User Guide
Contents
1. Figure 4 Bioanalyzer traces of RTL synthesized SENSE libraries purified with varying combinations of CBS and CBL Dark blue trace 120 pl CBS 40 pl CBL green trace 80 pI CBS 80 pl CBL light blue trace 40 pI CBS 120 pl CBL red trace 160 pl CBL LEXOGEN mRNA Seq Library Prep Kit User Guide 23 10 Appendix D Multiplexing SENSE libraries can be multiplexed Barcodes can be introduced as standard external barcodes during the PCR amplification step or as in line barcodes at the beginning of each read during the RT ligation step External barcodes require a separate sequencing reaction whereas in line barcodes do not External barcodes External barcodes can be introduced during library amplification with the SENSE External Bar code Kits Cat No 003 08 or 003 24 12 barcodes sets A H allowing up to 96 samples to be sequenced per lane on an Illumina flow cell In contrast to in line barcodes where the bar code is located at the beginning of both the forward Read 1 and reverse read Read 2 SENSE external barcodes require an additional index specific sequencing reaction To generate libraries with external barcodes replace the PCR mix PCR used during library amplification step p 15 with one of the PCR mixes PCRO1 96 supplied in the SENSE external barcode kits A H External barcodes are 6 nt long External External External External External External External Exte2. LEXOGEN mRNA Seq Library Prep Kit User Guide 5 Detailed Protocol 5 1 Poly A Selection Preparation Aliquot and Wash Beads Denature RNA Hybridize mRNA MB thawed at RT Total RNA thawed on ice BW stored at RT HYB thawed at RT H O thawed at RT BW stored at RT Magnetic rack Thermocycler 60 C1 min Thermomixer set to 25 C 25 C hold 1 250 rpm Aliquot and Wash Beads SENSE uses Magnosphere MS150 oligodT beads from JSR Life Sciences The magnetic beads must be washed before use All steps are performed at room temperature Mix the beads MB 0 well Transfer 10 ul of the resuspended beads per library prepara tion into a new 1 5 ml tube Beads can be washed as a batch if multiple library prepara tions are required Place the tube in a magnetic rack and let the beads collect for 2 minutes Remove and discard the supernatant with a pipette while the tube remains in contact with the mag net Remove the tube from the magnetic rack and add 200 ul bead wash buffer BW per library preparation Resuspend the beads and transfer the tube to the magnetic rack Let the beads collect for 1 minute remove and discard the supernatant Repeat this washing step once for a total of two washes Resuspend the beads in 10 ul RNA hybridization buffer HYB per library preparation Pipette and mix carefully to avoid introducing air bubbles Denature RNA RNA samples are briefly heated to resolve secondary st
3. Library Quality Control 22 Appendix D Multiplexing 0 0 0 0 ce ee ee 24 Appendix Sequencing 0 ee 28 Appendix F DGLGIANGIYSIS cc 2 ead ae ow ea yea OED 31 Appendix G Revision History o 33 MOLES a i ak eee ale a ario a a o a E a 34 LEXDOEN Enabling complete transcriptome sequencing 1 Overview This SENSE mRNA Seq kit is an all in one library preparation protocol designed to generate Illumina compatible libraries from total RNA within 4 hours The SENSE protocol maintains strand specificity gt 99 9 and allows the mapping of reads to their corresponding strand on the genome enabling the discovery and quantification of antisense transcripts and overlapping genes SENSE includes an integrated poly A selection so prior rRNA depletion is not required Insert size can be varied during the library preparation protocol itself meaning that size selec tion with additional kits is not necessary Optional multiplexing of libraries can be carried out using up to 12 in line barcodes or up to 96 external barcodes Libraries are compatible with both single end and paired end sequencing reagents The SENSE protocol consists of a highly specific bead based poly A selection step which removes almost all traces of rRNA tRNA and non polyadenylated RNA Information regarding input RNA requirements can be found in Appendix A p 18 Library production is initiated by the random hybridizat
4. alignment files are used to model the transcriptome and assess transcript abun dance Further analyses are experiment specific and can include differential expression differ ential splicing and promoter usage 32 LEXOGEN mRNA Seq Library Prep Kit User Guide 13 Appendix G Revision History July 31 2013 Improved beads MS150 oligodT beads JSR Life Sciences 11 Less viscous storage solution for beads same bead amount but reduced vo 11 lume and fewer pre washes 2 now instead of 3 qPCR to determine the exact cycle number of your endpoint PCR more E2 18 Fewer cycles recommended due to improved efficiency 21 Explanation of high molecular weight peak in bioanalyzer traces 22 Use Illumina Sequencing Primer for non barcoded and externally barcoded 28 29 SENSE libraries LEXOGEN mRNA Seq Library Prep Kit User Guide 33 14 Notes 34 LEXOGEN mRNA Seq Library Prep Kit User Guide LEXOGEN mRNA Seq Library Prep Kit User Guide 35 LEXDGOEN Enabling complete transcriptome sequencing mRNA Seq Library Prep Kit User Guide Lexogen GmbH Campus Vienna Biocenter 5 1030 Vienna Austria Telephone 43 0 1 345 1212 Fax 43 0 1 345 1212 99 E mail info lexogen com Lexogen 2013
5. the tube in a magnetic stand The time required for complete separation will vary depending on the strength of your magnets tube thickness viscousity of the solution and the proximity of the tube to the magnet Separation time may need to be adjusted accordingly When fully separated the supernatant should be completely clear and the beads collected at one point or line on the wall of the tube To remove the supernatant the tube containing the beads has to stay in close contact with the magnet Do not remove the tube from the magnetic stand when removing the superna tant as the absence of the magnet will cause the beads to go into solution again In general beads should not be centrifuged during the protocol However should liquid LEXOGEN mRNA Seq Library Prep Kit User Guide condense e g after step O or become entrapped in the cap or drops of fluid stay on the side of the reaction tube centrifugation at 2 000 x g for 30 sec should be carried out before placing the tube on the magnetic rack Allowing the beads to dry out can damage them Always keep the beads in suspension except for the short period after withdrawing the supernatant but before adding the next reagent Beads can be resuspended by vortexing but make sure that beads are not depo sited on the tube walls above the level of the liquid where they can dry during incubation If necessary stuck beads can be collected by centrifuging the tube briefly with a benchtop centrifu
6. 0 series for the 2100 Bioanalyzer Agilent Technologies Inc although RNA quality can also be assessed with denaturing agarose gel elec trophoresis if such a device is not available Most microfluidics platforms will carry out an auto mated peak analysis and generate a quality score RIN or RON and we recommend a RIN score of 8 or greater for optimal sequencing results Typically such samples have easily detectable rRNA peaks and a comparatively low abundance of short RNAs which can arise from both intact short transcripts as well as from RNA degradation Libraries can also be generated from lower quality RNA but this may lead to 3 bias in sequencing results Potential contaminants RNA samples should be free of salts metal ions and organic solvents which can be carried over from RNA extraction Several sources of contamination can be detected with a UV Vis spec trophotometer An acceptably pure RNA sample should have an A260 A280 ratio between 1 8 and 2 1 The A260 A230 ratio should also be approximately 2 Several common contaminants including proteins chaotropic salts and phenol absorb strongly between 220 and 230 nm and can often be identified as peaks in this region Contamination with any of these generates a ower A260 230 ratio Phenol also has an absorption maximum between 250 and 280 nm which overlaps that of nucleic acid so high 230 nm absorbance combined with a biphasic or broad peak between 250 and 280 nm may indicate contamina
7. 0 ul CBS centrifuge 1 min add 200 ul CW centrifuge 1 min repeat once exchange collection tube centrifuge 2 min exchange collection tube with 1 5 ml tube add 15 ul EB to column incubate 1 min at RT centrifuge 2 min PCR Purification LEXOGEN mRNA Seq Library Prep Kit User Guide 17 7 Appendix A RNA Requirements PCR Cycles RNA amount High quality mRNA Seq data relies on high quality input RNA The amount of total RNA required for SENSE depends on the poly A RNA content of the sample in question This protocol was tested extensively with various mouse tissues and human reference RNA Typical inputs of 500 ng total RNA for mRNA rich tissues such as kidney liver and brain or 2 ug total RNA for tissues with lower mRNA content such as lung and heart generate high quality libraries for single end 50 nt sequencing SR50 with 8 cycles of library amplification For other library sizes PCR cycles need to be adjusted as described in the table of Appendix B p 21 The input requirements for your particular experiment may be different and we have included extra reagents for library amplification and purification to assist with optimization If RNA input is not sufficient either due to naturally low poly A RNA content or degraded RNA additional cycles of library amplification may be necessary However as additional cycles of library am plification may increase the proportion of PCR duplicates it is more desirable to incre
8. CBS CBL mixture used in steps 23 and 26 Please refer to the table in Appendix B p 21 LEXOGEN mRNA Seq Library Prep Kit User Guide 15 Purification The finished library is purified from PCR components that can interfere with quantification Add 160 ul of column binding buffer CBS to the reaction mix well and transfer the solution to a column placed in a 2 ml collection tube Centrifuge for 1 minute at 12 000 xgat 18 C Apply 200 ul of column wash buffer CW to the column and centrifuge for 1 minute Repeat this washing step once for a total of two washes Remove the column and transfer to a fresh collection tube Centrifuge for 2 minutes at 12 000 x g at 18 C to dry the column Transfer the column to a new 1 5 ml tube and apply 15 ul elution buffer EB to the column Incubate at room temperature for 1 minute and centrifuge for 2 minutes at 12 000 x g at 18 C to elute the library At this point the libraries are finished and ready for quality control Appendix C p 22 pooling for multiplexed SENSE libraries see Appendix D p 24 and cluster generation 60 00 16 LEXOGEN mRNA Seq Library Prep Kit User Guide 6 Short Procedure 60 min Poly A Selection DO 200000 wash 10 ul beads 2 times with 200 ul BW resuspend beads with 10 ul HYB dilute 500 ng to 2 pg total RNA in 10 pl with H O incubate for 1 min at 60 C hold at 25 C add RNA 10 ul to be
9. Index Read Sequencing Primer 3 Insert Index2 AGAMCGGAAGAGCACACGTCTGAACTCCAGTCAC Index 1 ATCTCGTATGCCGTCTTCTGCTTG 3 Insert index2 TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG Index 1 TAGAGCATACGGCAGAAGACGAAC 5 3 Read 2 Sequencing Primer 5 Read 1 Multiplexing Read 1 Sequencing Primer not supplied 5 ACACTCTT TCCCTACACGACGCTCTTCCGATCT 3 Index Read Multiplexing Index Read Sequencing Primer not supplied 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCAC 3 Read 2 Multiplexing Read 2 Sequencing Primer not supplied 5 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3 30 LEXOGEN mRNA Seq Library Prep Kit User Guide 12 Appendix F Data Analysis This section describes a basic bioinformatics workflow for the analysis of SENSE NGS data and is kept as general as possible for integration with your standard pipeline In contrast to most other library preparation protocols SENSE libraries generate reads in a strand orientation opposite to the genomic reference Reads must be re oriented during data processing either by conver sion into their reverse complement before mapping or by inverting the directionality flag in the alignment files after mapping Processing raw reads We recommend the use of a general fastq quality control tool such as FastQC or NGS QC Toolkit to examine the quality of the sequencing run These tools can also identify over represented sequences which may optionally be removed from the dataset n order to reduce t
10. PCR96 GCCACA TCGAGG ATGAAC GACATC ATGGCG GCATGG ATTGGT ATATCC In general we recommend using a complete set of 12 barcodes for multiplexing e g PCRO1 12 or PCR13 24 and so on However if fewer barcodes are required also subsets of each set can be chosen 24 LEXOGEN mRNA Seq Library Prep Kit User Guide When choosing subsets of barcodes it is important to make sure that both color channels used by Illumina platforms red laser A C and green laser G T register a signal at each nucleotide position Listed below are some examples for subsets of barcodes Two samples per lane Replace the standard 8 ul PCR mix with 4 ul PCRO1 and 4 ul PCRO2 for one sample and 4 ul PCRO3 and 4 ul PCROA for the second Here two barcodes are applied to each sample in order to balance the red and green laser signals Four samples per lane Replace the standard PCR mix with PCRO1 for one sample PCRO2 for the second PCRO3 for the third and PCRO4 for the fourth Apply only one PCR mix to each sample Eight samples per lane Replace the standard PCR mix with PCRO1 through PCRO8 Apply only one PCR mix to each sample Twelve samples per lane Replace the standard PCR mix with PCRO1 through PCR12 Apply only one PCR mix to each sample Barcodes can also be combined across sets For example the first barcode of sets A B C D E F G and H can be combined in a lane mix i e PCRO1 PCR13 PCR25 PCR37 PCR49 PCR61 PCR73 and PCR85 the second bar
11. Set the thermomixer to 37 C and incubate for one hour with 1 250 rpm agitation Apply 100 ul bead wash buffer BW to the RT ligation reaction and mix thoroughly Col lect the beads with a magnetic rack for 2 minutes remove and discard the supernatant Apply 100 ul bead wash buffer BW to the beads and resuspend by pipetting or vortex ing gently Collect the beads with a magnetic rack remove and discard the supernatant After removing the supernatant from the second wash resuspend the beads in 10 ul RNase free water H O 0 LEXOGEN mRNA Seq Library Prep Kit User Guide 13 Second Strand Synthesis During this step the library is converted to dsDNA and is freed from the hybridized RNA by both the hydrolysis ofthe RNA and the second strand synthesis reaction itself Transfer the resuspended beads to a PCR tube or plate containing 9 ul second strand synthesis mix SSM O Add 1 ul enzyme mix 2 E2 O and mix well Conduct one cycle of thermocycling with the following program 98 C for 90 seconds 65 C for 60 seconds 72 C for 5 minutes hold at 25 C Purification The double stranded library is column purified to remove the magnetic beads and second strand synthesis reaction components ATTENTION Two different column binding buffers CBS and CBL are provided to further refine library size during column purification For appropriate mixing of CBS and CBL please consult Appendix B Adjusting Library Siz
12. _LESOGEN Enabling complete transcriptome sequencing S NSE Making sense of RNA sequencing mRNA Seq Library Prep Kit User Guide Catalog N umbers 001 08 001 24 002 08A In line Barcode Kit for Illu 002 24A 003 08A n line Barcode Kit for Illu 003 24A Publication Number 4 Revision Date July 31 2013 IRNA Seq Library Prep Kit For Illumina 8 rxn IRNA Seg Library Prep Kit for Illumina 24 rxn lina 8 rxn barcode 12 barcodes lina 24 rxn barcode 12 barcodes External Barcode Kit for Illumina 8 rxn barcode 12 barcodes sets A H External Barcode Kit for Illumina 24 rxn barcode 12 barcodes sets A H FOR RESEARCH USE ONLY NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE FORMATION IN THIS DOCUMENT IS SUBJECT TO CHANGE WITHOUT NOTICE Lexogen does not assume any responsibility for errors that may appear in this document PATENTS AND TRADEMARKS The SENSE RNA Seq kits are covered by issued and or pending patents SENSE is a trademark of Lexogen Lexogen is a registered trademark EU CH USA lumina is a registered trademark of Illumina Inc RNasin is a trademark of Promega Corporation RNaseZap is a registered trademark of Ambion Inc Agilent is a registered trademark of Agilent Technologies Inc Bioanalyzer is a trademark of Agilent Technologies Inc Thermomixer is a registered trademark of Eppendorf AG agnosphere MS150 oligodT
13. ads 10 ul incubate for 20 min at 25 C 1 250 rom wash 2 x for 5 min at 25 C 1 250 rpm with 100 pl BW withdraw supernatant 120 min Aliquot and Wash Beads Denature RNA Hybridize mRNA Library Generation O Ja goog O am n add 15 ul RTS or RTL see p 21 and resuspend beads add 2 ul ST and incubate for 5 min at 25 C 1 250 rpm add 3 pl El and incubate for 2 min at 25 C 1 250 rpm raise temp to 37 C and incubate for 1 h 1 250 rpm wash twice with 100 uL BW resuspend beads with 10 ul H O add 9 ul SSM and 1 pl E2 incubate 98 C 90 sec 65 C 60 sec 72 C 5 min add ul CBS and ul CBL see p 21 apply to column centrifuge 1 min exchange collection tube with 1 5 ml tube add 20 ul EB to column incubate 1 min at RT centrifuge 2 min add ul CBS and ul CBL to eluate reload onto same column transfer column into collection tube centrifuge 1 min add 200 ul CW centrifuge 1 min repeat once transfer column into a fresh collection tube centrifuge 2 min exchange collection tube with 1 5 ml tube add 13 ul EB to column incubate 1 min at RT centrifuge 2 min 60 min Reverse Transcription and Ligation 2 4 Strand Synthesis Purification Library Amplification DO add 8 ul PCR and 2 ul E2 mix PCR 98 C for 30 sec 98 C for 10 sec 65 C for 20sec gt 8 10x 72 C for 30sec e 72 Cior2min 10 C hold add 16
14. amples per lane Replace the standard ST with ST1 through T12 Apply only one ST to each sample When multiplexing less than 12 samples per lane it is also possible to assign a specific set of bar codes to each lane mix in which case sequencing results can be unequivocally associated with their corresponding biological samples regardless of miscommunications or mix ups between lanes while sequencing Various multiplexing options are available depending on your experi mental design but care should be taken to always use complete sets of four barcodes and that the individual libraries within a set of four barcodes are mixed in an equimolar ratio 26 LEXOGEN mRNA Seq Library Prep Kit User Guide Starter Stopper Barcode Heterodimer Sr None sr CTACG sT2 AACGT STe GCTTC ST4 TGGAA ST5 TTCAG ST6 GAGGA Si ACTCT ST8 CGATC STO TGCGC ST10 GATCG sn1 ATAAT ST12 CCGTA included in basic SENSE kit Dual barcodes External barcodes can also be combined with internal barcodes to allow up to 1152 samples to be multiplexed To prepare dual indexed libraries substitute the starter stopper heterodimer mix ST e delivered with the standard kit for those in the SENSE internal barcoding kit ST1 12 e as described in the above section for internal barcoding The internal barcode will be located at the beginning of the forward and reverse reads To add the external barcode substitute the library amplification mix PCR delivered with
15. arcodes Libraries without barcodes Here the standard starter stopper heterodimer mix ST and the standard PCR mix PCR supplied with the basic kit Cat No 001 08 001 24 is used 5 Read 1 Sequencing Primer 3 OR 5 Customized Sequencing Primer 3 5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTG Insert 3 TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAC Insert Insert AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCTCGTATGCCGTCTTCTGCTTG 3 Insert TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGTAGAGCATACGGCAGAAGACGAAC 5 3 Read 2 Sequencing Primer 5 For Read 1 it is recommended to use Multiplexing Read 1 Sequencing Primer Optionally the Customized Sequencing Primer can be used ATTENTION Be aware that PhiX spike in is not possible when using CSP Do not use a mixture of primers such as Multiplexing Read 1 Sequencing Primer and Customized Sequencing Primer Read 1 Multiplexing Read 1 Sequencing Primer not supplied 5 ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3 OPTIONAL Read 1 Customized Sequencing Primer supplied as CSP 100 uM 5 ACACTCTTTCCCTACACGACGCTCTTCCGATCTG 3 Read 2 Multiplexing Read 2 Sequencing Primer not supplied 5 GTGACTGGAGTTCAGACGTGTGCTETTCCGATCT 3 28 LEXOGEN mRNA Seq Library Prep Kit User Guide Libraries with external barcodes External barcodes 6 nt are introduced during PCR step 3 The standard PCR mix PCR O sup plied with
16. ase the amount of input RNA if possible for your application rather than to rely on extra PCR cycles to increase library yield As a starting point we recommend performing the protocol initially with 500 ng or 2 ug of total RNA according to the expected poly A content After purifying the second strand synthesis re action p 14 elute with 23 ul elution buffer EB O instead of 13 ul To determine the exact cycle number needed for your endpoint PCRs you have two options Option qPCR to determine the exact cycle number of your endpoint PCRs nsert 10 ul of the eluted 23 ul double stranded library step O into a qPCR reaction Simply add SYBR Green or an equivalent fluorophore to the PCR reaction to a final concentration of 1x For SYBR Green use 1 pl of a 1 500 SYBR Green dilution diluted in DMSO The total PCR reaction volume will be 21 ul SYBR Green has an emission maximum at 520nm which for some qPCR machines has to be adjusted manually Overcycle this initial qPCR 20 cylces or even more if little input material was used and then determine the fluorescence value at which the fluorescence reaches a plateau Calculate where the fluorescence is at 25 from the maximum and this is the cycle number you should use for the endpoint PCR using the second half of the template The SENSE kit is provided with enough PCR Mix and E2 to perform 2 PCR reactions for each library There is no need to purify or analyze the ove
17. barcodes In line barcodes are 5 nt long present on both sides of the insert and compose the first nucleo tides of Read 1 and Read 2 These barcodes are introduced during reverse transcription and ligation step the standard starter stopper heterodimer mix ST supplied with the basic kit is replaced by the starter stopper heterodimer mixes ST e supplied with the in line barcode kit Cat No 002 08 A 002 24 A No separate read out of the index is required 5 Read 1 Sequencing Primer 3 5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT Index Insert 3 TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA Index Insert Insert Index AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCTCGTATGCCGTCTTCTGCTTG 3 Insert Index TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGTAGAGCATACGGCAGAAGACGAAC 5 3 Read 2 Sequencing Primer 5 Read 1 Multiplexing Read 1 Sequencing Primer not supplied 5 ACACTCTT TCCCTACACGACGCTCTTCCGATCT 3 Read 2 Multiplexing Read 2 Sequencing Primer not supplied 5 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3 Libraries with dual barcodes For dual barcoding both external barcodes Index 1 and in line barcodes Index 2 are com bined This way up to 1152 libraries can be multiplexed IRSA Seguencing Priner su 5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT Index 2 Insert 3 TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA Index 2 Insert 5
18. beads are a trademark of JSR Life Sciences All other brands and names contained in this user guide are the property of their respective owners Lexogen does not assume responsibility for violations or patent infringements that may occur with the use of its products LIABILITY AND LIMITED USE LABEL LICENSE RESEARCH USE ONLY This document is proprietary to Lexogen The SENSE mRNA Seq kits are intended for use in research and development only They need to be handled by qualified and experienced personnel to ensure safety and proper use Lexogen does not assume liability for any damage caused by the improper use or the failure to read and explicitly follow this user guide Furthermore Lexogen does not assume warranty for merchant ability or suitability of the product for a particular purpose The purchase of the product does not convey the right to resell distribute further sublicense repackage or modify the product or any of its components This document and its contents shall not be used or distribu ed for any other purpose and or otherwise communicated disclosed or reproduced in any way without he prior written consent of Lexogen For information on purchasing additional rights or a license for use other than research please contact Lexogen WARRANTY Lexogen is committed to providing excellent products Lexogen warrants that the product performs to the standards described in this user guide for a period of up to six months f
19. code of each set i e PCRO2 PCR14 PCR26 PCR38 PCR50 PCR62 PCR74 and PCR86 can also be combined and so on f multiplexing fewer than 12 samples per lane it is also possible to assign a specific set of bar codes to each lane mix in which case sequencing results can be unequivocally associated with their corresponding biological samples regardless of miscommunications or mix ups between anes while sequencing Various multiplexing options are available depending on your experi mental design but care should be taken to always use sets of barcodes which give a signal in both lasers for each nucleotide position at least one of the bases A or C in the red channel AND one of the bases G orT in the green channel Furthermore the individual libraries within a lane should be mixed in an equimolar ratio to ensure this balance LEXOGEN mRNA Seq Library Prep Kit User Guide 25 In line barcodes n line barcodes can be introduced during library preparation with the SENSE In line Barcode Kit Cat No 002 08 or 002 24 allowing up to 12 samples to be sequenced per lane on an Illumina flow cell Indexing is performed by replacing the starter stopper heterodimer ST used during everse transcription and ligation step O p 13 with starter stopper mixes supplied with the barcode kit ST1 through ST12 9 Barcodes are 5 nt long and compose the first nucleotides of the read Due to the starter stopper heterodimer design both the forward a
20. dard Illumina pipeline LEXOGEN mRNA Seq Library Prep Kit User Guide 31 Trimming As SENSE is based on random priming there may be a higher proportion of errors at the first nucleotides of the insert due to non specific hybridization of the starter stopper heterodimer to the RNA These mismatches can lead to a lower percentage of mappable reads when using a stringent aligner in which case it may be beneficial to trim these nucleotides Trimming can be done with the same work flow for both reads in a paired end dataset The first seven nucleotides need to be removed from Read 1 starter side while on the stopper side it is only six nucleotides Read 2 If the Customized Sequencing Primer CSP was used only six nucleotides need to be removed from both reads Read 1 and 2 While trimming the first nucleotides introduced by the starter stopper can decrease the num ber of reads of suitable length the absolute number of mapping reads usually increases due to the improved read quality Reads which are too short or have generally low quality scores should be removed from the set Alignment At this point the filtered and trimmed reads can be reverse complemented and aligned with a short read aligner to the reference genome or assembled de novo Alternatively reads can be mapped first without conversion to the reverse complement and then the directionality flag in the alignment files can be inverted Transcriptome modeling The resulting
21. e p 21 Add a total of 160 ul column binding buffer x ul CBS and y ul CBL see Appendix B p 21 to the reaction mix well and transfer the solution to a purification column placed in a 2 ml collection tube Centrifuge for 1 minute at 12 000 x g at 18 C Transfer the purification column into a new 1 5 ml tube Do not discard the collection tube Apply 20 ul elution buffer EB to the column Incubate at room temperature for 1 minute and centrifuge for 2 minutes at 12 000 x g at 18 C to elute the library Add a total of 160 ul column binding buffer same mix as used in step 23 x ul CBS and y ul CBL see Appendix B p 21 to the eluted 20 ul mix well and reload the solution onto the same purification column Place the purification column back into in the original collection tube Centrifuge for 1 minute at 12 000 x g at 18 C Apply 200 ul of column wash buffer CW to the column and centrifuge for 1 minute at 12 000 x g at 18 C Repeat this washing step once for a total of two washes Transfer the column to a fresh collection tube Centrifuge for 2 minutes at 12 000 x g at 18 C to dry the column e 8 O 14 Transfer the column to a new 1 5 ml tube and apply 13 ul elution buffer EB O to the col umn Incubate at room temperature for 1 minute and centrifuge for 2 minutes at 12 000 LEXOGEN mRNA Seq Library Prep Kit User Guide x g at 18 C to elute the library ATTENTION If a
22. erts Additionally the desired library size can be further fine tuned by varying the ratio of short CBS to long CBL binding buffer in steps O ard O Please refer to the table below to see which column binding buffer CBS CBL and mixtures thereof is appropriate for your desired read length The required volumes of CBS and CBL can be added directly to the sample after second strand synthesis The ul listed refer to the volumes needed per sample to be purified Depending on your selected insert range the number of PCR cycles during library amplification varies slightly from 8 to 10 cycles Check the table to see which cycle number is required to obtain gt 10 nM of library for your selected read length All reference values shown here refer to 500 ng total RNA starting material If using lower RNA input amounts further cycles need to be added for RNA amount also refer to Appendix A p 18 Ratio of CB in Library library yield steps 23 26 Sequencing Recommended ERRE bp nt nt pl 88 SR50 16041 116 700 226 MIA 12 SR100 orPE50 53 120ul 40ul 140 700 250 134 55 6 zal 9 SR150 80ul 80ul 150 700 A II IO 14 83 10 PE100 or SR250 120pl 40l 140 1700 345 CIA 24 128 PE150 aj SOpl 80ul 150 1700 370 254 89 35 15 73 8 PE250 40ul 120ul 160 1700 395 oe eee 22 110 9 PE300 160pl 180 1700 424 III 38 154 10 For non multiplexed libraries Libraries prepared with internal barcodes are 10 bp longer libraries prepared with
23. external barcodes are 6 bp longer and dual indexed libraries are 16 bp longer SR Single Read Sequencing PE Paired End Sequencing ATTENTION DO NOT USE CBL ALONE in step O or ifthe library was synthesized with RTS as this may result in severe decrease in library yield LEXOGEN mRNA Seq Library Prep Kit User Guide 21 9 Appendix C Library Quality Control Quality control of finished SENSE libraries is highly recommended and can be carried out with various methods depending on available equipment A thorough quality control procedure should include the analysis of both the concentration and the size distribution of libraries Quality control methods The analysis of a small volume of the amplified library with microcapillary electrophoresis has become the de facto standard for many NGS laboratories and generates information regarding ibrary concentration and size distribution Several electrophoresis platforms are available from various manufacturers For low to medium throughput applications we recommend the Agi ent Bioanalyzer 2100 and High Sensitivity DNA chips Agilent Technologies Inc Typically 1 ul of SENSE library produced according to the directions in this manual can be analyzed directly on a High Sensitivity Chip However samples may need to be diluted to prevent detector saturation if additional PCR cycles were used ore accurate library quantification can be achieved with custom or commercially available qPCR assa
24. ge General Unless explicitly mentioned all steps should be carried out at a room temperature RT bet ween 20 C and 25 C Results may be negatively impacted if the protocol is performed at temperatures outside of this range While reaction set up is often performed at RT incubati on temperatures are explicitly defined and must be strictly adhered to To further increase reproducibility centrifugation should be performed at 18 C If a refrige rated centrifuge is not available centrifugation can be carried out at RT Ensure that adequate volumes of all reagents and the necessary equipment is available and set to the proper temperatures before beginning the protocol Make sure to pre heat thermomixers dry bath incubators well in advance Perform all pipetting steps with calibrated pipettes and always use fresh tips Pipette careful ly to avoid foaming as some solutions contain detergents Thaw all necessary buffers at room temperature or as indicated in the preparation tables at the beginning of each step of the detailed protocol Mix reagents well by vortexing or pipetting repeatedly and centrifuge briefly with a benchtop centrifuge to collect contents before use Keep enzyme mixes at 20 C until right up before use or store in a 20 C benchtop cooler Steps requiring a thermocycler have been tested with a maximum ramp speed of 5 C sec before denaturation and extension and 2 5 C sec during primer annealing While t
25. he bias introduced by the RT and hence to achieve better cluster identifi cation on Illumina platforms SENSE starters are not entirely random The heptamer starter is GNNNHNG When using Multiplex Read 1 Sequening primer the entire starter sequence is seen in the FASTOC reports GNNN is used for cluster calling However the Customized Sequencing Primer CSP covers the first G of this sequence and the following 4 bases NNNH will be used for cluster identification by the sequencer This will result in a typical pattern in the FastQC re ports with Gs being absent in position 4 of the sequencing reaction and a G at the 6th position De multiplexing optional SENSE in line barcodes Barcode splitting tools should be used to separate reads within a fastq file according to the given barcode sequence The resulting fastq files can then be analyzed separately as described It is advisable to process different barcodes in different folders in order to prevent the mix up of files De multiplexing can be performed either before or after quality filtering of the reads as these two processes do not affect each other The barcode is contained within the first 5 bases of the read and should be removed after de multiplexing but before alignment With a paired end dataset both the forward and the reverse reads contain the barcode SENSE external barcodes The barcocde is contained in the Index Read and demultiplexing can be carried out by the stan
26. hese ramp speeds are typical for most modern thermocyclers some models can exceed these rates and ramp speed may need to be decreased to ensure efficient annealing Pipetting and handling of viscous solutions Enzymes RTS and RTL are viscous solutions which require care to pipette accurately Quickly spin down the tubes to collect all liquid at the bottom of the tube Be sure to pipette slowly and check the graduation marks on your pipette tips when removing an aliquot When drawing up liquid the tip should be dipped 3 to 5 mm below the surface of the liquid LEXOGEN mRNA Seq Library Prep Kit User Guide 9 10 always at a 90 degree angle Do not dip the tip in any further as viscous solutions tend to stick to the outside of the pipette tip Any residual liquid adhering to the tip should be removed by sliding the tip up the wall or edge of the tube from which the liquid was taken Spin down the tube afterwards again to ensure that all liquid is collected at the bottom of the tube for further storage When dispensing the pipette should be held at a 45 degree angle and the tip placed against the side of the receiving vessel When pipetting liquids from bottles take special care that only the sterile pipette tip touches the bottle opening to prevent introducing RNAses or other contaminants Tips are sterile whereas the pipette itself is not If necessary tilt the bottle to bring the liquid closer to the opening and facilitate pipetting
27. ion of starter stopper heterodimers to the poly A RNA still bound to the magnetic beads These starter stopper heterodimers contain lllumina compatible linker sequences A single tube reverse transcription and ligation reaction extends the starter to the next hybridized heterodimer where the newly synthesized cDNA in sert is ligated to the stopper As the insert size is determined by the distance between starter stopper binding sites RNA fragmentation is not required Therefore spurious second strand synthesis from the 5 ends of fragments is absent providing the basis for the excellent strand specificity of the SENSE protocol Second strand synthesis is performed to release the library from the beads and the library is then amplified introducing the sequences required for cluster generation see Appendix E p 28 for a schematic representation of the finished library Library quantification can be performed with standard protocols and is further discussed in Appendix C p 22 Libraries are compat ible with single end or paired end sequencing Barcodes can be introduced either as in line barcodes at the beginning of each read or as standard external barcodes Appendix D p 24 External barcodes require a separate sequencing reaction whereas in line barcodes do not Data can be analyzed with a number of standard bioinformatic pipelines Special considerations for the analysis of SENSE data such as read orientation are presented in Appendi
28. nation Use commercial ribonuclease inhibitors i e RNasin Promega Corp to maintain RNA integ x ity when storing samples Use a sterile and RNase free workstation or laminar flow hood if available Please note that RNases may still be present on sterile surfaces and that autoclaving does not completely eliminate RNase contamination Before starting a library preparation clean your work space pipettes and other equipment with RNase removal spray such as RNaseZap Ambion Inc as per the manufacturer s instructions Protect all reagents and your RNA samples from RNases on your skin by wearing a clean lab coat and fresh gloves Change gloves after making contact with equipment or surfaces outside of the RNase free zone Avoid speaking above opened tubes Keep reagents closed when not in use to avoid airbor ne RNase contamination Bead Handling 8 Beads are stored at 20 C and must be be resuspended after thawing Beads can be resus pended by pipetting up and down several times or by vortexing When properly resuspen ded the solution should have a uniform brown color with no visible clumping on the walls or bottom of the tube Beads may stick to certain pipette tips in which case removing the beads from the inside of the tip may be impossible Avoid resuspending by repeated pipetting and instead resus pend by vortexing if this occurs with your tips Beads are superparamagnetic and are collected by placing
29. nd reverse reads of a paired end sequencing run will contain the barcode sequence As indices occur just before the insert a third read is not required so multiplexed libraries can be sequenced with standard single end or paired end reagents Illumina sequencers rely on the initial rounds of sequencing for cluster calling and it is important that an even nucleotide balance 25 each of A C G and T is maintained at these positions The indices included in the SENSE multiplex barcode kit consist of three balanced sets of four barcodes each of which when mixed in equimolar ratios provide sufficient diversity at each position Only pool libraries made with complete balanced sets of barcodes ST1 through ST4 ST5 through ST8 or ST9 through ST12 The use of incomplete sets for example ST1 ST2 ST5 and ST9 will result in deficiencies of some nucleotides and poor cluster calling Some examples of potential barcoding strategies are listed below Two samples per lane Replace the standard ST with 1 ul ST5 and 1 ul ST6 for one sample and ST7 and ST8 for the second Four samples per lane Replace the standard ST with ST9 for one sample ST10 for the second ST11 for the third and ST12 for the fourth Any complete set of four barcodes could be used Apply only one ST to each sample Eight samples per lane Replace the standard ST with ST5 through T12 or any two complete sets of four barcodes Apply only one ST to each sample Twelve s
30. omized Sequencing Primer 100 uM Bead Wash Buffer Column Binding Buffer Short Column Binding Buffer Long Column Wash Buffer oom MBO HYBO H 0 RTS RTL sT E10 SSM E2 PCR EB csP BW CBS CBL cw Volume needed for Storage 80 pl 240 ul 10 80 ul 240 ul 20 C 160 ul 480 yu HOE 120 ul 360 ul 206 120 ul 360 ul ORG 16 y 48 pl AOE 24u 72 ul 0 ME 72 Ul 216 ul JUE 24u 72 ul 20 C 64 ul 192 ul 20 C 464 pl 1390 ul 058 80 u 240 ul 20 C 64m 19 2 ml RT 3 84 m 11 52 ml RT 256m 7 68 ml RT 64 ml 19 2 mI RT including ethanol to be added by user Upon receiving the SENSE kit remove the smaller inner box and store it in a 20 C freezer The rest of the kit components should be stored at room temperature and protected from light Be fore use check the contents of BW CBS CBL and CW which may precipitate during shipping If a white precipitate is visible incubate at 37 C until buffer components dissolve completely Cat No 001 08 8 preps Add 6 ml absolute ethanol to CW and shake to combine Cat No 001 24 24 preps Add 18 ml absolute ethanol to CW and shake to combine 6 LEXOGEN mRNA Seq Library Prep Kit User Guide 3 User supplied Consumables and Equipment Check to ensure that you have all of the necessary materials and equipment before begin ning library preparation All reagents equipment and labware must be free of nucleases and nucleic acid contamination Reagents Ab
31. ond Strand Synthesis RTS thawed on thermomixer SSM thawed at RT CBS stored at RT RTL J 5 min 25 C 1 250 rpm E2 keep on ice or at 20 C CBL stored at RT ST thawed at RT CW stored at RT El keep on ice or at 20 C EB thawed at RT BW stored at RT H O thawed at RT Thermomixer set to 25 C Thermocycler 98 C for 90 sec Benchtop centrifuge 1 250 rpm 65 C for 60 sec Column 1 per sample Magnetic rack 72 C for 5 min Collection tubes 25 C o0 2 per sample Reverse Transcription and Ligation The starter stopper heterodimer mix is hybridized to the RNA and reverse transcription and liga tion is performed generating short cDNA fragments with linker sequences at either end After removing the supernatant from the last wash add 15 ul reverse transcription and ligation mix RTS e or RTL e ATTENTION RTS e is used for sequencing runs up to 150 nt single end or 50 nt paired end RTL e is used for sequencing runs gt 150 nt single end or 2100 nt paired end Please also consult Appendix B Adjusting Library Size p 21 Add 2 ul starter stopper heterodimer ST e For multiplexed libraries with in line bar coding replace ST e with ST1 through ST12 as described in Appendix D p 23 Mix by vortexing Incubate at 25 C for 5 minutes using a thermomixer with 1 250 rpm agitation Add 3 pl of enzyme mix 1 E1 mix by vortexing and incubate at 25 C for an additional 2 minutes at 1 250 rom
32. qPCR is intended to determine the exact cycle number of the endpoint PCR apply 23 ul elution buffer EB O to the column For further details please refer to Appendix A p 18 31 After elution libraries can be stored at 20 C for later amplification 5 3 Library Amplification Preparation PCR thawed at RT CBS stored at RT EB thawed at RT E2 keep on ice or at 20 C CW stored at RT Thermocycler 98 C for 30 sec Benchtop centrifuge A SUM ees 10x 72 C for 30 sec see Appendix B p 21 Collection tubes 2 per sample 72 C for 2 min 10 C oo PCR The library is amplified to add the complete adaptor sequences required for cluster generation and to generate sufficient material for quality control and sequencing Transfer 10 ul of the eluted library to a PCR tube or plate containing 8 ul PCR mix PCR O or 8 ul of the respective external barcode mix PCRO1 96 if multiplexing of libraries is in tended External barcode mixes 003 08 A H and 003 24 A H are sold separately and contain all reagents necessary for the PCR with the exception of the enzyme mix Add 2 ul of enzyme mix 2 E2 O and mix thoroughly Conduct 8 to 10 cycles of PCR with the following program Initial denaturation at 98 C for 30 seconds 8 to 10 cycles of 98 C for 10 seconds 65 C for 20 seconds and 72 C for 30 seconds and a final extension at 72 C for 2 minutes hold at 10 C ATTENTION Cycle numbers vary depending on the
33. rcycled PCR reaction on a Bioanalyzer Please be aware that the post PCR purification columns are only intended for the endpoint PCRs 8 post PCR purification columns plus 2 extra columns for the 8 rxn kit and 24 post PCR purifica tion columns 6 extra columns for the 24 rxn kit 18 LEXOGEN mRNA Seq Library Prep Kit User Guide Option II endpoint PCR with one additional cycle and Bioanalyzer quan tification Insert 10 ul of the eluted 23 ul double stranded library step O into the PCR reaction and per form 9 cycles of library amplification instead of 8 or one more cycle than listed in the table of Appendix B p 21 depending on the column binding buffer CBS CBL that was used for library purification If the library yield is as described in Appendix B p 21 performing the protocol on similar samples as described in the manual with 13 ul elution buffer and 8 cycles of amplifica tion should generate sufficiently complex libraries If yield is insufficient amplify the remaining 10 ul of the purified second strand synthesis reaction with 2 4 additional cycles until an accept able yield is reached and increase the total RNA input accordingly in future experiments Extra reagents for two 8 prep kit or six 24 prep kit additional library purifications are included RNA integrity The integrity of an RNA sample can be assessed with a variety of methods We recommend the use of a microfluidics assay such as the RNA600
34. rnal barcode kit barcode kit barcode kit barcode kit barcode kit barcode kit barcode kit barcode kit A 1 12 B 13 24 C 25 36 D 37 48 E 49 60 F 61 72 G 73 84 H 85 96 PCRO1 PCR13 PCR25 PCR37 PCR49 PCR61 PCR73 PCR85 ACATTA GAACCT ACAACG AGTTGA AGGCAT GAAGTG AACAAG TTGGTA PCRO2 PCR14 PCR26 PCR38 PCR50 PCR62 PCR74 PCR86 GGTGAG CGGTTA GCGCTG GACGAT ACCTAC AGAATC AACCGA CAACAG PCRO3 PCR15 PCR27 PCR39 PCR51 PCR63 PCR75 PCR87 CGAAGG AACGCC CAAGCA CACACT TGGATT GCGAAT TGGCGA CAATGC PCRO4 PCR16 PCR28 PCR40 PCR52 PCR64 PCR76 PCR88 AAGACA CAGATG GTTACC CAGCGT GCAGCC CGATCT CACTAA GGAGGT PCROS PCR17 PCR29 PCR41 PCR53 PCR65 PCR77 PCR89 TAATCG GATCAC IEEE TGCTAT CGCCTG CATCTA AAGCTC CAGGAC PCRO6 PCR18 PCR30 PCR42 PCR54 PCR66 PCR78 PCR90 CGCAAC CGCGGA CCAATT TCTTAA CCGACC AAGTGG TACCTT GGCCAA PCRO7 PCR19 PCR31 PCR43 PCR55 PCR67 PCR79 PCR91 AATAGC CCTAAG TTCGAG CCGCAA TATGTC TGCACG CTAGTC CTCATA PCROS PCR20 PCR32 PCR44 PCR56 PCR68 PCR80 PCR92 TTAACT GGCTGC CGTCGC CTCCAT TGACAC TCGTTC AATCCG CCTGCT PCROS PCR21 PCR33 PCR45 PCR57 PCR69 PCR81 PCR93 AATGAA ACCAGT TGTGCA GTCAGG ACAGAT ACACGC GTGTAG GGTATA PCR10 PCR22 PCR34 PCR46 PCR58 PCR7O PCR82 PCR94 GATTGT GTGCCA ACCGTG ACGTCT AGACCA GTAGAA ACTCTT TTCCGC PCR11 PCR23 PCR35 PCR47 PCR59 PCR71 PCR83 PCR95 ATAAGA AGATAG ATACTG GAGTCC GCTCGA AGTACT TCAGGA TAGGCT PCR12 PCR24 PCR36 PCR48 PCR60 PCR72 PCR84
35. rom the purchasing date Should his product fail to meet these standards due to any reason other than misuse improper handling or sto rage Lexogen will replace the product free of charge or issue a credit for the purchase price Lexogen does not provide any warranty if product components are replaced with substitutes Under no circumstances shall the liability of this warranty exceed the purchase price of this product LITERATURE CITATION When describing a procedure for publication using this product please refer to it as the SENSE mRNA Seq kit We reserve the right to change alter or modify any product without notice to enhance its performance CONTACT INFORMATION Lexogen GmbH Support Campus Vienna Biocenter 5 E mail support lexogen com 1030 Vienna Austria Tel 43 0 1 3451212 www lexogen com Fax 43 0 1 345121299 Y ge NES OO NA 10 EL 12 13 14 Table of Contents QVECINIGW esa Rik rk ee eRe Oe ae ae ee 4 Kit Components and Storage Conditions 6 User supplied Consumables and Equipment 7 GUIASINES e aa e ayta aa a a A 8 Detailed Protocol 0 ona ria a aa 11 5 1 Poly A Selection iia ena ern a 11 5S2 Ubro Generations s erea ad be God ea R 13 5 3 Library Amplification s oas cress o o oo 15 SHO Procedure sick ca aus twee adda Cae da awa ee 17 Appendix A RNA Requirements PCR Cucles 18 Appendix B Adjusting Library Size 21 Appendix C
36. ructures and promote efficient hybrid ization For information on appropriate amounts of total RNA input as well as RNA quantifica tion and quality control see Appendix A p 18 Dilute 500 ng to 2 g of total RNA to a volume of 10 ul with RNase free water H O 0 Denature RNA samples using a thermocycler at 60 C for 1 minute and then hold at 25 C Do not cool samples excessively or place denatured RNA on ice LEXOGEN mRNA Seq Library Prep Kit User Guide 11 Hubridize mRNA The denatured total RNA is incubated with the washed beads which specifically bind polyade nylated RNAs RNAs lacking a poly A tail are then washed away leaving only purified poly A RNA hybridized to the beads 8 Add the 10 ul of denatured RNA to 10 ul of washed beads and incubate using a hermomixer at 25 C for 20 minutes with 1 250 rom agitation Transfer the solution to a magnetic rack and remove and discard the supernatant Q Remove the tube from the magnetic rack and add 100 ul bead wash buffer BW Resuspend the beads and mix well Incubate using a thermomixer at 25 C for 5 minutes with 1 250 rom agitation Collect the beads by placing the tube onto a magnetic stand for 2 minutes Remove and discard the supernatant Repeat this washing step once for a total of two washes 12 LEXOGEN mRNA Seg Library Prep Kit User Guide 5 2 Library Generation Preparation Reverse Transcription and Ligation Sec
37. solute ethanol add to column wash CW solution Equipment e Magnetic rack e Benchtop centrifuge 12 000 x g rotor compatible with 1 5 ml tubes Calibrated single channel pipettes for handling 1 ul to 1000 ul volumes Thermomixer for 1 5 ml tubes dry bath incubator with shaking function e Thermocycler e UV spectrophotometer to quantify RNA Optional equipment e Automated microfluidic electrophoresis station Agilent Technologies 2100 Bioanalyzer e qPCR machine and library standards for library quantification e Benchtop fluorometer and appropriate assays for RNA quality control and library quantification e Agarose gels dyes and electrophoresis rig for RNA quality control Labware e Suitable pipette tips pipette tips with aerosol barriers recommended e 1 5 ml reaction tubes low binding certified ribonuclease free 200 ul PCR tubes or 96 well plates and caps or sealing foil e Vortex mixer Ice bath or ice box ice pellets benchtop cooler 20 C for enzymes The complete set of materials reagents and labware necessary for RNA extraction and quality control is not listed Consult Appendix A p 18 for more information on RNA quality Consult Appendix C p 22 for information on library quantification methods LEXOGEN mRNA Seq Library Prep Kit User Guide 7 4 Guidelines RNA Handling BD ases are ubiquitous and special care should be taken throughout the procedure to avoid BD ase contami
38. ssing A shorter side product caused by the direct ligation of starter stopper heterodimers to one another is sometimes visible at 129 bp and should com pose no more than 0 3 of the total library Higher proportions of this side product can indicate problems during library preparation 22 LEXOGEN mRNA Seq Library Prep Kit User Guide A second peak in high molecular weight regions between 1000 9000 bp is an indication of overcycling Performing the qPCR reaction to determine the cycle number of your endpoint PCR as recommended on page 18 should prevent overcycling Still even overcycled PCRs can be used for subsequent sequencing reactions without compromising your results However for further experiments using the same input RNA please adjust your cycle number accordingly or take advantage of the qPCR option bp ladder SENSE SENSE SENSE ay RTS RTS RTS 160pI CBS 120pICBS 80 CBS 40piCBL 8OpICBL wm A xI A x0 w 2009 E m y l Sl ES AA w 5 1 1 0 o moro w w aw fet Figure 3 Bioanalyzer traces of RTS synthesized SENSE libraries purified with varying combinations of CBS and CBL Dark blue trace 160 pl CBS green trace 120 pl CBS 40 pl CBL and red trace 80 pI CBS 80 pl CBL Va bp ladder SENSE SENSE SENSE SENSE RIL RIL RIL RIL 120pICBS 8OpICBS 4OpICBS AOp CBL 8OPICBL 120pICBL 160 pl CBL
39. the basic kit is replaced by PCR mixes PCRO1 96 from the external barcode kit Cat No 003 08 003 24 sets A H 5 Read 1 Sequencing Primer 3 OR 5 Customized Sequencing Primer 3 5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTG Insert 3 TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAC Insert 5 Index Read Sequencing Primer 3 Insert AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Index ATCTCGTATGCCGTCTTCTGCTTG 3 Insert TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG Index TAGAGCATACGGCAGAAGACGAAC 5 3 Read 2 Sequencing Primer 5 For Read 1 it is recommended to use Multiplexing Read 1 Sequencing Primer Optionally the Customized sequencing primer can be used ATTENTION Be aware that PhiX spike in is not possible when using CSP Do not use a mixture of primers such as Multiplexing Read 1 Sequencing Primer and Customized Sequencing Primer Read 1 Multiplexing Read 1 Sequencing Primer not supplied 5 ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3 OPTIONAL Read 1 Customized Sequencing Primer supplied as CSP 100 uM 5 ACACTCTTTCCCTACACGACGCTCTTCCGATCTG 3 Read 2 Multiplexing Read 2 Sequencing Primer not supplied 5 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3 Note Some nucleotide sequences shown in Appendix E may be copyrighted by Illumina Inc Oligonucleotide sequences 2007 2012 Illumina Inc LEXOGEN mRNA Seq Library Prep Kit User Guide 29 Libraries with in line
40. the standard kit for those in the SENSE external barcoding kits PCRO1 96 as described in the section for external barcoding External barcodes require a third index specific sequencing read LEXOGEN mRNA Seq Library Prep Kit User Guide 27 11 Appendix E Sequencing General The amount of library loaded onto the flowcell will greatly influence the number of clusters gener ated Each sequencing facility has slightly different preferences of how much to load From our ex perience a good starting point is to load between 7 and 14 pM of a SENSE library onto the flowcell All SENSE libraries can be sequenced using the standard Illumina Multiplexing Read 1 Sequenc ing Primer For experienced users we also offer the option to use a Customized Sequencing Primer CSP for libraries without barcoding or libraries with external barcodes which will yield approximately 10 more reads The CSP must not be used with libraries with inline barcodes or dual in line and externally barcoded libraries CSP is included in the SENSE kit as a 100 UM stock and must be used in the sequencing reaction at a final concentration of 0 5 uM As CSP and the standard Illumina Read 1 Sequencing Primer differ in one base CSP has an additional G at the 3 end PhiX cannot be spiked in if CSP is used Depending on the type of barcoding used four types of libraries can be generated Libraries with no barcode with external barcodes with in line barcodes and with dual b
41. tion with phenol rather than chaotropic salts Genomic DNA contamination Depending on the RNA extraction protocol used samples may also contain significant amounts of gDNA which is indistinguishable from RNA on a spectrophotometer Furthermore as many of the dyes used in RNA microfluidics assays stain single stranded nucleic acids much more intensely than double stranded low to moderate amounts of gDNA may not be readily visible LEXOGEN mRNA Seq Library Prep Kit User Guide 19 with an RNA specific microfluidics assay We highly recommend examining all RNA samples on a denaturing agarose gel or using a fluorometric assay with DNA and RNA specific dyes to check samples for DNA contamination On an agarose gel gDNA can appear as either a dark mass which remains in the slot if relatively intact or as a high molecular weight smear if it has been sheared during extraction SENSE libraries generated from samples containing gDNA may have an increased number of intergenic reads or lower strandedness The best way to avoid gDNA contamination is to use an RNA extraction protocol that does not co isolate gDNA However DNA can be removed from irreplaceable samples by acidic phenol ex traction or DNase digestion We do not recommend DNase treatment as the extended incubation with divalent cations can lead to RNA hydrolysis and decrease RNA integrity If samples must be DNase treated heat inactivation should be avoided and the enzyme deacti
42. vated by other means such as phenol chloroform extraction or silica column purification RNA storage If immediate RNA extraction is not possible tissue samples can be either flash frozen with liquid nitrogen or submerged in RNAlater Life Technologies Inc and stored at 80 C After extraction RNA can be stored at 20 C or 80 C in 10 mM Tris pH 7 0 Avoid frequent freeze thaw cycles as RNA might be sheared ERCC RNA spike in controls To enable the hypothesis neutral calculation of strandedness we highly recommend the ad dition of artificial transcripts of known strand orientation and concentration such as the ERCC RNA spike in controls Ambion Inc These sets of RNAs have a known strand orientation and no antisense transcripts so the calculation of strandedness based on ERCC sequences is more accurate than calculations based on reads aligning to the genome 20 LEXOGEN mRNA Seq Library Prep Kit User Guide 8 Appendix B Adjusting Library Size The size of SENSE libraries can be adjusted to the desired sequencing length This is accom plished by modulating the insert range of the library generated during RT ligation and by using different size cut offs during purification SENSE is offered with two different reverse transcription and ligation mixes to be used in step of library generation As shown in the table below RTS will produce libraries with shorter mean insert sizes while RTL generates libraries with longer ins
43. x F p 31 4 LEXOGEN mRNA Seq Library Prep Kit User Guide POLY A SELECTION Y 60 min O 20 min Aliquot and Wash Beads Total RNA 3 5 Denature RNA 5 3 5 3 5 3 5 Sy AMA Si ay Hybridize mRNA LIBRARY GENERATION Y 120 min O 60 min fe SN Hybridization of Starters Poly A RNA and Stoppers 5 A o a 5 3 ols 5 E E BIE cd E alle Reverse Transcription AAAAAAAA and Ligation nenek 3 Poly A RNA 5 A IA lL NL KL LU 5 TITTTTTIT 5 oF 5 3 5 3 5 3 Tagged cDNA library Second Strand Synthesis Double stranded cDNA library A Purification y i LIBRARY AMPLIFICATION Y 60 min O 20 min Va cDNA library with adapters for Ilumina sequencing PCR a A _ _ Xen Purification 0 A in line barcode optional external barcode optional Figure 1 Schematic overview of the SENSE workflow LEXOGEN mRNA Seq Library Prep Kit User Guide 5 2 Kit Components and Storage Conditions CW EtOH added MB Purification Columns Collection Tubes a Figure 2 Location of kit contents Magnosphere MS150 oligodT Beads RNA Hybridization Buffer Molecular Biology Grade Water Reverse Transcription and Ligation Mix Short Reverse Transcription and Ligation Mix Long Starter Stopper Mix No In line Barcode Enzyme Mix 1 Second Strand Synthesis Mix Enzyme Mix 2 PCR Mix Elution Buffer Cust
44. ys With these assays the relative or absolute abundance of amplifiable fragments contained in a finished SENSE library is calculated by comparing Cq values to a set of known standards While generating more accurate quantification these assays do not supply the user with information regarding library size distribution The use of such an assay for quantification in combination with Bioanalyzer analysis for size distribution is highly recommended If microcapillary electrophoresis platforms and qPCR machines are not available very basic qual ity control can also be performed by separating a small aliquot of the library on a polyacrylamide or agarose gel Library quantification can also be performed with an inexpensive benchtop fluo rometer using one of several commercially available assays Most UV Vis spectrophotometers are not sensitive enough at these concentrations to accurately quantify NGS libraries and should be avoided Typical results SENSE kits are provided with 2 different reaction buffers RTS and RTL which generate libraries with different size ranges Additionally the library size can be varied depending on the column binding buffer used in steps and O For a detailed overview regarding library size insert range and yield please refer to the table in Appendix B Adjusting Library Size p 21 Typical concentrations are between 7 15 nM 1 1 3 8 ng ul which are well suited for cluster generation without further proce
Download Pdf Manuals
Related Search