edit Curve on the Standards Results screen 3 Select a fit for the standard curve and press Enter The instrument applies the selected curve fit to the data and displays the new calibration equation and coefficient 1 Place the blank in the cell holder 2 With the appropriate protein parameter screen displayed press Zero Base to measure the blank 3 Place the unknown sample in the cell holder 4 Press Run The protein measurement screen is displayed and the measurement starts When the instrument is finished measuring the absorbance of the sample it displays the ID absorbance and concentration Here is an example Note Use the arrow keys to display the next or previous page A TEST NAME BRADFORD STD ID ABS A1 CONC 260 0 nm ug ml 999 0 121 123 45 1 0 234 2345 6 12 0 345 345678 i i i i PRINT SAVE TEST CLEAR LIST DATA PAGE RESULTS Coomassie Bradford Standard test results Direct UV measurements of proteins The Direct UV method determines protein concentration based on absorbance at 280 nm or 205 nm The example below shows the parameters for the Direct UV protein test at 280 nm For the Direct UV test at 205 nm Wavelength is set to 205 nm Spectrophotometer User Guide 65 TEST NAME DIRECT UV 280 WAV
100. nal accessory that enables samples to be drawn into a flow cell for automatic measurement The SuperSipper works with any kind of flow cell After the measurement is complete the sample may be sent to a waste receptacle or returned to its original vessel A continuous pumping mode can be used to run a rinse solution through the system when required e g between applications This section describes how to use Local Control Software to operate the SuperSipper For complete installation and operating instructions for this accessory see the corresponding manual on the documentation CD To operate the SuperSipper install the accessory as described in the operating manual Present the sample to the SuperSipper and press the switch to draw the required sample volume into the tubing When the system beeps remove the sample to allow the system to draw in the required air gap When the measurement is completed press the switch again to empty the flow cell The sample is pumped to a waste receptacle or the original sample vessel When the sipper is connected a status box appears on the right side of every method screens The status box indicates the presence of the SuperSipper and its status Spectrophotometer User Guide 136 Sipper screen SIPPER SIPPER OFF MODE SIP AIR GAP 50cm SAMPLE VOL 1 000 ml SAMPLE WASTE LOW VOL OFF I i VIEW CALIB CALIB RATE Use this s
101. ncerns about safety or need assistance with operation repairs or replacement parts you can contact our sales or service representative in your area or visit our web site at www thermo com spectroscopy Spectrophotometer Basics This chapter describes the major components of your spectrophotometer Keypad and LCD display To adjust the contrast for the LCD display press Home and then press the left or right arrow key o o o Q QO Gi e _ OOOOH 0000 0000 eem Keypad and LCD display Button Description Function Arrow keys Select an option on the current screen or popup menu gt From any graph with the Track option selected move the crosshairs right or left Move the Cell Changer Change display contrast from Home or initialization screens only Spectrophotometer User Guide 3 Button OOOO OOOO 0000 Zero Base OOOOOL Key functions 4 Spectrophotometer User Guide Description Numeric keys Function keys ESC Enter Run Home Zero Base Function Enter a number minus sign or decimal point Access and perform system functions as indicated by associated software labels Available functions depend on screen in use Delete entry Remove pop up box Clear error message Accept changes to field or parameter value Measure sample according to current method Return to Home screen For Scan methods perform
102. next wavelength in the list highlighted Up to 20 wavelengths may be entered When the list is finished press Acceprto accept the new list or Cance to return to the Fixed Method screen without changing the wavelength list Serial Press Enterto display the entry box for the wavelength to be used for the first sample Data entry is as for Multi A above When the required wavelengths have been entered press Accepfto accept the new list or press Cance to return to the Fixed Method screen leaving the original list unchanged Bandwidth This parameter is fixed at 2 0 nm Integration Defines the integration time for which the result is measured Use the pop up box to enter a value in seconds Note The current data will be lost if the integration time is changed 26 Spectrophotometer User Guide Parameter Delay Time not available for AquaMate models Timer s for AquaMate models only Lamp Change User UVcalc Function key View Results Save Method Print Method Function Specifies a delay between pressing Aun and the start of the measurement Enter a value from 0 to 99 minutes and 59 seconds Use a decimal point to separate minutes and seconds e g 99 59 The number of seconds must always be entered explicitly Allows you to add up to 4 timers in a method for specific purposes For each timer define the following Title Select a name that indicates the purpose of the timer Timer Wait Shake Invert Swirl Boi
103. nu Option Off Seeded Prompt User Function The system does not attach an identity to the sample Stores a user defined identification with each sample The sample ID is displayed and any printed results When LIMS Support is enabled the sample ID is also exported with the sample results and the method used When Use Sample ID is set to Seeded the following options appear in the Environment screen Sample ID Displays the Text Entry screen Enter a base name for the samples up to 11 characters and press Accept Sample ID Seeded Displays a pop up entry box Enter the number you want to assign to the first sample and press Enter e g enter 0 to identify the first sample as 1 The number is incremented automatically before each sample Allows the operator to identify each sample at run time Before each run the Text Entry screen is displayed and the user is prompted to enter a name for the sample Note When the Cell Changer is used in Auto mode the Sample ID is incremented automatically without stopping for ID confirmation between samples A Note The Prompt User option does not work when the Sipper is operating in the Sip amp Run or AutoSampler mode 4 AutoSave Result Toggles the AutoSave option on and off Option Function On Sample results are saved automatically after each run When AutoSave Result is set to On the following options are displayed in the Environment screen Filename Displays t
104. nue to skip the user prompt After the delay time has passed the system automatically proceeds to the next task in the measurement sequence Note Timers can be used with a sipper accessory that is in Auto mode You cannot use a timer with a cell programmer in Auto mode See Timer Function Keys for more information Note Note Note Note Option Lamp Change User UVcalc Function key View Calib View Results Save Method Print Method Calibrate Function Selects the wavelength at which the source is changed between the tungsten and deuterium lamps Select from 315 320 325 330 335 340 D2 W Note Selecting D2 or W manually overrides the Lamp Change setting and the selected lamp will be used regardless of the wavelength set Note This parameter is not available for the AquaMate Vis Displays the Text Entry screen used to enter a user name The user name is automatically saved with the method and any data produced by the method Note Changing the user name will not cause any current data to be lost Note If User Log on is in operation the user name cannot be changed Displays the UVca c screen See UVcalc for more information Description Displays the Quant Graph screen if valid calibration exists Displays the Quant Results screen if sample results exist for this method Displays the Save screen which allows the method to be saved to a USB memory device Prints the current met
105. o options Proceed or Cancel Select Proceed and press nterto reset The hours change to zero and the Energy readout shows the energy measured atthe appropriate wavelength Measures the energy for the selected lamp Note Clear the sample and reference beam and allow the lamp at least 10 minutes to warm up before measuring its energy To exit this screen press Home Spectrophotometer User Guide 131 Cell Changer The 7 Cell Changer allows you to present up to seven samples for sequential measurement The Cell Changer is available as a standard option on all spectrophotometer models This section describes how to install operate and remove the accessory Installing and removing the Cell Changer Follow these steps carefully each time you remove or install the Cell Changer carousel Installing the Cell Changer To install the Cell Changer 1 Remove the cover from the motor drive 2 Remove the single cell holder or other accessory from the sample compartment 3 Install the Cell Changer carousel Place the carousel on the motor shaft mounted inside the sample compartment taking care to align the tab on the underside of the carousel with the notch on the motor shaft Tab on underside of carousel Notch on motor shaft of Smart base unit Spectrophotometer User Guide 132 4 Tighten the screw on the top of the carousel by turning the knurled knob clockwise 5 From the Cell Prog screen press Initialize to a
106. on the user name cannot be changed Sets the maximum y axis value on the analog output Select from 2 9999 to 6 0000 Sets the minimum y axis value on the analog output Enter a number in the range between 3 0000 and 5 9999 Available only when the Cell Changer is installed and ABS Display is set to Parallel See Parallel Rate Measurements using the Cell Changer for more information Available only when the Cell Changer is installed and ABS Display is set to Parallel See Parallel Rate Measurements using the Cell Changer for more information Description Displays the Rate Results screen Displays the Rate Graph screen Displays the Save screen which allows the method to be saved to a USB memory device Prints the current method parameters using the selected printer Rate Graph screen This screen displays the Rate curve and allows it to be manipulated Function key Description View Results Displays the Rate Results screen Rate Page Displays the Rate Method screen Save Data Displays the Save screen which allows the method and data to be saved to a USB memory device Print Prints the rate graph and the results using the selected printer If a Cell Programmer is fitted see the note below Manipulate Displays the Manipulate pop up menu see descriptions below Rate Graph function keys If you are using the Cell Changer to run more than one rate in parallel three more print options are available Spectroph
107. on Factor D diluent vol sample vol sample volume Conc F X Aogy D Second order Second order Second order Second order Second order Second order Default Parameters 260nm dil vol 0 smp vol 1 260nm FactoFotigos 38 dil vol 0 smp vol 1 595 nm Standard concentrations of 25 125 250 500 750 1000 1500 2000 595 nm Standard concentrations of 2 5 5 10 15 20 25 550 nm Standard concentrations of 0 100 200 500 1000 2000 750 nm Standard concentrations of 1 5 25 125 250 500 750 1000 1500 562 nm Standard concentrations of 25 125 250 500 750 1000 1500 2000 562 nm Standard concentrations of 0 5 1 2 5 5 10 20 40 200 Displayed Units ug ml ug ml ug ml ug ml ug ml ug ml mg ml ug ml Spectrophotometer User Guide 167 Test Name Biuret Direct UV 280 Direct UV 205 Warburg Christian Cell Growth Test Cell growth Test Types Standard Curve Factor Factor Absorbance difference Absorbance 168 Spectrophotometer User Guide Calculation s First order through zero Dilution Factor D diluent vol sample vol sample volume Conc F X Axel Dilution Factor D diluent vol sample vol sample volume Conc F X Aos D Dilution Factor D diluent vol sample vol sample volume Protein Concentration Ai f A f Dr None
108. on typically takes the following form Method K307CT FXD Boron Equation Ml 1 74 80 Spectrophotometer User Guide The factors entered are those documented by Dr Lange However the values of these factors may be affected by local conditions In all cases we recommend that you check the factors using standard solutions appropriate to your laboratory and modify the equation accordingly Note that timers are not incorporated into the Dr Lange methods You can easily add them if desired by referring to the Timer parameter description in the Fixed section of this manual Spectrophotometer User Guide 81 Disk 4 CHEMetrics Vacu Vial methods Operation Test results 82 Spectrophotometer User Guide All the CHEMetrics Vacu Vial methods are Fixed FXD files which measure sample absorbance values at fixed wavelengths and compare them to known standards measured at the same locations These files have the following format Cxxxx FXD Prepare the sample and blank according to the instructions supplied with the test kit 1 Load the method see Loading a method for details 2 Place the blank in the cell holder and press Zero Base to take a baseline measurement 3 Insert the prepared sample into the cell holder and press Rzz to measure the sample 4 To measure another sample insert the sample and press Run In all of these methods the relationship between absorbance and concentration is linear and take
109. ormal on the Rate Method screen Measure Time specifies the time between each measurement on the first cell a 2 Display the Cell Changer screen Press Home then Accessories and select Cell Prog 3 Set up the Cell Changer method as required A Return to the Rate Method screen and press Zero Base to zero the instrument if required 5 Press Run to start the analysis The rate graph shows the data for the first cell To view the result of any other cell press Manipulate on the Rate Graph screen and select Another Cell The cell number currently displayed is shown to the right of the ID line To print the results press Print from the Rate Graph screen or the Rate Results screen The following options appear All Overlay Prints the results of all cells in the run together in batches of 4 Track and Section markers are not included All Sequential Prints each result in the run separately Track and Section markers are included One Result Prints the result currently displayed Track and Section markers are included Spectrophotometer User Guide 47 MCA Method screen Multicomponent Analysis MCA Select the MCA application on the Home screen to measure up to 20 components in a sample mixture You can set up the method to measure up to 20 wavelengths per sample Standards can be measured at run time or loaded from files obtained using the Multi A function available from the Fixed application Use the MCA
110. ote Changing the user name will not cause the current spectrum to be lost Note If User Log on is in operation the user name cannot be changed Displays the UVcalc screen See UV calc for more information Description Displays the Scan Peak Table screen after you perform a peak function or the Track Table screen after you use Track Displays the Scan Graph screen Displays the Filename Function screen and then saves the method including User Name Test Name and track wavelengths if Peak Table is setto Track Prints the current method parameters using the selected printer Displays the UVcalc results screen if an equation has been entered and results are available Spectrophotometer User Guide 17 Scan Graph function keys Manipulate menu options 18 Spectrophotometer User Guide Function key Description View Results Displays the Scan Peak Table screen Scan Page Displays the Scan screen Save Data Displays the Save screen for saving methods and data to a USB memory device Print Graph Prints the displayed data using the selected printer Manipulate Displays the Manipulate popup menu see descriptions below Scan Graph function keys Press Run to start a scan using the current method Press Zero Base to start a baseline using the current method MANIPULATE TRACK RESCALE COMPARE MODE PEAKS SMOOTHING ORIGINAL Menu Option Function Track Reports x and y axis values selected with the tracking c
111. otometer User Guide 41 All Overlay All Sequential One Result Manipulate menu options 42 Spectrophotometer User Guide Prints the results of all cells in the run on one sheet of paper up to a maximum of 4 results If more than four results are present the rest are printed on a second sheet Prints each result in the run on a separate sheet of paper Prints only the displayed results Press Run to start a measurement using the current method Press Zero Base to zero the instrument using the wavelength specified in the current method MANIPULATE TRACK RESCALE SECTION SMOOTHING ABS DISPLAY ORIGINAL ANOTHER CELL Item Function Track Sets the start and stop time for the rate calculation Rescale Changes x and y axis scales automatically or manually Section Sets sequential start and stop times to enable rates to be calculated on up to four sections of the rate curve Smoothing Allows three levels of smoothing to be applied to the Rate Curve ABS Display Toggles the graphical display between Absolute Values plots the measured absorbance of each sample vs time and Relative Values plots the change in absorbance relative to the first measurement over time Original Resets the graph to display the data as originally collected Another Cell Only present if the Cell Changer has been used Enables the results of another cell from the same run to be displayed Track Track graph function keys
112. parameters screen The following error messages may occur if you make a mistake in entering an equation or in setting up the system Error Message ONLY 1 FACTOR MAY BE ENTERED WITH SAMP THIS FORMULA HAS TOO MANY CONSTANTS FORMULA CONTAINS AN INVALID NUMBER BRACES DO NOT MATCH IN FORMULA ALL BINARY OPERATIONS REQUIRE TWO OPERANDS INVALID COMBINATION OF OPERANDS BRACE MISSING UNMATCHED CLOSE BRACE Problem LE Formula has two or more factors for each sample Formula has more than 9 numbers Formula has an invalid input Formula has too many brackets at one end Formula has an incomplete arithmetical operation e g 3 4 You have created a formula with missing user s e g F1 M1 Closing bracket appears before or without an open bracket THE FORMULA CANNOT START WITH THIS TOKEN Quant mode formula has an invalid initial token i e a user rather than an operand FORMULA CONTAINS OUT OF RANGE STANDARD A specified standard is no longer in the calibration ONLY ONE MULTIPLE MEASUREMENT IS ALLOWED Fixed mode formula has an invalid initial token FORMULA CONTAINS INVALID RESULT TOKEN The result from an earlier calculation is no longer being produced Spectrophotometer User Guide 117 Error Message Problem UVCALC INVALID CELL CHANGER MODE An invalid Cell Changer mode has been selected Check settings FORMULA CONTAINS OUT OF RANGE You have selected wavelengths outside the range set for the scan WAVELENGTH 11
113. plications Only one application can operate at a time Loading another application will overwrite any current data A Your instrument may display a Home screen that lists purchased methods or other individual methods that were selected manually for display at start up To display the default Home screen with the options listed above from the start up screen choose General Tests A Spectrophotometer User Guide 7 Local and Computer Control Remote computer Local computer Basic operation Spectrophotometer User Guide After power up the instrument is automatically set to local control Follow these steps to switch between local control and control from an external computer To switch from local control to an external computer via the RS 232C port 1 Display the Home screen 2 Wait until the instrument is idle 3 Press Remote O O OIOIQ REMOTE To return to local control 1 Wait until the instrument is idle 2 Press Home The main menu is displayed and the embedded keypad is operational To operate the Local Control software Use the function keys directly below the LCD display to move between software screens within an application e To initiate an action use the arrow keys to select an option on the current screen or popup menu and then press Enter e To return to the Home screen press Home Parameter entry Pop up entry box Pop up menu Toggle Text entry screen The Local Control
114. pplies to the BioMate 6 spectrophotometers only The BioMate 6 provides an assortment of general tests used to characterize biological and biochemical substances These tests fall into the following categories e Nucleic acid measurements e Protein measurements e Cell growth analysis These tests are accessed from the BioMate Tests screen which appears when you start the instrument or press Home BIOMATE TESTS I I NUCLEIC ACID TESTS PROTEIN TESTS CELL GROWTH OLIGO CALCULATOR LIBRARY i i I I I I L 1 SETUP GENERAL STORED REMOTE TESTS TESTS To display the default Home screen for Local Control Software from the BioMate Tests start up screen choose General Tests 4 Note All of the parameters for the BioMate applications described in this section are factory set This means if you want to change the parameters you will need to save them with a different name See BioMate 6 Test Parameters for a list of all the parameters used in each pre set test See Calculations for BioMate 6 Tests for a list of calculations used by each test a Spectrophotometer User Guide 55 Nucleic acid measurements These tests can be used to determine the concentration and purity of nucleic acid in an unknown sample DNA Measures absorbance at 260 nm and 280 nm or at 260 nm and 230 nm and determines concentration and purity based on the absorbance ratio and absorbance difference
115. prompt appears with the following options Stop Interrupts the measurement and displays the Fixed Results screen Zero Takes a baseline measurement Proceed Continues to the next task in the measurement sequence After the last timer is completed the system proceeds to the next measurement task Fixed Results screen The layout of the screen depends on the current settings for the Mode and Select parameters on the Fixed Method screen Parameter Single Multi Serial Function key Clear Results Fixed Page Save Data Print List LIMS Export Function In ABS or T modes up to 2 columns of results are displayed per page Two columns of results are displayed per page Results of each sample always start on a new page One column of results is displayed per page Results accumulate on the same page until it is full Description All results are cleared ready to start the next batch Displays the Fixed Method screen Displays the Save screen which allows the results to be saved to a USB memory device Prints the current list using the selected printer Sends the results via the RS 232 port Use the up down arrow keys to display the previous or next page of results Results are numbered sequentially up to 600 samples per batch Press Run to take another sample measurement Press Zero Base to zero the instrument at the wavelength s specified in the method Spectrophotom
116. quires the deuterium lamp the lamp will activate automatically The current data will be lost if the wavelength is changed a Pressing Run starts a fixed measurement using the current method and then switches to the Fixed Results screen Spectrophotometer User Guide 27 Timer function keys 28 Spectrophotometer User Guide Note Pressing Zero starts a zero using the current method Any changes to the Wavelength Bandwidth Integration or Lamp Change parameters will invalidate the current results a If Autoprint is selected see Setup for details a change to the Mode parameter will invalidate the current results Function key Description Change Mode Sets the operating mode for the timers Single Use Runs all timers before the first measurement only Multiple Use Runs all timers before each measurement Run Timers Runs the timers without initiating a measurement sequence Accept Stores the timer settings and displays the Fixed Method screen Cancel Cancels the timer settings and displays the Fixed Method screen If one or more timers are defined in a method the first timer starts when you press Run The system shows the remaining time for the current timer If you need to stop the timer press Stop If you allow the timer to continue and no user prompt is defined after the delay time has passed the system automatically proceeds to the next task in the measurement sequence If the timer includes a user prompt the
117. re will also be lines specific to the particular application Scan Fixed or Quant Option Function Formula Defines the terms and operands in the formula Title Specifies a name for the formula Use the Text Entry screen to enter a name and press Accept Units Gives the units for the equation Use the Text Entry screen to enter a name and press Accept Test Result Toggles between Yes and No Upper Lower Define the allowable limits for the test Limit Function key Description Accept Stores the entered settings Cancel Displays the Equations screen without storing your entries To enter a formula select Formula and press Enter The instrument 110 Spectrophotometer User Guide displays a simulated keyboard with the following symbols orM F R Space Each symbol represents an available formula term or operand see the table below for definitions Use the symbols to build a formula To add a term or operand to the formula select the corresponding symbol and press Enter Option A or M R and t Space Function key Switch Fields Accept Cancel Function 2 for UVcalc from a Scan Method Displays a pop up entry box to define the wavelength for the measurement M for UVcalc from a Fixed or Quant method Displays a pop up menu with the following options Once Only Constant Measures this value the first time and then uses that value for subsequent calculations M
118. ries Merck is either a trademark or registered trademark of Merck amp Co Inc in the United States and or other countries CHEMetrics is either a trademark or registered trademark of CHEMetrics Inc in the United States and or other countries Adobe is either a trademark or registered trademark of Adobe Systems Incorporated in the United States and or other countries Excel Microsoft Windows and Windows NT are either trademarks or registered trademarks of Microsoft Corporation in the United States and or other countries All other trademarks are the property of Thermo Fisher Scientific Inc and its subsidiaries 269 220300 Rev A Contents E Te TRITT TT TT Conventions used in this manual 2 Questions OF CODCEEDS set etsii erae ner aE tua Pe AT ene RYE VEPURE ERR TEE Ra Ee Fa Uu EA 2 Spectrophotometer Basics e sessessessereesoesossossessesoesoesossossosseseesoesoesoesossees 2 Kevpad and LCD E EE 3 Io Sess eus EE ee eet eg 5 KT 6 ENEE 7 Local and Computer Control 1e et ent ota eot 8 Pasic pera to Nissisen siiani is tesabe E titer vs bs avverte 8 EE 9 Saving and renaming methods and data ac edo aere 10 Saving a nethode unsere p ob i buie aes 10 Savio data nociones meta dome aca eM Le eter c m EAE 11 SCANS EEN reet 14 Scan Graphfunction eege eege 18 Manipulate menu options oiii eoo thc erii ire dolan 18 Track EE 22 Peale KEE 23 Tato KEEN 23 Peak Height screens seg deco aco EE 24 Fixed iiie PIU cu F
119. rument is finished measuring the absorbance of the sample it displays the ID absorbance and concentration Here is an example Note Use the arrow keys to display the next or previous page A TEST NAME OLIGOS CALC i i ID ABS A1 OLIGOS OLIGOS 260 0 nm ug ml pmol ul I 999 0 123 123 4 56 7 I1 0 345 12 34 5 67 12 0 678 1 234 0 567 13 1 234 12345 578980 i i PRINT SAVE TEST CLEAR LIST DATA PAGE RESULTS Oligonucleotide test results calculated factor 62 Spectrophotometer User Guide Protein measurements Standard Curve method These tests can be used to determine the concentration of protein in an unknown sample based on any of the following analytical methods Coomassie Bradford Standard or Coomassie Bradford Micro Measures absorbance at 595 nm Lowry Measures absorbance at 550 nm Pierce Modified Lowry Measures absorbance at 750 nm BCA Bicinchoninic Acid Standard or Pierce Micro BCA Measures absorbance at 562 nm Biuret Measures absorbance at 540 nm Many of these tests use similar parameters The example below shows the parameters for the standard Bradford test For a list of all parameters and calculations for each test refer to Appendices A and B COOMASSIE BRADFORD STANDARD TEST NAME Coomassie Bradford DATE STANDARDS 260 0 nm MEASURED WAVELENGTH 595 0 nm CURVE FIT QUADRATIC
120. rument measures the sample and displays the Fixed Results screen To run another sample insert the sample and press Run Test results The Quant methods automatically take measurements from the calibration graph in concentration units The UVcalc equation is therefore of the form Method H1260 QNT Boron Equation MI In effect the UVcalc equation is used to indicate the chemical form and set the measuring range limits Spectrophotometer User Guide 79 Disk 3 Dr Lange cuvette and pipette test kit methods All the Dr Lange cuvette and pipette tests are Fixed FXD methods These files have the following format Kxxxyyy FXD Wxxxyyy FXD where Kxxx or Wxxx Last four digits of the Lange test kit FXD Fixed application in software Operation Prepare the sample and blank according to the instructions supplied with the test kit 1 Load the method see Loading a method for details The Fixed screen is displayed with the method file name at the top 2 Place the blank in the cell holder and press Zero Base to measure the baseline 3 Insert the prepared sample into the cell holder and press Run The instrument measures the sample and displays the Fixed Results screen 4 To measure another sample insert the sample and press Run Test results In all methods the relationship between absorbance and concentration is linear and takes the general form C A x FACTOR Therefore the UVcalc equati
121. s e BioMate 6 All of these instruments can be run from the integral keypad and LCD display or from an external computer additional software is required Each system is comprised of a spectrophotometer with integral keypad LCD display with adjustable contrast and embedded Local Control Software plus two USB ports for connecting an external memory device and printer A USB memory device ships with each system A The embedded Local Control software controls all aspects of the system s operation You can collect data at fixed wavelengths at all points in a spectral range at one location over a period of time or run quantitative experiments The Local Control software includes our UVcalc application which automatically calculates results from measurements using user defined equations in Scan Fixed and Quant modes Spectrophotometer User Guide 1 Conventions used in this manual Note Notice A Caution Questions or concerns 2 Spectrophotometer User Guide This manual includes safety precautions and other important information presented in the following format Notes contain helpful supplementary information A Follow instructions labeled Notice to avoid damaging the system hardware or losing data a Indicates a hazardous situation which if not avoided could result in minor or moderate injury A In case of emergency follow the procedures established by your facility If you have questions or co
122. s Wavelength 1D First derivative of the Absorbance vs Wavelength spectrum 2D Second derivative of the Absorbance vs Wavelength spectrum 3D Third derivative of the Absorbance vs Wavelength spectrum 4D Fourth derivative of the Absorbance vs Wavelength spectrum Defines the starting wavelength of the scan must be at least 4 nm less than the Stop wavelength Enter a wavelength between 190 0 nm and 1096 0 nm or between 315 nm and 1096 nm for the AquaMate Vis If the start wavelength requires the deuterium lamp the lamp will activate automatically Defines the ending wavelength of the scan must be at least 4 nm greater than the Start wavelength Enter a wavelength between 190 0 nm and 1100 0 nm or between 319 nm and 1100 nm for the AquaMate Vis This parameter is fixed at 2 0 nm Sets the scan speed The available options depend on the setting for Scan Type above If Scan Type Intelliscan Mode select from Color Zip Survey Normal Quant Hi Res If Scan Type Standard Mode select from 3800 2400 1200 600 240 120 30 10 or 1 nm per minute Sets the frequency of data points in the spectrum The available options depend on the setting for Scan Type above If Scan Type Intelliscan Mode the data interval is defined by the Intelliscan Mode setting according to the table below Intelliscan Mode Setting Data Interval Color 10 nm Zip 4 nm Survey 2nm Normal 1 nm Quant 0 5 nm Hi Res 0 2 nm Spectropho
123. s a baseline scan For Fixed Quant and Rate methods zeros the instrument Connectors Front panel features 1 Sample compartment 3 Keypad 2 LCD display 4 USB memory device port Rear panel features 1 USB printer port 4 Power switch 2 RS 232 PC LIMS port 5 Power connector 3 Connectors to control optional accessories Spectrophotometer User Guide 5 Sample holders Variable pathlength cell holder supplied with all instrument models Test tube holder supplied with AquaMate models ze Holder for 1 inch square Hach Cells and AccuVac Ampule supplied with AquaMate models 6 Spectrophotometer User Guide Notice Note Software The Local Control Software is organized in a tree structure with all functions accessed initially from the Home screen You can collect and analyze data in five modes Scan Measures absorbance at all points in a defined wavelength range e Fixed Measures absorbance or 96 Transmittance at up to 20 fixed wavelengths Quant Determines sample concentration by comparing measured absorbance values against a concentration curve e Rate Measures absorbance at one wavelength over a defined period of time e MCA Quantifies up to 20 components in a sample mixture by comparing measured absorbance values against the absorbance of known standards The Scan Fixed Rate Quant and MCA options available from the Home screen are independent ap
124. s collected over a period of time To change a parameter setting select the parameter and press Enter See Parameter Entry for more information Note The current data will be lost if any of the method parameters except for the Test Name Slope Factor Units and User name are changed A RATE TEST NAME WAVELENGTH 340 0 nm BANDWIDTH 2 0 nm MEASURE TIME 00 30 DELAY TIME 00 00 ABS DISPLAY ABSOLUTE GRAPH HIGH 2 000 GRAPH LOW 0 000 FACTOR 1 000 UNITS LAMP CHANGE 325 nm USER i CHART HIGH 6 0000 CHART LOW 3 0000 I I I L PRINT SAVE VIEW VIEW ETIN UN METHOD d METHOD GRAFH _ RESULIS For Zeta Omega Evolution 160 UV 10 AquaMate Plus AquaMate Vis models 38 Spectrophotometer User Guide I TEST NAME RATE MODE SERIAL WAVELENGTH 340 0 nm BANDWIDTH 2 0 nm MEASURE TIME 00 30 DELAY TIME 00 00 ABS DISPLAY ABSOLUTE GRAPH HIGH 2 000 GRAPH LOW 0 000 FACTOR 1 000 UNITS I LAMP CHANGE 325 nm USER I CHART HIGH 6 0000 CHART LOW 3 0000 I PRINT SAVE VIEW VIEW METHOD METHOD GRAPH RESULTS For BioMate 6 model Menu Item Function Test Name Use the Text Entry screen to enter a descriptive name for the method The Test Name is saved with the method and any spectra produced by the method Rate Mode When the 7 Cell Changer is installed Rate Mode toggles between the Serial and Parallel set
125. s the general form C A x FACTOR INTERCEPT Therefore the UVcalc equation typically takes the following form METHOD C1603 FXD Bromine EQUATION M1 7 89 0 04 CHEMetrics determines the Factor and Intercept values specifically for the AquaMate However the values of these factors may be affected by local conditions In all cases we recommend that you check the factors using standard solutions appropriate to your laboratory and modify the equation accordingly Note that the CHEMetrics methods do not use timers You can easily add them if desired by referring to the Timer parameter description in the Fixed section of this manual Spectrophotometer User Guide 83 AquaMate method descriptions This section describes the AquaMate methods in each test kit including the analyte test description type of cell used when applicable measurement range the manufacturer s program number and file name Merck Alcohol 0 40 5 00 g l g l Alco 14965 14965P16 FXD 0 40 5 00 g l 10 mm Rectangular g l Alco 14965 14965P10 FXD Aluminum 10 mm Rectangular mg l Al 14825P10 FXD 20 mm Rectangular mg l Al 14825P20 FXD ea ee es kenen S gt nN o M MA 8 Sfo ole WNT xA e e colo 2 E Bis Kei ce iS N Vi j e S 14834 02 1 50 mg l Bes sean al tO 14834 14834P20 FXD n EM lasted 14834P10 FXD Calcium 20 mm Rectangular mg l Ca 1 0 15 0 mg l iug l Ca Gu ICT EE
126. s to display the default Home screen Test Name Use the simulated keyboard or the numeric keypad to enter a descriptive name for the method and then press Accept See Text Entry screen for details Drive Select a destination for the method file Press Zzterto toggle the Drive setting between Library saves the method in the instrument library USB Memory saves the method on the Library USB memory device installed in the USB Memory Device port on the front of the instrument Function key Description Save Stores your entries and displays the method parameters screen Cancel Cancels the Save operation and displays the method parameter screen Saving data To save displayed data press Save Data The Save screen is displayed SAVE TYPE D SCAN FILENAME SCN FILE TYPE NORMAL TEST NAME DRIVE LIBRARY I I L J CANCEL SAVE Save screen for saving data Item Function Type This field is assigned by the software depending on the type of data being saved Spectrophotometer User Guide 11 12 Spectrophotometer User Guide Item Filename File Type Test Name Drive Function key Save Cancel Function This field is selected automatically when you first enter the Save screen Use the simulated keyboard or the numeric keypad to enter up to 8 characters for the filename and then press Accept See Text Entry screen for details Selects a file format Normal
127. s used for the measurements one measures absorbance at 260 nm and 280 nm the other at 260 and 230 nm 56 Spectrophotometer User Guide The example below shows the parameters for the DNA 260 280 test For the DNA 260 230 test Wavelength 2 is set to 230 nm DNA 260 280 I I I TEST NAME DNA 260 280 WAVELENGTH 1 260 0 nm WAVELENGTH 2 280 0 nm REF WAVELENGTH CORRECTION OFF DNA FACTOR A1 50 00 DNA FACTOR 42 0 000 DISPLAY PROTEIN NO DILUTION MULTIPLIER 1 00 UNITS ug ml ID O OFF 01 AUTOPRINT OFF USER i i PRINT SAVE STORED VIEW TEST TEST TESTS RESULTS DNA 260 280 test parameters Measuring DNA 1 Display the appropriate DNA parameter screen and enter the initial sample number ID 2 Place the blank in the cell holder 3 Press Zero Base to measure the blank 4 Place the unknown sample in the cell holder 5 Press Run to start the measurement The DNA measurement screen is displayed When the instrument is finished measuring the absorbance of the sample it displays the absorbance DNA ratio and DNA concentration similar to the example below Note Use the arrow keys to display the next or previous page a Spectrophotometer User Guide 57 DNA with scan tests 58 Spectrophotometer User Guide TEST NAME DNA 260 280 ID ABS A1 ABS A2 260 0 nm 280 0 nm 1 0 123 0 456 DNA RATIO 1 7 DNA CONC 1234 5 ug ml
128. ser Guide 108 Specification Operation Up to 4 different equations may be applied to each measurement The formula editor supports and bracketing Allowed operands include measurements constants entered via the numeric keypad fixed amp variable factors input by the user at run time and UVcalc results from preceding equations Each formula may have up to 20 characters Each formula supports up to 9 terms including measurements constants variable factors and results Equations are automatically saved with the method If you save sample results that are produced with a method that contains calculations the calculations are also saved with the sample data Equations results units and pass fail results are included on the hard copy output When the UVcalc software is installed the instrument adds the UVcalc option to the Scan Fixed and Quant screens When no equations are programmed the UVcalc field is set to 0 Select UVcalc and press Enter to display a list of up to four UVcale equations empty when first installed UVCALC EQUATION 1 EQUATION 2 EQUATION 3 EQUATION A I Spectrophotometer User Guide 109 Defining a formula To create or edit an equation select an equation in the list and press Enter The equations parameters screen is displayed in the following format Formula Title Units Test Result No Upper Limit 0 000 Lower Limit 0 000 The
129. software provides the following types of screens and menus for setting and editing parameters Use to enter numerical values The valid range for the parameter is displayed in the menu This example sets the starting wavelength for scanning EDIT VALUE START 400 MINIMUM 190 0 MAXIMUM 1100 5 Use the numeric keypad to enter a new value and then press Enter Press ESC to close the menu without changing the parameter Use to select from a list of available options This example defines the level of smoothing applied to the collected data SMOOTHING NONE LOW MEDIUM HIGH Use the arrow keys to highlight an option and then press Enter Alternates between two available settings e g yes no or on off when you press Enter Use to enter alphanumeric characters such as the Test Name The software displays the available characters To enter a letter or symbol use the arrow keys to select the character on the display and press Enter Numbers can be entered using the numeric keypad The left arrow function key works as a backspace To remove the entire text string press ESC Spectrophotometer User Guide 9 When the entry is complete press Accept to input the new text or Cancel to close the screen without changing the parameter The following function keys are available from the text entry screen Function key Description Cancel Cancels the operation and re
130. taking care to align the tab on the underside of the carousel with the notch on the motor shaft 4 Tighten the central screw by turning it clockwise 5 From the CVC Setup screen press Initialize to identify and align the carousel 6 Check that the Carousel serial number displayed on the CVC Setup screen bottom portion matches the serial number of the calibration data top portion This step is important to ensure correct operation of the system Even though the spectrophotometer checks for a data to carousel match before running any test an initial confirmation is recommended a Spectrophotometer User Guide 147 CVC Home screen CVC TEST TEST STATUS TIME DATE 1 WAVELENGTH PASS 11 05 03 12 08 2 ABSORBANCE PASS 11 20 03 12 08 3 UV ABSORBANCE PASS 11 25 03 12 08 4 STRAY LIGHT PASS 11 28 03 12 08 5 BANDWIDTH PASS 11 33 03 12 08 6 NOISE PASS 11 38 03 12 08 7 DRIFT PASS 12 40 03 12 08 SAVE PRINT PRINT TESTS ALL RESULTS SUMMARY ALL 1 3 TESTS The CVC Test screen lists the available tests and for each test reports the time and date the previous test was run and whether it passed or failed To reach this screen press Home or General Tests and then press Cal Val To perform a specific test select the required option s either individually using the arrow keys or as a group using the appropriate function keys Then press Run Th
131. th and absorbance filters is accredited by the United Kingdom Accreditation Service UKAS to an ISO IEC Standard 17025 approved procedure 4 We recommend that you back up the calibration data storage device before use and store the master in a secure location a This section describes how to install and remove the CVC and to set up and operate the device using Local Control Software Follow these steps to load the serial number and calibration data for the CVC into the spectrophotometer s internal memory The first time you run this procedure the message W1022 NVM Checksum is displayed Press ESC to clear the message A 1 Press Home and select Setup 2 Insert the USB memory device that came with the CVC in the USB connector on the front of the spectrophotometer 3 Select CVC and press Enter 4 Press Load Data Spectrophotometer User Guide 145 The instrument loads the serial number and calibration date in the instrument s non volatile memory NVM and displays the values in the Calibration Data section top portion of the CVC Setup screen CVC Setup screen SETUP CVC 25 10 08 16 47 CALIBRATION DATA I l I I i SERIAL NUMBER 32764 d CALIBRATION DATE 03 12 08 I I CAROUSEL i SERIAL NUMBER 32764 d I l I I I l I SETUP LOAD INIT PAGE DATA ALIZE Item Function Calibration Data Calibration data for the
132. the number of characters entered for the year Select an option and press Enter Toggles the power up performance verification option on and off The optional Calibration Verification Carousel CVC must be installed to use this option When this option is On and the CVC is installed the instrument automatically waits on start up for the warm up period 60 minutes and then performs the Wavelength Absorbance and UV Absorbance calibration tests see CVC section Pressing ESC cancels the calibration Default File Type LIMS Support Use Sample IDs Note Selects the default file type that is displayed when you use the Save Rename function to save methods and data DEFAULT FILE TYPE NORMAL CSV JCAMP DX Menu Option Function Normal The native file type used by the Local Control software Note This is the only option available when saving a test file CSV Comma Separated Variable JCAMP DX JCAMP data exchange format Toggles the LIMS Laboratory Information Management System output option on and off When this option is On after each measurement the software automatically exports results methods and sample IDs when selected to the central LIMS computer via the RS232 port Make sure the LIMS interface is connected before you active the LIMS Support option in the software A Sets up automatic sample identification DEFAULT FILE TYPE OFF SEEDED PROMPT USER Spectrophotometer User Guide 123 Me
133. thod Calibrate Function Selects the wavelength at which the source is changed between the tungsten and deuterium lamps Select from 315 320 325 330 335 340 D2 W Note Selecting D2 or W manually overrides the Lamp Change setting and the selected lamp will be used regardless of the wavelength set Note This parameter is not available for the AquaMate Vis Displays the Text Entry screen to enter a user name The user name is automatically saved with the method and any data produced by the method Changing the user name will not cause any current data to be lost Note If User Log on is in operation the user name cannot be changed Description Displays the Results table if it contains results Displays the Standards results table if a calibration has been performed Displays the Save screen which allows the method to be saved to a USB memory device Prints the current method parameters using the selected printer Displays the Calibration screen to perform a calibration if standards and wavelengths have been entered Changing the Measure Stds parameter will cause all previous data to be lost a The current data will be lost if the integration time is changed a The current data will be lost if the lamp change parameters are changed a MCA Standards screen Note When Measure Stds is set to Yes this screen lists the standards for the MCA method Before the system can be calibrated each standard must
134. tings Parallel Rate measurements for up to 7 samples may be made in parallel In this mode MEASURE INTERVAL sets the time between each cycle i e the length of time between successive measurements on the first sample The number of measurements taken on each sample is set by the MEASURE CYCLES parameter The total time over which the measurements are made is the product of the MEASURE INTERVAL and the MEASURE CYCLES For example an analysis using 4 cells with MEASURE INTERVAL set to 15 seconds and MEASURE CYCLES set to 20 seconds would give a total measurement time of 5 minutes Serial Each sample is measured individually In this mode MEASURE TIME replaces MEASURE INTERVAL and sets the total time over which the sample is measured Use this setting when you want the 7 cell changer to behave like a single cell holder When the single cell holder is installed Rate Mode is automatically set to Serial Wavelength Selects a wavelength for measuring the samples Enter a value between 190 nm and 1100 nm or between 325 and 1100nm for the AquaMate Vis If the selected wavelength requires the deuterium lamp the lamp will activate automatically Note Any current data will be lost if the wavelength is changed Bandwidth This parameter is fixed at 2 0 nm Spectrophotometer User Guide 39 Menu Item Measure Time Delay Time Abs Display Graph High Graph Low Slope Range Factor Units Lamp Change 40 Funct
135. to a data point regardless of the displayed scales Pressing Enter places a marker at the current time To delete a marker place the cursor on the marker and press Clear Spectrophotometer User Guide 43 Rescale Absolute Absorbance Relative Absorbance 44 Spectrophotometer User Guide Up to five markers can be placed on the graph Rate results will be reported between markers providing a maximum of four sets of results Sections The minimum Section size is one second Results are listed on the Rate Results screen Selecting Track will remove the Section markers This option displays a pop up menu for changing the graph y axis scale The options available in the menu depend on the current setting for the ABS Display option in the Manipulate menu described above If ABS Display Manipulate menu is set to Absolute Values the Rescale menu has the following options RESCALE AUTO GRAPH HIGH GRAPH LOW Option Function Auto Displays the Rate Graph with the y axis rescaled so that the trace fills the screen Graph High Sets the upper and lower y axis limits for the Rate Graph Low Graph If ABS Display Manipulate menu is set to Relative Values the Rescale menu has the following options RESCALE AUTO RANGE Option Function Auto Displays the Rate Graph with the y axis rescaled so that the trace fills the screen Range Allows the user to set the upper y axis limit ABS Display Smoothing Orig
136. tometer User Guide 15 Parameter Parameter Peak Table Function If Scan Type Standard Mode the allowable data interval is defined by the Standard Mode scan speed setting according to the table below Speed Data interval 3800 10 4 2400 10 4 2 1200 10 4 2 600 10 4 2 1 0 5 240 10 4 2 1 0 5 0 2 120 10 4 2 1 0 5 0 2 30 10 4 2 1 0 5 0 2 10 10 4 2 1 0 5 0 2 1 10 4 2 1 0 5 0 2 Function Selects the type of peak point picking done automatically as part of the method Results are reported on the Peaks screen Peaks information is stored with any saved spectrum Available options include Off Sets Peak Table to Off No peaks information is produced as part of the scan Peaks Picks the highest peaks in a spectrum up to a maximum of 10 peaks Valleys Picks the lowest valleys in a spectrum up to a maximum of 10 valleys Pks amp Valleys Picks the 5 highest peaks and the 5 lowest valleys Zero Cross Picks all the points where the spectrum crosses zero up to a maximum of 10 crossing points Track Allows the data values to be reported at up to 10 user selected wavelengths Ratio Allows you to specify a ratio A1 A2 to be automatically calculated at the end of the scan Enter each wavelength at the prompt and press Enter Corr Ratio Allows you to specify the ratio of two wavelengths to be calculated relative to a third wavelength A Ag A2 All at the end of a scan Enter th
137. ts Anionic f 0 80 mg l mg l Cl mg l O mg l Cr Cer ag GOD G gt e es Spectrophotometer User Guide 98 mg l Fe 11 mm Round LCK 321 K321CT FXD mg l Fe II 11 mm Round LCK 320 K320CT FXD am 0 02 1 0 mg l mell Mn 50 mm Rectangular LCW 032 W032P50 FXD 0 2 5 0 mg l mg l Mn 10 mm Rectangular LCW 032 W032P10 FXD 0 05 1 0 mg l mg l Ni 50 mm Rectangular LCK 537 K537P50 FXD Fo H E gt E S E 6 zZ mg l Fe 0 02 2 50 mg l DNH 11 mm Round LCK 304 K304CT FXD 0 015 2 0 mg l NH amp N 1 3 15 0 mg l NH4 11 mm Round LCK 305 K305CT FXD 1 12 mg l NH4N 2 5 60 0 mg l NH 11 mm Round LCK 303 K303CT FXD 2 47 mg l NH N 60 167 mg l NH 11 mm Round LCK 302 K302CT FXD 47 130 mell NH N Nitrogen Nitrate 1 60 mg l NO 11 mm Round LCK 339 K339CT FXD 0 23 13 50 mg l JNO3 N 22 155 mg l NO 11 mm Round LCK 340 K340CT FXD 5 35 mg l NO N Nitrogen Nitrite 0 NO 11 mm Round LCK 341 K341CT FXD 0 NO N 50 mm Rectangular LCK 341 K341P50 FXD 11 mm Round LCK342 K342CT FXD Nitrogen Total Kjeldahl 11 mm Round pech oos 5omgi Phenol it mm ound ios Keescrxp Organic Complexing Agents 11 mm Round W907CT FXD 0 1 6 0 mg l mg l Ni 11 mm Round LCK 337 K337CT FXD I O z V e 6 Z S S V e al S Spectrophotometer User Guide 99 Program AquaMate File Name 5 90 mg l PO 11 mm Round LCK 049 K049CT FXD 1 6 30 0 mg l 3 7 70 0 mg
138. turns the previous screen Accept Accepts the text and returns to the previous screen Clears the last character in the text string Saving and renaming methods and data Saving a method 10 Spectrophotometer User Guide The Save screen appears in many places in the Local Control software The options available on the Save screen depend on the type of data being saved method or data To save a method display the method parameters screen and press Save Method The Save screen is displayed l SAVE i i TYPE M SCAN FILENAME SCN SMART START NO TEST NAME DRIVE LIBRARY I L CANCEL SAVE Save screen for saving methods Item Function Type This field is assigned by the software depending on the type of method being saved Filename This field is selected automatically when you first enter the Save screen Use the simulated keyboard or the numeric keypad to enter up to 8 characters for the filename and then press Accept See Text Entry screen for details Item Function Smart Start Selects whether the file will be displayed on the start up screen Press Enterto toggle the Smart Start setting between Yes and No When one or more files are selected for display on the start up screen the start up screen appears when the instrument is turned on instead of the default Home screen Press Home to see the new start up screen From the start up screen press Genera Test
139. u can also enable or disable automatic calibration verification LIMS Laboratory Information Management System output and the UVcalc application These parameters are described in more detail below ENVIRONMENT I LANGUAGE ENGLISH SOUND OFF DATE FORMAT dd MM yy AUTOMATIC CAL VAL OFF DEFAULT FILE TYPE NORMAL LIMS SUPPORT OFF USE SAMPLE IDS OFF AUTOSAVE RESULTS OFF AUTOPRINT RESULTS OFF USER LOG ON OFF HISTORY FILE OFF SETUP HISTORY PAGE FILE Spectrophotometer User Guide 121 Language Sound Date Format Automatic Cal Val 122 Spectrophotometer User Guide Function key Description History File Appears only when the History File option is enabled Change Users Appears only when User Log On is enabled and is available only to the system administrator UVcalc Off Appears only when the UVcalc application is installed Disables UVcalc and re enables functions that UVcalc disables Setup Page Displays the Setup screen Sets the language used on the display A pop up menu lists the available languages Select an option and press Enter The language used immediately changes to the one selected Toggles the audio warning on and off When Sound is set to Off error conditions are indicated by on screen messages only Sets the date format A pop up menu lists the available formats depending on whether the day or month is entered first and
140. uant Results screen if sample results exist for this method Quant Page Displays the Quant screen Edit Std appears Allows you to specify whether each standard will be used after calibration ignored or re measured Edit Curve Allows you to change the curve fit appears after calibration Quant Standards function keys Quant Calibration screen Press Zero Base to zero the instrument with the current method To start the calibration display the Quant Method screen and press Calibrate The Quant Calibration graph is displayed and the instrument prompts for each standard and replicate in turn As the measurements of the standards proceed the data points are marked on the graph When all the standards have been measured the system calculates the equation rescales the graph and then draws and displays the line of best fit on the graph To stop the calibration press Stop The calibration is aborted and the software returns to the Quant Standards screen Any values obtained are lost Spectrophotometer User Guide 35 Note Quant Results screen 36 Spectrophotometer User Guide Press Run to start the first sample measurement The sample results appear automatically on the Quant Results screen If you press Run before the calibration step is completed the message CANNOT RUN WITHOUT CALIBRATION is displayed Press ESC to clear the error message A Function key Description View Results Displays the Quant Res
141. uent scans until you removed it To remove the reference select Manipulate and then Original or load a new method To change the format of the displayed spectrum choose an option below Menu option ABS T 1D 2D 3D Function Absorbance Transmittance First derivative records the first derivative of the Absorbance spectrum Second derivative records the second derivative of the Absorbance spectrum Third derivative records the third derivative of the Absorbance spectrum Peaks menu Menu option Function 4D Fourth derivative records the fourth derivative of the Absorbance spectrum This option enables the spectrum to be automatically searched for peaks valleys or zero crossing points To perform a search select an option in the menu below and press Enter FUNCTION PEAKS VALLEYS PKS amp VALLEYS ZERO CROSS RATIO CORR RATIO PK HEIGHT When the search is complete the spectrum is displayed with the peak positions marked For a peak to be found there must be more than 15 data points between that point and a previous peak The menu options are explained below For Ratio and Corr Ratio enter the wavelengths as prompted All results can be viewed by pressing View Results Menu Option Function Peaks Marks the 10 highest peaks Valleys Marks the 10 lowest valleys Pks amp Valleys Marks the 5 highest peaks and the 5 lowest valleys Zero Cross Marks the first 10 zero crossings
142. ular Weight x 10 Extinction Coefficient Tm 2 A T or U 4 G C Tm 81 5 16 6logio M 1 0 7 M 0 41 GC 500 L P 0 63 form Displayed Units Length of bases Percentage Molecular weight x daltons M Extinction coefficient M cm g mL C C Spectrophotometer User Guide 169 Calculation Name Entry Parameters Formula Displayed Units Calculation of Tr units A units T units G units Tm 67 16 6logio M SE C units U DNA RNA hybrids 1 0 7 M 0 8 GC 500 L P M molarity of Na 0 5 form U ot form GC percentage of G and C form formamide in the solution L of base pairs P mismatching Calculation of Tr units A units G units C Tm 78 16 6logio M 1 0 7 M C f units U 0 7 GC 500 L P 0 35 form RNA RNA hybrids M molarity of Na GC percentage of G and C form formamide in the solution L of base pairs P mismatching Conversion from conc concentration ug ml pmol ul conc x 1000 mol wt pmol l ug ml to pmol pl mol wt sequence molecular weight 170 Spectrophotometer User Guide
143. ults screen if sample results exist for this method Quant Page Displays the Quant screen Standards Displays the Standards screen Print Graph Prints the Quant method and calibration graph Save Method Calibrate function keys Results are numbered sequentially up to 600 samples per batch Use the up down arrow keys to display the previous or next page of results Press Run to take another sample measurement The results are displayed automatically Function key Description Clear Results Deletes all data from the Quant Results table Quant Page Displays the Quant screen Save Data Displays the Save screen Print List Prints the Quant Results using the selected printer LIMS Export Sends the results via the RS 232 port Quant Results function keys Rate Select the Rate application on the Home screen to measure absorbance at one wavelength over a period of time Use the Rate Method screen to set data collection and analysis parameters When you are ready to analyze the first sample press Zero to zero the instrument Then place the sample cell in the sample holder and press Run The spectrophotometer performs the measurements and displays the result on the Rate Graph screen From there the spectrum can be manipulated and saved to a Library or USB memory device Spectrophotometer User Guide 37 Rate Method screen Use this screen to set instrument and analysis parameters for measuring and reporting absorbance value
144. ursor Rescale Changes x and y axis scales automatically or manually Compare Loads a reference spectrum for comparison Mode Defines the format of the collected and displayed data Select from 96T ABS 1D 2D 3D 4D Peaks Finds spectral peaks Select from Peaks Valleys Peaks amp Valleys Zero Cross Ratio Corr Ratio Pk Height Smoothing Applies Low Medium or High modified improved Savitsky Golay smoothing to the spectrum Original Resets the graph to display the data as originally collected Track Track graph function keys Rescale This option displays the tracking cursor crosshairs which can be used to select up to 10 x axis locations to be measured and reported To mark a wavelength move the cursor to the desired location and press Enter The cursor always moves to a data point regardless of the displayed scales Press View Table to see a table of measured values for the selected locations If you exit the Track graph the markers will be deleted Function key View Table Fast Slow Clear All Print Graph Scan Graph Description Displays the Track Table which lists the measured value at each selected wavelength Toggles between two cursor speeds In Fast mode the cursor jumps 5 of the graph or to the next data point whichever is greater In Slow mode the cursor jumps to the next data point or the next display pixel whichever is greater The function key label shows the deselected
145. wavelengths have been marked press Accept to accept the list and return to the MCA Methods screen Wavelengths can be selected either from a scan of the mixture to be analyzed or by performing a scan on each standard in turn and selecting suitable wavelengths Wavelengths already entered in the table are shown on the Scan Graph Function key Description Accept Accepts any changes made to the Wavelength list and displays the MCA Methods screen Fast Slow Toggles between two cursor speeds In Fast mode the cursor jumps 5 of the graph or to the next data point whichever is greater In Slow mode the cursor jumps to the next data point or the next display pixel whichever is greater Clear All Clears all marks Rescale Rescales the x and y axes so that the spectrum fills the screen MCA Wavelengths function keys 52 Spectrophotometer User Guide MCA Calibration screen Notice Analyzing a sample Before you calibrate use the MCA Standards screen to define the standards and the MCA Wavelengths screen to specify the wavelengths to be measured When you are ready clear the beam s and press Zero Base to perform a baseline scan To start the calibration display the MCA Method screen and press Calibrate If the results from a previous calibration are displayed you will be given the option to proceed or cancel If you select Proceed the previous data will be lost a Press Enter to start the calibration The message

Download Pdf Manuals

image

Related Search

Related Contents

取扱説明書 - 高須産業  User Manual For In Vitro Diagnostic Use Only ED-0216  Philips Ecomoods Wall light 16928/93/16  CONGRATULAÇÕES    取扱説明書  

Copyright © All rights reserved.
Failed to retrieve file