Home

CMI Release 10.7 User Manual CATIA Teamcenter

1. sceccececececcecececaceececececaceers 26 MUETIDEVEL AUTO EXPAND iia 27 DROP WITH MULTILEVEL EXPAND cccececcececcececcececcccuceccecsececeucecueaucuceeucaesucueaeceuaeceuaeeas 27 CHAPTER o ro acia in O aos A id 29 WORKING WITH CATIA V4 MODELS w ccccceceececescecescecescecnscecnecseuseseucescnensenensenenseseas 29 READING A MODEL FROM MEAMCENTEBR si e dede 29 UPDATING A MO DEl a A a E Oe o a 31 CMI User Manual vii viii SAVING A MODEL UNDER ANOTHER NAME scccescecesceceeecseetenceteneeteueeneeeeeeeteneeteneeseeeenes 31 CREATINGA NEW MODE de a ah po AS 32 POTTING AM lie dccopheancduabinece 33 CONVENIOS e ee 33 EXample Tora drawing SNE t ick ckicte rita AN 33 Creating amp Plot Pile ON ates a E E E 42 CHAPTER 6 lo Oe 43 WORKING WITH STRUCTURES 0oooccccocnncnnonnonnnnnnnnnnncnnnnnnnnnn nro nnnnnnnnnnnnnnnnnrnnrnnr nera 43 UNDERSTANDING THE STRUCTURE aca ualattalaeadeateatrtlatecaaiues 43 CREATING ASP ART taco iron delta did al eee Sete Rue ave can eae 43 Creating amr ASSCINONY oraaa ces A a 4 eau OS 43 CREATING A COMPONEN a a alisios inline 43 SEARCHING FOR PART S raptada alo derriba Ral a ca DTO 43 Searching TOrASSeMDITCS e cae dead oO 43 S al GRInG IOECOMNDON AN Sand 44 CREATING A STRUCTURE ui a A tee cla A e 44 Example EIC WES OM lo ens 45 LOADING A STRUCTURE IN CATIA ira id a ia EOI OA 46 HIGHLIGHTING A MODEL IN CATIA api ie tenelcioye ie or tous vebdeteleceeer Nclods een 49 UPDATING A STRU
2. models of a volume will be expanded from a Root Part down to the leaf parts The menu item Query gt DMU gt Show Models of DMU Volume presents a Dialog window to ask for the Root part and for the DMU Volume D CMI User Manual 54 Select Root and Yolume o x Root PartHumber for Heighbourhood E Yolume Hame for Part E CATIA End Box Min x CATIA End Box Min CATIA End Box Min z CATIA End Box Max x CATIA Bnd Box Max y CATIA Bnd Box Max z Figure 45 Select Root and Volume dialog If you click the selection box for the root Part all Part Numbers and Revisions are shown for which a CMI DMU File exists If the root Part is determined the click of the Volume Name selection box shows all Volumes of this specific root Part If there is no Volume of your choice for the root Part you can perform a dynamic Volume Search by specifying all volume values in the dialog window With the OK button the Volume search starts and all Catia Models of the selected Volume are presented in the Workbench under the same root Part t Only Catia Models with bounding boxes are searched Prior to the Volume Search a CMI DMU File must be created for the root Part via i the Workbench Action gt Create DMU File Prior to the Volume Search a DMU Volume must be created for the root Part via Action gt Create DMU Volume Import a Scene File lt is possible to load a scene file that has b
3. E CATIA 5 CMI Rack O x Start File Edit View Insert Tools CMI Analyze Window Help lj xj 4 A645 LERLE HHA N Rack Assembly Chassis 3dmap Chassis 1 Chassis 1 s Chassis CATShape Chassis 2 Chassis 2 Applications ro 4 7 Ss G i Activate Close Select representation Figure 140 Representation formats in CATIA V5 CATIA V5 Use BOM NO BOM geometries The CATIA V5 module can handle two different types of CATParts e BOM relevant and e NON BOM relevant NON BOM Relevant CATParts NON BOM relevant CATParts are CATIA V5 geometry files which are stored as a model under a Part in Teamcenter In CATIA V5 the Part and model is build up as CATProduct and CatPart see Figure Teamcenter CATIA Workbench CATIA V5 DM1R1410 Schr DM1R145chra D Off S Off Figure 141 Mapping for NON BOM parts in Teamcenter and CATIA V5 142 CMI User Manual BOM Relevant CA TParts BOM relevant CATParts are CATIA V5 geometry files which are stored as the only model under a Part in Teamcenter In CATIA V5 the Teamcenter Part is represented by a CATPart see Figure Teamcenter CATIA Workbench CATIA V5 DM1R14Compon DM1R14Compong YE lA os D Off S On Figure 142 Mapping for BOM parts in Teamcenter and CATIA V5 The option to use the BOM and NON BOM parts must be configured by the Administrator The user is able to decide which type of geometry mapping should be used in Syncronize
4. 20974 20975 20976 CMI User Manual WARNING MAP NOT FOUND IN DECL SERIES NO MAP NAME FOR EXCHANGE MAP FOUND NO VALID MAP PATH OR DLNAME FOUND SAME POINT SELECTED WRONG VECTOR SELECTED SAME AXIS SELECTED SELECTED MODEL IS NOT IN ASSEMBLY EXCHANNG MAP PATH DOES NOT EXIST CHANGES TO RO MODELS NOT ALLOWED MODEL DOES NOT EXIST MODEL WRITE WAS NOT SUCCESSFULL WARNING CHANGES IN SUBASS NOTHING TO SAVE UPDATE NO TRANSFORMATION STORED NO VALID TRANSFORMATION FOUND NO TRANSFORMATION DONE YET NO HELP SYSTEM DEFINED CAN NOT CONNECT TO HELP SYSTEM NO HELP FILE FOUND MODEL IS NOT PART OF WORKPLANE FAILED TO READ STORAGE MODEL NEED TO BE WRITTEN CATIA SESSION HAS BEEN CHANGED The map path searched for is not defined yet in your declaration series A new map will be created temporary There is no MAP entry in your environment Please contact your system administrator Couldn t find a valid entry in declaration series For the given search criteria Maybe the map you want to read from is invalid Please consult your CATIA system administrator Please select 3 different points Please select the transformation vector to change the direction of current transformation Please select 2 different axes The selected model belongs not to an assembly loaded so it can t be managed here Please use the standard CATIA functions The specified exchange map does not exist Please contact you
5. CATIA Teamcenter Interface CMI Release 10 7 User Manual Copyright 1999 2014 2015 T Systems International GmbH All rights reserved Printed in Germany T Systems International GmbH GDC Product Lifecycle Management Fasanenweg 5 70771 Leinfelden Echterdingen Germany htto www cmi support com T 49 0 40 5395 2020 49 0 391 5801 25688 mail cmi_support t systems com Manual History Version This edition obsoletes all previous editions Date November 1996 February 1997 July 1997 March 1998 December 1998 May 1999 September 1999 April 2000 July 2000 September 2000 December 2000 August 2001 December 2001 July 2002 January 2003 July 2003 March 2004 September 2004 December 2004 September 2005 Version Date March 2006 October 2006 March 2007 October 2007 March 2008 October 2008 March 2009 October 2009 April 2010 October 2010 April 2011 October 2011 April 2012 October 2012 April 2013 October 2013 April 2014 October 2014 April 2015 CMI User Manual A Trademarks CATIA is a registered trademark of Dassault Systemes Teamcenter Enterprise is a registered trademark of Siemens PLM Corporation Names of other products mentioned in this manual are used only for identification purpose and may be trademarks of their companies CMI User Manual Preface This manual describes the main functionality delivered by the CATIA Teamcenter Interface CMI and includes th
6. ESSSSSSSSs Predefined Object Structure The CATIA Teamcenter Interface CMI contains the following predefined object structure Described by CATIA Model n Figure 22 Predefined CATIA model structure For each part a relation described by with a document element must exist The relationship can be created by dragging any document object and by dropping it to the part object Please refer to the Teamcenter user documentation for managing relationships between Teamcenter elements The documents can contain at least one relation attaches with CATIA model elements You can attach more than one CATIA model to a single document and more than one document can be associated with each part Any CATIA model object can contain one relation Model has plot file with any plot file which can be created from CATIA E ES CATIA Model Plot File ModelhasPlotHle Figure 23 Plot file attached to a CATIA model CMI User Manual 19 All of the elements and the relations between them can be customized For more information please refer to CATIA Teamcenter Interface Customizing Documentation ee CATIA V4 Templates CATIA V4 templates are so called predefined empty CATIA V4 models They are useful if you want to use CATIA V4 models with the same settings and predefined views such as project environment and title block settings for drawings CMI prevents you from creating a new CATIA V4 model object without a CATIA V4 templ
7. Figure 8 CATIA Workbench menu Query The menu item Query searches for documents and parts standard Teamcenter Enterprise The menu item Query gt CATIA ltem searches for CATIA Items within the Workbench All items matching the search criteria are marked for more information about marked items please refer to Working with marked Parts The menu item Query gt CATIA Model searches for CATIA Models within the Workbench All models matching the search criteria are marked Menu item Query gt DMU CATIA Workbench CMI EDMG97 20050 i _ o xj File Action Info 411 Parta CATIA Item CATI i Mode l show Models of DMO Volume Phe aa aaa VAMU 12 eic aieiate Y left olaa LMLELEWE LME aldea SEEVEE gt gt gt Accepted Quality Document option initiating object Server Figure 9 CATIA Workbench menu Query DMU You should use this functionality only for frozen data Therefore use the configuration context to query only for frozen data The menu item Query gt DMU gt Show Neighbours is active when at least one Catia Model is selected selected models have thick black frames A dialog window is presented to ask for the root part of all selected Catia Models select Root Part for Neighbourhood o x Root PartHumber for Nei ghbourhood 10002401 H E Cancel Help Figure 10 root Part for neighbourhood search After pressing the OK Button the neighbourhood sear
8. The link child operation D This may only appear as an operation for CATProduct objects as CATParts cannot contain sub products In Teamcenter Enterprise any new child CATProducts or CATParts will be attached to the Teamcenter Enterprise Part of the parent object using the following methods if the child is a CATPart then the document attached to the child CATPart is attached to the parent Part object if the child is a CATProduct then its Teamcenter Enterprise Part is attached to the parent Part to create the Part Part relation The drop child operation ar This may only appear as an operation for CATProduct objects as CATParts cannot contain sub products Also CATParts cannot be dropped in Teamcenter Enterprise without customization In Teamcenter Enterprise any child CATProducts deleted from the CATIA product structure will be detached from the Teamcenter Enterprise Part of the parent object using the following method if the child is a CATPart then no drop will occur see also Deleting NON BOM Parts during Synchronize if the child is a CATProduct then its Teamcenter Enterprise Part is detached from the parent Part the Part Part relation is deleted After every operation the success or failure will be registered in the result column of the dialog If an operation fails the output window will provide you with the cause of the failure CMI User Manual AO CMI Geometry toolbar Create in Teamcenter
9. 150 CMI User Manual CMI opens a folder selection dialog to select a directory where CMI should store the exported files Select export directory 21 xi 3 CMI_RIT_TCS1O 5 code ma dell gt dev O DLNAME1 E DLNAME C j2sdk1 4 2_17 5 MSOCache 1 My Installations 5 Office 10 Make New Folder Cancel Figure 158 Select export directory dialog With OK CMI performs the export After the structure is stored in the export directory CMI shows a summary about the renamed files CMI Warnings CMI Information Selected export directory C Export The following files where exported InternalQuterWheel CATPart ExternalQuterWheel CATPart InternallnnerWheelDesignTable2 xls gt ExternallnnerWheelDesignTable2 xls InternalInnerWheelDesignTable 1 ds gt ExternalInnerWheelDesignTable 1 118 Internalinner Wheel CATPart gt Externalinner Wheel CATPart InternalWheel CATProduct gt ExternalWheel CATProduct InternalAxisGeoDesign able xls gt ExternalAxisGeoDesignTable xls InternalAxisGeo CATPart gt ExternalAxisGeo CATPart InternalAxis CATProduct gt ExternalAxis CATProduct InternalStructure CATProduct gt ExternalStructure CATProduct CMI Operation Status AAA O SS Close Figure 159 Export Information The export directory now holds the CATIA files of the exported structure and an XML file which holds the actual mapping of names between Teamcenter a
10. Here you can control for individual files how they should be treated during Synchronize as well as how they are going to be reconnected Update New radio buttons In order to be updateable a file has to be connected with Teamcenter If the file is connected but you rather want to store it as a new file click New to disconnect the file so that it will be created as a new object in Teamcenter during Synchronize The same allows to copy a part or data item that you have originally opened from Teamcenter Ignore checkbox Ignore this Item in Synchronize neither create a new item nor update Part number Instance name File name If the file is archived in Teamcenter under a different name than it has in CATIA you can suggest the name here It will take the place of the name in CATIA when Teamcenter is searched for the item Reconnect CMIArchives checkbox By default Reconnect does not search Teamcenter for CMlArchives to reconnect a CATProduct Check Reconnect CMlArchives to also search for CMlArchives Keep in mind however that several different Archives can contain a root product with the same part number or file name If this is the case you will be asked to select one of these a o l Handling of CATDrawings CATDrawings can be included in your assembly structures in Teamcenter Enterprise All the usual functions Read Update Create and Save As are supported for CAT Drawings in CATIA V5 via the CMI Toolbar CAT Drawings ma
11. Save Clear cancel Figure 160 Model Filter Preferences Deleting NON BOM Parts during Synchronize By default when you remove an instance of a geometry Non BOM CATPart in CATIA Synchronize Teamcenter does not perform any action in Teamcenter This is because there is no clearly equivalent action in Teamcenter that CMI can provide for instance it 152 CMI User Manual CMI User Manual cannot tell if you would remove the document from the Part or the CATPart from its Document If a user would regularly remove the Document from its Part an administrator can set the following variable in the Teamcenter configuration set CML REMOVE GEOMETRY DOCUMENT this would remove all versions of the document from the Part that attach the CATPart which was removed in CATIA This is appropriate if your business logic is that each CATPart has its own document the document attaches only one model If you would remove the Model from its document an administrator can set the following variable in the Teamcenter configuration set CML REMOVE_GEOMETRY MODEL This method is suitable if your Document attaches more than one models and no Document is attached to more than one Part If none of these definitions match your business logic you should instead override the customizing method for the dropping of geometries see CMI Customizing Manual or let the user handle it 153 Glossary Administrator Perso
12. ceecceccecececcecceceececeeceseeceeceeaeeaeeneeneas 114 FIGURE 96 CMIARCHIVE ROOT ITEM WITH THREE CHILDREN 2 02 0eceeceececeececceececeseeeeeees 115 FIGURE 97 CREATE ARCHIVE DIALOG IN TEAMCENTER 2 0ececcececcececeececeecececceceeseceeaeeess 115 FIGURE 98 DOCUMENT CREATE DIALOGS IN TEAMCENTER 2 csececceccecceccecceccecceceeseaseaees 116 FIGURE 99 CMI MESSAGE WINDOW 0cceceececcececeececeececeececececeeaecesaeceeaeseeeceseeaeseeaeeess 116 FIGURE 100 EXPANDED ARCHIVE ITEM IN THE WORKBENCH 2 csceececcecceceececceececeeeeseeees 117 FIGURETOTSGNILARCHIVE INFO oido iia 117 FIGURE 102 CMIARCHIVE IN BOM ASSEMBLY 2 22 0ccecceceeceeceececeeceeceececaeceeceeaeseeeueaeeas 118 FIGURE 103 SYNCHRONIZE DIALOG WITH BOM CMIARCHIVE ocooconcnnconcnncnnconcnnconnnnncnncnnnnnos 119 FIGURE 104 BOM ASSEMBLY WITH CMIARCHIVE 2 2ccecceceececcecceceeceececceceecucceeaesateueeeeas 119 FIGURE 105 GC ATANALYS Sueiro ia tiernas 120 FIGURE 106 ANALY SIS sucd eiii tito e iire 121 FIGURE 107 EXPAND V5 ANAL Sud dsd iria 121 FIGURE 108 EXISTING PRODUCT STRUCTURE ELEMENT LOADED BY CM1 02ceeeeeeeees 122 FIGURE 109 CMI PRODUCT WITH EXISTING CATANALYSIS 0ccecceceeceeceseeeeeceeeeeneeeeeeenenes 123 FIGURE 110 CATIA WORKBENCH AFTER EXPAND MODEL ON PARTNUMBER 2 2eee0e200 123 FIGURE 111 EXISTING CMIARCHIVE WITH CATANALYSIS LOADED BY CMI 0202c0eeee 124 FIGURE 112 CATIA
13. 88 CMI User Manual The icons Create in Teamcenter and SaveAs in Teamcenter are only active if you are working with a CATPart in a CATPart specific Workbench or with a CATDrawing in a CAT Drawing specific Workbench The icon Synchronization in Teamcenter is only active if you are working in the Product Structure Navigator CMI also supports storing CATParts as V4 Models The icons Create V4 Model and SaveAs V4 in Teamcenter are only active if you are working in a CATPart specific Workbench but you can also create CATIA V4 model if you ve selected a CAT Part in the Product You can get the Teamcenter Information of the CATParts CATProducts CATDrawings and CATIA V4 Models with the CMI Info Button if you loaded the Product Structure with CMI to CATIA V5 The other commands will be described in more detail later in this chapter An administrator can remove any CMI Command from the toolbars and menu in order to keep the interface lean Please see Customizing Manual for details On UNIX the commands on subordinate toolbars are part of the main toolbar CMI Options The CMI options in CATIA can be found in the Tools gt Options menu in the General gt Compatibility section under the CMI tab Options PRLDE a a 7 P V4N5SPACE v4 vssPEC Migration Batch aoxmL cur pemmans oxe gt General a na Kall Display F CMI CATIAVS Module i Version 97W10 Ee Compatibility
14. ERROR IN PERSONAL ENVIRONMENT SCRIPT ERROR IN GENERAL ENVIRONMENT SCRIPT FAILED TO OPEN THE LOGFILE TEMPORARY PART TEMPORARY MODEL NO ASSEMBLY DROP ERROR NO ASSEMBLY LOADED NO MODEL LOADED SYMMETRY NOT ALLOWED ACTIVE MODEL WRONG ALL MODELS IN READ ONLY ACCESS ACTIVE MODEL WRONG NO MODEL SELECTED Description Your model has been loaded successfully Your model has been saved successfully Your model has been updated successfully Your assembly is now loaded Your assembly is now loaded temporary Your assembly has been successfully updated Your DROP action has been successfully finished No model or assembly has been changed since loading The model you want to create is already in exchange map So a overwriting would be performed and could cause lost of model data No position has been changed since loading This is just a hint that the init process was started This is just a hint that the init process was ok The request was refused because an EDM process is always pending Please end the current action and try again The panel files can not be found please consult your CATIA system administrator Your private environment settings script is corrupt Please contact your system administrator The general environment settings script is corrupt Please contact your system administrator You have specified a log file in your setting This log file cannot be opened You have selected a temporary part
15. e te After your confirmation Teamcenter comes up Drag and drop parts assemblies documents or models into the Workbench Expand or Deexpand the assemblies or models in the workbench Send it to CATIA with Action gt To CATIA Modify your CATIA model Write the modifications back with METAPHSE gt UPDATE gt ALL After your confirmation the geometry and position information will be updated in Teamcenter Enterprise t You ve loaded a Teamcenter Enterprise document with n CATIA models and want to modify one of these CATIA models You can switch to any CATIA model in memory and modify it After you ve finished write the modifications back with METAPHSE gt UPDATE gt ACTIVE see also chapter Switching the active model 60 CMI User Manual es METAPHSE gt UPDATE The menu item UPDATE contains actions to update geometry and position information in Teamcenter Enterprise UPDATE gt ALL This menu item updates all geometry and position information in the Teamcenter Enterprise database All items must have been loaded from your Teamcenter Enterprise system before Read Teamcenter Enterprise CATIA items with METAPHSE gt READ Modify the geometry or position information Write the modifications back with METAPHSE gt UPDATE gt ALL Sy After your confirmation a list of models that have been modified will come up in CATIA If some models were active but the user must not change
16. which cannot be transformed in its position Your active model is a part of a temporary added document Such models can t be created or updated Please swap back to the model loaded active if you wish to save it You have selected a normal model that isn t a part of an assembly An error occurred while you tried to drop a model This may happen if a drop to an active model was performed To fix it please change your work plane before DROP Only one model is loaded No model was loaded to perform this action Symmetry is allowed only for geometry position changing Change the current working mode to geometry The active model is inside of the subassembly selected for modification Please swap to a model outside of this subassembly Your active model is a temporary empty model it is only used internally Please swap to the model your selected action is related to You tried to replace an assembly outside of your work plane Please change your work plane No model was selected Please change your work plane 19 80 20639 20640 20641 20642 20643 20644 20645 20646 20648 20650 20653 20654 20655 20656 20760 20761 20762 20763 20764 20765 20800 20801 20810 20811 20812 20900 20910 20911 20920 20921 ACTIVE MODEL HAS NO FRAME MODELNAME IS MISSING SOME MODEL S ARE NOT READABLE FAILED TO RENAME MODEL MODEL IS NOT READABLE FAILED TO SAVE MODEL FAILED TO UPDAT
17. 33 Draft named BLATT in appdefault obj the value following the keyword indicatordraft a View named FRAME in appdefault obj the value following the keyword indicatorview and Details like DIN AO and DIN A1 in appdefault obj one of the values following the keyword frames a s o Each Detail represents a possible title block which is to contain values out of the PDM System Catedm data appdefault obj general options connectmethod xtitle CMI exchangemap tmp exchange diname CATIA SUSER MPO1 MAP beer ike e Eco modelnametype 1 modrenallowed 1 geoposallowed 0 edbapphost S HOST debug 0 project UNKNOWN catiaversion 422 anparis l tmpaxis dlname example CATIA STANDARD MPO1 AED Saeta eS MEMO DE wpmodus 0 CONE SES Cut ol SU si Mormon V assembly symmetry 1 modellinks 1 Mons e Stats cum Ereman autorefresh O MA SAO St cal load warnimg l merge support 1 remove models 1 newupd 1 replace model 1 cmi custom update 3 Dex SUPPO r E 0 opos layer list sexamo Let UL Suso o bbox layer list example2 1 frame option redraw default yes Lima rCavordranke BLATT indicatorview FRAME standard format ISO frames DIN A0 DIN A1 DIN A2 DIN A3 DIN 44 definition script dshdrawingframe sh Color op elon ere ate plo Emile ves plotformat IBM GL eso E iC 4 Te A A O EOE terze oc AU AM DS al orientat
18. AS for overwriting old models Thus be sure that the model to be overwritten can be deleted CMI User Manual 31 Creating a new model A Load or create your CATIA Model in the CATIA session In CATIA METAPHSE gt DOCUMENT gt CREATE CATIA goes to the background oe A Teamcenter Enterprise Create CATIA Model dialog window appears Figure 26 Enter a model name the suffix lt model gt will be created automatically anda description and select the work location where the model should be saved Press Ok If you press Apply the window will not close after creating a new model and you can enter a new model name and generate another CATIA model with the same content J Create CATIA Model File Hame Work Location E Current Host Hare epdmd 69 W Register in the Database Description Template E Clear Cancel Figure 34 Dialog Create CATIA Model opened from CATIA 32 CMI User Manual Plotting a model Conventions The CATIA Teamcenter Interface permits an automatic update of title blocks in CATIA models with title block values that are retrieved from Teamcenter Enterprise The CMI function identifies title blocks ina CATIA model by means of a naming convention This naming convention is threefold in the way that it affects three levels of CATIA data in the model whose identifiers have to start with strings qualifying them to be constituents of a title block Tho
19. Components A Component cannot contain other Parts Please refer to the Figure 23 Predefined CATIA model structure on page 19 for more information about a default assembly data structure Creating a Part Creating an assembly D In a Teamcenter Enterprise browser window select Create gt Product Structure Classes gt Assembly Creating a component Ina Teamcenter Enterprise browser window select Create gt Product Structure Classes gt Component Searching for Parts Searching for Assemblies E In a Teamcenter Enterprise browser window select Query gt Product Structure Classes gt Assembly CMI User Manual 43 Searching for Components In a Teamcenter Enterprise browser window select Query gt Product Structure Classes gt Component AAA ss Creating a Structure To create a structure in Teamcenter Enterprise the parts of the Assembly need to have been created see the section Creating a Part in this chapter A relation uses part is generated by dragging and dropping the used part onto the part that uses it For example to create the relationship Part 1 uses part Part 2 just drag and drop Part 2 onto Part 1 The relationships need not to be made in a specific order For example the two steps to create the structure of the figure below are interchangeable drag and drop Part 3 onto Part 2 drag and drop Part 2 onto Part 1 Uses Part Uses Par
20. Drop the assembly structure or a model you want to use in CATIA V5 into the CATIA Workbench Expand it as necessary Click Action gt To CATIA in the Workbench menu Changes expands you make to other assembly structures in the Workbench will not be sent to CATIA D p Ei CATIA comes to the foreground with the selected product and the used structure The dropped part structure is removed from the CATIA Workbench after you send it to CATIA Via Synchronize you can save the new Use Relation in Teamcenter AAA CMI toolbar Replace from Teamcenter Replace the selected product in CATIA by a different Part from Teamcenter Read an assembly into CATIA using the CMI toolbar Read command Select a product to be replaced In CATIA V5 select the Insert from Teamcenter icon FA Drop the Part that you want to use in CATIA V5 into the CATIA Workbench Expand SS tas necessary Click Action gt To CATIA in the Workbench menu Changes expands you make to other assembly structures in the Workbench will not be sent to CATIA CATIA comes to the foreground the selected product is replaced by the part or structure from Teamcenter The instance name and positioning information is preserved The dropped part structure is removed from the CATIA Workbench after you send it to CATIA Via Synchronize you can save the new Use Relation in Teamcenter The previous relation is deleted CMI User Manual 105 eC Highlighting of CATParts CA
21. Manual 117 environment CML ARCHIVE BOM CHILDREN ON BOM Parts can only be inserted into already existing Archives Load an existing Assembly from Teamcenter Insert the Root product of the product structure you want to become a CMI Archive Use Create Attach Archive to create the CMlArchive Load a Part or Assembly from Teamcenter and insert it into a product that is part of the CMI Archive or use the Insert from Teamcenter command CATIA V5 CMI BOM Assembly N BOM Assembly P rchiveProduct1 ArchiveProduct1 1 oN ArchiveProduct3 ArchiveProduct3 f a w BO omponent BO omponent M omc BOM Com 1 F N ArchiveProduct4 ArchiveProduct4 1 Applications J CON P BOS 1 y AA ed Figure 102 CMlArchive in BOM Assembly An Archive with BOM Parts can only be updated with Synchronize Teamcenter CMI will create an Assembly Structure relation between the BOM Part and the Assembly that attaches the Archive 118 CMI User Manual CMI Synchronize Teamcenter Operation List BOM Component BOM Component CATPart BOM ee ArchiveProductl CMIArchive Update BOM Assembly BOM Assembly CATProduct Update Link T Synchronize Close Figure 103 Synchronize dialog with BOM CMlArchive For that reason you can only attach BOM Parts if the Archive was loaded together with its Teamcenter Assembly BOM Assembly Ly BOM Assembl A gt gt gt Accepted Dee
22. OPTIONS CACHE MANAGEMENT 2 0eceeececceececcecceececeeseeseeeeeeeeeaees 125 FIGURE 113 INTEGRATED VIEWERS 0cceccecceceececceececeeceeceeaeceecuecueaececeeaueaecueceeaesaesueaneas 126 FIGURE TIA TO VIEWER ACTION saturar aiii nia 127 FIGURE 115 MODEL FILTER PREFERENCES DIALOG 0 cecceceececcecceceeceeceececeecuecesaesaeeneaeeas 128 CMI User Manual CMI User Manual FIGURE 116 FIGURE 117 FIGURE 118 FIGURE 119 FIGURE 120 FIGURE 121 FIGURE 122 FIGURE 123 FIGURE 124 FIGURE 125 FIGURE 126 FIGURE 127 FIGURE 128 FIGURE 129 FIGURE 130 FIGURE 131 FIGURE 132 FIGURE 133 FIGURE 134 FIGURE 135 FIGURE 136 FIGURE 137 FIGURE 138 FIGURE 139 FIGURE 140 FIGURE 141 FIGURE 142 FIGURE 143 FIGURE 144 FIGURE 145 FIGURE 146 FIGURE 147 FIGURE 148 FIGURE 149 FIGURE 150 FIGURE 151 FIGURE 152 FIGURE 153 FIGURE 154 FIGURE 155 FIGURE 156 FIGURE 157 FIGURE 158 FIGURE 159 FIGURE 160 CHANGE VIEWER PP REFERENCES di 128 VIEWER PREFERENCES DIALOG cis da 129 EXPORT FROM VISMOCKUP 2 0cceceececeececeececececeeaeceeaececaececnececeeaeeeeaeeneaeees 129 SELECT VIEWER FILE NAME DIALOG 22 02c0cceeececceccecceccecceececcuececeuccascuseaeeaes 129 OPENED IN CATIA 00 ecceccececceccecceceeceeceececaecuecesaecaecueceeaecaecueceeaecuesueaesaneneaeees 130 RESULT OF AN EXPAND MULTIPLE LEVELS ccccecceececcecceccecceccescesenseaees 130 RESULT OF AN
23. TOKEN S1 echo TOKEN TOKEN case TOKEN in DIN A0 echo string Created Date EOS OS ILS areas CEP TDS ERA COLOm lai pie e Eo O AS ae o en WHsGhedie O Spa e Ocal AS Ss 921 a lala Ol gate is E escanea he goutis Le e Schoo sitio Moda AMO dato On ESO So UA OS O OT CARDS Toco lO E Oe E EOS o DO En OO AS paco Sita ME Ola Erne type Tr AMES So UA AS Cama AA echo string Name Name PND O SS a ONE HUASCO too O E Men tato OSO OO Sa e e S parant OA Es e cian Ss OS e T ato elie Seca Use Suso PIS AA OS A de ao ne CEPAP ESO O teen Sle AOS AS ae So folant DES Pe caes Ss soe Os US Esa OA a In this shell script drawingframe to be found in directory catedm bin the user is to define the entries PDM contents for his previously defined views like DIN A0 DIN A1 a s 0 In this example the view name DIN AO is put in comment Thus all subsequent entries would apply to just any titleblock defined by one of those views DIN AO DIN A1 a s o not only to DIN AO Such a view might contain several entries An entry for an example looks like the following string string Company Name Created Date xpos 380 ypos xpos 2 ypos size size string Modified ModificationDate xpos 2 ypos string Name Name xpos 0 ypos color 3 xpos 20 size size string User S USER orientation 1 ypos size In gen
24. Teamcenter command This allows to reference CAT Scripts that are held in Teamcenter in existing or new catalogs To use a CAT Script in a Teamcenter managed catalog the CAT Script must already be registered in Teamcenter as a CATIA Script class object Copy your CATScripts to your Worklocation and register them in Teamcenter CMI User Manual Host Mame wide5esy3115136 Work Location Work Location File Name InsertWMacro cCaTscript Assign to Class CATIA VO Process File CATIA VO Product File CATIA V5 Part File CATIA V5 Representation File CATIA V5 Design Table Text File CATIA HPGL Plot File CHI Mapping file CATIA TIFF Plot File CATIA V5 CGR for Cache File Figure 130 Register CATIA Script dialog To insert CAT Script macros into a Catalog open the Catalog for editing To open a Catalog that is already managed in Teamcenter for editing use the Read Catalog command Select an end chapter Click the Insert CAT Script from Teamcenter command A Teamcenter query for CATIA Scripts will appear 7 Query for Generic script file S i Work Vault Location Staging Area List a v Working File Name List A Y Desc Path Format y Working Path Format y se Checked Qut y Shadow Copy y Randomized y OQmer Dirk r Project Name Tr Superseded False y Frozen y Life Cycle State y Externally Managed y Current Life Cycl LC Rev Star
25. This menu item rotates the selected part around an axis Read an assembly as described in METAPHSE gt READ Select workplane as described in chapter ASSEMBLY gt MOD STRU gt MOVE WP Select MODPOS gt ROTATE Select a part in a sub tree of the actual workplane the selected tree will be 13 highlighted red Select an vector line the selected vector line will be highlighted red In addition a rotation angle occurs to visualize the rotation direction Enter an angle or Select a point line plane and a 2 point line plane A rotation angle will be calculated and displayed Confirm with YES The selected part will be rotated ASSEMBLY gt MOD POS gt MOVE gt AXIS This menu item moves the selected part from one coordinate system to another one A Read an assembly as described in chapter METAPHSE gt READ A Select workplane as described in chapter ASSEMBLY gt MOD STRU gt MOVE WP Select MOD POS gt MOVE gt AXIS Select a part in a sub tree of the actual workplane the selected tree will be red highlighted Or Confirm with YES Select part in list Select first axis or create your axis by Select a point to create the base Select another point line plane to create the x axis change direction by ENTER Select another point line or plane to create the y axis change direction by ENTER Confirm with YES to create the z axis Select second axis or create your axis b
26. Write the modifications back to Teamcenter Enterprise with the Synchronization in Teamcenter icon CMI User Manual 93 The following dialog will appear showing you which changes need to be written to Teamcenter Enterprise y CMI Rack_Assm N Rack Assm Nrack Rack 1 E Muewscrew NewScrew 1 A be 10_Screw 10_Screw 1 z Miscrew Screw 3 W 101 Screw 101_Screw 1 i CMI Update and Create in Teamcenter 2 x Niscrew Screw 1 be 101_ Screw 101_Screw 1 h Operation List Part Number Type Operation execute Result 10 Screw CATPart Create Screw Screw 4 A s PRITE T ET NewScrew CATProduct Create Link child Y p 101_5crew 101_5crew 1 101_Screw CATPart Update Y Applications Screw CATProduct Update Y Rack_Assm CATProduct Update Drop child Link child Y Output window Process next operation Process all l Figure 78 The Synchronization in Teamcenter Dialog The dialog s Operation column shows which procedures need to be performed in Teamcenter Enterprise for each object and may be a combination of the following Update The file and positional changes of any children will be updated in Teamcenter Enterprise Create The object will be created in Teamcenter Enterprise The object is completely new and not already in Teamcenter Enterprise Link child At least one new parent child relation will be created in Teamcenter Enterprise This reflects the add
27. amp i Every top level item in the CATIA Workbench will be opened in a separate browser in CATIA V5 CMI toolbar Update Teamcenter This command updates geometry and position information in Teamcenter Enterprise 92 CMI User Manual Modify the contents in CATIA Write the modifications back with Update Teamcenter icon Modified geometry CATProducts and transformation matrices will be updated CMI Messages 2 x CMI Warnings CMI Information Component file LEW Motor CATPart updated CMI Operation Statis eT O Update finished Figure 77 Dialog Window for Update CATIA Models ee CMI toolbar Synchronization in Teamcenter This command updates Teamcenter Enterprise with any changes made to your CATIA V5 Product Structure The changes that will be reflected in Teamcenter Enterprise include e any geometry and position information changes e the creation of any new CATParts CGR and CATProducts that have been added to your Product Structure e the creation of any new CATPart CGR and CATProduct instances e the removal of CATProducts from the Product Structure The list of changes made to the Product Structure since the last Read Update Synchronize is presented in the form of list of operations to be performed in Teamcenter Enterprise Modify your product structure in CATIA by adding a new CATPart CGR adding a new CATProduct removing a product or by changing the geometry of a CAT Part
28. and are thus relevant for the customization In this case the parameter list Date ModificationDate Name will be transferred to the x3GetAttrsForCAD CMI method as Attrs_demanded string list Now this string list can be scanned for each custom parameter the variable AttrVals_found is extended and given back to the CMI server The CMI server can now actualize all those titleblocks containing these entries with the most recent database information 39 Pdmltem x3GetAttrsForCAD DOCBEGIN KKEKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK Method Function x3GetAttrsForCAD Class Pdmltem Description Handles the x3GetAttrsForCAD message for the Pdmltem Message type is an object message This method delivers a set of attribute values found for a set of demanded attribute types It is called immediately after a Model Read in case the Model read is structured in accordance to a drawing frame defined in the script drawingframe The method provided on deliverance of CMI serves as an example showing how drawingframe and x3GetAttrsForCAD are supposed to cooperate In practical use this method will be overwritten in the Collo cmon us tEOnization called within xOWkBnch x3GetAttrs Language e PAE eme es E by Oke Sp or oy Gr or CA O Sp by A OA O Type Name Description SSS SS SS SS SS SS SSS 4 CO ObjectP
29. command Create command and SaveAs command To configure this behaviour an administrator can set the following variable in the Catia V5 environment CMI ENABLE ASK FOR BOM PART ON The default can be set with CMI BOM PART DEFAULT FOR SYNC one of BOM NOT SET NOBOM NOT SET forces the user to make a choice BOM by default creates a BOM CATPart NOBOM or not defined Creates NO BOM CATParts CMI OOTB behaviour Synchronize command The Synchronize command has a new function button Edit PDM Part category in the Synchronize dialog CMI Synchronize Teamcenter e ioj xj Operation List Part Number Aragan E a o Se o CATPart WOT SET Product ROE I reste a Link child Info __ Synchronize Close Figure 143 Synchronize dialog with enabled Edit PDM Part category button CMI User Manual 143 This button is enabled when a line with a CATPart model or CGR is to be created Then the user can select the BOM or No BOM type in the Edit new PDM Part category see Figure For the BOM type Teamcenter will create a new Part document and data item For the No BOM type only the data item will be created If NOT_SET is selected the Synchronize command will not start PartNumber pain POM Part category poes e BOM Type Mo BOM Type NOT SET Previous Figure 144 Edit new PDM Part category Create command After starting the Create command the user is asked for the type of the part whi
30. e g from CATIA NERO UE Sta mist havena eeban Men Sea a eS UI e hulls cia oe heaieimechic ola 0s alte gt SA BOS Pos a O So A Sia e leas noo us tas ESO rie OS description SO z mandatory Free Tert Tera TESS a EEES DOS ASICS Oe text position real values e g 10 0 belongs to view axis system default xpos 0 0 ypos 0 0 font a e ES pes Sibarita CDS aah ATTENTION some other attributes may depend on this co ars detroit tee derimedi1 ns le chavercnacl orientacion 0 gt horizontal 1 gt yerrtical default 0 Color gt s 0 gt no See gt req green gt blue So default 1 Aa 0 N E l V width sc mandatory real value e g 3 0 dera ul e size height of text real value e g 5 0 Sa it MO lane lovey so reo ao mils ad exe lence as RE ai details 5450 slant degrees real value must be between 0 0 and 45 0 detail OnO space space between text characters real value deraut o linetype P le Or COMAS 2 gt Underscoring SS sare angie 4 gt overscoring elSane oie Ml thickness real value e g 3 0 deraut ss 20 JUSTAS AA CSS e e EMO 0 eran Us ao a tons middle lea else Wee eee al EZ Tote We Teen Red exit values must be O everything was fine I farled 2 unknown frame name HH HH HHH E E E E E E S 4 SSF SS HS ST HHH 434244 4 4 4 4 E E 474 3 0 4 4 E E E E E E 3 4 4 42 07 0F HH HF 4 4 CMI User Manual 37 be St Lle 0 then exit 1 Gr
31. fields and press OK A new model will be created in the Teamcenter Enterprise environment we Notice Q If the active file was opened with File gt Open in CATIA it will be replaced by the new model registered in Teamcenter Enterprise If the active model came from Teamcenter Enterprise the new model will be added to the CATIA Session and made the active model 0 So in both cases you can continue to work with the model and later update it in Teamcenter Enterprise The content of the CATIA Workbench is not cleared CMI User Manual 63 DOCUMENT gt MUL CRE multi create This menu item creates multiple Teamcenter Enterprise CATIA model objects from the CATIA Session The new CATIA models are assigned to one DOCUMENT For each model a Teamcenter Enterprise dialog window appears and you can enter additional attributes It is recommended to use this functionality to import supplier CATIA Sessions models into the Teamcenter Enterprise database So only models loaded by native CATIA FILE SESSION OPEN will be offered to be created A Load several models from a native CATIA MAP METAPHSE gt DOCUMENT gt MUL CRE Select the models to be created in Teamcenter Enterprise ts Notice Q If the active model was opened with File gt Open in CATIA it will be pre selected CREATE to confirm Drop a DOCUMENT into the CATIA Workbench For each model a Teamcenter Enterprise dialog window appears Fill out the fie
32. function the administrator has to set the CATIA V5 environment CMI ENABLE CMIUPDATEPARTCMD ON This function updates all modified CATParts in Teamcenter Transformations and CATProducts are not updated amp To enable this function the administrator has to set the CATIA V5 environment CMI RESTORE POSITION ON This function restores the positions to their original state loaded from Teamcenter CMI User Manual 145 Reset Invalid Positions Ain optional CATIA V5 menu item that allows to reset invalid Model positions to the initial state identity matrix CMI ENABLE RESETINVALIDPOSCMD ON Get onginal geometry from Teamcenter at EE To enable the Get original geometry from Teamcenter command the administrator has to set the CATIA V5 environment CMI ENABLE CMIGETORIGGEOCMD ON A Part or V4 Model has to be selected in the product structure The commands retrieves the geometry file CATPart or V4 model from Teamcenter if it is not yet loaded in CATIA V5 The function is used in context of the Release Cache Working with CATIA V5 Released Cache to get the original geometry file from Teamcenter if only CGR s are transferred by the configuration Choose Update Position To get this function the administrator has to set the CATIA V5 environment CMI_ENABLE UPDATEPOSITIONDIALOG ON This function is available for normal Update and the Update Position Toggle keep state Cancel Figure 148 Choose Matrix
33. it Part 4 1 Part 5 A 1 objects FoLnd gt gt gt Accepted Attaches opti 1 objects Found gt gt gt Iecepted Irop on he ne Cat za Item Part 1 A 1 v Figure 40 Drag amp Drop an assembly into the CATIA Workbench D Select Part 1 in the CATIA Workbench Choose the Expand option in the Pop Up menu of the part The parts that are used by the selected assembly appear You can expand one level or multiple levels Caution if you have created complex assembly structures this action may need some time to expand all levels of the assembly CMI User Manual 47 Catia Item Part 4 A 1 was created Catia Item Part 5 A 1 was created Expansion complete It is also possible to choose the Expand Multiple Levels function with the View gt Display Models option In this case the structure shown in the CATIA Workbench is the same as before plus the models Part 4 Part 4 model gr e A 1 Part 5 Part 2 ES Part 5 Ly Part 2 A A Part 5 model cer Milos 5 Part 2 model Part 2 1 1 Part 3 Ly Part 3 A art 1 1 Part 3 model Part 3 1 Part 1 model dep P E Refresh is complete Refresh is complete Expansion complete Figure 42 Expanded assembly structure with models in CATIA Workbench y You can now decide to either load the whole assembly or to load the assembly with only a selection of sub components parts To exclude a subpart
34. manage CATIA V4 and V5 models and assemblies in the Teamcenter Enterprise and CATIA V4 and V5 CATIA V5 uses assemblies similar to Teamcenter Enterprise CMI makes a bidirectional mapping between the Teamcenter Enterprise structure and the CATIA V5 structure So users have the full functionality of Teamcenter Enterprise and CATIA V5 _ a CMI joins the advantages of CAD with PDM CMI User Manual The CATIA Teamcenter Interface combines the CAD Excellency of CATIA with the power of the PDM system Teamcenter Enterprise It provides the user with a more sophisticated way of working with CATIA by allowing the management of product structures and multiple level assembly structures within the PDM system The CATIA Teamcenter Interface CMI permits Integration of CATIA data in workflow e g release control Management of CATIA data in vaults without knowledge about the underlying file system Updating concurrent engineering processes by different users Attachment of plot files to their corresponding CATIA models Distribution of CATIA data in a network Simultaneous management of CATIA data and structures Construction of part structures within Teamcenter Enterprise Individual Parts to contain more than one physical CATIA model Modification of the position of the structures Search for CATIA data by different attributes Automatic load of Meta data stored in Teamcenter Enterprise to fill the title blocks of CATIA drawings C
35. menu item creates a Teamcenter Enterprise CATIA model object from the model that is currently active in CATIA A CATIA model selected in Teamcenter Enterprise and dropped into the Workbench is then overwritten by the contents of the CATIA model in CATIA memory Please refer to Chapter 6 for more information how to create a CATIA model object in Teamcenter Enterprise Design or load your local CATIA model In CATIA select METAPHSE gt DOCUMENT gt SAVE AS Double click or drag the Teamcenter Enterprise CATIA model object that you want to create into the workbench It s contents will be overwritten with the model that is active in CATIA Q If the model you save was opened with File gt Open in CATIA it will be replaced by the model you dropped If the model you save came from Teamcenter Enterprise the model you dropped will be added to the CATIA Session and made the active model So in both cases you can continue to work with the model and later update it in Teamcenter Enterprise The content of the CATIA Workbench is not cleared DOCUMENT gt CREATE This menu item creates a Teamcenter Enterprise CATIA model object from the model that is currently active in CATIA A Teamcenter dialog window appears and you can enter additional attributes 4 Design or load your local CATIA model In CATIA select METAPHSE gt DOCUMENT gt CREATE A Teamcenter Enterprise dialog window appears Fill out the
36. new files The save restore session does not restore files that were not loaded from the PDM system CMI Advanced Toolbar Reconnect Teamcenter 106 CMI recognizes files that have been loaded into Catia V5 through the Catia Workbench Since it knows that they are from Teamcenter it can update them there Other files that you load with eg File gt Open it will not know They will be regarded by Synchronize as new files and it will create new Teamcenter objects for them CMI User Manual If you open a product structure from disk that contains files that are already in Teamcenter you can use Reconnect Teamcenter to make CMI recognize these files It will recognize Products if the Partnumber is correct and CATPart model files based upon their filename If the CATPart is a BOM CATPart Component in Teamcenter the Partnumber must also match Synchronize S TC file access Partnumber Instancename Parent Partnumber Type Filename Y CMI Unknown Read Write ExternalStructure CATProduct ExternalStructure CATProduct C Ignore item Y CMI Unknown Read Write ExternalAxis Axis 1 ExternalStructure CATProduct ExternalAxis CATProduct Que Y CMI Unknown Read Write ExternalAxisGeo AxisGeo 1 ExternalAxis CATPart ExternalAxisGeo CATPart ean Y CMI Unknown Read Write ExternalWheel Left Wheel ExternalStructure CATProduct ExternalWheel CATProduct New ECMI Unknown Read Write ExternalinnerWheel InnerWheel 1 ExternalWh
37. not load items that are already loaded Working with marked Parts 50 D SS ra e To speed up your work with the CATIA Workbench it is possible to mark parts assemblies or models Marked items are shown with a blue icon It is possible to apply the following functions to the marked items In the CATIA Workbench Action gt Marked Items gt Deexpand Marked Items All marked items and sub items are removed from the CATIA Workbench In the CATIA Workbench Action gt Marked Items gt Unmark All All items are set to the unmarked state In the CATIA Workbench Action gt Marked Items gt Marked items to CATIA All marked items are sent to CATIA If Teamcenter the OMF server and CATIA run on the same host you can use this command directly Otherwise you have to initialize the communication from CATIA CMI User Manual CMI User Manual with METAPHSE gt READ or METAPHSE gt REREAD first 8 AA SS eae ee er ae ee ee ee ee ee ee ee ee ae ee ae ae ee ee ee ee ee ee ee er ee ee er ee ee ee ee er ee ee er ee ee ee ee es ee ee i ee ee ee ee ee a ee eS ee ee ee es ee ee eS eS eS ee ee ee ee Se ee ee ee es ee ee eS SS eS eS eS es ee ee ee eS ee ee ee ee ee ee l In the CATIA Workbench Action gt Marked Items gt Highlight Marked Items All marked items and sub items are highlighted in CATIA a D y Note that this function is only available if Teamcen
38. seececeeceececceceeceececcecaeceeceeceeaeceeceeaeseeeneaneas 92 CMI TOOLBAR UPDATE TEAMCENTER c cecceccecceccecceceeceecaeeaecaeecuecueceecueceecueeueeaesaeenseaees 92 CMI TOOLBAR SYNCHRONIZATION IN TEAMCENTER 22 20 eeceeeceececcecceccecceccecceceuseesenseaees 93 CMI GEOMETRY TOOLBAR CREATE IN TEAMCENTER cceceececcecceceececceeeeseeceeeeeaeeeeeeeeenes 99 CMI GEOMETRY TOOLBAR SAVEAS IN TEAMCENTER cecceceececcecceceececceeeeeeeceeeeeneeeeeeenenes 99 CMI GEOMETRY TOOLBAR CREATE V4 MODEL 0ececeececeececeececeececeececeeeecesaeceseeeesaees 100 CMI GEOMETRY TOOLBAR SAVEAS V4 MODEL IN TEAMCENTER 2 eccececeececeececeeeeceees 101 SMITOOEBARSCVHINEO cunas a a ee a et eee 101 SMITOOEBAR PADD TEMES are ete a o a Bete ee eatin 103 Visualize multiple revisions of an Assembly USING Add Temp 1 ccccsseseecsneeeeseaees 104 CMI TOOLBAR COMPARE VERSI N a de 104 CMI TOOLBAR INSERT FROM TEAMCENTER 2 ecceccecceeceeceeceecceeceececcuecuecuseueeutearsaseasens 105 CMI TOOLBAR REPLACE FROM TEAMGCENTER tito dei a de de ed 105 HIGHLIGHTING OF CATPARTS CATPRODUCTS AND MODELS IN THE CMI WORKBENCH 106 CMI ADVANCED TOOLBAR LOCAL SAVE AND RESTORE 2 2cceeeeceececceceeceececcececeseeeaes 106 CMI ADVANCED TOOLBAR RECONNECT TEAMCENTER coococcnccnnconconccncnnconccnconcnnncncnnnnnnnns 106 HANDEING OF GAT DRAWINGS ered esacterece haw la bd 108 Creating a CATDrawing From a Single Model occc
39. that need confirmation Your Comments are Welcome Please feel free to tell us your opinion we are always interested in improving our publications Mail your comments to T Systems International GmbH GDC Product Lifecycle Management Fasanenweg 5 70771 Leinfelden Echterdingen Germany mail cmi_support t systems com vi CMI User Manual Table of Contents CHAPTER tag Oe ne Re SO oe a Oe Re SOR ro RE AA OR EO EE 1 OVERVIEW lt di 1 INTRODUCING CMI CATIA TEAMCENTER INTERFACE oooccccccoccncoconcnncccononconanonnnnoncnnonencnnnnnos 1 CMI JOINS THE ADVANTAGES OF CAD WITH PDM 2 cccececcececcececcececcecececcucuccucecsecauaecass 1 EE E EEUE e co ica AE 2 CHAPTER 2ra a aa 3 CENO STARTED 0 00 a e a E 3 ASSUMPRONS rata cara 3 STARTING APPLICATION So alo ar aciaede o 3 ENABLING THE CMI TOOLBAR IN CATIA VB ccccececececccccccccccecececececececesetecenenetetenenecenecs 4 ENABLING CMI IN THE CATIA V4 FUNCTION PALETTE ccccececcccccccccccececenececeneneteneneneneness 4 GHIAP TER 3 0 stan eaatied A E EEA E E 5 THE CATIA WORKBENCH 2 abi 5 WHAT IS THE CATIA VWORKBENGH eds 5 THE CATIA WORKBENCH MEN ee le canal ei cad 6 MONTI AS cal one PEEN AOE A ae E EN TYE ett CT ca atacar sa l 7 MANO cic es ec ect et ose ek sca E E a se chs ds doe eee E E E 7 Meneo AAA A A A A as 9 MCG MCT QUIEN o iio 9 Mentira QUERY OMG 3 A Ia idas 10 Menoe Opon er E 12 PMU PTE TEN CES pei 13 e NS RA A SA II II A Re een RR er Pe 13
40. these models a status panel will pop up It is not necessary to confirm this panel Select the models you want to update The selected models will be updated in Teamcenter Enterprise Select Models to Save List of Parts Table Top Table OK CANCEL Figure 48 Dialog for Update CATIA Models UPDATE gt ACTIVE This menu item updates the geometry information of the active model in CATIA in the Teamcenter Enterprise database As a prerequisite the model must have been loaded from your Teamcenter Enterprise system before Read Teamcenter Enterprise CATIA items with METAPHSE gt READ Modify the geometry information Write the modifications back with METAPHSE gt UPDATE gt ACTIVE HgS EE After your confirmation the geometry information of the active model in CATIA will be updated in Teamcenter Enterprise This menu item can also be used to update the following models gt Models which have been loaded as a part of an assembly structure CMI User Manual 61 gt Models which have been loaded as a part of a Teamcenter Document that contains more than one CATIA model UPDATE gt POSITION This menu item updates all position information changed in CATIA in the Teamcenter Enterprise database As a prerequisite the assembly must have been loaded from your Teamcenter Enterprise system before _ Read Teamcenter Enterprise CATIA items with METAPHSE gt READ Modify the position information Writ
41. you have loaded has no root or an empty root Something is wrong with your assembly It isn t allowed to modify the selected model this model is a part of root The action performed was canceled by EDM system Some Models have incompatible project environment settings to your CATIA project Check your project environment Your assembly has been successfully updated For more information refer your EDM system Some models of the splitted document couldn t be updated Is your workbench open and initialized The action performed was ended with an error The panel function failed check if the desired panel definition exists in the panel install directory No info available for this model The ditto in current view isn t holding a valid plot format Please check the ditto The plot is finished The plot is in progress The selected plot format is invalid The work plane can t be moved in this direction The deepest or highest level in assembly structure has been reached No valid document found to set the WP A model with such a name always exists in your exchange map Please rename your model or check in the model in your exchange map first and retry Before something can be added temporary a model must be loaded with the read function CMI User Manual 20922 20923 20924 20930 20931 20932 20940 20941 20942 20943 20944 20950 20960 20965 20966 20967 20970 20971 20972 20973
42. 00 to indicate that there are 100 pieces of these screws needed for the assembly But you will not necessarily keep a CATIA model for the screw and you don t want to position each screw individually Therefore with the default parts CMI ignores the quantity Each part is transferred to CATIA only once matching the visible product structure To indicate that CMI should instead observe the quantity you can create a special subassembly relation the Uses Part Masters with Qty relation Whenever this relation is used to build an assembly the quantity will be observed in CMI In the example each of the 100 screws would be represented in CATIA Only one physical model exists but you can position each screw individually using the CMI functionality 56 CMI User Manual k Assembly Objects oj xj File Action Info Create Query Window Options View Help Item Identifier Class kev seq Nomenclature EX Lale A 4 Chassis Part A Chassis Part Get Item Into Get Spare Attributes Refresh Expand Relationship f Expand Multiple Levels P Show Relationship b Edit Relationship Uses Part Masters Uses Part Mastersa with CY m Help on Menu Is Described By r s PIL Has Rewision Effectiwities i Has Structure Efiectivities More b Figure 46 How to create subassembly relations that support Quantity The Uses Part Masters with Qty relation is created by dropping parts onto an Edit Relationship browser St Using a Multi
43. 02223 has i 1 DMIR1I4 01720 DM1R14 022021 DM1R14 021721 a SL a D Off S Off DMiri4 02173 1 592956 D Off S Off DM1R14 02173 1 59265 D Off 3 Off 1 objects are expanded gt 1 objects are expanded Expansion complete Figure 121 Result of an Expand Multiple Levels 130 CMI User Manual amp CATIA Workbench 5 CMI EPDMD90 20051 a loj xj File Action Info Query Options View Help DM1R14 022020 DM1R14 021720 DM1R14 022020 DM1R14 02204 DM1R14 0217 ig DM1R14 0220 E 1 11298 1 D Off S Off gt gt gt Accepted Expand for Visualization option initiating object server 1 objects are expanded Expansion complete Figure 122 Result of an Expand for Visualization Figure 121 shows a normal expand multiple level with all structures and models Figure 122 shows that the second part contains a Visualisation file which represents the whole part with models and substructures In CATIA V5 a new menu item Build Visualization is available that builds up or updates a visualization file from a selected product and stores the visualization under the selected item These cgr can then be created updated with the CMI Synchronize command A You can also use CATParts as a visualization file by setting the CATIA Model Type Attribute to CATIA V5 Visualization CMI does not control the content or actuality of the visualization file Catalog Management Manage Catal
44. 1 266666601544159 1e 01 CATIA End Box Max X 1 6000000000000000e 01 CATIA Bnd Box Max Y 4 599998474121091e 01 CATIA End Box Max z 1 4000000000000000e 01 print Figure 44 GetInfo CATIA Model dialog Help You can display all neighbour models to a model in the workbench In CATIA Workbench select a root assembly and select menu Action gt Create DMU File This assembly will be expanded down to all leafs and a DMU File is created with all absolute positions and the bounding boxes of all models This file is stored ina D DMU Vault Select the desired Catia model and select menu Action gt Show Neighbourhood The root assembly is expanded down to the selected Catia model and to all neighbour models by evaluating the DMU file For several Catia models Select the desired Catia models and select menu Query gt DMU gt Show Neighbour s The root assembly is expanded down to the selected Catia model and to all neighbour models by evaluating the DMU file D gt yta Notice You can affect the computation of neighbourhood by increasing the DMU Tolerance Increasing the DMU Tolerance means increasing the bounding box of the selected model In CATIA Workbench Options gt Change Preferences gt DMU Preferences Volume search for models You can display all models of a predefined volume in the workbench In CATIA Workbench select menu Query gt DMU gt Show models of DIMU Volume Al
45. 144 PART TYPE ASK DIALOG WITH CREATE COMMAND scceccecceccecceseeeeeeeeeens 144 PART TYPE ASK DIALOG FOR SAVEAS COMMAND sceseeseeceeceeseesseeeeeeueees 144 SYNCHRONIZE WITH DESIGN TABLE 22 02ceeceeeceececcecceccecceecuccuccuceeccuscueeaseaes 145 CHOOSE MATRIX TO UPDATE o ak 146 REFERENCE GEOMETRY 0 cececceceecececcececeececeececaececeececuececeeaeceeaesesaeeeseeaeeaees 147 EXPAND WITH REFERENCE ad 148 EXPANDED REFERENCE e e ate 148 SYNCHRONIZE WRITE IMPORT EXPORT MAPPING FlLE ocooccnccnccnccnccnccnccnncnncnn 149 CREATE GMUINVIAPPING EME e at lead Le Lt 149 CMI MAPPING FILE IN TEAMCENTER 22 22 eeeeeececcecceccecceccecceccucceccecceseueeseass 149 GMIRE CONNEC Tios ea tie ae oe AE di e tordo De ue 150 GREATESGMINMAPAINCA E e o a endo DU e 150 USE MAPPING FILE FOR EXPORT DIALOG 2 ceccecceeeeeeceeceeceeceececcucceeeueeueeaseaees 150 SELECT EXPORT DIRECTORY DIALOG lt a andes Gide isis 151 POR TINO RIAU OI Masset vada cito ae ee cc ec a eee 151 MODEL FILTER PREFERENCES onu elias 152 xiii CHAPTER 1 Overview This chapter provides basic information about the CATIA Teamcenter Interface and lists some features of this application interface E AAA Introducing CMI CATIA Teamcenter Interface The CATIA Teamcenter Interface CMI was developed by T Systems as a high end integration between the CAD system CATIA V4 and V5 and the PDM system Teamcenter Enterprise With this interface it is possible to
46. 5 and displayed in the Product Structure Navigator of CATIA V5 as shown in the following figure A ef Stat TeampDM fie Edt Yew Insert Toos Analyze Window Help 4 Py CMI CVS_CHAIR ES EVS CHAIR I 7 CV5_CHAIR_SEAT mdzprsgsite cmi4 20NTabb g gt 8 cio Ha CV5_CHAIR_BOARD mahggyfsite cmi420NTadc Es CV5_CHAIR_LEG mghggyisite cmi4 20NTadc gt E CV5_chair_leg CATPart CV5_chair_leg CATPart 1 3 H Cv5_chair_leg CATPart E 2 CV5_CHAIR_LEG mghggzasite cmi420NTadc oe GS CV5_CHAIR_LEG mghggzdsite cmi4 20NTadc B gt 7 CV5_CHAIR_LEG mghggzgsite cmi4 20NTadc a CV5_chair_leg CATPart CV5_chair_leg CATPart 1 e BY Constraints TA CV5_CHAIR_BACK mdzprtdsite cmi420NTabb E Applications 6 1 p s D e se 3 Gg EA EPA AAA RENA ERES AO MEA Figure 71 Product Structure Navigator in CATIA V5 CMI User Manual 87 In the diagram above the CV5_ CHAIR_BACK Teamcenter Enterprise Parts of object type Component are mapped to CATProducts within CATIA V5 The part CV5_ CHAIR LEG demonstrates the deeper structure of a part in CATIA V5 Immediately under the CATProduct CV5_CHAIR_LEG you will find the icon for the same part CV5_chair_leg CATPart This node and all following levels picture the associated model of the CV5_ CHAIR _LEG and its characteristics This is named the CATPart es You may also build completely new assem
47. 5 x File Action Info Query Options View Help Analysis CMI Analysis 1 9031134 ieee a ay ll Server at gt gt gt Accepted Drop on Workbench option initiating object EI E A Me CATIA Y5 CMI Archive Analysis ojx Start SmarTeam File Edit View Insert Tools CMI Window Help _ o x FN Analysis Manager Links Manager 1 g Link 1 gt C CMIXMAP Product caA TProduct L Results gt C CMIXMAP Analysis CA TAnalysisResults m i Analysis Connection Manager 1 von Mises Stress nodal value ar 4 Analysis Connections 1 N m2 y Omeg Finite Element Model 1 Nodes and Elements E Properties 1 f Materials 1 Isotropic Material 1 Isotropic Material 2 20911600 was pf wb ee Select an object or a command l Figure 111 Existing CMlArchive with CAT Analysis loaded by CMI The result is the CATAnalysis document in CATIA V5 Changes made by the user can be updated with the standard CMI Update commands sr If you only have the V5 GPS product but not a GAS license you can still store a CATAnalysis in a CMIlArchive Your administrator should add the following settings to the CATIA environment CMI_ENABLE_CRE_ANALYSIS_ARCHIVE ON CMI_ANALYSIS_ARCHIVE_OWN_WINDOW ON With these settings you can create a CMlArchive out of the Analysis Manager The second setting ensures that CAT Analysis opens in a separate window even if the CMlArchive is attached to an Assembly 124 CMI User Manu
48. 60 Clear cancel Figure 83 Dialog Window for Create CATIA Model in Teamcenter Work Location field set to the single available value in the selection list You may only create CATIA V4 Models from CATParts These parts mustbe opened in a CATPart Workbench window or be selected in the Product Structure ta Navigator With this toolbar button a CATPart file currently set active in CATIA V5 may be created in Teamcenter Enterprise as a CATIA V4 model A CATIA V4 model selected in Teamcenter CMI Geometry toolbar SaveAs V4 Model in Teamcenter Enterprise and dropped into the Workbench is overwritten by the contents of the In converted CATPart in CATIA memory Design or load your local CATPart In CATIA V5 select the Save As V4 in Teamcenter icon La Teamcenter Enterprise will request you to drag and drop an item in the Workbench In order to Save As V4 in Teamcenter with a CATPart double click or drag a CATIA V4 model or document with an attached CATIA V4 model to be overwritten into the Workbench in Teamcenter Enterprise Its contents will be overwritten by the CATPart active in CATIA V5 in CATIA V4 model format The Save As CATIA V4 Model toolbar button is only enabled if the CATPart item is open in a separate Workbench window in CATIA V5 101 a This command displays the Information from Teamcenter Enterprise for CATParts CGRs button displays attributes of the correspondent Teamcenter objects
49. A Workbench V5 CMI EDMG125 20050 loj x Fil Action Info Query Options View Help Assemblyl RootItem CMTIA ey Assembly Rootitem A ee Pata all 1 DAS O gt gt gt Accepted Expand Models option initiating object Server Tepes om omole Figure 100 Expanded Archive Item in the Workbench In CATIA V5 the TeamCenter informations are attached for the CMlArchive The CMI info dialog shows the Information for the CMIArchive object in CATIA V5 e CATIA V5 CMI Assembly1 UN EJ start SmarTeam File Edt view M CMI Archive Properties CMlArchive attributes Assembly 1 Exchange map archive file name i sembly1 C CMIXMAP Rootltem CMIArchive z N Rootltem RootItem 1 O changed in CATIA AN RootChild RootChild 1 iain A RootChild2 1 Revision ooo a RootChild3 RootChild3 1 re lRoottem More atribute information Applications po a 1509 8008 SO me OR am Teamcenter attributes iaa CATIA 1 element selected E Gj Figure 101 CMI Archive Info e The CMlArchive can be modified or extended e g by adding new CATParts The changed CMlArchive can be updated in TeamCenter with the Standard CMI Update Commands Use BOM Parts in CMI Archives Js It is possible to use BOM Parts from Teamcenter within an Archive To enable this functionality the administrator should set the following variable in the CATIA V5 CMI User
50. A dialog window as the one below appears Fill in the field File Name Fill in the field Work Location Create CATIA 5 Part File Ioj x File Hame HewtatPart Work Location wl tc31 epdmdi2 E Current Host Hare epdm4 Description HewtatPart CATIA Model Type CATIA Part Template Vault Location temprvl E Template x CATPart E apply Clear Cancel Help Figure 26 Dialog Create CATIA V5 Part File Push the square button beside the fields Work Location or Template Vault Location or Template to choose from a list of possible values If there is only one possible value pushing the button will fill in the field automatically Fill in the field Template Vault Location and Template CATIA V5 templates are CATIA V5 files predefined by the administrator in specific Vault Locations used as a basis to create other CATIA V5 files See also CMI Installation Manual lf the Description field has not been filled in a warning appears in the status line vis us is useful and recommended to fill in the Description field because this value will i Press Ok E Creating a CATIA V4 Model from a CATIA V4 Template From the Menu Bar in Home Collection select Query gt CATIA Files CATIA V4 Template Fill in the fields with data to refine the search a Press Ok 22 CMI User Manual Select the CATIA Template you want to use Use the
51. ATIA V4 files Enables the loading of CATIA V4 files to CATIA Use CATIA V5 CATPart files Enables the loading of CATParts Use CATIA V5 CATDrawing files Enables the loading of CATDrawings CATProduct Worklocation Storage location for saving CATProducts and other Catia V5 files Transfer CGR files to Catia V5 Allows the user to send CGR files to CATIA V5 see Working with CATIA V5 Released Cache Transfer model files to Catia V5 User can choose to not send model files to CATIA V5 84 CMI User Manual Use CATIA V4 Files The Use CATIA V4 Files option is evaluated during Expand and To Catia in the Workbench and also during a Read command in CATIA If Use CATIA V4 Files False then all V4 files are ignored by these functions Use CATIA V5 CATPart files The Use CATIA V5 CATPart option is evaluated during Expand and To Catia in the Workbench and also during a Read command in CATIA If Use CATIA V5 CATPart Files False then all CATPart files are ignored by these functions Use CATIA V5 CATDrawing files Use CATIA V5 CAT Drawing files True loads all CATDrawings during To Catia Transfer CGR files to Catia V5 Transfer CGR files to Catia V5 is used in the context of Catia V5 It means that CGR files are transferred to the Catia V5 Release Cache instead of CATParts V4 models to the exchange map In standard CMI this applies only for checked in models A prerequisite for this is that CGR files are pro
52. ATIA Workbench V5 CMI SCPLM053 20050 i Oj x File Action Info Query Options View Help MyNormalStrud SY MyNormalStr A MyReferencedA iY MyReferenced A MyReferencedi Ly MyReferenced A MyReferencedA YQ MyReferenced A MyReferenceT Ly MyReference A MyReferenced MyReferenced A b 4 gt 4 objects are expanded a 1 objects are expanded Expansion complete bud Figure 151 Expanded Reference The reference geometry relation is a product element structure relation Configuration context applies In order to use this functionality your administrator has to configure the prefix for the Reference component in CATIA V5 See CMI Customizing Guide Import Export using a mapping file Set CMI ENABLE CREATE_IMPORT_FILE ON to enable options in CMI Reconnect and Synchronize Teamcenter commands to map CATIA data that exists both in your PDM system and at a partner site but under different naming conventions Synchonize Use the Write Import Export mapping file option in the Synchronize dialog to record or map original names for CATIA data that is stored in Teamcenter 148 CMI User Manual CMI Synchronize Teamcenter i ioj x peration List Part Number Categor gt ExternalAxisGeoDesign Table xls DesignTable 1 DesignTable ExternalAxisGeo Create Link ExternalAxis CATProduct Create Link ExternallnnerWheelDesignTable 1 xls DesignTable 1 DesignTable C
53. CATPart A Y CMI Unknown Read Write ExternalWheel Left Wheel ExternalStructure CATProduct ExternalWheel CATProduct New CMI Unknown Read Write ExternalInnerWheel InnerWheel 1 ExternalWheel ExternalinnerWheel CATPart PartNumber Y CMI Unknown Read Write ExternalOuterWheel OuterWheel 1 ExternalWheel CATPart ExternalQuterWheel cATPart InternalinnerWheel Y CMI Unknown Read Write ExternalWheel Right Wheel ExternalStructure CATProduct ExternalWheel CATProduct in almeria CTP Select unknown Reconnect selected Use mapping file CI Reconnect CMIArchives 9 Cancel Figure 155 CMI Reconnect Export to Folder Command Set CMI ENABLE EXPORTCMD ON to enable the Export command in the CATIA toolbar With the export command you can save data that you have opened from Teamcenter to a folder of your choice If a mapping file is available the products in the structure can be renamed to their original part numbers and file names This allows you to return files that you have originally received from an external partner in their original state 10 x eS Figure 156 Create CMI Mapping file CMI asks if you want to use the mapping file a _ Use mapping file from Teamcenter to export structure Figure 157 Use mapping file for export dialog If Yes the structure is stored in the export directory using the original names of the CMI Mapping file If No the structure is stored into the export directory without renaming
54. CMI ENABLE CMICATALOGUPDCRECMD ON in the Catia environment in order to enable the Update and Create function for CATCatalogs Update or Create Catalog allows to save new or updated CATCatalogs in Teamcenter It will manage the necessary keyword attributes so that the Parts contained in the catalog can be retrieved from the Teamcenter database instead of the local file system After starting the Update or Create Catalog command the catalog document is analyzed and the following dialog is shown 134 CMI User Manual CMI Synchronize Catalog 3 2 x Catalog Filename Catalog Mame Examplecatalng catalog ExampleCatalog catalog OOO Modell cc S PED Jpdated by CML cc 20080207 Modell Open as copy Loaded by CMI 20080225 Modell Open Mok known by CMI UDF_A Instantiate Created by CMI Edit selected Synchronize S Figure 127 Catalog synchronize dialog For new catalogs that were not already opened from Teamcenter the user can change the file name which should be used in Teamcenter The Type can be Open Open as copy and Instantiate These types describe the way in which the parts will be handled when the catalog is used e Open Open the referenced object in CATIA so that the existing Teamcenter part is used e g standard part e Open as copy Open the referenced object in CATIA so that it will be recognized as a new Part in Teamcenter e g templates e Instantiate Instantiate is used for Features
55. CTURE Seu a PO on PP er 49 REREADING A STRUCTURE initial id tidad 50 WORKING WITH MARKED PARTS ceccecceccecceccecccceeceecaeceeeaeeaeeaeeaeecueceecueceecuesueceesaeeaeeaeens 50 SET THE ACTIVE MODEL te dee aTe 51 SENDING PARTS TO 4D NAVIGATOR cccccccecceccecceccuccaeeaeceecaecaeeaeeaeeceeceecueseecueeueeueeeeeneeaees 52 PMY VO UME a a dada ad 52 NEIGHBOURHOOD OF MODELS sorsia r a E 53 VOLUME SEARCH FOR MODELS idas 54 IMPORTA OCENE F ICE nc trece R 55 CANCELING COMMUNICA TION sees sarita ES acters 56 SUPPORT OF QUANTITY andare nano SEA 56 CHAPTER FP EAS E A AE E E A EA O dad 59 THE CATIA V4 CMI FEUNC TIO Nica 59 MENU STRUCTURE IN CATIA ceceremed a aaas 59 USAGE OF THE CATIA CMI FUNCTION 2 cccceceececcecceceeceeceeeeceecueceeaecueceeaeeaecueaesaeeeteneness 60 METAPASE gt READ o edo lao 60 METARASE SUPDATE 0 a de a de edo alas es 61 UPDATES ALL ds tha Ok o ios e Ur dd is Des e dio EL 61 UPDATES ACTIVE e a 61 UPDATE POSITION e a ae ORT 62 UPDATE gt GEOMETRY MODELS oosiecocicccccccccccccoccceccsccscnssevvaesrsvsssrusreveeccesdsvececesvusss 62 METAPHASE gt DOCUMEN aaa ol bado len 63 DOCUMENT SAVE AS eae eS 63 DOCUMENT CREATE a a O e 63 DOCUMENT MUE CRE UA Ea E 64 DOCUMENT SAHLINWB o e a eo 65 DOCUMENT Std aac ie o o do nance lan e eta do 65 METAPRASE S REREAD E E e 65 RERA D SAL Dae arene ge de o ORE are oer RSet nee 66 REREAD GEOMETRY e r da e atac ao en do 66 REREAD gt POSITION e le bed ea e od e o 66 RE
56. Catia Level V5R 19 c T Systems 2003 2010 Fi Parameters and Measure Fa Devices and Virtual Reality infrastructure Virtual Product Mechanical Design Ll Use one temporary product window for all CMI Workbench contents Shape Other Options Analysis amp Simulation LI Single Part Modus manno E Do not hide Products not from CMI Workbench AP Digtal Mocku A Deactivate geometry files not from CMI Workbench igital Mockup LI Use extra directory for non CATIA items in CMI Archives es Equipment amp Systems Use directory VA gt Machining Simulation E A Al m Figure 73 CMI Options dialog CMI User Manual 89 Use one temporary product window for all CMI Workbench contents When this option is checked all top level Assemblies in the CMI Workbench are loaded under a temporary CATProduct in CATIA Single Part Modus When this option is checked all CATParts of a structure are loaded in separate windows during CMI Read The rest of the structure will not be loaded Do not hide Products not from CMI Workbench When this option is checked CMI does not hide the any node in the Product structure during CMI Read By default CMI hides all nodes in the CATIA tree not loaded by CMI Deactivate geometry files not from CMI Workbench When this option is checked CMI deactivates all geometry nodes not loaded by CMI during the current CMI Read action in the Product structure Use extra directory for non CATIA i
57. E MODEL FAILED TO LOAD MODEL MODEL UPDATE NOT POSSIBLE NO CORRECT MODEL FOUND NO WRITE ACCESS TO MODEL NO ROOT MODEL INCORRECT ASSEMBLY MODIFICATION NOT ALOWED ACTION CANCELED MODEL HAS WRONG PROJECT ASSEMBLY PARTIALLY UPDATED MODEL PARTIALLY UPDATED COMMUNICATION FAILED ACTION FAILED PANEL ERROR NO INFO RETURNED NO VALID PLOT FORMAT ERROR PLOT FINISHED PLOT IN PROGRESS PLOT FORMAT TYPE ERROR CANNOT MOVE WORKPLANE FAILED TO CHANGE WORKPLANE MODEL IN EXCHANGE MAP ALWAYS EXISTS NO MODEL HAS BEEN LOADED Your currently selected active model is not your first model below the root Only the first root model contains valid drawing frame attributes No plot sheet will be generated You tried to save a model without a title Please setup a title for this model CATIA was unable to read the following model s The model RENAME function failed probably because of problems with your exchange map CATIA was unable to read the model C01 located in CO2 CATIA cannot save the active model in the PDM system Check your access rights of this model in the PDM system CATIA cannot update the active model in the PDM system CATIA cannot load the specified model You can t update a model that isn t loaded from PDM system Please use CREATE to insert the model in PDM CATIA cannot handle this model in the PDM system You tried to write a model in read only mode You are not the owner of this model The assembly
58. ES Moving the Workplane up means that the Workplane will be a part in a higher layer of the structure see in the figure below The models below the active workplane are highlighted If there is no higher layer a message will be displayed EN Figure 59 Moving the Workplane up ASSEMBL Y gt MODSTRUSMOVE WP gt DOWN Moving the workplane down means that the active workplane crosses the tree structure downwards see in the figure below The models below the active workplane are highlighted If there is no lower workplane a message will be displayed CONFIRM with YES CMI User Manual 71 rd Ze 4 5 J Figure 60 Moving the Workplane down ASSEMBL Y gt MODSTRU gt MOVE WP gt SET Select Element The active workplane and its sub trees are highlighted Or CONFIRM with YES Choose the new workplane from the list the chosen part and its sub trees is highlighted and confirm with OK select work plane f Filter on Part List of Parts Main A Abstand Abstand ocheibe Stab Sia achel Stat Stab Platte Cancel l Figure 61 Selection panel for the new workplane ASSEMBLY gt MOD POS This menu item
59. EXPAND FOR VISUALIZATION 2 cccceeceececcecceccecceccuscaseuteaees 131 SELECT CATALOG FOR BROWSING DIALOG 0 cceccecceeceececeeeceeeeeceseeeeeeeeeaeeaes 132 COR TREO GO Se eas E E E ce ce ee 132 SELECT CATALOG FOR EDITING a ds lee Ait eee 133 SELECT DOCUMENT IN SESSION 00 0 134 CATALOG SYNCHRONIZE DIALOG is 135 CONFIRM TO CONTINUE SYNC OPERATION 0eceeceecceececcecceeceeceeceeeeeeeeeaeeueeaes 135 SUCCESSFULLY FINISHED SYNCHRONIZE CATALOG 0cceccecceceececceceeceeceeeeees 136 REGISTER GAMA SCRIPT DIAC Guaicaipuro 137 QUERY GATIA SCRIPT DIALOG ties shee hla ada ale teh alta Addu cM 137 SELECT CA OC EIR Teta cadus asadas end o aa le tt he Ae ce da 138 INSERTED GAT SCRIP E deta tse Bete cle Male a dat a le Aetna 138 SYNCHRONIZE GATALOG DIALO Quesada de e ate te Ae ada 138 CATDUAVS DIAC Gis eee ee te es wt he a 139 CMI CATDUAV5 INTEGRATION DIALOG 0 cecceceececceceeceececcesaecuecuseeseeueeeees 140 CATDUAV5 GLOBAL RESULTS sti ee i OO ds 140 CATIA VERSION VERIFICATION ici ene Oe On Oe oe i 141 REPRESENTATION FORMATS IN CATIA V5 CATIA WORKBENCH 0200008 142 REPRESENTATION FORMATS IN CATIA V5 CATIA V5 c ooooccccccnccnnccnncnnconanonnos 142 MAPPING FOR NON BOM PARTS IN TEAMCENTER AND CATIA V5 2 02000 142 MAPPING FOR BOM PARTS IN TEAMCENTER AND CATIA V5 ce ceceeeeceeeeeeeees 143 SYNCHRONIZE DIALOG WITH ENABLED EDIT PDM PART CATEGORY BUTTON 143 EDIT NEW PDM PART CATEGORY ini o
60. HE NEW WORKPLANE 2 ceeceeceecceececceccecceccuccescusenseaes 72 MODEL SELECTION PANEL ccccecceccecceeceeceeceeceecaeeaeecueceecuecuecuecuecuecuteuecaecaeeneeaes 73 Al O ee ees eT 77 AUTOMATICALLY SET DEFAULT WORK PLANE 2 0sceeeeececceeceececcecceccueeuseeseuseaees 77 EMICONTE at cl ts da eee or 78 CMI STRUCTURE FOR CATIA VD catch beet dade eee chee Bea veuebenc 83 ASSEMBLY AND COMPONENT lt a a 83 ASSEMBLY COMPONENT MODEL CATPRODUCT AND CATPART 22 0000ee0e 84 PRODUCT STRUCTURE IN TEAMCENTER 2 0ccecceeceeceeccecceececcecceccuccuseueeaseusesens 86 EXPANDED PRODUCT STRUCTURE IN TEAMCENTER 0 cecceececceccecceccuscesceseasens 87 PRODUCT STRUCTURE NAVIGATOR IN CATIA V5 cin ince 87 FIGURE 72 FIGURE 73 FIGURE 74 FIGURE 75 FIGURE 76 FIGURE 77 FIGURE 78 FIGURE 79 CMI TOOLBARIN CATIA VS is 88 CMIFOPTIONS DIA CO Gusta dao as 89 CATIA WORKBENCH WITH A CATDRAWING ITEM AND A CATPART ITEM 90 PART DESIGN WORKBENCH FOR READ UPDATE CREATE OR SAVEAS CATPART91 DRAWING WORKBENCH FOR READ UPDATE CREATE OR SAVE AS CATDRAWING A A RS O EN O Tea 92 DIALOG WINDOW FOR UPDATE CATIA MODELS 0cococcncncncononcncncononcncncnnonincnnnnones 93 THE SYNCHRONIZATION IN TEAMCENTER DIALOG ccococcccncnccnnnccnnnccnnnnnnnncnannnnnnons 94 DIALOG WINDOW TO CREATE A NEW CATPART WITHIN THE PRODUCT STRUCTURE IN TEAMCENTER ENTERPRISE ancianos a cette e e ee eet ie 96 FIGURE 80 DIALOG WIND
61. IA and to provide several manipulation facilities for the CMI commands found in CATIA The entire data interchange between Teamcenter Enterprise and CATIA is achieved via the CATIA Workbench First of all you should register or create some CATIA model objects in Teamcenter Enterprise CMI defines some new classes in Teamcenter that can be used to manage CATIA models plus plot files generated from them and also new classes to manage the CATPart CATProduct and CATDrawing files of CATIA V5 The management of CATIA models is described in Chapter 5 CATIA V5 files in Chapter 8 a a Y The CATIA Workbench in Teamcenter Enterprise has to be started before you can Call the functions of CMI CATIA Teamcenter Interface D To open the CATIA Workbench either select the Teamcenter Enterprise function Window gt CATIA Workbench Or select a CATIA model in Teamcenter Enterprise and double click on it A window as the one seen below will appear CMI User Manual CATIA Workbench 5 CMI EDMG97 20050 loj x File ction Info Query Options View Help A MELCEDLEG LUL Prerereneea ODELE aligalie Ler LME els asic Server al Figure 2 CATIA Workbench window The initialization of the communication between CATIA and Teamcenter Enterprise was successful if the title of the CATIA Workbench has the following format CATLA Workbench 5 CMI EDMG97 20050 J 7 ON Work with V4 V5 Your host name Port num
62. IA documents and CATIA parts and assemblies placed in the CATIA Workbench It works the same way as the METAPHSE gt READ function but in difference to it all functions do not delete the current CATIA Session All METAPHSE gt REREAD functions leave non CMI models unchanged This means the designer is able to use models assemblies from CMI in conjunction with other models e g models loaded over the CATIA File Open function This function is also valuable in cases where you want to expand the assembly already loaded into the CATIA Workbench in a different way e g de expand one sub tree and re expand another one instead It is also possible to add new CATIA models CATIA documents and CATIA parts and assemblies to the Workbench After having reread the modified contents of the CATIA Workbench CATIA will reflect the new situation shown in the Workbench Generally all METAPHSE gt REREAD functions are much faster than the METAPHSE gt READ because only your current CATIA Session is only updated with the parts of the Workbench content not yet loaded to CATIA CMI User Manual 65 REREAD gt ALL All unsaved modifications positions and geometries will be updated with the original data from CMI REREAD gt ALL leaves non CMI models untouched in the session REREAD gt GEOMETRY REREAD gt GEOMETRY updates the current CATIA Session with the CMI Workbench content In addition REREAD gt GEOMETRY resets all changed and unsaved models
63. MI Architecture The following figure explains the architectural basics of the CATIA Teamcenter Interface CMI Metaphase CATIA z Heme Collection for sapot uset ear Lite nia Inte Cresta Diary Werte Gatica fia tele Frertshee bettin Martes Preferences wert Len rt fe CATIA Workbench CMI edmg5 20050 file Betton Lua Query fpticos pies Bel ad spews caliper rs RST FATS FT pajas jr E A a A A ODA COME CATIA Workbench CATEDM Network Figure 1 CATIA Teamcenter Interface architecture The user can expand an assembly within the CATIA Workbench and send this assembly to CATIA V4 or CATIA V5 After changing geometries and or positions in CATIA the user can update the assembly in Teamcenter Enterprise 2 CMI User Manual CHAPTER 2 Getting Started This chapter describes how to start CATIA within the Teamcenter Enterprise environment and also how to enable the CMI functionality within CATIA V4 and CATIA V5 Assumptions Some assumptions for a better understanding of the descriptions and examples A The CATIA V4 functionality is installed with the menu item name CMI in CATIA CATIA can be called both directly from the users desktop environment and from a UNIX shell via the command catstart sh CATIA V5 should display the CMI toolbar amp as ER UNIX Start CATIA V5 with the command cmicatstart sh Windows Make sure you have
64. Modify Position with its sub items allows you to modify the positioning of the assembly product structure in Teamcenter from CATIA The following functions suppose that an assembly is loaded into the CATIA memory With all operations in this menu you can use the CATIA YES button to get a list of all models below the current workplane So it is easy to select the part you want to move 12 CMI User Manual Select Model Filter on Model Figure 62 Model selection panel Please use the Filter On Model field to find only some specific models ASSEMBLY gt MOD POS gt TRANSLAT This menu item Translate translates the selected part in the direction indicated by the selected line axis or from point to point Read an assembly as described in chapter METAPHSE gt READ Select workplane as described in chapter ASSEMBLY gt MOD STRU gt MOVEWP Select MOD POS gt TRANSLAT Select a part in a sub tree of the actual workplane the selected tree will be highlighted red Select a vector or line the selected line vector will be highlighted red You can also select a first and second point a red highlighted vector between the 2 points will be created Enter a distance or select the second point Click at the vector or press the ENTER Button in order to change the transformation direction NTE Confirm with YES The selected part will be translated ASSEMBLY gt MOD POS gt ROTATE A CMI User Manual
65. OW TO CREATE A NEW CGR WITHIN THE PRODUCT STRUCTURE IN TEAMCENTERENTERPA SE ios in 97 FIGURE 81 DIALOG WINDOW TO PREPARE A DOCUMENT IN TEAMCENTER 2 cecceeceeceeeeeeees 98 FIGURE 82 DIALOG WINDOW FOR CREATE CATIA V5 PARTS OR CATIA V5 DRAWINGS 99 FIGURE 83 DIALOG WINDOW FOR CREATE CATIA MODEL IN TEAMCENTER 2 2 0eeeeeeeee 101 FIGURE 84 INFORMATION DIALOG WINDOW FOR CATPRODUCT WITH MORE ATTRIBUTES 102 FIGURE 85 CMI INFORMATION FOR MULTIPLE ITEMS 02 0eceeeceeceececcecceccecceccesceseuseueenees 103 FIGURE 86 CMI RECONNECT DIALOG ccceceececcececeeceeeececececececeececueaecesaeseseeseeeeaeseeaeeess 107 FIGURE 87 MANAGE REPRESENTATIONS DIALOG ceeceececceceececceeeeeeeceeeeeeeeeceeeenneeeeeeenenes 110 FIGURE 88 MANAGE REPRESENTATIONS DIALOG REPLACE cscceccecceccecceceecceseeseusesenees 110 FIGURE 89 TEAMCENTER REGISTER FILE DIALOG 0 ccceeceeeeeeceeceeceeceeceeceeeeeeeseneeeeaeenees 111 FIGURE 90 PART WITH ATTACHED CATPROCESS DATA ITEM 0 cecceceeceeceeeeseeceeeeeneeeeeeenenes 111 FIGURE 91 CATIA WORKBENCH WITH DROPPED PROCESS ELEMENT 0 2sceeceeeceeceeeeees 112 FIGURE 92 EXPANDED PROCESS ELEMENT 0 da 112 FIGURE 93 LOADED CATPROCESS IN CATIA V5 0 cccececcecceceececceeceeeeceecessesaecueceeaeeaeeneaneas 113 FIGURE 94 ASSEMBLY DROPPED IN THE CMI WORKBENCH 2 sseceececcecceccecceccecceceaeeaseaees 114 FIGURE 95 LOADED ASSEMBLY IN THE CATIA V5 0
66. PAGE TOF PULIO VEION as A EE 14 UE ARA A aa asin se cae adelaide wad sa aie E EEEa 14 Menu ent TAG Da ii abit asociados 15 POP UP MENUS OF WORKBENCH ITEMS cds 15 FANS AN TAS VIDAD na eo hess ed ee 15 Documents in the Workbench 1cccececececcccccecccccecensnenenenenenenenenenenensnansnansnsususencsnacas 16 Models in the Workbench 2 ccccccccceccccencceccccecensceceesenscscuaesenseesaesenstecauaenenscataesansnscass 17 CHAPITER LA veceee ds mescaceeeeeeeacansececetseeccecaestes 19 GENERAL FUNCTIONS cssiturianiniii n ais 19 PREDEFINED OBJECT STRUCTURE Ent es a adi Ed od do je de o lil e Cata e 19 CATANA TEMPLATES e e Ea 20 GREATING A CATIA V4 MODEL dis 20 CREATING A CATIA V5 CATPART CAT DRAWING cccsceccececcececcececcecuceccuceccuceeeecaeaecass 21 CREATING A CATIA V4 MODEL FROM A CATIA V4 TEMPLATE cccccecececececececececececececenes 22 REGISTER EXISTING CATIA V4 MODELS c ccccccececececececececececececucccaceuauauuauauuauauaenenenes 23 SEARCHING FOR CATIA V4 MODELS ccceccecececccecececuccecececuececececaeauuececseacaunecscaueaeneces 23 SEARCHING FOR CATIA V4 TEMPLATES cccccecececcecececccccecccuccccecsceeauuececacauauuecscauaunenseas 24 SEARCHING FOR SAVED CMI SESSIONS ccccscececcecececccecececccaccecscecuaececacauaeuecscauuneneeas 25 RESTORE A SAVED CMI SESSION cccccccccccececececececececececucucucucacacacacacacauauauauauaegusucenenenenes 26 LOADING SEVERAL SAVED SESSIONS IN CMI WORKBENCH
67. Parts uses i InternalinnerwWheel Component 1 InternalinnerwWheel iy InternalOuterWheel Component InternalOuterWheel Described By desBy m uie 0 00 InternalStructure General Document Attaches att InternalStructure xml CHT Mapping file gt gt gt Accepted Is Described By option initiating object server 2 objects found gt gt gt Accepted Artaches option initiating object server Figure 154 CMI Mapping file in Teamcenter CMI User Manual 149 You should also check this option if you receive a changed version of a structure that was imported to update the mapping file with new subassemblies Reconnect If a mapping file was created when the product structure was first imported into Teamcenter this file can be used to map the CATIA names to the names the products have in Teamcenter Click Use mapping file to retrieve a mapping file that is attached to the top level Part from Teamcenter If a part was imported from outside the internal name will be supplied by the mapping file ax TC fle access Partnumber imstamcename Parent Partnumber Type Fiename Synchronize configuration Y CMI Unknown Read Write ExternalStructure CATProduct ExternalStructure CATProduct O Ignore item Y CMI Unknown Read Write ExternalAxis Axis 1 ExternalStructure CATProduct ExternalAxis CATProduct ME Y CMI Unknown Read Write ExternalAxisGeo AxisGeo 1 ExternalAxis CATPart ExternalAxisGeo
68. Quantity Relation the Quantity is limited to 100 instances by default Q An administrator can change this limit See CATIA Teamcenter Interface Customizing Guide for this and additional considerations regarding CMI Quantity support CMI User Manual 57 CHAPTER 7 The CATIA V4 CMI Function This chapter describes how to use the CATIA function METAPHSE within the CATIA environment and its interaction with CMI and Teamcenter Enterprise E Menu structure in CATIA The following figure shows the menu structure of the CMI CATIA V4 module In this structure it is possible to see which menu items can be reached through this CATIA function METAPHSE Figure 47 CMI CATIA function menu structure CMI User Manual 99 SSS SESE Usage of the CATIA CMI function The METAPHSE function is designed conformably to the look and feel of the CATIA Motif user interface If you are familiar with the CATIA user interface you will be able to work with the METAPHSE function just as well as usual If any message appears on the status line you can type help on the CATIA command line to get more information about this message To get help for the active menu point you can type edmhelp TS METAPHSE gt READ This menu item reads CATIA models CATIA documents and CATIA parts and assemblies placed in the CATIA Workbench If you want to send one or more assemblies or models use A Read Teamcenter CATIA items with METAPHSE gt READ
69. READSHES NO e e ole sed ea edo oo AA o 66 INTRODUCTION TO THE ASSEMBLY STRUCTURE 0 ceceececeececeececeececeececeeeeceeaecuseceeeeaeseees 66 Switching the ACTIVE MOE ici 66 METAPASE AS SE MB so oca ds 67 ASSEMBEY MOD S IO eo do e 67 ASSEMBLY gt MOD STRU gt DROP cacceccccccccocccascccceccescesesscnervccecsvetscttececcsscoectecaesseces 67 ASSEMBLY gt MOD STRU gt REPLACE ociocooccocnnccnccccncncnoncnncanonnnnnnnnnnnnnnnnnnnncnancnnes 68 ASSEMBLY gt MOD STRU gt ADD TMP oocioccocnncnncnncnncncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnonnnannnnos 68 CMI User Manual ASSEMBLY gt MOD STRU gt MOVE WP iieeeccccccceceeeeeeeeeeenaeaeeeeesseeeeeeeeeseeeeeeeaaaaaas 68 ASSEMBLY gt MODSTRU gt MOVE WP gt IN WORK B uuu tciccsccccscceccecceceectececceceeceeseeaes 70 Send the active work plane from the Workbench to CATIA ccccccccsseecccceseceeseeees 70 ASSEMBEY MODSTRU gt MOVEWP gt UP ias 71 ASSEMBL Y gt MODSTRU gt MOVE WP gt DOWN icocconconcnncnoconcnnconcnnconcnonnnnnnnnoncnnnnnnos 71 ASSEMBLY MODSTRU gt MOVE WP SED 20 ias 72 ASSEMBLY gt MOD P O E k e o ed eee 72 ASSEMBLY gt MOD POS gt TRANSLAT u 0 1 c1ccccceccceccccceccecceeceenessssnsessssssssscsensens 73 ASSEMBEY SMODPOS ROTATE a o a OS 73 ASSEMBLY gt MOD POS gt MOVE gt AVISA ao iii 74 ASSEMBLY gt MOD POS gt MOVE gt SYMMETRY u 1ccccccccccccecceccecceccescesenscnssneens 75 ASSEMBLY gt MOD POS gt MOVE gt LINE ceccccocccccocccccovecvcvecsecreccenc
70. S eS a ias ccoo Get Attributes before inflate dynamic attributes dstat InflateDisplayedName this mfail CHECK InflateDisplayedName tor i 0s 1 lt numval ae 4 e e pe e e a S ea ib value a aA e Se hs dstat objGetAttribute this CreationDate amp value DSTAT objGetAttribute CreationDate ee sen Gert 5 TREMENDO SUaSiS se WC SUE NOMI Wicks cic neyjote A e E ee a Deh e dstat objGetAttribute this LastUpdate amp value DSTAT objGetAttribute LastUpdate end else if STRCMP attr type ModificationDate elses STR eMES ier hESC pa e dstat objGetAttribute this TDisplayedName amp value DSTAT ob jGetAttribute TDisplayedName tendreis sae OTR ME Water type Name wir iS Sere a lO bude dae 4 Ss SUS le else Sern oer Aide eo una value s t a end tor lis O a a tie sa 7 CLEANUP MPDBXFEND Me dS SORKAT Clow return crace moc name Qstar Tb de Eo You will find the customizable method x3GetAttrsForCAD in custom x3Custom mth This method is called within x0WkBnch x3GetAttrs for Assemblies and CATIA models So you can overwrite it for your specific Assembly or CATIA Model classes CMI User Manual 41 Creating a Plot File object 42 The plot file object is an object that contains the information to be filled in the draft of the model to which it is attached To create a plot file object perform the following steps A In CATIA se
71. SIGN_ TABLES ON To use Design Tables for CATProducts also CMI_USE_DTFORPRODUCT ON needs to be set in the Catia V5 configuration y CATIA V5 Assembly CATProduct EJ zt pe id ven pet jook CMI Window tep 4685 25 43 Assembly pe Assemb lolx Ho Cylinder Cylinder 1 x Eal ylinder Category Operation Execute Result DesignTable Create Y CATPart CATProduct CATPart CATProduct Create Link Create Link Create Link Create j Link Plate Cylinder ControlCylinder 1 Assembly BPF Formula 1 PartBody Pad 1 Sketch 1 Radius 2 Radius diameter 25 PartBody oW plate Plate 1 gt 2 PlatewithHole PlatewithHole 1 eN PlateWithHole me xy plane Ses yz plane aQ Info Synchronize Close Output window 2 BHP SAQ Lina page so mode TE Ta zx plane gt Relations iiaii ControlPlate 1 i e PartBody Applications Dad AD MS Ba dF Figure 147 Synchronize with Design Table Design tables are not stored by default because of performance considerations also you need a sound methodology if you allow the use of design tables in your methodology since design tables have the power to change your product structures a To enable this function the administrator has to set the CATIA V5 environment CMI ENABLE CMIUPDATEPOSITIONCMD ON This function updates only the transformation matrices in Teamcenter The CATProducts and CATParts are not updated sf To get this
72. TProducts and models in the CMI Workbench 4 D If you want to highlight CATParts CATProducts and models in the CMI workbench triggered by CATIA V5 In CATIA V5 select the CATIA models parts you want to highlight in the CATIA workbench and choose the Highlight in Workbench command from the CATIA CMI toolbar Now the models parts are highlighted in the workbench as Marked Item Highlight a part model in the CATIA workbench In CATIA V5 select the Highlight in Workbench icon x CMI Advanced Toolbar Local Save and Restore Using Save Local the contents of the Catia V5 session can be stored locally This snapshot of the session will persist even when Catia V5 is closed 3 E When the session is restored with Restore Local you can continue your work as if you had just used Read from Teamcenter ie you can perform Updates The Restore Local command is only available when the Catia is empty ie no documents are open to avoid conflicts EA a a T A T A AE E DR RAR a R Es a ag aa aa R 1 With Save Restore Local you can avoid reading large assemblies from Teamcenter repeatedly However the status of the data in Teamcenter may change if you keep your local snapshot for a long time It may get stale The following restrictions apply Only one saved session is maintained at a time The session can only be saved when the data is up to date le there are no files in a modified state and no
73. The CATProducts CATDrawings and V4 Models a CMI toolbar CMI Info CMI User Manual The More range of attributes can be customized Jem Crankshat asm Erankshaft AssmCrankshaft Assm JA CrankshaftRight CrankshaftRight 1 CrankshaftRight 1 5A CrankPin CrankPin 1 CrankPin 1 CMI Information i 3 x 4 Product Properties Single Object Multiple Objects Catia attributes Exchange map file name CiexmapyS1CrankPin C4TProduct E Changed in Catia Teamcenter attributes C Part read only C File read only C File attachable Partnumber feen OOOO Instancename ranni SSS Revision 4 1 Nomenclature Erann SSS S More attribute information a _aH Ha pa ae CMI More Attributes xj Attribute Mame Attribute Value EA A A Checked Out Creator super User Database Name cicm5i41 Created 2 007 04 17 11 44 20 315 Last Modified 2 007 04 17 11 44 20 351 Default hy 1 Default Unit PsmEa Marne CrankPin 4 1 1 Externally Managed FTR Index Exists ho Figure 84 Information dialog window for CATProduct with More Attributes Select the CATPart CATProduct CAT Drawing or V4 Model In CATIA V5 select the CMI Info icon An The appropriate dialog info window appears 102 CMI User Manual CMI Crankshaft_Assm w Crankshaft AssmCrankshaft Assm i A ici RIGA 1 CrankshaftRight 1 Singl
74. V5 see CMI toolbar Update Teamcenter All Documents in the ProductList and ResourcesList which are loaded from CMI will also be updated aue You can also Save a CATProcess that you have created in CATIA using Synchronize Teamcenter CMI will create a new Assembly item for the Process that references the products and resources The CATProcess is handled much like a CATProduct CMI User Manual 113 C Handling of CMIArchives CMI supports the use of CMlArchives A CMlArchive is a data item in TeamCenter which contains a CATIA V5 structure The Structure has one root item which can be a CATProduct or a CATPart If the root item is a CATProduct it can contain more items of tyoe CATIA V5 Component CATIA V5 CATProduct or CATIA V5 CATPart In the following sections the handling of CMlArchives is described in detail First open the CMI Workbench in Teamcenter and drop an Assembly into the CMI Workbench see Figure 94 After sending Action gt To CATIA or The Read Command in CATIA V5 the CMI Workbench content to CATIA V5 the product structure is loaded in the CATIA V5 application D amp CATIA Workbench V5 CMI EDMG125 20050 loj x File Action Info Query Options View Help Assemblyl 2 Assembly A I Sending items to CATIA A ss ls IS E Psa AA FAA Oda Eoln x e lar lee Figure 94 Assembly dropped in the CMI Workbench Me CATIA Y5 CMI Assembly1 olx Start SmarTeam Ele Edit View Insert Tools Analy
75. Viewer will send all marked items to a specific Viewer The menu item Action gt Marked Items gt Browse Marked Items will generate a Browser with all marked persistent objects The menu item Action gt Create DMU File creates a CMI DMU File for the clicked Part in the DMU Vault Location Every Revision of the Part has its own DMU File stored in the Vault Location If the DMU File already exists in the Vault the user has to confirm the overwrite The Root Part is expanded for all Catia Models For each Catia Model an entry is stored in the file with the absolute postion and the assembly path from the Root Part to the Model CMI User Manual Menu item Info Menu item Query CMI User Manual File Action Info File Action PER ouery Options View Help Get WB Content Info Figure 7 CATIA Workbench menu Info The menu item Info gt Get Item Info displays extended information about an item that the user has selected in the CATIA Workbench The menu item Info gt Get WB Content Info displays the number of CATIA parts and models within the CATIA Workbench Also the size of the contained CATIA models will be displayed This information dialog helps to estimate the size of the CATIA Session Options View Help Document Quality Document 411 Parts All Documents CATIA Item General Document DMU Design Document CATIA Model Specification Document Manufacturing Planning Document Technical Publication Document
76. VisMockup will be opened in CATIA Start Datei Bearbeiten Ansicht Einf gen Tools CMI Analyse Fenster Hilfe B CATIA Workbench V5 CMI SCPLMO55 20051 Sa G65 ADAC E EAS AABT File Action Info Query Options View Help Item Identifier Instance Name Ts CMI Rack Rack Rack A 1 Rack Uses Parts has SW Case ECA Case Case 1 E Uses Geometry has Do CaseModel 1 CaseModel CATPart g CaseModel CiTPart CaseModel mn Screw Screw 3 Screw Screv A 1 ScrewModel 1 ScrewModel CATPart E Uses Geometry has E ScrewModel CaTPart ScrewModel ws Screw Screw 2 AN 4 Screw Screw A 1 E ScrewModel 1 ScrewModel CATPart Uses Geometry has a z L g ScrewModel CiTPart ScrewModel E E Bedingungen Applications Finished Unmark All 32 A Ra f Sending items to CATIA BICES GO fo m of 5 Done y CaseModel CATPart 2008 04 29 07 21 57 cgrf CaseMod BA ay Figure 120 Opened in CATIA ee Expand for Visualization The context menu of the Catia Item representations in the CATIA Workbench contains a new option Expand for Visualisation The option expands the selected Branch over multiple levels with models displayed If a part with an attached Visualization model is found the expand is stopped at this node and only the Visualization model is expanded CATIA Workbench 5 CMI EPDMD90 20051 2 Oj xj File action Info Query Options View Help DM1R14 O2ezeq has G pMiR14
77. With this toolbar button a CATPart or CATDrawing file currently set active in CATIA V5 can be created in Teamcenter Enterprise A Teamcenter create dialog window appears to enable the user to set additional attributes Design or load your local CATPart or CAT Drawing In CATIA V5 select the Create in Teamcenter icon a s A Teamcenter Enterprise dialog window appears Fill in the fields and press OK A new CATPart or CATDrawing will be created in the Teamcenter Enterprise environment D Create CATIA 5 Part File 5 x File Name HewPart CATPart Work Location WL 1 edmg9 9 B Current Host Name edmy99 Y Register in the Database Description HewPart apply Clear cancel Help J Work Location field set to the single available value in the selection list Figure 82 Dialog Window for Create CATIA V5 Parts or CATIA V5 Drawings oF The Create in Teamcenter Enterprise command is available if the CATPart or CATDrawing has been opened in a separate CATPart or CATDrawing Workbench window in CATIA V5 CMI Geometry toolbar SaveAs in Teamcenter With this command a CATPart file or CAT Drawing file currently set active in CATIA V5 can replace another in Teamcenter Enterprise A CATPart or CATDrawing selected in Teamcenter Enterprise and then dropped into the Workbench will be overwritten by the contents of the CATPart or CATDrawing in CATIA memory CMI User Manual 99 Design or loa
78. abase Description HewPart apply Clear cance1 Help Work Location field set to the single available value in the selection list Figure 79 Dialog Window to Create a new CATPart within the Product Structure in Teamcenter Enterprise CMI User Manual CATIA 5 Prod_Cgr1 CATProduct A O x EJ Starkt Datei Bearbeiten Ansicht Einf gen Tools CMI Analyse Fenster Hilfe 2 x ra e Pl APP plic ations CMI Synchronize Teamcenter Operation List CATPraduct En ay Link Create CATIA 5 CGR File File Mame EE CATPart cgr Work Location E Current Host Hame edmyTt W Register in the Database Description Rad CATFPart y Figure 80 Dialog Window to Create a new CGR within the Product Structure in Teamcenter Enterprise Fill in the fields and press OK The CATPart CGR will be created in Teamcenter Enterprise After your confirmation a dialog window for creating a corresponding document will appear as follows D CMI User Manual 97 98 fi Prepare Generic Document 10 x Class to Prepare General Document Manufacturing Plannin Document Name Hew Part Doc cancel Help E Figure 81 Dialog Window to Prepare a Document in Teamcenter gt If this document exists in Teamcenter Enterprise the CATPart will be attached to this document otherwise a new document will be created in Teamcenter Enterprise
79. ach an existing CAT Analysis file with the CATIA V5 functionality add existing component Figure 109 122 CMI User Manual Me CATIA Y5 CMI PartNumber i loj xl po Start SmarTeam File Edt View Insert Tool CMI Analyze Window Help x ELIAS 46 4448 a Analysis Analysis 1 S Analysis Manager ks Manager 1 As al Analysis Connection Manager 1 Finite Element Model 1 E i ES E ma en Applications e an TERA or a command Figure 109 CMI Product with existing CAT Analysis Select the Analysis in the Product structure and use the Attach Archive Function see Handling of CMIlArchives The result is an new CMlArchive with the CATAnalysis file CATProducts CATParts and the optional CATAnalysisResults file which is attached to the existing PartNumber Figure 110 shows the PartNumber with the new CMlArchive attached to it D E CATIA Workbench V5 CMI EDMG125 20050 loj x File Action Info Query Options View Help PartNumber Analysis CMI PartNumber mas A i Analysis 9031134 D Ser Pl The Part Document was created gt gt gt Accepted Expand Models option initiating object server Expansion Sopa wen Figure 110 CATIA Workbench after Expand model on PartNumber The newly created Archive can be dropped into the CATIA Workbench and loaded to ATIA with the Read commana CMI User Manual 123 E CATIA Workbench V5 CMI EDMG125 20050
80. al eC Working with CATIA V5 Released Cache CMI supports the use of CGR files in the release cache of CATIA V5 For this purpose the Teamcenter customization has to store the CGR files of Catia models in a specific CGR Vault During To Catia these CGR files are copied to the Released Cache instead of the Catia models to the exchange map In CATIA V5 the CGR files are loaded in visualization mode D CATIA Workbench Options gt Change Preferences gt CMI Preference Set Transfer CGR File to CATIA V5 to Only CGR CGR geometry the released cache TOOLS gt OPTIONS Set Work with the Cache System to On and set the path to Check timestamps must be On A y Options ee General hal Display ER Compatibility E Parameters and Measure Fa Devices and Virtual Reality Infrastructure Material Library Catalog Editor FS photo studio Ml Real Time Rendering Part Infrastructure DELMIA Infrastructure elo Annotations Infrastructure EP collaboration Infrastructure ji Mechanical Design ow Shape Analysis amp Simulation AEC Plant Machining t a Digital Mockup El 2 am Ax Cache Management Cor Management ENOVIAvpm Nodes Customization Product Structure en 4 B Configure 7 Cache Activation A Work with the cache system Cache Location Path to the local cache C Documents and Settings ddjuga Local Path to the release
81. amcenter During the CMI Update Synchronize process CMI replaces the original representation file in the exchange directory by the new representation file and changes the Source path of the representation back to its original value Then the new representation file which has the name of the old file is updated in Teamcenter To use this function you need write access to the cgr or model data item in Teamcenter Although the cgr or model is represented in an embedded component of a higher CATProduct you need no write access to the CATProduct Restrictions There must be only one representation in one component The Name of the representation must not change CMI User Manual C O Handling of CATProcess CATProcess is a CATIA V5 file type In Teamcenter Enterprise the CATProcess file SS canbe registered with the standard Teamcenter function register Figure 89 lo x Host Hame edmg125 Work Location WorkLoc 125 File Hame Processl1 CaTProcess Assign to Class Method Source File Honeditable Text File OS Dependent Binary File Report File CATIA Model CATIA Template Catia V5 Archive File Catia V5 CGR File Catia V5 Drawing File Index Langua gel E Cance1 Help Figure 89 Teamcenter Register File dialog After registering the CATProcess file the CATProcess data item can be attached to an Assembly Figure 90 show
82. and Power copies which will be instantiated The Status Field can be Updated Loaded Not known and Created by CMI e Loaded by CMI The part is from PDM and already was in the Catalog at load time e Updated by CMI The Part is from PDM but the Type was changed e Not Known by CMI The Part is not from PDM Created by CMI The referenced File was opened from PDM and is new in the Catalog After Pressing the Synchronize button CMI will check all entries and if there are unknown entries the user must confirm that he will continue x 1 At least one catalog endchapter is not compatible with CMI i Do you want bo continue with the Sync operation Figure 128 Confirm to continue Sync operation CMI User Manual 135 This indicates that there is a Part that is not managed by PDM Next the Catalog is registered or updated in Teamcenter CMI Synchronize Catalog x Catalog Filename Catalog Mare ExampleCatalog catalog ExampleCatalog catalog 20080208 Modell Open Updated by CMI 20080207 Modell Open as copy Loaded by CMI 20080225 Modell Open Mot known by CMI UDF_A Instantiate Created by CMI Edit selected Synchronize Objects Found by the query 1 Operation succeeded in Teamcenter Figure 129 Successfully finished Synchronize Catalog Using Macros CATScripts in Catalogs 136 Set CMI ENABLE CMICATALOGINSERTSCRIPTCMD ON to enable the Insert CAT Script from
83. art The menu item PLOT attaches the created plot file to the active document object in Teamcenter Enterprise 4 Read a Teamcenter CATIA Model object with METAPHSE gt READ Design your view which you want to plot Select METAPHSE gt PLOT After confirmation the plot file is generated Save the document back with METAPHSE gt UPDATE gt ACTIVE After confirmation the generated plot file is registered within Teamcenter Enterprise and attached to the Teamcenter Enterprise CATIA Model object re Menu structure in CATIA With the menu item DEFAULT you can switch the work plane functionality The work plane concept is described in ASSEMBLY gt MOD STRU gt MOVE WP Sa If you do geometry transformations with the ASSEMBLY gt MOD POS gt function then it is necessary to have the right work plane active This panel allows you to select the way in which the work plane is activated The default selection of the panel is Assembly 76 CMI User Manual Preferences Workplane Type Geometry 25 Default Workplane yr Assembly Multiselection Figure 63 Default panel Geometry If you check Geometry the ASSEMBLY gt MOD POS functions will change the position of the selected geometry Model instead of the assembly This option is only available if Geometry positions are supported in your customization of CMI Default Workplane If Default Workplane is
84. ate object Templates are always generated by registering file item objects as CATIA Templates This work is generally done by your administrator _CMIUSR3 Conta DI x File Action Info Query Window Options View Help Item Identifier tas sed 5 4 Temp late model WP al Iki 1 Register File l lo x Host Hame edmig T Work Location WL CHIUSE 4 File Hare Template model Assign to Class Editable Text File Export File Generic Aggregate HTML File Independent Binary File Honeditable Text File 0S Dependent Binary File Report File CATIA Model ox Cancel Help Figure 24 Registering an existing CATIA V4 model as CATIA V4 Template You can copy an existing CATIA V4 model to your Template location and register it as a CATIA V4 Template object as shown above The registered CATIA Templates may then be used to create new CATIA model objects ee Creating a CATIA V4 Model From the Menu Bar in Home Collection select Create gt CATIA Files gt CATIA V4 Model A dialog window as the one below appears Fill in the field File Name D 20 CMI User Manual Fill in the field Work Location Home Collection for rmuenct 5 x File ction Info ne Query Search Window Options View Help Create CATIA 4 Model Ioj x P7 Mile Hane work collection Work Location a Current Host Hame epamd93 Y Register in the Database Description Template CATIA Hodel Type CATIA Ya Mode
85. available in CATIA V5 CMI D In the CATIA Workbench select the CATIA model you want to be highlighted in the CATIA session and choose the Highlightin CATIA option in the Pop Up menu CATIA comes to the foreground with the selected CATIA model highlighted 4 a Since this option is only available at CATIA models in the CATIA Workbench you have to expand the assembly structure with the Show Models option before transferring the assembly to CATIA Updating a Structure There are 3 ways to update a structure In CATIA METAPHSE gt UPDATE gt ACTIVE Updates the active model geometry information A In CATIA METAPHSE gt UPDATE gt GEOMETRY Updates the geometry information of all activated models A In CATIA METAPHSE gt UPDATE gt POSITION Updates the position information of all changed positions rm There are two restrictions that shall be considered S AAA e E O eR O NAAA OA a If a model related to a part of the structure is in a vault this model cannot be modified for example it is not possible to change its color Despite of this it is possible to modify the relative position between this part and the others the position data is stored in the part relation object lf a part of the structure is in a vault the model related to this part can be modified if it is not checked in but there is no way of changing the position of this part a CMI User Man
86. ber Figure 3 CATIA Workbench Title bar description If the title bar of the CATIA Workbench doesn t show your workstation host name and a port number please consult your administrator A The CATIA Workbench Menu Below the CATIA Workbench menu items will be described File Action Info Query Options View Help Figure 4 CATIA Workbench menu items 6 CMI User Manual Menu item File e Session Import File Import 4DNav File Export s CMI File Import s CMI File Page Setup Print Contents Print Window Select All Close Window Figure 5 CATIA Workbench menu File The menu item File gt Save Session will save the contents of the CATIA Workbench in the database To restore the contents of the CATIA Workbench use the standard Teamcenter Query for Saved CATIA Session please refer to chapter 5 The menu item File gt Import 4D Nav File will load a scene file that had been written and modified by the 4D Navigator All models below parts that are visible in the 4D Nav will become marked in the CATIA Workbench The other points in the menu item File contain standard Teamcenter Enterprise File items For more information about the entries please refer to Help gt Menus D Menu item Action CATIA Workbench 5 CMI EPDMD38 20051 File Pr Info Query Options View Help To CATIA 4dd To CATIA To 4D Mavigator To Viewer Cancel To CATIA Clear Workbench create DNU File Ma
87. blies or extend current assemblies including geometry by creating your product structure in CATIA V5 and via the Synchronization in Teamcenter command which automatically creates the equivalent assembly in Teamcenter Enterprise a By default CMI uses a CATProduct with each Component as shown above Itis also possible to have Components that only use a CATPart See Use BOM NO BOM geometries _ CMI Toolbar The following figure shows the toolbars of the CATIA V5 CMI module Descriptions of the toolbar and the command icons follow the diagram xf AAS E BBG Read from Workbench Update Teamcenter Highlight in Teamcente Create Attach Archive _Create Altach Archive an reate V4 Model Modify non Catia Archive Content Insert from Teamcenter Save As in Teamcenter AddTemp From Teamcenter Create in Teamcenter E y ff BART Restore Local Save Local Reconnect with Teamcenter Build Visualization E 4 Update Teamcenter A Create V4 Model Synchronize Ea lt q Save As V4 Model Teamcenter Dn Figure 72 CMI Toolbar in CATIA V5 Using the CMI toolbar in the CATIA Product Structure Workbench it is possible to read files from the CATIA Workbench in Teamcenter Enterprise You can then modify the geometry in your CATIA V5 session The modifications can be updated in Teamcenter Enterprise via the Update Teamcenter or the Synchronization in Teamcenter button in CATIA V5
88. cally be restored except for items that are no longer valid e g those parts that have been revised or removed from the structure In these cases an asterisk is shown at the parent item to indicate that you might want to re expand this item You can see the last sequence of the models in saved CMI Session when the button Option gt Change Preferences gt CMI Preferences Set Show last model sequence in saved session TRUE iol xi CAT Product Worklocation Work Location E Check WH before transfer to CATIA False Show last model sequence in Saved Session fae Send custom attributes to CATIA False Use CATIA 5 CATPart files True Use CATIA 5 CATDrawing files True Use CATIA Y4 files True Work with CATIA y5 Drop with multilevel expand False Transfer CGR files to CATIA 5 Ho Transfer mdel files to CATIA 5 True Save Clear Cancel Help Figure 30 CMI Preferences Loading Several Saved Sessions in CMl Workbench You can drag drop additional saved CMI Sessions into the CMI Workbench See Figure 28 26 CMI User Manual Home Collection for super user je x File Action Info Create Query Search Window Options View Help C U O 4 EiT_5crew Startup Preferences CATIA Workbench 5 CMI EDMG135 20050 oO xj A 1 He E EiT Flange Flange Geo ci v5 my work items EiT Flange Flange Geo 1 465129 File Action Into Query Options Vi
89. ch should be created in Teamcenter Figure shows the part type ask dialog and the user has the possibility to choose a BOM type a No BOM type or to cancel the command x ik Do ou Want Eo create a BOM part J Yes BOM part Mo Po BOM E Mein Abbrechen Figure 145 Part type ask dialog with Create command For the BOM type Teamcenter will create a new Part document and data item For the No BOM type only the data item will be created SaveAs command After starting the SaveAs command the user is asked for the type of the part which should be used in Teamcenter Figure shows the part type ask dialog and the user has the possibility to choose a BOM type a No BOM type or to cancel the command SS ti tI m Do you want Eo Use a BOM part J Yes BOM part Mo Mo BOM E Mein Abbrechen Figure 146 Part type ask dialog for SaveAs command For the BOM type Teamcenter will create a new Part document and data item For the No BOM type only the data item will be created 144 CMI User Manual Design Tables Update Position Update Parts Restore Positions CATIA V5 Design Tables can be stored in Teamcenter Both CSV and Excel files are supported A Catia V5 specific Dependency relation is created between the CATPart and its Design Table Design tables referenced by CATParts and CATProducts are supported This functionality needs to be enabled in the Teamcenter configuration set CMI DE
90. ch starts and all neighbour models of all the selected Catia Models are presented in the Workbench under the same root Part All clicked Catia Models are highlighted in the workbench Only Catia Models with Bounding Boxes are searched Prior to the Neighbourhood Search a CMI DMU File must be created for the root Part via the Workbench Action gt Create DMU File 10 CMI User Manual the DMU Preferences That means the bounding box values of the selected Catia Model are augmented with the DMU Tolerance Default 0 0 The menu item Query gt DMU gt Show Models of DMU Volume presents a Dialog window to ask for the root Part and for the DMU Volume Select Root and Yolume l lol x Root FartHumber for Heighbourhood E Yolume Hame for Part E CATIA End Box Hin x CATIA End Box Min y CATIA End Box Hin z CATIA End Box Max x CATIA Bnd Box Hax y CATIA End Box Max z Figure 11 Dialog for selection of root and volume If you click the selection box for the root part all Part Numbers and Revisions are shown for which a CMI DMU File exists When the root part entry is set a click on the volume name for Part selection box shows all Volumes for this specific root Part If there is no volume that meets your requirements for the root Part you can perform a dynamic Volume Search by specifying all bounding box values in the dialog window When pressing the OK button the Volume search b
91. checked the work plane is automatically set to the next higher assembly in the assembly tree when you select a model el 97 2g 910 a el Y Automaticly set Workplane i Changeable Relation Selected Element Figure 64 Automatically set default work plane Assembly If you check Assembly you can set the work plane with the ASSEMBLY gt MOD STRU gt MOVE WP commands If you switch ASSEMBLY gt MOD STRU gt MOVE WP or set the work plane from the CATIA workbench the selection is automatic reset to assembly Multiselection Check Multiselection to apply ASSEMBLY gt MOD POS positioning to multiple parts at once The parts to be positioned can be selected in a panel Note that only the leaves of an assembly are displayed for selection Also a part that occurs in the assembly both as a leaf and with subassemblies is not displayed for selection CMI User Manual 77 To do Check METAPHSE gt DEFAULT Multiselection METAPHSE gt ASSEMBLY gt MOD POS gt Confirm to get a list of the selectable elements Select the elements to be transformed The selected elements are highlighted red and confirm with OK 4 Do the transformation as described in METAPHSE gt ASSEMBLY gt MOD POS gt Menu structure in CATIA To get help for CMI you have 2 possibilities Click on METAPHSE gt HELP and the browser which was specified in the customization will appear in order to show the complete CMI user manual T
92. ches for CATIA V5 model elements It is possible to attach more than one CATIA V5 model to a single document however a particular model may only be attached once within a document More than one document can be associated with each part A structure is made of one or more parts Teamcenter Enterprise knows two kinds of Part objects Assemblies Y Components Figure 67 Assembly and Component CMI User Manual 83 An assembly can contain other subparts i e assemblies or components whereas a component cannot contain other parts A Object Mapping Teamcenter Enterprise uses the product structure classes assembly and component CATIA V5 uses CATProducts and CATParts Both assemblies and components are mapped to CATProducts in CATIA V5 Models in Teamcenter Enterprise are represented by CATParts in CATIA V5 Assembly Component Figure 68 Assembly Component Model CATProduct and CATPart The CATProduct and the CATPart are stored under different documents of a part CMI Preferences It is necessary to set the CMI preferences correctly in order to work with CATIA V5 The following actions open the CMI Preferences dialog window Window gt CATIA Workbench the Workbench will then be open and active Options gt Change Preferences gt CMI Preferences The main preference settings for working with CATIA V5 are as follows Work with CATIA Toggles modes between working with CATIA V4 or working with CATIA V5 Use C
93. cols JT format based on the PLMXML protocol the UGS JT viewers JT2GO htto www jt2go com TC Visualization are supported CGR format based on the 3DXML protocol the Dassault Systemes viewer http www 3ds com products solutions 3 UGS G d a FQeHet m ja Saa ao TEF e f Figure 113 Integrated viewers CGR or JT files respectively must be provided by your Teamcenter PDM implementation CMI may have to be customized to use them The viewer executable must be configured by the administrator See CMI 8 8 Customization Manual for the necessary steps CMI User Manual CMI User Manual Expand a product structure in CATIA Workbench Action gt To Viewer will send the actual Workbench content to the Viewer Action gt Marked Items gt Marked To Viewer will send the marked Items to the Viewer 3 CATIA Workbench V5 CMI EDMG125 20051 O x Ea Info Query Options View Help To CATIA Add To CATIA o 40 Navigator Clear Workbench Cesate DLU Pils Mark Selected Items Browse Selected irens Marked Items Deexpand Marked Items Unmark All Marked Items To CATIA Add Marked Items To CATIA V4 Highlight Marked Items Marked To 4D Navigator Marked To Viewer Figure 114 To Viewer action In order to exclude the CGR that are provided exclusively for viewing the Model Filter preference in the CATIA Workbench is extended by a Viewing model type CATIA V5 V
94. ction may lead to data deletion 2 Cleaning action may lead to data modification 3 Unimportant error Cleaning action without huge i Reset Filter messages ma Document Selection m Output EE e O Report Name GlobalResults Figure 135 CATDUAV5 dialog CMI User Manual 139 Use from the CMI toolbar to read the data that you want to clean Select the cleaning method you want to use CMI CATDUAVS Integtration ikd Ea _ Clean Geometry Files Clean Structure Clean Geometry and Structure Cancel Figure 136 CMI CATDUAV5 Integration dialog Clean Geometry Files uses CATDUAV5 for all CATParts and CATDrawings to be loaded from the CMI Workbench Clean Structure uses CATDUAV5 for all CATProducts to be loaded from the CMI Workbench OK starts the Read from Workbench and launches the CATDUAV5 utility before loading the files Cancel aborts the Command After cleaning the files the result is shown in the web browser it can be found in SCMIXMAP CMI CATDUA Result lt YYYY gt lt MM gt lt dd gt lt hh gt lt mm gt lt ss gt htm C xmap CMI_CATDUA_Result_20090814082530 htm Windows Internet Explorer GAD C xmap CMI_CATDUA_Result_20090814082530 htm 9 X Live Search We de C ixmapicMI_CATDUA Result_20090814082530 htm Md E ab i Page Oj Tools Global Results Report Generat
95. d cache C ReleasedCache Cache Size l Check Maximum size Maximum size 500 MB Timestamp l Check timestamps LI GMT timestamp format Sd ox Cancel Figure 112 CATIA Options Cache Management For further information on the preconditions for the CGR file handling and for customization hints refer to the same chapter in the customization manual CMI User Manual 125 ey Support of external references With the commands Update Create Save As Synchronize CMI reads out the external references from CATParts and CATDrawings to other CATIA documents In TC Enterprise a customizing point is available to handle the CATIA V5 link information provided via CMI In TC Enterprise links between CATParts CCP can be managed Each link of a CATPart to another CATPart is represented by a depends or relation In CATIA V5 the functionality Get referenced documents automatically loads the referenced documents from TC Enterprise into the current CATIA V5 session If you want to leverage this functionality please contact us at cmi_support t systems com _ OOO Viewer integration for JT PLIMXML and CGR 3DXML Prerequisites 126 With the To viewer command the content of the CMI Workbench can be sent to a specific viewer to obtain a quick preview out of TC Enterprise This functionality is also available without a CATIA V5 installation This functionality works OOTB with two file formats and proto
96. d your CATPart or CATDrawing in a separate window in CATIA In CATIA V5 select the Save As in Teamcenter icon 48 i Teamcenter Enterprise will request you to drag and drop an item into the CMI SS Workbench In order to Save As in Teamcenter with a CATPart double click or drag the CATPart or the document with an attached CATPart to be overwritten into the CATIA Workbench in Teamcenter Enterprise The CATPart active in CATIA V5 will then overwrite its contents The same process applies to CATDrawings ta Save As in Teamcenter is only allowed if the item CATPart or CATDrawing has been opened in a CATPart or CATDrawing Workbench window in CATIA V5 Please take care when you Save As a CATPart which is used in a CATProduct a reference to the CATPart is stored within the parent CATProduct CMI Geometry toolbar Create V4 Model This command converts a CATPart to a CATIA V4 model and creates it in Teamcenter Enterprise Design or load your local CATPart In CATIA V5 select the Create V4 Model icon e i A Teamcenter dialog window appears Fill in the fields and press OK A new CATPart will be created in the Teamcenter Enterprise environment D 100 CMI User Manual Current Host Name edmy99 Help ne Create CATIA Model oO x File Hame MODEL FROM CATPART model Work Location WL 81 edmy99 Y Register in the Database Description Model from vs CATIA Model Size 53
97. del to be updated For CATProduct objects this means that the file will be updated in Teamcenter Enterprise No user interaction is necessary The create operation For CATProduct objects if the nomenclature property field has been filled in CATIA then no user interaction will be required and the following steps will be completed a Teamcenter Enterprise Part will be created adocument object will be created the CATProduct file will be registered the document will be attached to the Part and the CATProduct file to the document If the nomenclature property field has not been filled in CATIA then the Create Assembly Teamcenter Enterprise dialog box will appear requesting the missing nomenclature attribute When the nomenclature attribute has been filled the procedure completes as above For CATPart CGR objects a dialog window for creating a CATPart CGR will appear similar to Action gt Prepare in Teamcenter Enterprise 95 96 m5 CMI Internal Carter 3 3 Internal Carter g5 Cylinder _Block_ IFoqLwdsite cu1800A3ans si 8 Cylindre Block Cylindre Block 1 FA eT is o Ring_D _ IfogLxgsite cuis00A3ans i Ring D7 Ring D7 1 i NewPart NewPart 1 5 NewPart SF xy Ebene gt pe AF y2 Ebene Ef oy Ehene Create CATIA 5 Part File loj x File Nane HewPart CATPart Work Location WL 81 edmg9 9 E Current Host Name edmg99 Applications V Register in the Dat
98. e Use CATIA 5 CATPart files True Use CATIA 5 CATDrawing files True Use CATIA Y4 files True Work with CATIA vI bi Drop with multilevel expand False Transfer C6R files to CATIA 5 Ho Transfer model files to CATIA Y5 True Save Clear cancel Help Figure 13 CMI Preferences menu 4D Navigator Map If 4D Navigator integration is desired user has to set path for 4D Navigator exchange map 12 CMI User Manual CATProduct Worklocation Location where CATProducts and other files created from within Catia V5 are saved Check WB before transfer to CATIA If user tries to transfer a Workbench content it will be checked if it probably will not fit to the CATIA Environment Setup This will avoid an unsuccessful attempt of transferring a lot of data that may cause an error message or even a CATIA system crash Show last model sequence in Saved Session Is this button set saved session is reloaded with the newest sequences of models in CATIA Workbench Use CATIA V5 files CATDrawings and CATParts are sent to CATIA V4 V5 This attribute was labelled Enable CATIA V5 files in former releases Use CATIA V4 files CATIA V4 Models are sent to CATIA V4 V5 Work with CATIA User can choose between work with CATIA V4 or CATIA V5 Drop with multilevel expand Automatic expand of the product structure when an Assembly is dropped onto the Workbench Transfer CGR Files to CATIA V5 Preference allows use
99. e immediately Otherwise a Dialog window is presented to ask for the Root part of the selected CATIA Model Select Root Part for Neighbourhood o x Root PartHumber for Nei ghbourhood 740002401 H E Cancel Help Figure 21 Select Root Part for Neighbourhood 17 By pressing the OK button the neighbourhood search starts and all neighbour models of the selected Catia models are presented in the Workbench under the root Part The clicked Catia model is highlighted in the workbench ERE n nln Cannan OLE a ao A iG al ons ira ire y O ar AS Se a de AO PAR E a ne eGR ae Gn BEGG bare rst ne ore re eae re re tee re Sore ae re You should use this functionality only for frozen data Therefore use the configuration context to use only frozen data Only Catia models with bounding boxes will be searched Prior to the Neighbourhood Search a CMI DMU File has to be created for the root Part via the Workbench Action gt Create DMU File You can modify the extent size of the neighbourhood by changing the DMU Tolerance in the DMU Preferences That means the bounding box values of the clicked Catia model will be increased by the DMU Tolerance Default 0 0 CMI User Manual CHAPTER 4 General Functions This chapter describes how to handle CATIA relevant data in Teamcenter Enterprise It describes operations such as creating CATIA models and assembly structures as well as how to search for them
100. e Object Multiple Objects Parthumber Nomenclature Appl ic a ti a Modified Read Write Crankshart_4ssm Crankshaft _Assm Open Read Write CrankshaftRight CrankshaftRight Open Read Write KurbelweleRechts Modified Read Write CrankPin CrankPin Open Read Write CrankshaFtLeft CrankshattLett Figure 85 CMI Information for multiple items A CMI toolbar Add Temp D Allows the user to visualize a temporary structure together with the working one For example if the user is making a design of a car and wants to see if the luggage boot is big enough he can load a suitcase as a temporary structure by doing the following supposing that the car structure is already loaded Read an assembly here the car assembly into CATIA using the CMI toolbar Read command In CATIA V5 select the Add Temp icon 3 Drop the assembly or model you want to add temporarily to CATIA the suitcase into the CATIA Workbench Expand it as necessary Click Action gt To CATIA in the Workbench menu Changes expands you make to other assembly structures in the Workbench will not be sent to CATIA Instead of an Assembly you can also drop a Saved Workbench Session CATIA comes to the foreground with both the original and temporarily added structures loaded in the same window here the car and the suitcase structure It will not be possible to make any changes to the temporarily added suitcase structure The temporarily added part structure is removed
101. e The active work plane and the active model are different If you want to edit a model you have to make it active If you move or rotate a model in the structure by using the TRANSFOR Function then you do not change the relationship to the root structure element but the geometry of the active model There are several possibilities to choose the active work plane ASSEMBL Y gt MODSTRU gt MOVE WP gt IN WORKB Call the active work plane from the workbench CONFIRM with YES AZ Choose the assembly in the CATIA workbench with the right mouse button SS Set work plane see fig Below Send the active work plane from the Workbench to CATIA Choose the assembly in the CATIA workbench with the right mouse button Set work plane D 70 CMI User Manual 13 CATIA Workbench CMI ig033 20051 File Action Info Query Options View Help Abstand i cD Abstandhalt y A 1 latta Abstand j Platte Platte A 1 gt bstandheli a Mark Unmark Part 1 A Scheibe Mark All Subassemblies gt Scheibe Unmark All Subassemblies A Get Item Info Refresh Set Workplane Expand Multiple Levels Scheibe Scheib Expand a o Expand Models 1 Show Relationship Deexpand Branch Catia Item Stab A 1 was created Catia Item Stab A 1 was created Expansion complete Figure 58 Choose the active workplane in the CATIA Workbench ASSEMBLY gt MODSTRU gt MOVE WP gt UP CONFIRM with Y
102. e Version Similarly to Add Temp Compare Version is used to load different versions of the same assembly However in this case the version that is already open is read only and the version that is added can be modified In Catia V5 go to Tools gt Options gt Compatibility Tab CMI and make sure that the option Use one temporary product window is checked Read revision A of your assembly as described in CMI toolbar Read AE You will find that it is opened in Catia underneath a product tagged CMI Workbench In CATIA V5 select the Compare Version icon S Notice that Revision A is renamed with the TMP _ prefix Revision A can no longer be modified and saved in Teamcenter Find and expand Revision B of your assembly Send it To Catia Revision A and B of your assembly are opened in the same Window in Catia V5 You can overlay and position the assemblies relative to each other for comparison 104 CMI User Manual Use Synchronize Teamcenter to update Revision B of the assembly Notice that Revision A and all it referenced files are ignored and will not be modified in Teamcenter a CMI toolbar Insert from Teamcenter Allows the user to load a CMI structure under a selected product Read an assembly into CATIA using the CMI toolbar Read command i Select a product to be the root of the inserted structure In CATIA V5 select the Insert from Teamcenter icon
103. e creation storage modification and management of CATIA models and assembly structures in the Teamcenter Enterprise PDM system About this Manual This manual is intended for end users of the CATIA Teamcenter Interface It assumes that the reader is familiar with the CATIA application and with Teamcenter Enterprise Object Management Framework OMF as described in the Object Management Framework User s Manual Related Documents The following manuals contain information about installation usage and customization of the CATIA Teamcenter Interface Manual Title Version CATIA Teamcenter Interface Installation Administration Guide 10 7 CATIA Teamcenter Interface User Manual 10 7 CATIA Teamcenter Interface Customizing Guide 10 7 AS Organization CMI User Manual This manual contains the following chapters some are specific to a particular version of CATIA either V4 or V5 or are valid for both Chapter 1 provides basic information about the CATIA Teamcenter Interface and describes some features of this application interface Chapter 2 describes how to start CATIA within the Teamcenter environment and also how to enable the CATEDM Module in the CATIA Function Palette Assumed is that the CATEDM module will be referenced under the function name METAPHSE within the CATIA working session default setting during the installation Chapter 3 introduces the CATIA Workbench and lists its functions The goal of this chapte
104. e the following functions available notice that you can decide to show or to hide the model representative with the toggle View gt Display Models Ccuboidi model Cuboidi 1 16400 D Off 5 On 12K 4E Mark Unmark Model Get Item Info Refresh Deexpand Model Highlight in CATIA Draw Flag On Off Swap Flag On oft Activate Model show Neighbour Models show Relationship Y5 Dependent On YS is Depended On By Figure 20 Context menu on Model in Workbench Pop Up Menu Item Description Mark Unmark Model Marks or unmarks the model representative Get Item Info E Displays extended model representative information Refresh Refreshes the representation of the model De expand Model Removes the selected model Highlight In CATIA Highlights the selected model in CATIA Draw Flag On Off Toggles the Draw Flag Swap Flag On Off Toggles the Swap Flag Activate Model Marks the model to be the active model in CATIA Show Neighbour Models Marks the neighbour models in Workbench needs DMU Export File see Figure 11 The model representative in the Workbench shows information about the model file and the flags you have set suspension m suspension Fa 1 4720 D OFF Ss Un Show Neighbour Models performs the Neighbourhood Search for the clicked CATIA Model If the complete path from the Root Part to the clicked CATIA Model is in the Workbench and there exists a CMI DMU File for the Root Part the search is don
105. e the modifications back with METAPHSE gt UPDATE gt POSITION Y After your confirmation all position information changed will be updated in Teamcenter Enterprise To modify the position information between two parts you have to use the METAPHSE gt ASSEMBLY gt MOD POS command in CATIA Please refer to chapter The Workplane to see how to use the workplane concept UPDATE gt GEOMETRYMODELS This menu item updates the geometry information of all activated models in CATIA in the Teamcenter Enterprise database As a prerequisite the models must have been loaded from your Teamcenter Enterprise system before A Read Teamcenter Enterprise CATIA items with METAPHSE gt READ cs Modify the geometry information Write the modifications back with METAPHSE gt UPDATE gt GEOMETRY vias Ay After your confirmation a list of models that have been modified will come up in CATIA If some models were active but the user must not change these models a status panel will pop up lt is not necessary to confirm this panel Select the models you want to update The selected models will be updated in Teamcenter Enterprise Select Models to Save List of Parts lable Top Table OK CANCEL Figure 49 Dialog for Update CATIA Models 62 CMI User Manual A METAPHSE gt DOCUMENT The menu item DOCUMENT contains actions to save the active model in CATIA in the Teamcenter Enterprise environment DOCUMENT gt SAVE AS This
106. ecaeaeseeaeeaes 61 FIGURE 49 DIALOG FOR UPDATE CATIA MODELS c cccececcececcececceceeeeceeeececeeeeeeeeeeneaeenes 62 FIGURE 50 DIALOG FOR MULTI CREATE MODELS IN CATIA ccccceeceececceceececcecceseeceeeneaees 64 FIGURE 51 DIALOG FOR MULTI CREATE MODELS IN TEAMCENTER 2 2cceceeceececceceeceeeeeeess 64 FIGURE 52 MODEL INFO DIALOG cccceceeceeceececeecececaeenecueceececaecueceeaeeaeceeceeaesecueaesaeeneeneness 65 FIGURE 53 PANEL FOR SELECT A SUBASSEMBLY TO DROD 2 cececcececeececeececececeececeeaeeess 67 FIGURE 54 CONFIRM DROP IN EDM DIALOG uuu eccececeececcececeececeececeececeeaeceeaeceeeaueeeaeeneaeeees 67 FIGURE 55 TREE STRUCTURE WITH ONE TREE 2 cecceceececcecceceececceccecaeceeceeaeceecueaesaeeneeneaees 69 FIGURE 56 TREE STRUCTURE WITH SEVERAL TREES AND A VIRTUAL ROOT 2 cecceeceeeeeeeeeees 69 XI xii FIGURE 57 FIGURE 58 FIGURE 59 FIGURE 60 FIGURE 61 FIGURE 62 FIGURE 63 FIGURE 64 FIGURE 65 FIGURE 66 FIGURE 67 FIGURE 68 FIGURE 69 FIGURE 70 FIGURE 71 ACTIVE WORKPLANE IN THE TREE STRUCTURE cc 00cccceeeeeceeceeseeceseeeeeseeeeesauees 70 CHOOSE THE ACTIVE WORKPLANE IN THE CATIA WORKBENCH 00cceeeeeeeeees 71 MOVING THE WORKPLANE UP 02ccceeccceeeceneetenceceeeeeeeeeeeeteneeteueeseeeaeetaneenanes 71 MOVING THE WORKPLANE DOWN 2 0cceeceeceecceececceeceecuecuecuecuecuecueeeecaecaseaeeaes 72 SELECTION PANEL FOR T
107. ed Model types will pass in the Expand Function of the CATIA Workbench unselected Model types will be filtered Filter for public versions If the Filter for public versions is activated only private and public Catia Files are transferred to Catia Private means that the file is owned by the actual user public means that the file is checked in to a vault If there is a checked out file of another user during To Catia the latest public predecessor file is transferred to Catia if existent Menu item View File Action Info Query Options Help Teon View List View w bee VIET Change List View Columns Change Sort Display Models Figure 16 CATIA Workbench menu View The menu item View displays items in the CATIA Workbench in list view or in tree view You can also modify the list view columns or sort the items Finally you can choose whether models are to be displayed within the CATIA Workbench or not For more information about the entries please refer to 14 CMI User Manual Help gt Menu File Action Info Query Options viev FSR session Information General Help Menus CMI Product Into Figure 17 CATIA Workbench menu Help The menu item Help displays information about your session about the menus and their meaning Additionally CMI product information can be displayed q AAA Pop Up menus of Workbench Items If you select a Part or a Document or a CATIA Model and drop it in
108. ed on Friday 14 August 2009 at 08 26 47 Document Location File C xmap LVL2 CATProduct OK C xmap Base_3 CATProduct OK C xmap Base_4_CATProduct OK C xmap Base_1 CATProduct OK C xmap Base_2 CATProduct OK Checker Global Results Report for Checked Documents Reports Return Codes Detected Prio 1 Prio 2 Prio 3 Report for Cleaned Documents Reports Return Codes Detected Fixed Prio 1 C xmap Base 1 CATProduct 401 401 0 C xmap Base 2 CATProduct 401 401 C xmap Base 3 CATProduct 401 401 C xmap Base 4 CATProduct 401 401 C xmap LVL2 CATProduct 817 817 Batch successfully processed ReturnCode 0 Figure 137 CATDUAV5 Global Results After inspection you can update the cleaned files in Teamcenter If you do not update the changes made by CATDUAV5 are not stored 140 CMI User Manual Note Cleaning files may take a long time Attention For files that are already open CMI cannot load the version that was cleaned by CATDUA Make sure that you close the files that you want to clean Verification of CATIA Release CMI can check the CATIA version of files against the current CATIA session during Read This can be used to avoid loading a document from a newer CATIA release to an older CATIA version The CATIA Release SP HF that was used to save a file is stored in Teamcenter To enable the check set the
109. eeeceeeeeess 30 FIGURE 34 DIALOG CREATE CATIA MODEL OPENED FROM CATIA ccceceececceeeeseeeeeeeeness 32 FIGURE 35 NAMING CONVENTIONS FOR DRAWING SHEETS 2 2cceccecceceeceececeececuccesaeceeeesaess 33 FIGURE 36 A SIMPLE ASSEMBLY STRUCTURE 2 2 cecceceececcecceceececceccecaeceecusaeceecuesesaecueeneaes 44 FIGURE 37 EXAMPLE OF AN EXPANDED ASSEMBLY IN TEAMCENTER ENTERPRISE BROWSER 44 FIGURE 38 EXAMPLE ASSEMBLY STRUCTURE IN TEAMCENTER ENTERPRISE BROWSER 45 FIGURE 39 EXAMPLE ASSEMBLY STRUCTURE WITHIN CMI CATIA WORKBENCH 2 02 0 46 FIGURE 40 DRAG DROP AN ASSEMBLY INTO THE CATIA WORKBENCH ceccecceeceeeeeeeeeees 47 FIGURE 41 EXPANDED ASSEMBLY STRUCTURE IN CATIA WORKBENCH 22 eccecceceeceeeeeeess 48 FIGURE 42 EXPANDED ASSEMBLY STRUCTURE WITH MODELS IN CATIA WORKBENCH 48 FIGURE 43 THE CREATE DMU VOLUME DIALOG cccecceeccecceceeceeeeueeeeeeeeueeeueeeseuseeeeusaeeaes 53 FIGURE 44 GETINFO CATIA MODEL DIALOG ccccceccececeececeececeececeececeeaeceeaeceseeeeeeaeeneaeeaes 54 FIGURE 45 SELECT ROOT AND VOLUME DIALOG cccccceccecceceecceceueeeeeeeeeeeeeeeuseeseesauseusaeeans 55 FIGURE 46 HOW TO CREATE SUBASSEMBLY RELATIONS THAT SUPPORT QUANTITY 2 00 0 57 FIGURE 47 CMI CATIA FUNCTION MENU STRUCTURE ccccccceseeseeeeeeeeeeeeeeeeueeeseueeeeaueaueaes 59 FIGURE 48 DIALOG FOR UPDATE CATIA MODELS c cccececceceececeececeececeeeecesaee
110. eel ExternalInnerWheel CATPart PartNumber Y CMI Unknown Read Write ExternalOuter Wheel OuterWheel 1 ExternalWheel CATPart ExternalOuterWheel CATPart InternalinnerWheel Y CMI Unknown Read Write ExternalWheel Right Wheel ExternalStructure CATProduct ExternalWheel CATProduct File name InternalinnerWheel CATPar Use mapping file C Reconnect CMIArchives Select unknown Reconnect selected l oa 2 conc Figure 86 CMI Reconnect dialog There are three possible states CMI Unknown CMI does not know this item at all It would be created as a new Part in Teamcenter Can be reused CMI knows this item is in Teamcenter But it appears that in Teamcenter there is no instance known by the same instance name under the same parent item Maybe it was deleted or is new Synchronize would create a new instance of the existing Part in Teamcenter Can be updated CMI knows the object as well as this instance is in Teamcenter It can be updated in Teamcenter Can not be updated CMI knows the object as well as this instance is in Teamcenter but it is not writeable and cannot be updated in Teamcenter Archive content The object is part of a CMlArchive Broken Link A broken link cannot be reconnected It will be ignored during synchronize An asterisk signifies that the Reconnect Dialog recognized the item but it is not yet reconnected Items are actually reconnected when you close the dialog with OK Click Cancel t
111. een written with the 4D Navigator As result all models that are described in the scene file will be marked in the CATIA Workbench D In CATIA Workbench select menu Action gt To 4D Navigator SS The assembly is transferred to 4D Navigator CMI User Manual 55 In the 4D Navigator Modify the scenario by using only the Show NoShow toggle After that save the scenario in a so called Scene file In the CATIA Workbench select menu File gt Import 4Dnav File Choose the file that has been written in the last step All models that were set to Show in 4D Navigator will be marked in the Workbench f i Notice The assembly has to be loaded with the Action gt To 4D Navigator to the 4D Navigator and the contents of the Workbench must not be changed until this task Canceling Communication If necessary you can cancel the communication while the CATIA session is waiting for an assembly structure In CATIA Workbench select menu Action gt Cancel To CATIA The communication is cancelled the CATIA window becomes active AAA Support of Quantity In Teamcenter Enterprise the relation between part version and part master Uses Part Masters has an attribute Quantity This attribute indicates how many instances of a component are used by an assembly E g if a certain screw is used 100 times in an assembly you would add a component for the screw to the assembly only once but set the quantity to 1
112. egins and all Catia models within the selected Volume will be shown in the Workbench under the same root Part ese Seg ag A OD een Pars A ane et ae er EN ER ee Ee iE ea aT a re nem Oe are eae ee ee ae a ae TP a O in an ln ln in in tr i ih ar a a a da a 1 i Only Catia Models with Bounding Boxes are searched gt Prior to the Volume Search a CMI DMU File must be created for the root Part via the Workbench Action gt Create DMU File Prior to the Volume Search a DMU Volume must be created for the root Part via Action gt Create DMU Volume CMI User Manual 11 Menu item Options CATIA Workbench 5 CMI EPDMD96 20051 File Action Info Query Bei View Help change Preferences Database Model Filter Configuration Context CMI Preferences DAU Preferences Wiewer Preferences Figure 12 CATIA Workbench menu Options The Options Menu has two Menu items the Change Preferences Submenu and the Model Filter Option The menu item Configuration Context sets changes the user s configuration context Within the database preferences you can define the query scope for the databases to be searched in If the user wants to work with CATIA the settings at Options gt CMI Preferences have to be set correctly 2101 x CATProduct Worklocation Work Location Check WH before transfer to CATIA False Show last model sequence in Saved Session False Send custom attributes to CATIA Fals
113. en the file or Part from the PDM system You cannot use Open Document or Open As New Document in this context 132 CMI User Manual Read Catalog The administrator needs to set CMI ENABLE CMICATALOGREADCMD ON in the Catia environment in order to enable the Read Catalog function Read Catalog allows to retrieve CATCatalogs from Teamcenter for editing Select Catalog for editing q x CatalogDocumentl cataloo MyCatalog catalog YourCakalog catalog TestCataloghoS catalog Refresh List Fram Teamcenter Open Catalog For Editing lt Close Figure 125 Select Catalog for Editing Pick from the list of catalogs available in Teamcenter The catalog will be opened in the Catalog Editor CMI User Manual 133 201 xi TAE a ah Ti MyCatalog catalog ee Chapter 1 Lil ComponentFamily 2 Description Definition Mame ComponentFamily 2 4 Reference Keyword values Preview Type feUnset gt i ss SSSSSSSCSCS File name Select document Select external Feature Select document in session sesion docente CuexmapySIScrew CA TProOduct File name Crexmapysi5crew CATProduct Files of type CaTProduct CATProduct eN B ox 8 canaf Figure 126 Select Document in Session Use Select document in session to build the catalog from Parts or files that were opened from Teamcenter via CMI Update or Create Catalog The administrator needs to set
114. eneaees 15 FIGURE 18 CONTEXT MENU ON PART IN WORKBENCH 2 ececceceececeececeecececeeceseececeeaeseeaeeess 15 FIGURE 19 CONTEXT MENU ON DOCUMENT IN WORKBENCH 2 cecceceececcecceceececcesaeceeensaess 16 FIGURE 20 CONTEXT MENU ON MODEL IN WORKBENCH 2 0 eececcecceceeceeceseecececcesaeceeensaess 17 FIGURE 21 SELECT ROOT PART FOR NEIGHBOURHOOD 0ececceccececeeceeceeeeceeceeeeeeeeeeeeness 17 FIGURE 22 PREDEFINED CATIA MODEL STRUCTURE cccccecceceeceeceueeeeeeeeeseeeseeseeseeceesaeeees 19 FIGURE 23 PLOT FILE ATTACHED TO A CATIA MODE L 2 ccccececceccecceceeceeceseeceeeuscesaecnteneaees 19 FIGURE 24 REGISTERING AN EXISTING CATIA V4 MODEL AS CATIA V4 TEMPLATE 20 FIGURE 25 DIALOG CREATE CATIA V4 MODEL cececeececeececeececeececeececeseeceseeeeeeeaeeneaeeaes 21 FIGURE 26 DIALOG CREATE CATIA V5 PART FILE 0ccccecceceececeececeececeseeceseeeeeeeesueaeeess 22 FIGURE 27 TEAMCENTER BROWSER WINDOW CATIA V4 TEMPLATE OBJECTS AND POPUP 23 FIGURE 28 SEARCHING A CATIA V4 MODEL IN TEAMCENTER DATABASE 2 2 cecceeeeceeeeeeess 24 FIGURE 29 QUERY SAVED SESSION OIE 25 FIGURE 30 CMI PREFERENCES aa ao 26 FIGURE 31 SEVERAL SAVED SESSIONS IN CMI WORKBENCH 2 02ceccececeececeececeececeeeeceeeeeess 27 FIGURE 32 DRAG DROP A SINGLE CATIA MODEL INTO THE CATIA WORKBENCH 30 FIGURE 33 DRAG amp DROP A DOCUMENT INTO THE CATIA WORKBENCH 2 2 ceceecece
115. eral those entries represent constant values like Company Name values delivered from the environment like User and values coming out of the PDM like ModificationDate Those entries representing values out of the PDM are preceeded by These values will be provided by means of the customizable x3GetAttrsForCAD CMI method which will be described soon Each view section in the drawingframe script file can contain the following entries within a single line Statement Syntax Description Xpos xpos x x position of text entry Ypos ypos y y position of text entry Size size s size of text entry Color color c color of text entry 38 CMI User Manual CMI User Manual Orientation orientation o orientation of text entry String string sub string text entry The sub stringcan contain following statements Statement Example Description string T Systems The string will be written into the drawing String T Systems The string will be written into the drawing lt var gt USER The UNIX user name will be written into the drawing lt var gt Date The alias name for the x3GetAttrsForCAD message In our example listing it is the alias name for the Teamcenter attribute CreationDate How to get values from the PDM System into one of the defined titleblocks like DIN AO DIN A1 a s o automatically on reading the model via CMI The parameters that begin with are those coming from PDM
116. esaeceecusaecaeeuecesaeeneeneaess 6 FIGURE 5 CATIA WORKBENCH MENU FILE 2 ccc0cceccecceceececcecceceeceececaececueaececueceeaesneeneaees 7 FIGURE 6 CATIA WORKBENCH MENU ACTION 0cceccecceceececcecceceeceecesaececueaeeaecueceeaeeeteneaees 7 FIGURE 7 CATIA WORKBENCH MENU INFO 2 cececceececceceececcecceceeceeceeaececueaecaecuecesaesneeneaees 9 FIGURE 8 CATIA WORKBENCH MENU QUERY ccecceceececeececeececeececeeeeceeeececaececneaesueaeeesatens 9 FIGURE 9 CATIA WORKBENCH MENU QUERY DMU c cccecceccecceceeceeceeeeceececcesaeceeeneaees 10 FIGURE 10 ROOT PART FOR NEIGHBOURHOOD SEARCH 0 seeeeeceeeceeceeceeceeceeceecueeeeeueeeeneeaes 10 FIGURE 11 DIALOG FOR SELECTION OF ROOT AND VOLUME cscceccecceeceececceeceeceeceesueeneeaes 11 FIGURE 12 CATIA WORKBENCH MENU OPTIONS 0cceccecceceececceeeeeeceeeeeeeeeeeeeseeneeeeeenness 12 FIGURE 13 CMI PREFERENCES MENU 0cc0ccececceceecececcececeececeececeececeeaecueaeceeaeeesneaeeneaeeaes 12 FIGURE 14 DMU PREFERENCES MENU cc 0cceceececeecececcececeececeececeececeeaecueaecesecesneaesneaesass 13 FIGURE 15 MODEL FILTER PREFERENCES DIALOG 0cceccecceceececceececeeceecesaececusaesaecueeneaees 14 FIGURE 16 CATIA WORKBENCH MENU VIEW ccecceceeceececceceececceceeceeceecesaeceeuesesaeeeeeneaees 14 FIGURE 17 CATIA WORKBENCH MENU HELP 2 2 0ececceececceceececceececeeceecesaeceeueceeaeeee
117. escecccccescsecectevesseos 75 ASSEMBEY S MOD POS TRAPO tn e i ds dl ao ces 75 ASSEMBLY gt MOD POS gt TRAFO gt STORE uuu tececcsceccccecneccecceccecceceeeeneeeeeneenssaeens 75 ASSEMBLY gt MOD POS gt TRAFO gt REUSE iiocconccccnccnncnnncnccncnncnnnnnncncnnnnnnnnnnos 76 A A A A Meee he ee 76 MENUS TRUCTUREIN CATIA Sa A ion 76 COME E E EEE A A 77 DOTAUIE VVOIK DIAG roerei a O A dE AA AO A 77 ASSCIMDIV lid bau Ed EE e A A EA 77 MTS CIO CUM A A A ido 77 MENU STRUCTURE IN CATIA Lt td AAA a it AE da tas 78 THE MESSAGES IN GATA ree sec A ae kaa eas 78 CHAPTER Bci A incida 83 WORKING WITH CATIA V5 unn ia 83 iaa o A one anetscesaneseceeatessensane a a 83 PREDEFINED OBJECT STRUCTURE desde dla deans lence 83 OBIE Ts MAPPING saeara a a 84 GMI PREFERENCE O Serua a TE 84 USSCATIA V POS asian do a Se te a REEE 85 Use CATIA V5 CATPart NCS 000000000000000000nnannannnannanannnnnnnnnnannannnnnnnnnnnnnnnnnnnnnnnnnnnnnanna 85 Use CATIA V5 CATDrawing files ooooonccccoconnnncccononoconononononnnncononononnnonncnnanonnnnos 85 Transfer CGR files to Catia V5 ccccccecccccccccccccecceccecseceececcersessesecaunsensesensussesneaensenetsass 85 PRODUCT STRUCTURE CATIA V5 VS TEAMCENTER ENTERPRISE 0ccecceceeceeceeeeceeeeeeess 85 EMINEOOEBA Eat lc deceo 88 AiO A en ame ord the a notes Seen sect foie Saeed ee 89 CATPARTS AND CATDRAWINGS IN CATIA WORKBENCH IN TEAMCENTER ENTERPRISE 90 CMI TOOLBAR READ FROM WORKBENCH 2
118. ew By customization this can be enhanced to Product View and Resource View The views are later used in the CATIA V5 module to define the View where the Assembly should build in CATIA Workbench 5 CMI EDMG125 20050 50 x File Action Info Query Options View Help ProductView l1 objects are expanded Expansion complete Added items to an expansion Figure 92 Expanded Process Element After sending Action gt To CATIA or The Read Command in CATIA V5 the CMI Workbench content to CATIA V5 the CATProcess document is loaded in the CATProcess Workshop of the CATIA V5 application The ProductView Assembly is build in the Product List As described above the adding of Assemblies to the Resource list can be customized in Teamcenter Figure 93 shows the opened CATProcess in CATIA V5 CMI User Manual DEUE v5 Process1 CATProcess lo x B Start SmarTeam Fie Edit View Insert Toos CMI Window Help x Y T P P R y nE ProcessList L Process z E Part Operation 1 A p L Machining Process List 1 3e ProductList SN ProductView ProductView 1 a PVPart PVPart 1 ar ResourcesList i ST l a l e f amp m i _ i mn m ma _ me 2 OSES O29 C vw HO Be Os wed IO Bm Select an object or a command oj ay Figure 93 Loaded CATProcess in CATIA V5 Changes in the CATProcess document in CATIA can be updated with the Update Command of CMI in CATIA
119. ew Help DP off S On Ef 2E EiT screw testsession testsession2 EiT screw EiT Screw H Query working Maximum Number of Items to Retrieve set to 5000 gt gt gt Accepted CATIA Model option initiating obj gt gt gt Accepted Save Session option initiating object server Saved Workbench Session testsession vas created The Collection Relation was created Figure 31 Several Saved Sessions in CMl Workbench Make sure that the Configuration Context and Database Scope are set correctly so that all items can be found ee Multilevel Auto Expand Due to CMIs Multilevel Auto Expand you can expand parts selectively under an assembly in the CATIA Workbench To expand selectively first drop the top level Assembly onto the Workbench without expanding it Now drop any subassembly onto the assembly already in the Workbench CMI will expand all the way to all occurrences of this subassembly without expanding unnecessary product structure The function allows to load dedicated parts in context to each other without unnecessary clutter You may drop several parts at once onto a part in the CATIA Workbench eC Drop with multilevel expand The preference Drop with multilevel expand will automatically expand the assembly structure if you drop an Assembly onto the Catia Workbench In Catia Workbench Options gt Change Preferences gt CMI Preferences CMI User Manual 27 CHAPTER 5 Working with CATIA V4 models Thi
120. following in the Teamcenter Configuration set CMI VAL I DATE CAT TA Va RSION ON CATIA V5 Part File bottom_bench_CP CATPart was not loaded because it was stored by a higher catia release than yours CATIA V5 Part File top_bench_CP CATPart was not loaded because it was stored by a higher catia release than yours aa CMI Operation Status O Workbench successfully read from Teamcenter SS Close l Figure 138 CATIA version verification Representation Formats in CATIA V5 The CATIA V5 module can be configured to support CATIA V5 shape representation files in a generic way CATIA V5 Representation files can be used in a product structure and are handled in a similar fashion to V4 Models To enable support for specific Shape Representations an administrator can set the following variable in the Catia V5 environment CMI REP FORMATS 3dmap CATShape In this example the 3dmap and CATShape Representation formats will be handled by the CMI Catia Module Figure 139 and Figure 140 Other Formats that may be relevant are st1 and jt CMI User Manual 141 amp CATIA Workbench 5 CMI EDMG136 20050 loj xj File Action Info Query Options View Help Chassis 3dmap Chassis 3dmap 1 140 Chassis CaTShape Chassis CAaTShape 1 767201 gt gt gt Accepted Expand Models option initiating object server Expansion complete gt gt gt Accepted Deexpand Branch option initiating object server
121. from being loaded into CATIA select the part and hide it with the Deexpand option in the popup menu a In the CATIA Workbench select the option Action gt To CATIA in the menu The assembly is transferred to CATIA RA After having transferred the data the CATIA session appears with the desired assembly structure You can modify the assembly and save it in Teamcenter 48 CMI User Manual N You can drop more than one part or assembly to the CATIA Workbench It is also g possible to mix parts and assemblies with CATIA models or documents t If you drop another part onto a part in the CATIA Workbench instead of onto the Q background and the dropped part is a subassembly it will be expanded You can use this to expand only selected subassemblies to avoid expanding a complex structure only to de expand most of it afterwards For further information please refer to the section entitled Multilevel ee a ee ee ee ee ee ee a a ee a ee a ee ee ee a a a ee a ee a ee a a a ae ae ae a ae ae ae ee N E ee ee S ES l Highlighting a Model in CATIA In cases where you have loaded an assembly structure to CATIA as described in the steps above it may be useful to find the equivalent model in the CATIA session of a Part model displayed within the CATIA Workbench For this purpose it is possible to highlight CATIA models in CATIA using the currently selected Model in the CATIA Workbench Model highlighting is also
122. from the CATIA Workbench after you send it to CATIA CMI User Manual 103 Je All Partnumbers and Filenames in the temporarily added structure are prefixed with TMP _ where F is a counter in CATIA V5 beginning with 1 Every AddTemp will Increase the counter This prefix is customisable by the customer i Limitations Product are not transferred to CATIA the products will be represented by CATIA Components only position information from Teamcenter is processed e Standard Parts are not supported Visualize multiple revisions ofan Assembly using Add Temp Add Temp in Catia V5 can be used to load different versions revisions of an Assembly or Model at the same time In order to make this possible the Part Numbers and File names of the temporarily added assembly are prefixed with TMP _ In Catia V5 go to Tools gt Options gt Compatibility Tab CMI and make sure that the option Use one temporary product window is checked Read revision B of your assembly as described in CMI toolbar Read You will find that it is opened in Catia underneath a product tagged CMI Workbench In CATIA V5 select the Add Temp icon 5 Find and expand Revision A of your assembly Send it To Catia Revision A and B of your assembly are opened in the same Window in Catia V5 You can overlay and position the assemblies relative to each other for comparison 4 D 4 D CMI toolbar Compar
123. gt gt Accepted Deexpand Model option initiating object server CATIA Workbench CMI edmg 17 20050 caliper caliper amp brake re dd caliper ual 2 driving_shaf dri_shaft dri shaft peer da gt g a 5 ore s yA 244K 4K lo_tra q tra gt trace suspension ISR En race Det A up_tra up_tra A b carr wheel_carrie heel _carr W heel_ carri dep ES 1 367520 D OFF S On 358K 49K gt caliper mode caliper El 1 875360 D OFF S On 858K Y 114K caliper mode caliper 1 875360 D OFF S On 858K 114K lower_traver 0 1278K 12K trace_bar mo 429K 6K upper_traver upper_trave 1 544000 D OFF S On 575K 7 10K gt gt gt Accepted Configuration Context option initiating object server Figure 39 Example assembly structure within CMI CATIA Workbench C Loading a Structure in CATIA 46 To load an assembly structure in CATIA Start the CATIA Workbench as described in chapter 3 The CATIA Workbench has to be started for CATIA relevant functions i e read update etc Once the CATIA Workbench is started you can leave this window A In CATIA METAPHSE gt READ confirm with yes CATIA goes into the background CMI User Manual The CATIA Workbench comes to the foreground 4 D Drag amp Drop the Part that is the root of the selected structure in the CATIA SS Workbench or double click
124. h of Catia models bounding boxes must be generated for all Catia models and the administrator has to set up the DMU facilities by configuration variables The generation of bounding boxes is specified with installation of Catia To verify the bounding box values of a Catia model select Info gt Get Item Info 52 CMI User Manual Create DMU Yolume loj x Volume Hame Fart Hunber Rev A Organization Hame E Project Hame E Description Title Type CATIA End Box Hin x CATIA End Box Hin CATIA Bnd Box Min z CATIA Bnd Box Max x CATIA Bnd Box Hax y CATIA Bnd Box Hax z Figure 43 The Create DMU Volume dialog A DMU Volume is defined by two x y z coordinates like a bounding box The volume relates to a Root Part that means the same volume for a Child Part must differ from the Root Part corresponding to the transformation matrix AAA Neighbourhood of models o Notice To evaluate the neigbourhood of Catia models bounding boxes must be generated for all Catia models and the administrator has to set up the DMU facilities by configuration variables The generation of bounding boxes is specified with installation of Catia To verify the bounding box values of a Catia model select Info gt Get Item Info CMI User Manual 53 GetInfo CATIA Model loj x CATIA End Box Hin X 1 6000000000000000e 01 CATIA End Box Hin Y 4 6599996474121094e 01 CATIA End Box Hin zZ
125. he Database Description Footltem Clear Cancel Help Work Location field set to the single available value in a the selection list E Figure 97 Create Archive Dialog in TeamCenter After pressing the OK Button the prepare dialog for the Teamcenter Document is lt presented to select an existing or to create a new Document for the Archive In the CMI User Manual 115 example Figure 98 we create a new document in TeamCenter if Prepare Generic Document Class to Prepare General Document Manufacturing Plannin w Cancel Help create Design Document Document Hame ArchiveDoc chiveDoc Organization Hame E Rey A Project H ame E Descripti on Titl e Typ e Clear Cancel Help Figure 98 Document create dialogs in TeamCenter lp After creating all Objects and relations in TeamCenter the User gets the Information from TeamCenter in a Message Window within CATIA V5 see Figure 99 CMI Messages Catia 5 Archive File Rootltem CMlArchive was created Created Design Document ArchiveDoc 4 1 1 CMI Operation status O Attach Archive successful S Figure 99 CMI Message Window 116 CMI User Manual CMI has created a new CMlArchive data item and a document in TeamCenter The Document is linked with the Assembly Figure 100 shows the expanded CMlArchive after the Expand Models Option was used in the CMI Workbench D E CATI
126. ic viewer to obtain a quick preview out of TC Enterprise This functionality is also available without a CATIA V5 installation The menu item Action gt Cancel To CATIA cancels the communication between CATIA Workbench and CATIA session and the CATIA session window will appear The menu item Action gt Clear Workbench will erase all data in the Workbench The menu item Action gt Mark Selected Items will mark all items that are currently selected The menu item Action gt Browse Selected Items will generate a Browser with all selected persistent objects The Workbench contains only dynamic Representation objects of persistent Teamcenter objects to work on the origin objects you should apply this command The menu item Action gt Marked ltems gt De expand Marked ltems removes the marked parts from the CATIA Workbench including all subassemblies The menu item Action gt Marked Items gt Unmark All will unmark all items in the workbench The menu item Action gt Marked Items gt Marked Items To CATIA will send all marked items to CATIA The menu item Action gt Marked Items gt Add Marked Items To CATIA V4 will send all marked items to CATIA V4 The menu item Action gt Marked Items gt Highlight Marked Items will highlight all marked items in CATIA The menu item Action gt Marked Items gt Marked to 4D Navigator will send all marked items to the 4D Navigator The menu item Action gt Marked Items gt Marked to
127. iewing which will only be sent to CATIA if Use model filter is set 127 model Filter Preferences Oj x Use model filter Model types CATIA 5 Cgr CATIA 5 Draving CATIA 5 Part CATIA Y5 Representation CATIA 5 Visualization Select the model types which should not be filtered Filter for public versions Save Clear cancel Help Figure 115 Model Filter Preferences dialog Configuration Directory and format 3dxml pdmxml etc are configurable in preferences New Viewer Configuration in options gt Change Preferences Menu option Squat View Help Change Preferences Database Model Filter Configuration Context CHI Prelerences DMU Preferences Viewer Preferences Figure 116 Change Viewer Preferences The Viewer Map directory defines the local Directory which is used for the storage of the viewer file and the related viewing files 128 CMI User Manual E Viewer Preferences o x Viewer Map C user sde5225 cmi viewermap Tn Viewer Format EE HT y 3D XHL Figure 117 Viewer Preferences dialog Interoperation with VisMockup An assembly that was opened into VisMockup from the CMI Workbench with the To Viewer functionality can be imported back into CATIA V4 V5 based on configurations or selections made in VisMockup In order to send the configured product structure from VisMockup to CATIA V5 or V4 you need to export it from VisMockup as plmxm
128. ile your administrator should add the following setting to the CATIA environment CMI_STORE_ANALYSIS ON Load an Assembly or Part from Teamcenter In CATIA generate the Analysis Use Synchronize Teamcenter to store the CAT Analysis file in Teamcenter CATIA 5 CMI Can_Analysis CATAnalysis Start File Edit View Insert Tools CMI Window Help 18 xj PS nalysis Manager pfs Links Manager 1 bk Finite Element Model 1 Nodes and Elements Properties 1 Materials 1 4 Static Case Figure 105 CAT Analysis Synchronize will also update the Assembly the Analysis is referencing 120 CMI User Manual In Teamcenter the Data Item for the Analysis will be created and attached to the Document of the Part or Assembly for which the Analysis was generated amp CATIA Workbench 5 CMI W4DE5ESY3118137 12004 y m xj File Action Info Query Options View Help A Can CiTPart 429030 Can_Analysis l Can Analysis 1 2509039 E 4 Objects found by the query 1 Objects found by the query 1 gt gt gt Accepted Deexpand Model option initiating object server Figure 106 Analysis To read the Analysis Drop the Part into the CMI Workbench and expand the SS Analysis with Expand V5 Analysis l4DESESY3118136 20050 a o ete ee i ee amp sry Options View Help BOM Componen has BOM Combone BOM Ass BOM Assembly BOM Assemb
129. ill of Material BOM This allows to reference context geometry in the CATIA structure eg for drawing creation Ps CATIA V5 CMI MyReferenceTop2 Pel x J Start File Edit View Insert Tools CMI Analyze Window Help 18 x EES SLE SBS N MyReferenceTop2 Hs REF_XXX REF_XXX 1 oN MyReferencedAssembly MyReferencedAssembly 1 A R MyReferencedAssemblySub MyReferencedAssemblySub 1 Po MyReferencedComponent 1 MyReferencedComponent CATPart R MyReferencedAssemblySub2 MyReferencedAssemblySub2 1 N MyNormalStructure MyNormalStructure 1 Applications d de Fe 2 Cot OG fo 3 FB 0 3 SA 3 A Bs seada S e a comand jg OC BL Figure 149 Reference Geometry Reference geometry can be inserted below a CATIA component that adheres to a special configurable naming convention Synchronize will create a CMI specific relation between these Parts and the Teamcenter assembly structure From then on you can load these reference parts along with the regular assembly structure whenever required CMI User Manual 147 MyReferenceT O ma MyReferenceTop2 MyReferenceTop2 A i Mark Unmark Part Mark All Subassemblies A Unmark All Subassemblies Get Item Info Get Spare Attributes Refresh Set Workplane Highlight in CATIA Expand Multiple Levels Expand with Reference Expand for Visualization Expand Expand Models Fywnand VS Nrawinne Figure 150 Expand with Reference amp C
130. initiating object server 600006712500 1T D Off S Off ZS TAS Figure 33 Drag amp Drop a document into the CATIA Workbench 30 CMI User Manual mn Fe If the selected model is in a vault it will be loaded in read only mode a I Workbench cm ea A eee A A CS A OSC OS OI OG UE CS CCG eG ec A Oe SS e IE TESTER eC Updating a model You can drop more than one CATIA model or CATIA document to the CATIA After having read the document from the Teamcenter Enterprise database the designer update the model he simply chooses might carry out his activities in CATIA and might probably want to save the changes To In CATIA METAPHSE gt UPDATE gt ACTIVE It is not possible to update models that are already in a vault To update these models they must first be checked out to a Work Location Saving a model under another name ar y 8 Create a Teamcenter Enterprise CATIA Model object with the desired name see Chapter 5 of this manual section Creating a CATIA Model panna O Load or create your CATIA Model in the CATIA session H Z AZ A In CATIA METAPHSE gt DOCUMENT gt SAVE AS CATIA goes to the background document a Double click the created Teamcenter Enterprise model object or drag and drop it into the CATIA Workbench The model that was in CATIA will overwrite the created It is also possible to use METAPHSE gt DOCUMENT gt SAVE
131. ion V plottracefile tmp SUSER plottrace Poran e 7 immioy o USERS Oke eatin Puto ito CAME DM Tock iP DMR Shore ond helper object SA EA o VOSA aM Olen ao Gln A tories e ale SMS Malos CAMAS A aay ME 4 ok o e AUS Clio ele CMI User Manual CMI User Manual The values for sizeX and sizeY in appdefault obj following the keyword plot option must be written in the order of above Detail names Thus each value pair corresponds to one of the title blocks defined by its detail name appearing at the same sequential position after the already mentioned keyword frames In our example the title block corresponding to the detail DIN AO has coordinate values x 1189 0 and y 841 0 the title block corresponding to the detail DIN A1 has coordinate values x 841 0 and y 594 0 a s o Those coordinate values refer to the axis system of the CATIA view the view in our example was named FRAME and define the size of such a titleblock Now we create a CATIA model with the CATIA Teamcenter Interface and CATIA that fits to the previously explained naming conventions thus allowing to automatically update titleblock contents with their corresponding values out of the PDM System see appdefault obj Load a CATIA model which should be used as root model METAPHSE gt READ Double click the CATIA model or Drag amp Drop it in the CATIA Workbench and select ACTION gt To CATIA The model will be loaded in CATIA Split CATIA
132. ip Object Management Framework OMF Teamcenter module where it is possible to find the tools and the information needed to the common users activities Within OMF each piece of information is an object represented by an icon that users can manipulate Palette Any group of CATIA functions created for specific requirements Plot File File in a specified format that can be plotted or opened in a viewing tool and represents a 2D view of a model Pop Up Menu The menu that appears when the user points an icon and holds the right mouse button pressed Query To search the database for objects that match specific criteria Register To make a file or directory known as an object maintained in the Teamcenter database Tree View Style of browser window in which objects are displayed as relationships in horizontal branches Vault Secure place for storing information To access the data confined in a vault it is necessary to check out or revise the data 156 CMI User Manual
133. ip will be dropped in the actual Teamcenter product structure Update Drop in EDM x Figure 54 Confirm Drop in EDM dialog CMI User Manual 67 O CAUTION The relationship is also dropped in the Teamcenter product structure ASSEMBLY gt MOD STRU gt REPLACE This menu item replaces the selected sub part by another one Read assembly as described in chapter METAPHSE gt READ Choose MOD STRU gt REPLACE Select a subassembly the selected part will be highlighted After confirmation the CATIA Workbench window comes to the foreground Drop the Part you want to replace the subassembly with into the CATIA Workbench The Workbench will show the new part in place of the old one Click Action gt To CATIA CATIA comes to the foreground and the selected part is replaced by the new one CAUTION The relationship between two parts is also replaced in the Teamcenter Enterprise product structure ASSEMBLY gt MOD STRU gt ADD TMP Allows the user to visualize a temporary structure together with the working one For example if the user is making a design of a car and wants to see if the luggage compartment is big enough he can load a suitcase as a temporary structure by doing the following Supposing that the car structure is already loaded Read the whole assembly as described in chapter METAPHSE gt READ Choose MOD STRU gt ADD TMP After confirmation the CATIA Workbench window co
134. it in the CATIA Workbench Now you can expand de expand the models related to the document If Teamcenter Enterprise the OMF server and CATIA run on the same host you can directly double click a model in Teamcenter to display it in CATIA It is not necessary to initialize the action from within CATIA first amp assembly Objects 3 File Action Info Create Query Search Window Options View Help 10 x Item Identifier Class Rev Seq no 600006712500 _V3_ 1 Y 29 12 04 Top Assembly A il 295 9 7700827125 J Assembly A al AR 8200008365_ C Assembly A 1 82 Y 6200010016 J Assembly A il 62 9 8200010017 K Assembly A il 62 Y 6200010021 K Assembly A al 82 g 6200010022 J Assembly A al 82 8200010023_ J Assembly A i 82 Uses Parts uses E g M000013541 V14 1 Assembly A 1 MO Is Described By psm_desBy F Goo001849100V14 1 General Document A 1 amp CATIA Workbench 5 CMI EDMG135 20050 l loj x ile Action Info Query Options View Help Attaches att JE YE 600006712500 _V3_ 1 mode 98200010027 _ H 98200010030 J Y 8200010085_ G 600006712500 8200010086 G A 8200010087 _ J Fah Y 98200010088_ J 98200010162 D Y 8200010163 _ 9200010164 e 8200010180 E 4 2 objects found gt gt gt Accepted Attaches option inil One object found Refresh is complete Expansion complete gt gt gt Accepted Drop on Workbench option
135. ition of a child product in CATIA Drop Child At least one parent child relation will be deleted in Teamcenter Enterprise This reflects the deletion of a child product of the object in CATIA Prepare A CATPart has been brought into the product structure It has been recognized as being from CMI Teamcenter Enterprise but it requires preparation before being brought into the assembly in Teamcenter Enterprise Preparation could for example be the creation of a General Document to attach the file to The column Execute shows whether the operation will be executed or not If there is any reason why the operation cannot be executed then the reasons will be shown in the Result column If the Process Next Operation button is pressed the operation marked in the Next Op column by the gt symbol is executed If the Process All button is Pressed the list of executable operations is worked through in the order shown on the screen In both cases the results from Teamcenter Enterprise are shown in the Output Window 94 CMI User Manual D D CMI User Manual below the list The update operation For CATPart objects this means geometric information will be updated in Teamcenter Enterprise If the model in the assembly has been modified a dialog window will appear in Teamcenter asking for confirmation of the model that needs to be updated in Teamcenter see figure 76 You may deselect the model if you do not want the mo
136. jects D A_FrontWheel A_Brake A_Suspension DrivingShaft Inner_ Mudguard WheelCarrier BrakeDisc BrakePiston LowerTraverse UpperTraverse TraceBar Create the relationships between the Assembly objects like you can see in the figure above D Tip After Drag Drop Expand Relationship Uses Parts Create the following Document objects for the following Assembly objects DrivingShaft Inner_Mudguard WheelCarrier BrakeDisc BrakePiston LowerTraverse UpperTraverse TraceBar a D Create the relationships between the Assembly objects and the corresponding Document objects as listed above i e Drag amp Drop the Document DrivingShaft CMI User Manual 45 onto the Assembly DrivingShaft Tip After Drag Drop Expand Relationship ls Described By D Tip The CATIA files have to be stored in the users Worklocation D DrivingShaft Register the example native CATIA files included in the distribution ask your administrator if you do not have those files as CATIA V4 Models Create the relationships between the Document objects and corresponding CATIA Models i e Drag amp Drop the CATIA Model DrivingShaft onto the document The so created product structure you can now put into the CMI Workbench and expand it see figure below The you can send it to CATIA How to do so see the following chapters File Action Info Query Options View Help Expansion complete gt
137. l Clear Cancel F 2 gt gt Accepted Open option initiating object server gt gt gt Accepted CATIA V4 Model option initiating object Server gt gt gt Accepted CATIA V4 Model option initiating object server Figure 25 Dialog Create CATIA V4 Model t Push the square button beside the fields Work Location or Template to choose from a list of possible values If there is only one possible value pushing the button will fill in the field automatically Fill in the field Template CATIA templates are CATIA models predefined by the administrator used as a basis to create other CATIA models If the Description field has not been filled the Warning Description of CATIA Model is missing appears on the status line ta It is useful and recommended to fill in the Description field because this value will l appear in the Window menu of the Motif CATIA User Interface after the model has been loaded via the CMI interface Further on the dialog for i e METAPHSE gt UPDATE gt ALL menu option will not list CATIA models without this description You will see instead of the names vf et IS possible to open a new browser MeN eS the recently created CATIA Creating a CATIA V5 CATPart CATDrawing From the Menu Bar in Home Collection select Create gt CATIA Files gt CATIA V5 Part File CATIA V5 Drawing File D CMI User Manual 2
138. l You can keep the file name 9 Teamcenter Visualization Mockup 2007 aaaaaa 4580 plmxml Y File Edit view Navigation Actions Tools Web Concept Window Help do oo S Qt MOI DBRA logt wi Berks sala iD amp t File Ic viewmap aaaaaa 4580 plmxml Browse F Models File format Product Structure plmxml v Options SHER CATIA Workbench Py I Rack Hierarchy CATIA Workbench ts Y Case 1 i O Screw 2 y E O ScrewModel e Loy CD Hauptk rper HA k A Screw 3 Description Export product structure to PLM gt lt ML format Cancel Figure 118 Export from VisMockup In the Workbench click File gt Viewer File To Catia to have CMI mark up the product structure and automatically send it to Catia via the Marked Items To Catia functionality CATIA Workbench V5 CMI SCPLMO55 20051 Peet Action Info Query Options View Help Save Session Instance Name Import File Import 4DNav File Viewer File To Catia Page Setup Print Contents Print Window CaseModel Select All Select Viewer File Name Close Window m art ScrewModel EA She a Screw Screw A 1 Viewer File Hane Peer ree Gt es aaaaa 4580 p mm E Uses Geometry has a ES ScrewModel CiTPart ScrewModel Cancel 6 objects are expanded 1 objects are expanded Expansion complete Figure 119 Select Viewer File Name dialog CMI User Manual 129 Only those geometries that were selected as visible in
139. lds and press OK A new model will be created in the Teamcenter Enterprise environment MULTICREATE List of Models Assembly Table Table Table Top Table Leg CREATE SELECT ALL CANCEL a Figure 50 Dialog for Multi Create Models in CATIA Create C47 4 Model Assenbly Table a Figure 51 Dialog for Multi Create Models in Teamcenter 64 CMI User Manual DOCUMENT gt HL IN WB This menu item marks the selected model in the CATIA Workbench This provides a link back from CATIA to Teamcenter Enterprise Models must be displayed in the Workbench to see the effects of this function Choose DOCUMENT gt HLIN WB E me i Select the model you want to mark in Teamcenter Enterprise After your confirmation the model will be marked in the CATIA Workbench See Chapter 7 Working with marked Parts DOCUMENT gt INFO This menu item gives you information stored in Teamcenter Enterprise about parts you will select Choose DOCUMENT gt INFO iii Select the model from which you want to have information Model Info E xj User Vault External System super user Last CATIA Update a OLE fo oe Fla Ppa aj 18 Superseded Work Vault Location Staging rea Work Location Randomized Eq A _ _ _ _ gt Cancel Figure 52 Model Info dialog After pressing Cancel you can select other parts to get their information METAPHSE gt REREAD This menu item reads CATIA models CAT
140. lect METAPHSE gt READ A Retrieve or create a CATIA model which is created with the conventions as SS described above i e containing a title block D Double click the CATIA model or Drag amp Drop it in the CATIA Workbench and select S ACTON gt ToCATA The model will be loaded in CATIA D A In CATIA select METAPHSE gt PLOT The plot file object is created Oi A In CATIA select METAPHSE gt UPDATE gt ACTIVE mL The model will be updated The plot file object will be copied to Teamcenter Enterprise and registered as a plot file The plot file object will be related to the model object by the relation Model has plot files 1 Model has plot files is a 1 1 relationship what means that only one plot file can be attached to a CATIA model and that a plot file can be attached to only one CATIA model Thus the next time a plot file is created the existing object in Teamcenter Enterprise will be overwritten CMI User Manual CHAPTER 6 Working with Structures This chapter explains the concepts underlying the work with structures and describes how to create assemblies and components search for parts load parts in CATIA and modify the structure position Understanding the Structure A structure is made of one or more parts Teamcenter Enterprise knows two kinds of parts Assemblies and Components Y An Assembly is a Part that can contain other Parts i e Assemblies or
141. log Now you can use the catalog to execute the CAT Script that is stored in Teamcenter with Manage Catalogs 138 CMI User Manual ee Optional CMI CATIA V5 functionalities There are numerous CMI features that are not enabled in OOTB CMI Often these support specific methodologies used by individual CMI customers These features are usually enabled by an administrator by setting environment variables Automatic CATDUA 65 To clean CATIA files that are stored in Teamcenter with the file based CATDUA utility you can use the Read with CATDUA command In order to enable this command the following setting must be present in the CATIA environment CMI ENABLE CMICATDUAREAD ON The CMI CATDUAVS5 integration needs a template configuration file to run CATDUAVS5 The configuration file can be generated like described in the CATIA documentation Using CATDUA V5 outside an interactive Session Use the procedure described in Method 2 Accessing the Batch Interface from the CATUTIL CATDUA V5 Batch Tool to define the batch parameters Make sure the Document Selection is empty Save the configuration file to CMI_CATDUAV5 xml The configuration file CMI_CATDUAV5 xml must be available on every client The following variable must be set to point to the CATDUAV5 configuration file CMI CATDUAV5 CONFIG lt path gt 1CMI CATDUAV5 xml Selected Operation clean y Select Filter Priority Domain Keyword 1 Cleaning a
142. ly A 1 g BOM As A Mark Unmark Part Mark All Subassemblies Unmark All Subassemblies Get Item Info Get Spare Attributes Refresh Set Workplane Highlight in CATIA Expand Multiple Levels Expand with Reference Expand for Visualization Expand Expand Models Routine ulyServerk Expand V5 Drawings ww may now be incorr Expand V5 Analysis 75 Analysis option Show Relationship Figure 107 Expand V5 Analysis You can also drop the Analysis file into the Workbench but in order to update the Analysis results you should load and expand the Assembly along with its Analysis Analysis using a CMIArchive file The CATIA V5 data type CAT Analysis can also be stored in a CMlArchive along with a snapshot of the product structure see also Handling of CMIArchives Read an existing product structure document to CATIA V5 Figure 108 CMI User Manual 121 CATIA Workbench V5 CMI EDMG125 20050 File Action Info Query Options View Help PartNumber Ly PartHNumber A 1 gt gt gt Accepted Database option initiating object server gt gt gt Accepted Drop on Workbench option initiating object server Pe CATIA v5 CMI PartNumber a lol Start SmarTeam File Edt View Insert Toos CMI Analyze Window Help 59 x a e y a a it N L Applications A DE ATP ETT PETIT 1 element selected Figure 108 Existing product structure element loaded by CMI Att
143. mat gt forking Path Format 7 Modification Date fran Modification Date top CATIA Model Type Last CATIA Update CATIA Model Size Creation Date from Creation Date to Creator Haximm to Retrieve Template Query Type Figure 28 Searching a CATIA V4 Model in Teamcenter database A Searching for CATIA V4 Templates In a Teamcenter Enterprise Browser window select Query gt CATIA V4 Template Fill in the fields with data to refine the search Press Ok 24 CMI User Manual as Searching for Saved CMI Sessions Ina Teamcenter Enterprise Browser window select Query gt Saved CATIA Session Fill in the fields with data to refine the search Press Ok fi Query Saved Session Hane Description Sea Checked Out Ovner super user Project Hame a Superseded False Frozen Life Cycle State Externally Managed Modification Date from Modi fication Date to Creation Date rom Creation Date to Creator Maximum to Retrieve 50 Query Type Local Save Recall Set SCOPE Clear cancel Help a Ej Figure 29 Query Saved Session CMI User Manual 25 Restore a saved CMI Session E To restore a saved CMI Session simply drag and drop the session icon into the CATIA Workbench The contents of the Workbench will automati
144. mes to the foreground Drop the assembly or model you want to add into the CATIA Workbench Expand it as necessary Click Action gt To CATIA in the Workbench menu Changes you make to other assembly structures in the Workbench will not be sent to CATIA at this time CATIA comes to the foreground with both the car and the suitcase structure In this case it is not possible to carry out any changes in the suitcase structure The temporary added part is removed from the CATIA Workbench after you send it to CATIA ASSEMBLY gt MOD STRU gt MOVE WP The work plane defines the level in a sub tree of a hierarchical assembly relative to which modifications in the hierarchical assembly become effective The relative location and rotation between a part and one of its sub parts or sub structures is defined by a relationship If there is only one tree structure then the first Part of the tree becomes the root If there are several trees or other models in CATIA then a virtual root joins the independent models and sub trees to one tree 68 CMI User Manual 2 Relation Figure 55 Tree structure with one tree Virtual Root e Relation Figure 56 Tree structure with several trees and a virtual root It is only possible to transform the relationships between the active work plane and its direct sub parts and its sub structures CMI User Manual 69 Part e Relation Figure 57 Active workplane in the tree structure o
145. n who configures the system inserts users manages users permissions and maintains the database Browser Window that displays icons representing objects CATEDM CATIA Engineering Data Management System Integration The CATIA add on GII module which enables several PDM systems to communicate with the CATIA system in terms of managing CATIA models and structures The name of the module can differ from installation to installation i e METAPHSE Check In Action that takes from the users the right to update a work item Check Out Action that gives the user the exclusive right to update a work item Checking out an item creates a copy of the work item in the specified work location Configuration Context An attribute that determines which Part versions should be displayed for example only the last revisions Dialog Window Window in which the user enters information Field Component of a dialog window in which the user can enter text Generic Workbench Set of components such as windows dynamic items and information items used in Teamcenter integration products Gil Graphics Interactive Interface The GIl is a powerful programming tool which completes the Open System Access to the CATIA environment Icon CMI User Manual Graphical representation of an object 155 List View Style of browser window in which objects are viewed as small icons in a list with attribute values in columns Object An item or relationsh
146. nd all subassemblies Unmarks the part and all subassemblies Displays extended part representant information Refreshes the displayed attributes of the part representant Sets the working plane to the selected part representant Marks the selected part in CATIA Expands the part relationship until the last level Expands the part relationship until the last level if visualizations are found the level expand is stopped and only the visualization is expanded Expands the part item relationship in one level Expands only the models attached to the part Expands any CATDrawings attached to the Part Displays related Documents Displays any Black Box files attached to the Part Removes the selected part or assembly including all subassemblies For the document representative displayed in the Workbench browser there are the following functions available New Test Doc 003 4 1 Get Item Info Get Spare Attributes Refresh Expand Deexpand Document Figure 19 Context menu on Document in Workbench Pop Up Menu Item Get Item Info Refresh Expand Deexpand Document Description Displays extended document representative information Refreshes the representation of the document Expands the related models Removes the selected document including all related models CMI User Manual Models in the Workbench CMI User Manual Context sensitive to the model representatives displayed in the Workbench browser there ar
147. nd the external structure CMI User Manual 151 CGM File support The files in the CATIA session are now external and can no longer be updated with CMI The CATProducts CATParts point to the external files in the export directory The part numbers are set to the original part numbers stored in the CMI Mapping file If CMI_EXPORT_STDATTRIBUTES was set the configured attributes Nomenclature Definition Revision or Description are also set back to their original values In order to use CGM files with CATIA set CML ENABLE CGME ON in the CATIA environment CMI will support the Teamcenter OOTB class CGM Computer Graphics Metafile from the Industry Standard Classes for basic Read and Update operations with CATIA V5 Please observe the following A CGM is always updated in Update or Synchronize regardless of modifications made A CGM in a product structure is by default not sent to Catia or expanded in the Workbench To expand and send it go to Options gt Model Filter in the Workbench and check Use model filter In order to view CGM files the Model Type CATIA V5 Visualization must be selected E CATIA Workbench V5 CMI WA4ADE5ESY3118136 20050 TEE Sg File Action Info Query Options View Help Engine Ly Engine PistonAs m PistonAssm CATIA V5 Cgr CATIA V5 Drawing TA V5 Part TA V5 Representation CATIA V5 Viewing CATIA WS Visualization Select the model types which should not be filtered Filter for public versions
148. o get help for a specific menu point of the CMI CATIA module do the following Activate the menu point for which you want to get the help Select in the Help Drop Down menu CMI Context Help The browser which was specified in the customization will appear in order to show the Help chapter for the active menu point Getting Help Reference Doc New in this Release Mouse amp Keyboard CHI Context Help DOCUMEN I ASSEMBLY PLOT DEFAULT HELP Figure 65 CMI Context Help Please refer to the installation guide how to customize your default help viewer launching gt gt gt The Messages in CATIA In addition to the online help it is also possible to get more information to the messages inside the CATIA session on the CATIA command line as following help 78 CMI User Manual Numb er 20501 20502 20503 20504 20505 20506 20507 20508 20509 20510 20600 20605 20606 20610 20615 20616 20620 20625 20626 20630 20631 20632 20633 20634 20635 20636 20637 20638 CMI User Manual This is the list of message numbers and their meaning Panel output MODEL LOAD OK MODEL SAVE FINISHED MODEL UPDATE FINISHED LOAD OK TEMPORARY ASSEMBLY LOAD OK ASSEMBLY UPDATE FINISHED ASSEMBLY DROP FINISHED NO MODEL HAS BEEN CHANGED MODEL IS ALREADY IN MAP NO POSITION HAS BEEN CHANGED INIT POM MODULE INIT OK REQUEST REFUSED CAN NOT ALLOCATE PANELFILES
149. o keep them as unknown e g if you do want to save them as new Teamcenter objects Y pe Reconnect does not create anything in Teamcenter or update any files Use Synchronize to update data Y Load a CATProduct into CATIA using File gt Open In CATIA V5 select the Reconnect Teamcenter icon i In the CMI Reconnect Dialog click Select unknown In this case all lines will be selected Click Reconnect selected If any items are recognized in Teamcenter they will change their status To reconnect these items close the dialog with OK Click Cancel to leave the dialog without reconnecting the items Reconnected items that are writeable in Teamcenter will be in the modified state to be able to update them in Teamcenter Use Synchronize to create the unknown new data and to update the reconnected files gt If you want to keep individual items as new unselect them before you click Q Reconnect selected CMI User Manual 107 Use mapping file If a mapping file was created when the product structure was first imported into Teamcenter this file can be used to map the CATIA names to the names the products have in Teamcenter Click Use mapping file to retrieve a mapping file that is attached to the top level Part from Teamcenter and map between external names and Teamcenter names Import Export using mapping files needs to be enabled by your CMI administrator See Optional CMI Functionality Synchronize Configuration
150. of problem can be found in the Installation Manual i Enabling CMI in the CATIA V4 Function Palette A In CATIA select the KEY permanent function or the FILE gt KEYBOARD item Select METAPHSE in the list of functions on the right Select a function key on the left select a function that will probably not be used The METAPHSE function will be swapped with the function selected in step 3 vt It is possible to store the palette so that it is not necessary to enable the METAPHSE function every time CATIA is restarted For information about storing palettes see the Motif CATIA Solutions User s Guide chapter 3 Presenting the Motif CATIA User Interface section Storing Palettes STORE Item TA If the METAPHSE option is not in the list of functions on the right a problem with the installation may have occurred In this case contact the administrator Information about this kind of problem can be found in the Installation Manual 4 CMI User Manual CHAPTER 3 The CATIA Workbench This chapter introduces the CATIA Workbench with a general explanation and then by listing its functions The goal of this chapter is to make the user familiar with this component The CATIA Workbench functions will be explained in subsequent chapters E What is the CATIA Workbench The CATIA Workbench is a standard Teamcenter Enterprise structure browser used to graphically prepare an assembly structure for sending to CAT
151. of an embedded component in the product structure It is not possible to modify such a representation directly It is only possible to use the Save As function of CATIA V5 to create a new cgr or model file of a loaded CATPart or CATProduct To update the representation you have to replace the original representation by the new representation Load an assembly which uses a cgr or model in the product structure CMI User Manual 109 CATIA 5 CMI High pressure cleaner_Assy z joj xj Start File Edit View Insert Tools CMI Analyze Window Help Ej xj m pressure cleaner ASSY y Inderfloor_Assy TERE h i Sr FR As y Wheel right E a Wheel_Assy Wheel left a High pressure cleaner_Assy_cgr High pressure cleaner_Assy 1 Manage Representations j A ee Default activated Associate High pressure cleaner_Assy_cor cmap High pressure cleaner_Assy cgr cor YES YES Remove Replace Rename Deactivate Set s Default Figure 87 Manage representations dialog Use the Replace function to use the cgr or model file with a new representation Manage Representations E ajx High pressure cleaner Ass EPA cg r e EL maplHigh pressure cleaner assy updated fo E cge V ve Remove Replace Rename Activate Deactivate Set As Default Figure 88 Manage representations dialog Replace Use CMI Update or Synchronize functionality to update the new cgr or model file in Te
152. ogs CMI can also manage CAT Catalog files in Teamcenter PLM compatible Catalogs reference files and Parts that are actually stored in the PDM system If the user opens or inserts a file from the Catalog CMI retrieves the corresponding data from Teamcenter By default CMI retrieves the exact revision of a Part that was inserted in the Catalog but a mode where the Part Master is referenced in the catalog is also supported In oder to create Master based catalogs set CMI_DYNAMIC_CATALOG ON in your CATIA environment Ez The administrator needs to set CMI ENABLE CMICATALOGCMD ON in the Catia Environment to enable the Manage Catalogs function The Manage Catalogs button is enabled when you have a CAT Product active It allows to retrieve CATCatalogs from Teamcenter for browsing CMI User Manual 131 Select Catalog for browsing x CatalogDocument 1 catalog My Catalog catalog YourCakalog catalog TestCataloghoS catalog Refresh List From Teamcenter Open Catalog For Browsing N Close Figure 123 Select Catalog for Browsing dialog Pick from the list of catalogs available in Teamcenter The catalog will be opened in the Catalog Browser Catalog Browser C exmap 5 MyCatalog catalog Current ComponentFarnily 2 Sl el E a P Launch Bolt 200 400 Bolt 200x600 Bolt 300x1400 lt OK Cancel Figure 124 Catalog Browser Double click an end chapter to op
153. ooconncncccoconcconccononncnnonnnanonos 108 Creating a CATDrawing From a Product Structure ooooococcononccnnccononcconoconanncnnonnnanonos 109 HANDLING OF CGR AND MODEL FILES ana a on noe eee ad ls elias Es DSRS 109 HANDENG OFGATPROCE SS star ba oli 111 HANDEING OF GIVIIARCHIVE S tata ia ia 114 Use BOM Parts in CMI Archives ici A lia dios 117 CMI User Manual ix HANDLUNG OF CA TA NAD SIS vss a a aaa aaa aiarad 120 Store a CATANALVSIS MO vicio dde sai dea 120 Analysis 0sing a CMIArehive MO taa 121 WORKING WITH CATIA V5 RELEASED CACHE cooocccccnoncnnononcnncnnnnonnononcnnonnnnnnnonanennnnanennnnnas 125 SUPPORT OF EXTERNAL REFERENCEG cccccccsseeseeceeeeceeeeeseecceeeeseeeeeseseeeeeessaeeaeeeeeeeeessaas 126 VIEWER INTEGRATION FOR JT PLMXML AND CGR 8DXML cooccccocccnccnoconcononcnnononcnncnnos 126 PROTCOUISN CS NA A A A E 126 In 127 Co eset head ethene NL tee eed att As 128 INTEROPERATION WITH VISMOCKUP 2ssssecccecceceessseeeeeeceeesaussseeeeeceeeeasseeeeeeeesseaaeees 129 EXPANDROR VISUALIZATION oi 130 CATALOG MANAGEMENT eas banca ea rieca xc ihe a ec ereceicuen tetas ehic 131 Manage CARITA ll Auta ee 131 OA A ee Oa AE 133 Update or Grele Catalo asii A A Aa as 134 Using Macros CAT Scripts in Catalogs 1 0cccccccscosseccccsconseseccccansenecsseadeesscssaaseares 136 OPTIONAL CMI CATIA V5 FUNCTIONALITIES cccccoocccccccconooncncncnononconcnnononcnnnonannncnnnenananeos 139 PUTOTM ATIC CA TOUA ti A A a ten de jek ie Se A
154. ou have to save this model on file system Current CATIA session has been changed Please redo your selections 81 82 20980 20981 20982 20983 20984 20985 20986 20987 20988 20989 20990 20991 20992 20993 20994 20995 20996 NO LICENSE NUMBER SET LICENSE INIT FAILED NO MORE FREE LICENSES LICENSE EXPIRED NO LICENSE FOR MODULE DIFFERENT MACHINE TIMES NO CONNECTION TO LLD NO CONNECTION TO GLD UNKNOWN LICENSE ERROR UNABLE TO START LLD NO MODEL SELECTED NO MODEL FOUND NO POINT SELECTED SAME POINT SELECTED POINTS ARE LYING ON ONE LINE POINTS ARE IDENTICAL INVALID ANGLE VALUE No license number is set in environment Please contact your system administrator Could not init license process Please contact your system administrator All available licenses are currently in use Retry later or contact your system administrator Your license has been expired Please contact your system administrator No license installed for this module Please contact your system administrator The LLD machine time differs from the GLD machine time Please contact your system administrator No connection to local license daemon Please contact your system administrator No connection to global license daemon Please contact your system administrator Something is wrong with your license environment Please contact your system administrator Please check your license environment or contact your sy
155. r CMI User Manual assembly Objects 7 15 x File Action Info Create Query Search Window Options View Help Item Identifier Attaches att L MH co0006712500 V3__1 model Y 8200010027 H 98200010030 _ J Y 8200010085 G Q 8200010086 G 98200010087 _ J 98200010088_ J 98200010162 D 9200010163 _ 9200010164 5200010150 E 4 2 objects found gt gt gt Accepted Attaches option initiat One object found Class Rev Seq no Y 29 12 04 Top Assembly red 292 9 7700827125 J Asserbly A al cea 9 6200006365 c Assembly A al 32 9 6200010016 J Asserbly A al 62 8200010017 K Assembly Lol 82 8200010021 K Assembly A 1 82 8200010022 J Assembly Lo 82 9 8200010023_ J Assenbly A dl 82 Uses Parts uses JE M000013541_V14 1 Assenbly A il MO Is Described By psm_desBy Goo001649100V14 1 General Document A G00006712500_VW3_ 1 General Document A 1 amp CATIA Workbench 5 CMI EDMG135 20050 5 x File Action Info Query Options View Help 600006712500 a D OLLAS OLE IK A FK Expansion complete gt gt gt Accepted Clear Workbench option initiating object server gt gt gt Accepted Drop on Workbench option initiating object server Figure 32 Drag amp Drop a single CATIA Model into the CATIA Workbench You can also double click a document that contains one or more CATIA models or Drag amp Drop
156. r is to make the user familiar with this component of CMI The CATIA Workbench functions will be explained in depth in subsequent chapters Chapter 4 describes how to create and search for CATIA models Chapter 5 describes how to load documents stored in Teamcenter into CATIA how to update a model how to save it under another name and how to create plot files Chapter 6 explains the concepts underlying the work with structures and describes how to create assemblies and components how to search for parts how to load parts into CATIA and how to modify the assembly structure and assembly positions Chapter 7 delves into the menu items of the METAPHSE function in CATIA and describes how to modify the structure and the position of sub assemblies Chapter 8 explains how to work with CATIA V5 Glossary contains the CATIA Teamcenter Interface terminology A Conventions Used in this Manual This font Is used for document titles and emphasis kem 1 gt Item 2 Is used to identify a menu path to reach a specific function METAPHSE Is used to identify a CATIA V4 function nt This icon is used to identify tips and attention advices This iconis used to identify vault related tips This icon is used to identify Teamcenter Enterprise related sections and actions This icon is used to identify CATIA related sections and actions This icon is used to identify CATIA V5 related sections and actions This icon is used to identify actions
157. r system administrator Update a read only model The model does not further exist in CATIA memory The model was deleted The model could not be correctly written to Map Maybe disk storage is low or NFS is poor Please contact your system administrator There are changes in the subassembly selected for DROP All model and relation changes have been made in this subassembly will be lost if you continue If you are unsure save the assembly before DROP No model or assembly to update The structure you have loaded contains no model No model or assembly to update The structure you have loaded contains no model Before you are able to use this function you have to store the last transformation you have done Unable to found a valid transformation for reuse First a position must be changed to be able to store a transformation First a position must be changed to be able to store a transformation A help system Netscape or mosaic must be defined Please contact your system administrator Problems to connect to help system Please contact your system administrator No or a wrong help file path was defined in your environment Please contact your system administrator The model you ve tried to change is not a part of a subassembly defined by the work plane Please reset your work plane Failed to read session data from application data Please contact your system administrator Before you can add a new model to an assembly y
158. r to send CGR files to CATIA V5 see Working with CATIA V5 Released Cache Transfer model files to CATIA V5 Preference allows user to not send model files to CATIA V5 Usually this preference should remain not set or true It is used with the optional Get original geometry from Teamcenter feature in Catia V5 For further information about working with CATIA V5 please read the CMI Preferences chapter for CATIA V5 Use the Check WB before transfer to CATIA preference only when you are Q handling very large CATIA Sessions because it will reduce the interface performance DMU Preferences If user wants to use DIGITAL MOCKUP DMU you can change the tolerance extension of the bounding box for the neighbourhood search via the DMU Preferences menu option This tolerance is added to all bounding box values of the selected Catia Model ini xi DHU Tolerance Wf _ Save Clear Cancel Help a Figure 14 DMU Preferences menu Mode Filter The Menu item Model filter will start the Model Filter preferences Dialog Figure 15 which is used to set the actual Model Filter CMI User Manual 13 Model Filter Preferences Ioj x Use model filter CATIA Vi Model CATIA 4 Template CATIA 5 Archive CATIA 5 Cgr CATIA 5 Drawing CATIA 5 Part Figure 15 Model Filter Preferences dialog The Use model filter option will define if the Filter should be used If the Filter is Used the select
159. reate ExternallnnerWheelDesignTable2 xls DesignTable 2 DesignTable Create ExternalInner Wheel CATPart BOM Create Link ExternalOuterWheel CATPart BOM Create ExternalWheel CATProduct Create f Link ExternalStructure CATProduct Create Link eee Edit PDM Part category Info Synchronize Close Output window Figure 152 Synchronize Write import export mapping file Create CMI Mapping file 0 x File Name InternalStructure xml Work Locationjwl_scp1m053 E Current Host Name SCPLM053 V Register in the Database Description InternalStructure Apply Clear Cancel Help Work Location field set to the single available value in the selection list Figure 153 Create CMI Mapping file As a result of the Synchronize an XML mapping file is created and attached to the Top level assembly in Teamcenter of the new structure This file maps original names to Teamcenter names and will be used by the Reconnect and Export commands Assem bly Objects i loj x File Action Info Create Query Search Window Options View Help Item Identifier rev Seq Nomenclature i InternalStructure Assembly Internal Structure Uses Parts uses InternalAxis Assembly InternalAxis InternalWheel Assembly 1 InternalWheel Uses Parts uses aa InternalInnerWheel Component 1 InternalInnerWheel a InternalOuterWheel Component Internal OuterWheel InternalWheel Assembly 1 InternalWheel Uses
160. right mouse button to get the context menu and select Create CATIA model Fill in the fields as described under Creating a CATIA model CATIA 4 Template Objects File Action Info Create Query Search Window Options View Help 0 x Item Identifier Class seq Project Name Lite Cy G Tempiat ells Workine Temp late mode 1 HOE inch Get Item Info Get Spare Attributes Refresh Expand Relationship b Expand Multiple Levels p Edit Relationship b Create CATIA Model Help on Menu Maximum Number of Items to Retrieve set to SOOO Query Complete Objects found by the query ds k Figure 27 Teamcenter Browser Window CATIA V4 Template Objects and popup AE Register Existing CATIA V4 Models Another way to register CATIA models is to copy your existing CATIA model files with the suffix lt model gt to your work location If you open this work location in Teamcenter the CATIA model files will then be identified as File with an empty icon Now you can select the CATIA models and register them as CATIA Model ee Searching for CATIA V4 Models In a Teamcenter Browser window select Query gt CATIA Files CATIA V4 Template Fill in the fie ds with data to refine the search Press Ok D CMI User Manual 23 Query for CATIA 44 Model Superseded y Frozen Life Cycle State Po Externally Managed Pe Shhaciony Copy Description Path Fo
161. rk selected Items DEGWSE Selected Items Marked Items Deexpand Marked Items Unmark All Marked Items To CATIA Add Marked Items To CATIA 14 Highlight Marked Items Marked To 4D Mavigator Marked To Viewer Browse Marked Items Figure 6 CATIA Workbench menu Action CMI User Manual 7 The Action menu allows the sending of the CATIA Workbench contents to CATIA V4 and CATIA V5 The menu item Action gt To CATIA will send the contents of the CATIA Workbench to the CATIA session and the CATIA session window will appear This menu item is only selectable if items are present in the CATIA Workbench The menu item Action gt Add To CATIA will add additional contents or remove deexpanded contents of the CATIA Workbench to the CATIA session and the CATIA session window will appear Only the newly added items will be loaded into the existing Catia session This menu item is only selectable if items are present in the CATIA Workbench If working with Catia V5 Add To Catia will add the Workbench contents to a single product Window below a synthetic Product tagged CMI Workbench The menu item Action gt To 4D Navigator will send the contents of the CATIA Workbench to the 4D Navigator that will appear If there is still a 4D Navigator running the content of the CATIA Workbench is added to the former content of the 4D Navigator With the To viewer command the content of the CMI Workbench can be sent to a specif
162. ructure a mn To see the models in the CATIA Workbench you have to activate A stscstsrstctr 4 I Ee H SSH Sz Use the right mouse button to get the context menu and select Activate Model The model is now displayed red 91 It is only possible to activate models which are owned by you Only one model can be the active model l Da E a aes OSS ce a NE ne S E a aaa aaan l __ Select Action gt To CATIA The content of the CATIA Workbench is loaded in CATIA lt and the model displayed red is set the active model ta If no model is activated in your CATIA Workbench CATIA activates the first model in the CATIA model list Sending Parts to 4D Navigator It is possible to send the content of the CATIA Workbench to the 4D Navigator In CATIA Workbench select menu Action gt To 4D Navigator The assembly is transferred to 4D Navigator In the CATIA Workbench it is also possible to select menu Action gt Marked Items gt Marked To 4D Navigator On using this function only the marked items are transferred to 4D Navigator ta Remember that the path to the 4D Navigator exchange map has to be set with In CATIA Workbench Options gt Change Preferences gt CMI Preferences DMU Volume For a volume based DMU Search you must create DMU Volumes for CMI In a Teamcenter Enterprise standard browser select Create gt DMU Volume To evaluate the volume searc
163. s 139 Verification OF CATIA AROS isis rian inline A AA detente 141 Representation Formats in CATIA V5 occoooncnnccoccnonoconnnnccnononccnanonncnnnonnnnnnnnnnonanonnnnos 141 Use BOM NO BOM geometries ooccccccoconcconcccconcconocnnonoonnnnnnnnonnonnnnanonnononanonos 142 DESO TAOS E 145 UPA POS MMT E eae ee 145 PANE care coa 145 Restore FP OSINONS mi orere A a E A AER 145 FICSCTINVAUG F OSIUONS sei A a E e a O AEEA EE 146 Get original geometry from TCAMCENTEL cccccccsseeeececssneeeeecsnsueeseessauesseessaaaenseess 146 Choose Upadle FOSON cai oleae thet acia 146 VEFSION CNECK aung Read acen aca 147 Check Tor Education IA oia 147 Reference Geometrias a o eaaa aal 147 Import Export using a mapping file oocooonccncccnncncocononnononnononnanoncnnanonnononnnnnnnos 148 EXPO to Folder COMME asl 150 CGM FE SUP ade Eaa 152 Deleting NON BOM Parts during SyNCHrQONIZE oooocccnccncocccnnccnnoncconononanonnnnonnanonnnnos 152 GLOSSAR iaia ert at later teats UR 155 CMI User Manual CMI User Manual Tab le of Figures FIGURE 1 CATIA TEAMCENTER INTERFACE ARCHITECTURE 0sccecceccecceececcecceeeeseeseeseseneeas 2 FIGURE 2 CATIA WORKBENCH WINDOW 2 0cceceececeececeececeececeececeeaeceeaecueaececeececueaecueaeeesaeees 6 FIGURE 3 CATIA WORKBENCH TITLE BAR DESCRIPTION cccceceeseeeeeseeseeseeseueeueeeeueeaeeueeaeeas 6 FIGURE 4 CATIA WORKBENCH MENU ITEMS 2 c0c0cceececceceececcecceceeceec
164. s an example for a process element with an attached CATProcess data item 210 x File Action Info Create Query Search Window Options View Help Item Identifier Creation Dati Process Element Assembly 01 28 2005 18 Is Described By psm desBy Lg ProcessDocument Design Document 0172872005 1 Mi Level ves ALL lL Process1 CcATProcess Catia Y3 Process Fil 01 28 2005 1 Accepted Tis Described By option Initiating object server one object found Seo Accepted Attaches option initiating object server Figure 90 Part with attached CATProcess data item After dropping the Process Element in the CATIA Workbench CMI will detect the attached CATProcess and changes the icon of the dropped Process Element Figure 91 shows an example for an dropped Process Element CMI User Manual 111 112 SE a ar ri J6 CATIA Workbench V5 CMI EDMG125 20050 l ojx File Action Info Query Options View Help Process Elem To Process Ele A 1 gt gt gt Accepted Clear Workbench option initiating object BERVAR gt gt gt Accepted Drop on Workbench option initiating object Figure 91 CATIA Workbench with dropped Process Element After an expand of the Process Element in the CATIA Workbench the expanded Parts are by default marked as Product view elements Figure 92 shows an expanded structure By default all child items of the Process Element are classified as Product Vi
165. s chapter describes some typical tasks such as loading documents stored in Teamcenter Enterprise to CATIA updating a model saving it under another name and creating plot files your access permissions allow this action All CATIA model related actions can also be used for the CATIA Template objects i e you can load a CATIA Template in CATIA and update the modified model if af To read a CATIA model stored in the Teamcenter Enterprise PDM System EA Reading a model from Teamcenter Start the CATIA Workbench as described in chapter 3 HERA AH The CATIA Workbench has to be started for CATIA relevant functions i e read update etc Once the CATIA Workbench is started you can keep this window open during your Teamcenter Enterprise session Any operation in the CATIA Teamcenter Enterprise function has to be confirmed by the permanent key YES in order to become effective in Teamcenter Enterprise ra In this manual all the CATIA functions selections shall be immediately followed by this confirmation unless it is specified otherwise 2222222200 CATIA goes to the background The CATIA Workbench comes to the foreground You can now retrieve either a document that contains one or more CATIA models or RX a single CATIA model ACTION gt To CATIA The model is automatically loaded in CATIA Double click the CATIA model or Drag amp Drop it in the CATIA Workbench and select 29 a
166. screen into DRAFT and 3D with IMAGE gt SCREEN gt DEFINE Create a Draft with DRAFT gt CREATE SP SPace 3D gt DR Drawing Drawing mode has to be activated has to be done in the ROOT model name e g Blatt Create geometry e g a PLANE DR gt SP 3D Space mode has to be activated Create a 2D point in your new created Draft POINT gt COORD SP gt DR Drawing mode has to be activated Create View with AUXVIEW gt CREATE functionality SP gt DR Drawing mode has to be activated Describes the projection to the plane created before SELECT LINE PLANE created in point 5 SELECT POINT created in point 6 KEY VIEW ID e g FRAME Create a Detail with DETAIL gt CREATE KEY DETAIL ID name e g DIN A3 Select in your 2D View created with AUXVIEW a Line Point to create a Ditto onto this view 35 lt 4 Save the model with METAPHSE gt UPDATE gt ACTIVE a How to define the contents to be shown in a title block Beneath the keyword Mframe option in appdefault obj the keyword definition script indicates the name of the script which defines the PDM contents of the title blocks dshdrawingframe sh in the example provided on delivery of CMI CMI User Manual Catedm bin dshdrawingframe sh ely loa Ssh this 1S an example shell script usage drawingframe frame name It creates a set of entries which are used
167. se qualifying identifier sub strings are to be defined for drafts if any draft identifier starts with the qualifying string the CMI function continues to search for views if any view identifier starts with the qualifying string the CMI function continues to search for dittos referring to details if any detail identifier starts with the qualifying string defining a title block the CMI function retrieves all values defined for this title block from Teamcenter and displays them in the corresponding view positions There is only one configurable start string for drafts and one other for views but there may be a multitude of strings for details as many as different title blocks defining their corresponding title blocks Thus the need for probably many different title blocks in a company is covered The following figure shows a simple draft with the name conventions used by the CATIA Teamcenter Interface View Frame Draft Sheet xxx Figure 35 Naming conventions for drawing sheets Example for a drawing sheet CMI User Manual In the following we describe a sample which fits to the conventions that we need to define in the file appdefault obj This file must be located in a path that can be found in PATH You can find a sample for this file in the CATIA part of your CMI installation catedm data appdefault ob In this example in appdefault obj following the keyword frame option we will define a
168. set up the right environment refer to Installation and Administration Guide Launch CATIA V5 with the command CNEXT exe env CatiaCMlEnv direnv C lt path to the CMIEnv gt EE See Starting Applications Before working with CMI it is necessary to start the OMF the classic Teamcenter Enterprise user interface and the Motif CATIA User Interface or the Windows version of CATIA For information on starting OMF see the Object Management Framework User s Manual chapter 1 Before You Begin section Starting OMF provided by UGS PLM Solutions For information on starting the CATIA User Interface see the CATIA Solutions User s Guide t Ifthe CATIA Launching Tool is installed it is possible to start CATIA from the OMF Browser in Teamcenter Enterprise by double clicking the icon To install the CATIA Launching Tool you should take a look at the CATIA Teamcenter Installation Manual chapter 2 Installing CATIA Launching Tool Jt If CATIA is not started out of the OMF it makes no difference if Teamcenter Enterprise or CATIA is started first CMI User Manual 3 Enabling the CMI toolbar in CATIA V5 In CATIA V5 select the menu View gt Toolbars gt CMI View gt Toolbars gt CMiGeometry Tools View gt Toolbars gt Advanced Tools f If the CMI toolbar is not in the list of toolbars a problem with the installation may have occurred In this case contact the administrator Information about this kind
169. stem administrator No model was selected No model found No point was selected Please select 3 different points Please select at least one different point Distance between two points is too small Input angle is less than angular tolerance Invalid value for defining rotation CMI User Manual CHAPTER 8 Working with CATIA V5 Introduction This chapter describes the CMI interface between CATIA V5 and Teamcenter Enterprise It provides you with a short overview of the object structure in Teamcenter Enterprise and its mapping to the CATIA V5 product structure Typical tasks discussed are CMI Preference configuration loading models parts structures drawings stored in Teamcenter Enterprise into CATIA V5 and creating updating parts and drawings in Teamcenter Enterprise One of the main subsections deals with creating and saving CATIA V4 models ee Predefined Object Structure The CATIA Teamcenter Interface contains the following predefined object structure to support CATIA V5 Y Is Described By y Attaches gt 537 Assembly Document CATPart Figure 66 CMI Structure for CATIA V5 The relation Is Described By exists between a part and a document This relation can be created by dragging and dropping any document onto a part object Please refer to the Teamcenter Enterprise user documentation for managing relationships between Teamcenter Enterprise objects The document can contain at least one relation Atta
170. subparts CV5_CHAIR_BACK and CV5_CHAIR_SEAT Every subpart of the top assembly has further subparts For example CV5_CHAIR_SEAT has component CV5_CHAIR_LEG attached four times and a single CV5_ CHAIR_BOARD If we expand the CV5_CHAIR_SEAT Component we find the parts CATProduct and CATPart files attached to their respective document folders The CATProducts are attached within Catia V5 Product Document folders and the CATParts are stored within the Design Document folder of the Component 86 CMI User Manual Assembly Objects File Action Info Create Query Window Options View Help Item Identifier Q CV5 CHAIR Assembly Uses P rts uses Y CV5 CHAIR BACK Assembly Q CV5 CHAIR SEAT Assembly Uses Parts uses Y CV5 CHAIR BOARD Component Y CV5 CHAIR LEG Component Is Described By psm _desBy CMICVS CHAIR LEG CATIA Product Document T Attaches att E CV5 CHAIR LEG CATProduct Catia V5 Product file CVS chairl g Design Document Attaches att L di CVS chair leg CATPart Catia Vo Part tale Y CV5 CHAIR LEG Component Y CV5 CHAIR LEG Component Y CV5 CHAIR LEG Component Is Described By psm_desBy E CMICV5 CHAIR Attaches att L E CVS CHAIR CATProduct Catia V5 Product file DesignDoc Chair Design Document gt gt gt Accepted Is Described By option initiating object server 2 objects found v Figure 70 Expanded Product Structure in Teamcenter This structure will be transferred via the CATIA Workbench to CATIA V
171. t Figure 36 A simple assembly structure Please refer to the Figure 21 Predefined CATIA model structure on page 19 for more information about the default assembly data structure The figure below shows an example assembly in tree view where Document objects and model objects have also been created and related to the Part objects assembly Objects E xj File Action Info Create Query Search Window Options View Help A 6200010023 A Q gt gt gt Accepted Uses Parts option initiating object server One object found Updated items in an expansion Figure 37 Example of an expanded Assembly in Teamcenter Enterprise browser 44 CMI User Manual Example Structure for CMI The following instructions describe step by step how to create an example assembly structure which can then be loaded into the CATIA session File Action Info Query Window Options View Help A_Brake Y 1 work collection Contains BrakeDisc 4 1 BrakePiston Y Y Y Y PD eD A_Suspension A_FrontWheel Y A E T uses Y 1 1 DrivingShaft A 1 I H 1 orn WheelCarrier TF 1 raceBar HDS pperTravers FDC gt gt gt Accepted Is Described By option initiating object server 1 objects found gt gt gt Accepted DropOnIconi option initiating object server Figure 38 Example assembly structure in Teamcenter Enterprise browser Create the following Assembly ob
172. ted y Modification Date from Modification Date to Creation Date from Creation Date to Last Modified By Maximum to Retrievej50 Query Type Local z Original Creator Save Recall Set Scope Clear Cancel Help Figure 131 Query CATIA Script dialog CMI User Manual 137 Pick a CATScript from the list The CATScript will be inserted under the selected end chapter in CATIA The keyword attributes for Teamcenter will be filled in automatically EL Select script Figure 132 Select CATScript CATIA V5 CMI Macros catalog m cl gt RAS _ a_i o Stat File Edit View Insert Tools CMI Window Help LLL AEA SB AIA ES BBE CBS ie a Search Filter Al Result Reference Keywords Preview Generative Data Name CMLOBID CMI_DBNAME CMI_CLASSNAME 1 InsertMacro vjmirZbsite DD81LX adg DD81LX x0CatScr A l Macros catalog f Chapter 1 CMIMSTR_OBI E ComponentFamily 2 Figure 133 Inserted CATScript If the catalog already references a CAT Script and you want to connect it with Teamcenter Select the existing CAT Script reference instead of the end chapter Finally to store the modified catalog in Teamcenter use the Update or Create Catalog command CMI Synchronize Catalog Macros catalo g Updated by CMI Figure 134 Synchronize Catalog dia
173. tems in CMI Archive Select an additional directory where non CATIA files like jpeg doc are handled for CMI Archives CATParts and CATDrawings in CATIA Workbench in Teamcenter Enterprise 90 CATIA V5 will read all expanded assemblies single CATParts CATDrawings or CATIA V4 models from the Teamcenter Enterprise CATIA Workbench The following figure shows a CATDrawing item and a CATPart item in the CATIA Workbench CATIA Workbench CMI EDMG108 20051 File Action Info Query Options View Help CuttingMech 4 Draving Cutt E 1 162740 D Off S On 4 Cylindre Bl E 1 2 Figure 74 CATIA Workbench with a CATDrawing item and a CATPart item CMI User Manual CMI User Manual When you have transferred a CATPart from Teamcenter Enterprise to CATIA V5 via the CATIA Workbench the part will be displayed in CATIA V5 in a new window CMI for CATIA V5 also supports CATIA V4 models and CATIA V5 Drawing files CATDrawings CATDrawings may be included in assembly structures in Teamcenter Enterprise however in CATIA V5 they will be displayed in separate windows as shown in the figures below All the normal CMI functions Read Update Create and Save As may be used with CATDrawings and CATParts within CATIA V5 Fs caTra 5 Part EJ start TeamPDM Datei Bearbeiten Ansicht Einf gen Tools Fenster Hilfe sl Eb Ix x MF xy Ebene AF y2 Ebene AF 2x Ebene gt e Hauptk rper l a e Ski
174. ter the OMF server and CATIA are running on the same host To Mark or Unmark Parts you can use the following actions p gt SS In the CATIA Workbench in the Pop Up menu of parts and assemblies you can use the Mark Unmark Part option gt SS Use the standard selection mechanisms left click left click and Shift left click and Cntrl to select several items then choose Action gt Mark Selected Items Sz In the CATIA Workbench Action gt Marked Items gt Unmark All All items are set to the unmarked state D In the CATIA Workbench Query gt CATIAdtem A Query Dialog appears Fill out the fields of the Query Dialog to specify the parts and assemblies to find as you are used to do in a standard Teamcenter Enterprise Query Dialog Use the Clear Button to empty all input fields The Query will find and mark all parts and assemblies in the CATIA Workbench Mark Items functionality also supported with CATIA V5 Set the active model Predefine the model to be the active model in the next CATIA Session in your CATIA Workbench AZ Start the CATIA Workbench as described in chapter 3 gt EN fs veg In CATIA METAPHSE gt READ confirm with yes Sz CATIA goes into the background The CATIA Workbench is automatically emptied and comes into the foreground Drop one or more assemblies into your CATIA Workbench and expand the st
175. to Update If you have changed some positions in the CATIA session this function allows you to select the relations to be updated If you select a line in the dialog the corresponding instance will be highlighted in the CATIA structure tree Yes gt Matrix will be updated in Teamcenter No gt Matrix will stay unchanged in Teamcenter To change the state you can double click a line or select the line and press the Toggle keep state button 146 CMI User Manual Version check during Read If you read a file from Teamcenter and another version of the file is already open in CATIA the new version of the file cannot be opened until you close the file in CATIA However CMI will set the metadata so the open file can eg be saved as the new version You can enable a more strict control of version mismatches If the variable CMILPREVENT_ DIFFERENT _VERSIONS ON is set in your CATIA environment CMI will abort the Read if there is a version ambiguity either in the Workbench product structure or between the Workbench product structure and the current contents of the CATIA session Check for Educational Flag CMI can make sure that no CATIA documents that were created with an educational license of CATIA are entered into your PDM system Set Reference Geometries The concept of reference geometries lets you include Parts and Assemblies in the CATIA product structure that are not part of the general Teamcenter Assembly structure B
176. to its original condition REREAD gt GEOMETRY leaves modified positions untouched REREAD gt GEOMETRY leaves non CMI models untouched in the session REREAD gt POSITION REREAD gt POSITION updates the current CATIA session with the CMI workbench content REREAD gt POSITION resets all changed and unsaved positions REREAD gt POSITION leaves modified geometries untouched REREAD gt POSITION leaves non CMI models untouched in the session REREAD gt RESYNC REREAD gt RESYNC updates the current CATIA session with the CMI Workbench content Only models which are not already loaded in CATIA will be added to the current CATIA session In difference to REREAD gt ALL REREAD gt RESYNC leaves your modified models and positions unchanged in your session This is the fastest way to synchronize the contents of CATIA with the workbench REREAD gt RESYNC leaves non CMI models untouched in the CATIA Session f Choose the appropriate METAPHSE gt REREAD gt in CATIA E MEE After your confirmation Teamcenter Enterprise comes up Drag and drop parts assemblies documents or models into the Workbench if you AZ lt wantto add new ones and or Expand or Deexpand assemblies or models in the workbench Send it to CATIA with ACTION gt To CATIA ee Introduction to the Assembly Structure Switching the active mode By switching the active model all individual parts in an assembly can be worked on Switching will onl
177. to the CATIA Workbench a new object will be created dynamically The new created icon represents the CATIA relevant data of the dropped object The icons in the Workbench are the same as in the Standard Teamcenter Enterprise browsers with an additional arrow on the lower left corner indicating that this item is to represent an originating Teamcenter Enterprise object Parts in the Workbench On the part representants displayed in the Workbench browser there are the following functions available notice that assembly parts and component parts use the same icon Merete Maja e I Mark Unmark Part Mark 411 Subassemblies Unmark All Subassemblies Get Item Info Get Spare Attributes Refresh Set Workplane Highlight in CATIA Expand Multiple Levels Expand for VYisualizatiorn Expand Expand Models Expand V5 Drawings Show Relationship Is Described By Attached Black Box Files ae Deexpand Branch Figure 18 Context menu on Part in Workbench CMI User Manual 15 Pop Up Menu Item Mark Unmark Part Mark All Subassemblies Unmark All Subassemblies Get Item Info Refresh Set Work plane Highlight in CATIA Expand Multiple Levels Expand for Visualization Expand Expand Models Expand V5 Drawings Show Relationship gt Is Described By Show Relationship gt Attached Black Box Files Deexpand Branch Documents in the Workbench Description Marks the selected part representant Marks the part a
178. tr this PdmItem object is Seco tortas eee ted enanos da Nsicseatlo ess ma eta o Sao MOLDES Ben i Update Parameters Type Name Description e 52 2 S HEo o o o o o o o ooo o opo o o o o oo o s o o o o o oo o o o o oo ooooo o oo Obi bie Ieslicslinl cis ic Type Name DeserapEion SS ER RECREA EAE 4f 4 etorri ieee a Le ound alos srOredenanOed maint tout es ja integer mrail method success failure status E 0 USC OKAY Este e ess ul i 0 unsuccessful 4 Return Value SS Se Sa 4 CO status asar OKAY SUCCESS NOT OKAY BAD PARAMETER Failure o o S DOCEND ae message Pdmltem x3GetAttrsForCAD impur 3 ObDJeEectPTtE EANES input o SES sees cemanced OUT e TO O ea ESA OT El output integer xmfail code E eee a ee ee ee ay Declaration of variables cal Sp a a a gE eg ge ge ee ee we ee ee ee SP pe INCI string value NULL integer numVal 0 integer 1 0 A ee age E EEE E ag E EE ce ie ge E e E ee E E a Begin E CEOE ee xJ MPDBXFSTART Pdmltem x3GetAttrsForCAD A a ee ee a ee ee ee eee ee EEEE Initialize return values ee ee A A eee a A a US On A ao clemienarc ech LE lnumvyal 4 goto CLEANUP CMI User Manual a lnumval ey Pave cle als OIG Sie CC sai S
179. tual workplane the selected tree will be highlighted red Select the first and second line the selected lines will be highlighted red Confirm with YES The selected part will be moved ASSEMBLY gt MOD POS gt TRAFO The TRAFO functionality is to facilitate the work with all transformation routines of the CMI CATIA module This function gives the user the ability to reuse a transformation once defined multiple times To work with this function at least one transformation must have been performed before ASSEMBLY gt MOD POS gt TRAFO gt STORE This menu item stores the last transformation done ASSEMBLY gt MOD POS gt TRANSLATE ROTATE MOVE The stored transformation can be used on any other part TRAFO gt REUSE A Change the position of an assembly METAPHSE gt ASSEMBLY gt MOD POS gt Select MOD POS gt TRAFO gt STORE Confirm with YES The last transformation part will be stored CMI User Manual 75 ASSEMBLY gt MOD POS gt TRAFO gt REUSE After you have stored a transformation you can reuse it on any part you want This menu item reuses the last stored transformation f Select work plane as described in chapter ASSEMBLY gt MOD STRU gt MOVE WP Select a part in a sub tree of the actual workplane the selected tree will be highlighted red Select MOD POS gt TRAPO gt REUSE Confirm with YES The last transformation part will be reused on the highlighted p
180. ual 49 C O O Rereading a Structure If you choose METAPHSE gt READ in CATIA the modifications to models and positions that you currently have in CATIA will be lost To send additional data to CATIA or to restore only part of your data e g to undo changes you can use METAPHSE gt REREAD There are 3 ways to reread a structure f In CATIA METAPHSE gt REREAD gt GEOMETRY ee ta Reads the current content of the CATIA Workbench Rereads all models but does not read positions that are already in CATIA ltems that are no longer in the Workbench will be removed from CATIA Items added to Workbench will be also added to the CATIA Session In CATIA METAPHSE gt REREAD gt POSITION Reads the current content of the CATIA Workbench Rereads all positions but does not change models that are already in CATIA Items that are no longer in the Workbench will be removed from CATIA Items added to Workbench will be added also to the CATIA Session In CATIA METAPHSE gt REREAD gt RESYNC Reads the current content of the CATIA Workbench Reads only models that are not already loaded in CATIA but does not change any existing positions and models ltems that are no longer in the Workbench will be removed from CATIA Items added to Workbench will be also added to the CATIA Session If you want to add or remove few items from CATIA you can use METAPHSE gt REREAD gt RESYNC This is faster than the other options as CATIA does
181. vided by your PDM System The CGR files are expected in the same vault location where the CatPart V4 model are located but you can also assign a specific CGR location via the config variables CMI_CGR_HOST CMI_CGR_VAULTLOC_PATH There are three allowed values for Transfer CGR files to Catia V5 No No suppresses transfer of cgr files Only CGR Only CGR transfers the cgr files instead of CATParts V4 models CGR geometry transfers the cgr files to the Release Cache and CGR geometry the CatParts V4 models to the exchange map SSS __ Product Structure CATIA V5 vs Teamcenter Enterprise CMI User Manual Product structures in Teamcenter Enterprise correspond well to product structures found in CATIA V5 The following graphic illustrates the core product structure in Teamcenter Enterprise 85 E Assembly Objects E AE File Action Info Create Query Mindow Options View Help Item Identifier Class Y CV5 CHAIR Assembly Uses Parts uses Y CVS CHAIR BACK Assembly Uses Parts U36853 CV5 CHAIR BACK CROSSPIPE Component Y CVS CHAIR BACK CROSSWAY Component Y CVS CHAIR BACK PIPE Component Y CVS CHAIR BACK PIPE Component Q CVS CHAIR SEAT Assembly Spee Parte seo Y CV5 CHAIR BOARD Component CV5 CHAIR LEG Component Y CV5 CHAIR LEG Component CV5 CHAIR LEG Component Y CV5 CHAIR LEG Component al lls Ty Figure 69 Product Structure in Teamcenter Assembly CV5_CHAIR has
182. xpand Branch option initiating object server gt gt gt Accepted Expand Models option initiating object server Expansion complete Figure 104 BOM Assembly with CMlArchive The transformation positioning information stored in Teamcenter for this part instance is a summary of the transformations that are hidden in the CMlArchive so the positioning eg in a DMU is correct relative to the Assembly ES Since in CATIA it may not be obvious which parts of the product structure are stored Q in the CMlArchive and which are individual parts in Teamcenter the ability to use a BOM Part under a CMlArchive should only be used for specific use cases where this is implicitly clear to the user One use for instance is to build supplier Parts into an OEM structure where differenciation may be possible by the different naming conventions CMI User Manual 119 Handling of CAT Analysis Store a CATAnalysis file Y a ws D CATAnalysis files can be stored in Teamcenter as a Dataltem The Analysis is attached to the Teamcenter Part of the product or CATPart that it is referencing It is handled in a similar way as a CATDrawing normally the Analysis files are not loaded it is loaded if it is explicitly expanded in the Workbench Unlike with a CATDrawing the assemblies referenced by the Analysis are updated if you use the Synchronize Teamcenter function in the Analysis Workshop To manage CATAnalysis as a native f
183. y Select a point to create the base Select another point line or plane to create the x axis change direction by ENTER Select another point line or plane to create the y axis change direction by ENTER Confirm with YES to create the z axis Click at the vector or press the ENTER Button in order to change the transformation direction 3 NTE Confirm with YES 74 The selected part will be moved to the second coordinate system CMI User Manual ASSEMBLY gt MOD POS gt MOVE gt SYMMETRY This menu item mirrors the selected part in relation to a 2D plane A Read an assembly as described in METAPHSE gt READ Select workplane as described in chapter ASSEMBLY gt MOD STRU gt MOVE WP Select MOD POS gt MOVE gt SYMMETRY Select a part in a sub tree of the actual workplane the selected tree will be highlighted red Select a plane the selected plane will be highlighted red Confirm with YES The selected part will be mirrored ASSEMBLY gt MOD POS gt MOVE gt LINE This menu item moves a part The relative position between the first selected line and the selected part is identical to the relative position between the second selected line and the part after the action is completed A Read an assembly as described in METAPHSE gt READ Select workplane as described in chapter ASSEMBLY gt MOD STRU gt MOVE WP Select MOD POS gt MOVE gt LINE Select a part in a sub tree of the ac
184. y be created for single models or for assemblies There are however several caveats when working with CATDrawings and CMI dependant on the context of the CATDrawing Creating a CATDrawing From a Single Mode 108 SS When creating a CATDrawing for a CATPart always send the CATPart singly without its assembly from Teamcenter Enterprise to CATIA V5 and then create the CAT Drawing This method will preserve the context of the CAT Drawing irrespective of whether the CATPart is later loaded into CATIA singly or as part of an assembly If you later make changes to the CATPart and you wish the CATDrawing to update and reflect the changes you must load both the CATPart and the CATDrawing in CATIA V5 using CMI before you update the CAT Drawing Drag and drop the CATPart into the CMI Workbench Select Action gt ToCatia CMI User Manual Create the CATDrawing with the usual CATIA V5 functions Select the Create in Teamcenter icon a Creating a CATDrawing From a Product Structure Drag and drop the assembly into the CMI Workbench Select Action gt ToCatia Create the CATDrawing with the usual CATIA V5 functions 4 Select the Create in Teamcenter icon En pe CMI can fill in Drawing title blocks with attributes from Teamcenter This requires customization See Customizing Guide D EET Handling of cgr and model files In CATIA V5 cgr and model files are managed as representation
185. y work on parts belonging to the user MODEL gt SWAP Swapping the active model standard CATIA function Select a model CONFIRM with YES A Edit model Write back the modifications with METAPHSE gt UPDATE gt ACTIVE CONFIRM with YES vis You can find out the loaded and the active models by help of the standard CATIA function SESSION gt MANAGE 66 CMI User Manual A METAPHSE gt ASSEMBLY The menu item ASSEMBLY contains assembly structure relevant actions ASSEMBLY gt MOD STRU This menu item Modify Structure with its sub items allows you to modify the assembly product structure in Teamcenter Enterprise from CATIA The following functions suppose that an assembly is loaded into the CATIA memory ASSEMBLY gt MOD STRU gt DROP This menu item removes the relationship between selected sub part and assembly A Read assembly as described in chapter METAPHSE gt READ Choose ASSEMBLY gt MOD STRU gt DROP Select a sub part the selected part will be highlighted You can also pick the part to set the subassembly to drop Click YES instead of selecting a model Select work plane Filter on Part List of Parts Assembly Table Table Table Figure 53 Panel for Select a Subassembly to Drop After confirmation the sub part will disappear in CATIA memory A panel asks if you want to drop the subassembly in Teamcenter Enterprise also If you click yes the relationsh
186. ze Window Help x 4 5568 20 4448 Assembly 1 Applications SBS S20 E A Bees ume oJ Gl Select an object or a command Figure 95 Loaded Assembly in the CATIA V5 114 CMI User Manual Figure 95 shows the loaded Assembly Product in the CATIA V5 Now we add the Structure which should be attached as CMlArchive as child items to the Assembly1 In our example the three possible types are added under the Root item Figure 96 e CATIA V5 CMI Assembly1 o x i Start SmarTeam Hile Edit View Insert Tools Analyze Window Help gt Y Assembly 1 A WM Rootltem RootItem 1 AN RootChild RootChild 1 ig RootChild2 RootChild2 1 a RootChild3 RootChild3 1 Applications 2 a ES j de 32 Fey ca Ka fo 2 3 a ya TFT Figure 96 CMlArchive Root item with three children 1 element selected Select the root Item of the Product which should be attached as CMI Archive see Rootltem Rootltem 1 in Figure 96 The parent object of the selected must be loaded from CMI The CMlArchive will be attached to an existing CMI structure by using the Attach Archive Toolbar button In CATIA V5 select the Attach Archive icon E In the TeamCenter client the Dialog shown in Figure 97 will appear D create CATIA V5 Archive File MME File Hame Rootitem CHMIArchive Work Location WorkLoc 125 E Current Host Hame edmq125 M Register in t
187. zze 2 Y Kantenverrundung 1 Kantenve S 1 c rer a El tenverrundung 2 El G a E 058940800 mz Ein Objekt oder einen Befehl ausw hlen Figure 75 Part Design Workbench for Read Update Create or SaveAs CATPart 91 Ea 5 Drawing1 10 xj Start TeamPDM File Edit wiew Insert Tools Window Help a laj x SS a ral ef te 2 y E None E SM User Default F y C Drawing Sheet 1 L MM sheet 1 2 l B Front view R Bi Rear view ie ho He Top vien 1 Ta gt Es jiin Bottom view D L Bil Left view E ss Aa Ri Right view L gia RF Isometric view roy lt he Ca v v C hr EJ E 114 Lana B ii log Day BAAN kez E LSA A CATIA P E Select an object or a command Figure 76 Drawing Workbench for Read Update Create or Save As CATDrawing CMI toolbar Read From Workbench With the Read from Workbench button in the CMI Toolbar the contents of the CATIA Workbench in Teamcenter Enterprise may be read into CATIA V5 The CATIA Workbench may contain CATParts CATDrawings CATIA documents CATIA V4 models and assembly structures If you want to send one or more assemblies CATParts or CATDrawings to CATIA follow these instructions Drag and drop parts drawings models assemblies or documents into the Workbench P Expand or Deexpand the assemblies in the Workbench Read Teamcenter CATIA items with Read From Workbench icon 4

CMI Release 10.7 User Manual CATIA Teamcenter

Contents

Download Pdf Manuals

Related Search

Related Contents