Sanger Sequencing Troubleshooting Guide
Contents
1. Ea GEG Oe eG Ml Too much template il I hi Ih Ji i WA TAN iN ut i Will Whi MONN oll lh Dall lah tl nal ita NAY 0 a Sanger_troubleshooting_guide_v1l doc August 2009 RAC AAGGTAC TACAIGG ACG ACG ACAAGG GATCCGG TGG AGG TGGAGG TGG ATTAC cM ACCCAAGC TGGGEGC cMiceGccec TC TEGGCCGGGGC TCG GCCC TEGGGGG Secondary Structure Problem Sequence starts well but signal stops abruptly Sequence starts well but signal weakens gradually ski slope effect Sequence starts well but signal weakens rapidly Probable cause Secondary structure GC and AT rich templates can cause the DNA to loop and form hairpins Linearized DNA restriction enzymes may have cut an internal site Too much DNA template overload of DNA leads to excessive number of short fragments Repetitive region Repeat regions especially GC and GT repeats can cause the signal to fade either due to depletion or slippage or secondary structure Multiple peaks downstream to homopolymer Problem Overlapping peaks following stretch of mononucleotide Sequence TAKAAGTCG TA TAAATTTTTTITTTTTTTITGGCGAAGGAAATITMAT Probable cause Enzyme slippage occurs giving varying lengths of the same sequence after this region n 1 n 2 and n 3 populations ATT TGGTTTTTTGGGAAGGGAAATG N RANA WWW Solution Add 1ul DMSO to the sequencing reaction to help relax the structure De2. alts phenol EDTA ethanol Insufficient amount of primer Check primer dilution Inefficient primer binding Redesign primer Poor start followed by weak sequence as U tecr creacte rec Gas Ach e M dvy lo TGATTTCGC TCG GCCATGC TCGCCGGG Ml i il WAN ly i tian su Problem Probable cause Solution Poor sequence at the Primer binding to itself Redesign sequencing primer Start followed by weak Signal Other primers present Check PCR clean up has removed all other possible primers Sanger_troubleshooting_guide_v1l doc August 2009 Multiple peaks Base G102 3CGGCCGCG AATTCAC TAG THIATTTCCGGATTAGGAMC TGATC TGAC TCAMCAGGGCTGAMAAMTCCATG TtccHcaaTtchac ny bial WN Ny hal i i yi A ha Problem Probable cause Solution Overlapping peaks in Multiple priming sites Use a different primer the sequence data Residual primers PCR product Make sure all PCR primers and has not been cleaned up dNTPs have been removed Poor purification during Order new sequencing primer primer synthesis full length preferably HPLC purified primer is mixed in with shorter primer missing one base giving a shadow Sequence one base behind the real sequence Mixed plasmid prep Contaminated template Clean sequence at the start with mixed peaks beginning at the cloning site Ensure single colonies are picked INDEL in PCR product Sequence the complementary stand Sequence from cloned PCR products CTT OS SCAT 8 CS TS TS TASS TE
3. sign primers close to the hairpin Run product out on an agarose gel to check Use less DNA template Add 1ul DMSO to the sequencing reaction Sequence the complementary strand r149 Gal Al oM W uhly Solution Sequence the complementary strand Sanger_troubleshooting_guide_v1 doc August 2009 Artifacts TATAATCGATCCAAACT GCT 1176 GATCA TCAAGAGACTCGC TAGCCTCTATTTTTCG TICATGGECCATCETITCTITT dl athe mn Ron tA fh Problem Large peaks obscuring the real sequence Sudden large multicoloured peak covering 1 2 bases Sample peaks become lumpy and increasingly unreadable early in the sequence before 500bp Probable cause Dye blobs caused by unincorporated BigDye and typically seen at 70bp and 120bp Usually seen in failed or weak sequences Real sequence can still be read underneath these blobs Small air bubble of dried polymer within the capillary If related to individual samples this is due to a contaminant in the sample Degradation of polymer or capillary array Solution Add more DNA template or less BigDye to sequencing reaction Contact us and sample can be re run Clean up template DNA Inform us if loss of resolution continues Sanger_troubleshooting_guide_v1l doc August 2009
4. the gene DOO Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing Possible causes for failure and their solutions are listed below each example The list is not exhaustive so please contact us at genepool sanger ed ac uk if you have any other solutions to add Failed sequence TA MA GGAATGANGETGHMAACGG A TTATHTctTehc ER rMRch Mirar ch Bra Free Mare Bcc occ chr a acria Problem Lack of sequence data Probable cause No priming site present Primers have degraded through freeze thaw cycles Inefficient primer binding Insufficient amount of DNA template DNA has degraded Inhibitory contaminant in your samples eg salts phenol EDTA ethanol Solution Make sure the primer site is present in the vector you are using Redesign use a different primer Make up new primer stocks Redesign primer Quantify DNA Increase the amount of DNA template Re extract DNA Clean up DNA template Sanger_troubleshooting_guide_v1l doc August 2009 Weak sequence Base ib BACAR GE TEG G 6G A TE GCITTE COAG ACAGGG AAG G TAC TG GCGGAGACGATCGAAG GCE TGG TTGAGGE TITETGCA TEOGACS Ww Wc os waa ataa a atl ona duam Problem Probable cause Solution Low peaks throughout Insufficient amount of DNA Quantitate the DNA template Increase the amount of DNA template Inhibitory contaminant in your Clean up DNA template samples e g s
Download Pdf Manuals
Related Search