Home

Cisco Systems WSC4500XF16SFP User's Manual

Contents

1. 130657 Mux buffers Catalyst 4500 Series Switches Installation Guide EZE 78 14409 08 Chapter4 Removing and Replacing FRUs Replacing Backplane Modules on a Catalyst 45078 45108 Switch Step4 Ifyou are removing a clock module remove the two screws that attach the module to the backplane Stepb Find the seating levers on both sides of the connector for the module you wish to replace See Figure 4 22 Figure 4 22 Finding the Seating Levers N NC Step6 release the module from its connector pull the levers outward with your fingernails The module will pop out slightly See Figure 4 23 Figure 4 23 Releasing the Module Catalyst 4500 Series Switches Installation Guide 78 14
2. m Catalyst 4500 Series Switches Installation Guide 78 14409 08 Preface Dill Obtaining Documentation BRWRS HAA Hea Stack MIEN ARLE SASH CARS TEIG T FASE RA LEE 1816 Te IE a ee RAY S SRT BL I Ee IEA 11 IBRA DERT cf 24175 16 BSEOSHBMIL Translated Safety Warnings 228 LC lt ESL ESL Obtaining Documentation Cisco com Cisco documentation and additional literature are available on Cisco com Cisco also provides several ways to obtain technical assistance and other technical resources These sections explain how to obtain technical information from Cisco Systems You can access the most current Cisco documentation at this URL http www cisco com techsupport You can access the Cisco website at this URL http www cisco com You can access international Cisco websites at thi
3. 0 0 0 0 0 0 o mannnpynnnnnannnannannnunrnn annnainanannaanreanaananann ian Catalyst 4500 Series Switches Installation Guide 78 14409 08 Installing the Switch in a Rack Chapter 3 the Switch L Brackets on the Front Edge of the Catalyst 45078 Switch Figure 3 3 1189 o anaq nanannannaannnananananna nannannannannnnnnananann nannannannanannnnnnnanann annnananananananaaannna anannrgananannaanagannna B h i anancanannaaanaanonaanann 1 nnaa dnnnannananancanaunnn 1 aancaaannnaunnnuannuunaununa o aacauananaunauununcanaaaauana mnnamnnnnnnnnnnnmannnnnnun 0 0 0 VO caaaannaaununauaunnnaaunna naanaanananagaaaagnananan e Catalyst 4500 Series Switches Installation Guide 78 14409 08 Rack Mounting the Switch Installing the Switch in
4. o o e screws Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter 4 Removing and Replacing FRUs Removing and Replacing the Chassis Fan Assembly Catalyst 4510R System Fan Assembly Figure 4 20 Fan assembly QODDO00D0D0D00000000000000000000000000000 o naaaaaaaaunanaaaaaaaaaaauunaaaaaaaaaaauna aaaaaanaaaaunnaaunaanaauananaaaaanaaaunaauna aaaaannaaaunnanaanaauannanauaunaaaunaana aaaaanaaaaunnanannaanannaaaaannaaaunaana auaaaaaaauaaaaauuaaauuuauuaunauuauuuaaaanuuu manaaaaaauauanaunauaaaaaauaaaanauauaaanaunuaa unaq Fm as aunnunanaunananaanananaaaannananmannunan aannaannnnaaaanaaaununauunuunauaunnnnununna nmanaaaaaauaaanaaanaaaaaaaaaaanaaaaaanaaauaa aaaaaaaaunaauanaaauaaaaauaaaaaaaaaaaaauna aanaaanaaanuanaunauunanaaununauunaanuunauna o o naaaaaaaauanaaaaaaaaaaauuanaaaaaaaaaaaunua aanaaannnaananauanaunaaunananaaannnaaunaunaua aanaaanaaaunanaaaauanaaanaanaaunaaaunaaauna aanaannaaananananunaaunaunaaunnaaunanana naanaaananaaanaunaaunnaunnanaaanaaauaunana aanaaannnaaannanaauunnaunununaaaunnauu
5. naaaaaaaaaaaaaunanaunuuuna nuanananaunnanaunnananaunnun nmaaaaanauaaaaaanuuanadauauua naaaaaaauaaaanaaaaaadaaaaa auaaaaaauunaaaaauaaaaaaua mqanaunaaanaunauauunaunnauu uaaauaaaaaaunaauaunaauauuna daannmaaanaaaaaaaauaududunna go nmanaaaaaanauaauaaunaunaua aanaannnnaaunnnaanunauunna nmaaaaaauaaaaaaaaauaaaanuna aanaaannnnaaannnaununauunna aaaaannaaaunaaunaunnaaunna o aadaannaaaaununnaaunnnamnmna o SN AAANNNNXXXX Catalyst 4500 Series Switches Installation Guide 78 14409 08 Troubleshooting Chapter 5 Contacting the Cisco Technical Assistance Center Catalyst 4510R Serial Number Location Figure 5 6 OV10 LS200 187 8611 dMaunanaunanannuuanunnaunnunaununaunnunnumn o nanaaaaannnaaanaanaaaannananaaaananaaaa nganaaaaannanaaanannaaaanananaaaaaanaaaa uiaiia maaaaaaananunauaaaaaaaanaaaaaaanaaaauaana nanaaaaaannnaaanannaaaanananaaaannanaaaana naaaanaaaaannnauaaananaaaaannnanaannnaa nanaaaaananaaaaaanaaaaanaaaaaaaaaaaaana maaannaaaaaaaaunaaaaaaaaaaaaaaaaaaaaaaa nm
6. daanaaaaaaaanaunanannannnn o anaaaannanananaaaunaaaauaa naaanannnnannnanaanaaaunaa naaaaaaanannnaananaaaaana anaaaaaaanaunaunaaunauana o aanuaunuananaaaaananaaaaan o 78 14409 08 Grounding holes 2 Catalyst 4500 Series Switches Installation Guide Installing the Switch in a Rack System Ground Connection Guidelines Chapter3 Catalyst 4510R Grounding Holes Figure 3 16 22626 o BManaauaanuaununauauunauauunaauauanuuununu o maaanaaanauananaaunaaaaaaaaaaauanaauanuaa anaaaanaaauananaannaaunanaaunaaauaunana naaaaaaaauannunanaauaaaaauaaaaaaauaaaauna uaaaauanaaauaananaaanaauunaaaauanaaauuaaaa aaaaaaaanaaauaaanaanaaauaaaaaaaaaaaaaaana aaaaaannaaaunnaunaunanaaunanaaunnanauunana aaaaaaaaunaaaaaauaaaaauaaaaaaaaaaaaaaana aganannnanaanannananaunuunuannanannnnna aaaaaanaaananauunuunnaaunnanaaunnaaununann aaaaaanaaaannaanaanaaaaanaanaaanaanauaaanaann naanaaannaananaananunaaunanunaaunnanuunannua heima Nmu u u ja Sa ja ja jaama aaa a a a a Sm a a a a a a Va a Sa Sa Sa Sa Va Va Sa Y maaanaaauaunaunanaauaaaaaaauauanauaaaauauuaa BMaananaaannuuaaaanannaunaununuuauaaunauannnn o aqanaaaannaaananaauunnnauanaaaunnauaannna aanaaaannaaannanaunannnunanaa
7. anaaaanaaaaunnaaaunnaaunnana o nmauunaanauaananaununaunauunauaua o naanaanaaanaanaaaaaanauanaanaa Catalyst 4500 Series Switches Installation Guide Screws Fan assembly Captive installation Removing and Replacing FRUs Removing and Replacing the Chassis Fan Assembly Chapter4 Catalyst 4507R System Fan Assembly Figure 4 19 Fan assembly 91189 BMaaaunnanannunananaununmn naaaaaaaauaaaaauaaaauaauaa aanaanannaaannnaanunauuna aaanaaaannanunaanunauununn nanaaaaaananaaaaaaaaaauaa auananaaaaunaunaununaunuaununa naanaanaaunnuunuunuaunaununu nuanunanauaananaunnanuananan iaia aaa naaaaauaaanaauuaauaauaaauauaa o aannuuununuunuunuauauunauauna aunaaunaaaunauananuuaunuununuua nmaaaaaanauaaagaanauaaaaua naaaaaaaauaanaaauaauaaaaua
8. DODDDDODDODDODUDDDODUODUDODDUDU BOBDODDODDBDODDBDOBODUDUDDBDDDUOODUUDR LDODDODDDDODDDDDODDDDODDDDDLDUU O 77510 DODDDDDDDDODODDDDDDDDDODUDn O QODDODDODDDDDDDODDDODDDDDDDUDDR The Catalyst 4506 switch supports the Supervisor Engine II H 10 IV V and V 10GE The supervisor engine has a nonblocking full duplex switching fabric that provides connections between the supervisor engine and the switching modules The Gigabit Ethernet ports can be configured with any combination of copper 1000BASE T shortwave SX LX LH and ZX interfaces or CWDM and DWDM GBICs For a description of GBICs refer to the Catalyst 4500 Series Module Installation Guide or the Catalyst 4500 Series Supervisor
9. 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter2 Preparing for Installation Site Planning Checklist 1 IEEE class 3 device 17 3 W total output power 284 W Total heat dissipated by system 284 75 3 415 1293 BTUs hr Note Although a class 3 device needs 15 4 W to power up 17 3 W need to be generated from the backplane in order to have 15 4 W at the switch port 17 3 W comes from the WS X4248 RJ45V DC DC converter s efficiency 89 Site Planning Checklist Table 2 2 lists the site planning activities that you should complete before you install a Catalyst 4500 series switch Completing each activity helps to ensure a Table 2 2 successful switch installation Site Planning Checklist Task No 1 Planning Activity Space evaluation Space and layout Floor covering Impact and vibration Lighting Maintenance access Environmental evaluation Ambient temperature Humidity Altitude Atmospheric contamination Airflow Verified by Time Date Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter2 Preparing for Installation Table 2 2 Site Planning Checklist continued Site Planning Checklist Task No Planning Activity Verified by Time Date 3 Power evaluation Input power type e Receptacle proximity to the equipment Dedicated separate ci
10. Catalyst 4503 Switch Specifications Catalyst 4503 Switch Specifications Table A 1 lists the Catalyst 4503 switch specifications Table A 1 Item Catalyst 4503 Switch Specifications Specification Environmental Temperature ambient operating 32 to 104 F 0 to 4090 Temperature ambient nonoperating and storage 40 to 167 F 40 to 75 C Humidity RH ambient noncondensing operating 10 to 9096 Humidity RH ambient noncondensing nonoperating and storage 5 to 9596 Altitude operating and nonoperating 200 to 6500 ft 60 to 2000 m Switching Components Backplane 24 Gbps full duplex backplane 4 Gbps Uplinks Port density 116 ports when using a Catalyst 4500 Series Supervisor Engine II Plus TS 96 ports with other supervisor engines Inline power integrated support 820 W per switching module Physical Characteristics Dimensions H x W x D 12 25 x 17 31 x 12 50 in 31 12 x 43 97 x 31 70 cm Weight Minimum weight 31 25 Ib 14 1 kg Maximum weight 75 Ib 34 kg Chassis and backplane 29 Ib 13 1 kg Fan tray 2 25 Ib 1 0 kg Airflow Switch Right to left Power supply Front to back H Catalyst 4500 Series Switches Installation Guide 78 14409 08 AppendixA Specifications Catalyst 4506 Switch Specifications MI Table A 1 Catalyst 4503 Switch Specifications continued Ite
11. mgaaaannunuunnunnuunnunnnuauuaa o maunnanaaunauaaaannunuunuunnunana naaanammaaaaaaaanaaaaaaaaauna aaaaaaaaanaanaaaaaaaaaaanaaaaa naaaaannununuununauaanunuaauuaa fa a fa Va Ja Va fa Ya fa fa a fa o maunaaaaaaanuuaannnunununununa naanaummanaaaaanaaaaaaaaaaauna o o o o nauaaanmnmnunaunumunauaanaaaauaad aaaaaannaaannnnaunaaaaaaaunu nnnnnnnnnnnnnanannannnnnnnn uanaannnnaaaaaaaaauaunununu nmaaaaanaanuunuunnauuunauauuaa nauaaunannannauaaanauaaaaaaaaunu aaja ja juam jm m m fo o oa Von Yon on Yon Jo in on Yon J in an Jon Yin a o uaaaanaaaaaaaaaaaaaannaauna naaaannnananaaaaaaaaaaaaaaaa 20000A O00000 Catalyst 4506 Grounding Holes Figure 3 14 Catalyst 4500 Series Switches Installation Guide 78 14409 08 Installing the Switch in a Rack Chapter 3 Catalyst 45071 Grounding Holes Figure 3 15 System Ground Connection Guidelines 13764 o aanuunuanunnaunaunuannauna o aaaaaannnaaannaaanaaanana nunanaannaannnanaaaaaauana naaaaaaannaannnaaaaaaaaana ananaaaannaaanananananuna naaanaannnunununnunnanananunu naaaaaaaaunumumunaananaauunad naaaaaannnunumumnuaaanaaanuna aunnananannaananananannnna naaaaaaaaanaaanaaauuaaaunu aaanaaaaaanaaaaaaaaaaaaaaa naanaaaanmaaannaaaaaaaaauana aaaaaannaaannnaauaaaaana
12. Bare the wires on one end Connect the wires to a suitable and safe earth ground Connect the RJ 45 cable to a female RJ 45 connector Briefly connect all cables to the grounded cable before connecting to networking equipment Leave cables from the networking equipment in the distribution closet connected to ports at user desktops After you make connections on either side of the cable to networking equipment the cable will not build up charge Preventing Electrostatic Discharge Damage Electrostatic discharge ESD damage which can occur when electronic cards or components are improperly handled results in complete or intermittent failures Port adapters and processor modules consist of printed circuit boards that are fixed in metal carriers Electromagnetic interference EMI shielding and connectors are integral components of the carrier Although the metal carrier helps to protect the board from ESD use a preventive antistatic strap during handling Following are guidelines for preventing ESD damage e Always use an ESD wrist or ankle strap and ensure that it makes good skin contact Connect the equipment end of the strap to an unfinished chassis surface When installing a component use any available ejector levers or captive installation screws toproperly seat the bus connectors in the backplane or midplane These devices prevent accidentalremoval provide proper grounding for the system and help to ensure tha
13. e Checking the Shipping Container Contents page 3 2 e Rack Mounting the Switch page 3 3 Before starting the installation procedures in this chapter complete the site planning checklist in Table 2 2 of Chapter 2 Preparing for Installation 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter3 Installing the Switch ina Rack Checking the Shipping Container Contents lt Note For information on installing the supervisor engine and switching modules and verifying switch operation refer to the Catalyst 4500 Series Module Installation Guide For information on configuring the switching modules refer to the software configuration guide for your switch and software release Checking the Shipping Container Contents Note Step 1 Step 2 Do not discard the shipping cartons and poly bag when you unpack the switch Flatten and store them You will need the containers if you need to move or ship the switch in the future Repacking instructions are provided in Appendix B Repacking a Switch Follow these steps to check the contents of the shipping cartons Check the contents of the accessories box against the Accessories Box Components Checklist and the packing slip that were included with your switch Verify that you received all listed equipment including the following e Switch hardware documentation and software documentation if ordered Optional equipm
14. 78 14409 08 wm AppendixA Specifications Catalyst 4500 Series Power Supplies Table A 5 1000 W AC Input Power Supply Specifications Item Specification Minimum software requirement Power over Ethernet AC input type AC input voltage AC input current Maximum KVA rating AC input frequency Power supply output capacity Power supply output Output holdup time Max heat dissipation Cisco IOS Release 12 1 12c EW Catalyst Operating System software version 7 4 1 Not supported Autoranging input with power factor corrector 100 to 240 VAC 10 for full range 12 A 100 VAC 5 A 240 VAC 1 32 KVA 50 60 Hz nominal 3 Hz for full range 1000 W plus 40 W fan 12 V 83 4 A 3 3 V 12 2 1667 W maximum 20 ms minimum 943 BTUs hr 1 A Catalyst 4503 with a Catalyst 4500 series Supervisor Engine II Plus TS and a 1000W power supply will be able to provide 158 4 W of Power over Ethernet to ports on the supervisor engine Switching modules in other slots will not be able to provide PoE Table A 6 1300 W AC Input Power Supply Specifications Item Specification Minimum software requirement Cisco IOS Release 12 1 12c EW Catalyst Operating System software version 7 4 1 Power over Ethernet Supported up to 800 W 211 Cisco phones in combined mode AC input type AC input voltage AC input current AC input frequency Maximum KVA rating Autoranging input with power fac
15. Fast Ethernet switching module WS X4248 FE SFP 24 port IEEE 802 3af compliant PoE 10 100BASE TX switching module WS X4224 RJ45V 48 port IEEE 802 3af compliant PoE 10 100BASE TX RJ 45 switching module WS X4248 RJ45V 48 port IEEE 802 3af compliant PoE 10 100BASE TX RJ 21 switching module WS X4248 RJ21V 32 port 10 100 Mbps Fast Ethernet plus 2 port Gigabit Ethernet switching module WS X4232 GB RJ 32 port 10 100 Mbps Fast Ethernet plus 2 port LOOOBASE X Layer 3 Gigabit Ethernet routing module WS X4232 L3 32 port 10 100 Mbps Fast Ethernet switching module with modular uplink support WS X4232 RJ XX 4 port MT RJ uplink module WS U4504 FX MT optional Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter Product Overview Switch Features Table 1 1 Features of the Catalyst 4503 Switch continued Feature Description Switching module support continued 2 port Gigabit Ethernet switching module WS X4302 GB 6 port 1000BASE X Gigabit Ethernet switching module WS X4306 GB 6 port Gigabit Ethernet switching module WS X4506 GB T 12 port 1000BASE T plus 2 port 1000BASE X Gigabit Ethernet switching module WS X4412 2GB T 18 port Gigabit Ethernet switching module WS X4418 GB 24 port 10 100 1000BASE T Gigabit Ethernet switching module WS X4424 GB RJ45 48 port Gigabit Ethernet 1000 BASE LX SPF switching module WS X4448 GB LX 48 port 10 100 1000BAS
16. nauanannunuanuun o o o hnnanannannn jaaananaaunuuu iananaanaanaa naauaaauaaauuaucsuaaaaaadaaaaaaa o naqqa aaaaaaaaaaaaanaanaaaaanaanaa j Fan assembly Catalyst 4500 Series Switches Installation Guide 78 14409 08 Product Overview Fan Assembly Chapter1 Catalyst 4507R Airflow Figure 1 15 annaaunnanauun raana 3999539900901 nuuauununua 39999399300 iaaanaauna 3999999909999 auaaaaananaunaauugiauannauu naaaaaaauunnauaan ianaaaaa anaaaauuuuuuun nooo aanaannaauuaunu 9999939909990 iaia anaaannanaunuMailannaaunna uiaiia 3000090909990 aaaaaaaauaanagauunaaaauna anaaannaunuciuunaunaaunna aaaaaanaaanunnanununnanuna aaaaaanaaaanaanaanaaanna o aanananaunanu anaaannauaununu ijannaauna ananaunnnaunuunr Fan assembly Catalyst 4500 Series Switches Installation Guide 78 14409 08 Product Overview Chapter 1 Fan Assembly Catalyst 4510R Airflow Figure 1 16 aaaanndMauaaanauannanunnauuunuaur aaaaannMEaaananaanaaaunaa
17. 2 or 3 or OUTPUT FAIL If the LED labeled GOOD is off or if the LED labeled FAIL is on take the following steps Ensure that the power supply is flush with the back of the chassis e Unplug the power cord loosen and reinstall the power supply tighten the captive installation screws and then plug in the power cord If the LED labeled GOOD remains off there might be a problem with the AC source or the power cable Connect the power cord to another power source if one is available If the LED labeled GOOD fails to light after you connect the power supply to a new power source replace the power cord Note this unit has more than one power cord repeat Step 1 through Step 4 for each power input If the LED labeled GOOD still fails to light when the switch is connected to a different power source with a new power cord the power supply is probably faulty Replace the power supply If the LED labeled FAN OK fails to light when the switch is connected to a power source with a known good power cord there is a malfunction in the fan that cools the power supply Replace the power supply If a second power supply is available install it in the second power supply bay Check that the LED labeled GOOD is on for the additional power supply Check that the LED labeled FAIL is off If the LEDs are not on repeat the previous procedure to troubleshoot the second power supply H Catalyst 4500 Series Switches Ins
18. 40 5 VDC 2x15A 1400 W 44 0 VDC Table A 11 Allowable Power with Two 1400 W DC Triple Input Power Supplies in Combined Mode PS1 PS2 1 20r3 2 3 1 2 3 1 824 W 907 W 1320W 1400 W 1700 W 2or3 907 W 990 W 1400 W 1450 W 1750 W and 2 or 3 1320 W 1400 W 1700 W 1750 W 1900 W 2 and 3 1400 W 1450 W 1750 W 1820 W 2130 W land2and3 1700 W 1750 W 1900 W 2130 W 2450 W Catalyst 4500 Series Switches Installation Guide 78 14409 08 ES AppendixA Specifications Catalyst 4500 Series Power Supplies Table A 12 2800 W AC Input Power Supply Specifications Item Specification Minimum software requirement Cisco IOS Release 12 1 13 EW Catalyst Operating System software version 7 5 1 Power over Ethernet Supported up to 1400 W 240 Cisco phones in combined mode AC input type Autoranging input with power factor corrector AC input voltage 200 to 240 10 for full range AC input current 16 A maximum at 200 VAC AC input frequency 50 60 Hz nominal 3 for full range Maximum KVA rating 3 52 KVA Power supply output 2800 W maximum 12 V 9113 3 A 3 3 V 912 1 A Data 50 V 28 A PoE 1360 W 40 W redundant mode Data 2473 W maximum in combined mode Data 1400 W maximum each in redundant mode PoE 2333 W maximum in combined mode PoE Max heat dissipation 2387 BTUs hr Output holdup time 20 ms minimum Catalyst 4500 Series Swi
19. A Catalyst 4500 series switch can use a 1000 W 1300 W 1400 W 2800 W see Figure 1 17 or 4200 W with two inputs see Figure 1 18 AC input power supply 1400 W DC input power supply with integrated PEM see Figure 1 19 or a 1400 W DC multiple input power supply see Figure 1 20 The AC input power supply has a power cord that connects each power supply to the site power source The DC input power supply is equipped with a input terminal block that is directly connected to the site power wiring Each power supply has an ON OFF switch that supplies power to the switch For information on removing and replacing power supplies see the Removing and Replacing the Power Supply section on page 4 2 Figure 1 17 AC Input Power Supply All Except 4200 W Captive screws fs AC receptacle 79136 gt 2 C Catalyst 4500 Series Switches Installation Guide 78 14409 08 EE Chapter1 Product Overview Power Supplies Figure 1 18 4200 W Dual Input AC Power Supply Captive screws 130106 4600Acy Note The 4200 W AC power supply should not be used in mixed voltage configurations All the inputs in a chassis must be the same voltage 110 or 220 V Figure 1 19 1400 W DC Input Power Supply Captive screws Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter1 Product Overview
20. Chapter 3 Installing the Switch in a Rack the Switch L Brackets on the Front Edge of the Catalyst 4503 Switch Figure 3 1 28167 o aanannaanaananananan o onannnannnanannan naannaannnanaaan aaannanananannaa naannnaananannana unc OS TIYVITIIICWICIIIIIQICIQI Baananm nnaannan 1 1 1 aauaaaaanaaannaa Aanancsanannannaan TG uu 4 aunuuuanuuaunnuuu nanacaaaanunaaauna Catalyst 4500 Series Switches Installation Guide 78 14409 08 Rack Mounting the Switch Installing the Switch in a Rack Chapter3 L Brackets on the Front Edge of the Catalyst 4506 Switch Figure 3 2 28164 n naananannananannannnnannnn o o nnnnnnnanananunnnaanannannn nananannannaannannanauannann nanaaannannananannanaanunnann nadaaaaanaaaaaaaanaaaaaaaana anaaannanaaaanaananananaana nanannnannanannnnnnunnunnunn nanannnanacfinannannadanananna f O O Of n nanunaunaaaaanac andnannan o muanunnnr nununnun nnnnnnune nannangannannaaohnnannnanr O
21. LEDs section on page 1 24 If the supervisor engine does not boot correctly after reseating and restarting contact Cisco TAC See the Contacting the Cisco Technical Assistance Center section on page 5 16 Switching modules The LEDs labeled STATUS on each switching module indicate whether the switching module has been initialized correctly The supervisor engine must be operating properly before the switching module will initialize If a switching module is improperly installed in the switch it will not function so if the supervisor engine is working but a switching module is not try reseating the module For more informations see the Troubleshooting Switching Modules section on page 5 10 If you determine that the switching module is not operating contact Cisco TAC as described in the Contacting the Cisco Technical Assistance Center section on page 5 16 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter5 Troubleshooting Using LEDs to Identify Startup Problems Using LEDs to Identify Startup Problems All system states in the startup sequence are indicated using LEDs By checking the LEDs you can determine when and where the system failed in the startup sequence If you have problems after the switch is on refer to the configuration procedures in the software configuration guide for your switch After you connect the power cords to your Catalyst 4500 series switch follow these
22. Product Overview Power Supplies Power Supply Fan Each power supply has a built in fan Air enters the front of the power supply power input end and exits through the back An air dam keeps the airflow separate from the rest of the chassis which is cooled by the system fan assembly Load Sharing Feature S When you install and turn on a second power supply on a Catalyst 4500 series switch it provides approximately one half of the required power to the system If one power supply fails the other power supply immediately assumes full power to maintain uninterrupted system operation Note Load sharing works only when both power supplies in the chassis are the same type When you install a redundant power supply load sharing and fault tolerance are enabled automatically no additional software configuration is required Environmental Monitoring Feature With the environmental monitoring and reporting feature you can keep your system running by resolving adverse environmental conditions before loss of operation The power supply monitors its own internal temperature and voltages In the event of excessive internal temperature the power supply shuts down to prevent damage When the power supply returns to a safe operating temperature it restarts If the power supply output voltage is not within the specified range the LED labeled OUTPUT FAIL will light An instance of substantial output overvoltage can shut d
23. System Boot Verification lt Note This chapter covers only the chassis component hardware aspects of troubleshooting For configuration issues refer to the software configuration guide or command reference for your switch System Boot Verification When the initial system boot is complete verify the following That the power supplies are supplying power to the system The LEDs should be green Use the show environment Cisco IOS command to view power supply activity e That the system fan assembly is operating Listen for fan activity The Fan tray LED should be green during operation e That the system software boots successfully Hook up a terminal and view the startup banner Use an RJ 45 to RJ 45 rollover cable to connect the console port to a PC with terminal emulation software set for 9600 baud 8 data bits no parity and 1 stop bit Watch for any messages after startup That the supervisor engine and all switching modules are installed properly in their slots and that each initialized without problems If all of these conditions are met and the hardware installation is complete refer to the software configuration guide and command reference publications for your switch so that you can troubleshoot the software If any of these conditions is not met use the procedures in this chapter to isolate and if possible resolve the problem Catalyst 4500 Series Switches Installation Guide EIN 78 14409 08 Chapte
24. Figure 4 6 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter4 Removing and Replacing FRUs Removing and Replacing the Power Supply Figure 4 6 Loosening the Side Clamp Screw 79139 Step3 Disconnect the power cord from the power supply being removed Step4 Loosen the two captive screws see Figure 4 7 Figure 4 7 Loosening the Captive Screws Captive screws 79140 Catalyst 4500 Series Switches Installation Guide EN 78 14409 08 Chapter4 Removing and Replacing FRUs Removing and Replacing the Power Supply A Caution Use both hands to grasp a power supply Stepb Grasp the power supply handle with one hand Place your other hand underneath to support the bottom of the power supply as shown in Figure 4 8 Figure 4 8 Handling an AC Input Power Supply 79141 Step6 Pull the power supply out of the bay and set it aside Warning Blank faceplates and cover panels serve three important functions they prevent exposure to hazardous voltages and currents inside the chassis they contain electromagnetic interference EMI that might disrupt other equipment and they direct the flow of cooling air through the chassis Do not operate the system unless all cards faceplates front covers and rear covers are in place Statement 1029 Step7 If power supply bay is to remain empty install a blank power supply filler plate over the
25. Power Supplies Figure 1 20 1400 W DC Triple Input Power Supply Captive screws 120562 Note The 1400 W DC triple input power supply is not compatible with other power supplies used on these products and can only be used with similar supplies In redundant mode the two power supplies must have identical inputs The 1400 W DC input power supply either single or triple input may be used with the Catalyst 4500 Series AC Power Shelf Documentation for the Catalyst 4500 Series AC Power Shelf is at http www cisco com univercd cc td doc product lan cat4000 inst_nts 78_15068 htm Catalyst 4500 series switches support one power supply and an optional redundant power supply Each AC power supply has an individual power cord and status LEDs Systems with redundant power supplies will share the load with each unit providing approximately one half of the total load For information about configuring your switch for redundant and combined modes refer to the software configuration guide for your switch The Catalyst 4510R requires at least 1400 W of input power The 1000 W AC and 1300 W AC power supplies for the Catalyst 4500 series will fit and function in a Catalyst 4510R however power management may be required in high density configurations Cisco recommends the use of the 1400 W DC 1400 W AC and 2800 W AC power supplies for the Catalyst 4510R When power is removed from one power supply on a Catalyst 4500 series swit
26. Power supplies e Supports 1000 W 1300 W 1400 W 2800 W or 4200 W AC input power supply or a 1400 W DC input single or triple input power supply Optional redundant power supply 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Chapter Product Overview Switch Features Table 1 2 Features of the Catalyst 4506 Switch continued Feature Description Supervisor engine support Supports the Supervisor Engine II H IL 10GE IV V Holds the ASIC based forwarding engine data path and the management processor and software control path Features interface monitoring environmental status and SNMP and console Telnet interface Note Packets are not forwarded while the module is removed a system reboot occurs when a supervisor engine is reinserted Switching module support 24 port 10 100BASE TX Fast Ethernet switching module WS X4124 RJ45 e 24 port IO0BASE FX Fast Ethernet switching module WS X4124 FX MT 48 port IO0BASE FX Fast Ethernet switching module WS X4148 FX MT 48 port LOOBASE LX10 Fast Ethernet switching module WS X4148 FE LX MT 48 port 10 100 Mbps Fast Ethernet switching module WS X4148 RJ 48 port IOOBASE BX10 D Fast Ethernet switching module WS X4148 FE BD LC e 48 port 10 100 Mbps Fast Ethernet switching module WS X4148 RJ21 48 port Cisco pre standard Power over Ethernet PoE 10 100BASE TX switching
27. You should hear the fans at system start If the system is still detecting a fan assembly failure contact the Cisco TAC for assistance Troubleshooting Backplane Modules The Cisco Catalyst 4500 Series redundancy scheme uses removable redundancy modules also called mux buffers on the passive backplane to switch traffic to the active supervisor engine There is one redundancy module per switching module Redundancy modules and a redundant clock ship standard with every Cisco Catalyst 4507R and 4510R chassis Spare redundancy modules C4K MUX and a clock module C4K CLOCK are available for serviceability The following conditions indicate that you may need to replace the redundancy modules and clock module 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter5 Troubleshooting Troubleshooting Switching Modules Theswitch powers down and stays down for a few minutes to a few days for no clear reason e The output fail LED on the power supplies are red and no power is delivered to the chassis The other LEDs on the power supply are green The Status LEDs on the switching modules and the supervisor engine are flashing green e CPU Utilization LEDs are flashing green or off If you observe these conditions contact the Cisco TAC for assistance in ordering replacement redundancy modules and a clock Troubleshooting Switching Modules Each switching module has one LED labeled STATUS that
28. fan tray and backplane components The 1400 W DC power supply can accept up to 7500 W DC for data and PoE applications Up to 1400 W can be dedicated for data supervisor engine fan tray etc while the remaining power is passed through via the PEM and is used for PoE When only one external AC power shelf is used with two 2500 W AC power supplies it provides the 1400 W DC power supply with 5000 W of DC power in total When two AC power shelves are strapped together the switch can provide up to 7500 W of DC power 3 1 redundant Cisco Catalyst 4500 Series Service Provider DC Power Supply The triple input 1400 W DC power supply is optimized for service provider or central office deployments By providing multiple inputs the service provider DC power supply enables central office technicians to customize the output power to meet their application needs Many central office deployments require only a fraction of the 1400 W available in the service provider power supply Low current inputs mean technicians can connect the supply to smaller fuses and breakers The service provider power supply makes it possible to deploy a Cisco Catalyst 4503 Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter Product Overview System Architecture with a single 15A circuit Likewise it is possible to deploy a fully populated Cisco Catalyst 4510R with two 20A and one 15 circuits rather than a single 60A conne
29. page 1 26 RESET Button page 1 26 LEDs e CompactFlash Port page 1 27 Table 1 6 describes the supervisor engine LEDs Table 1 6 Supervisor Engine LEDs LED Color State Description STATUS Indicates the results of a series of self tests Green All diagnostic tests passed Red A test failed Orange System boot or diagnostic test is in progress Off Module is disabled UTILIZATION Green 1 100 If the switch is operational this display indicates the current traffic load over the backplane as an approximate percentage LINK Indicates the status of the 10 100BASE T port 10 100 1000BASE T or uplink ports Green The link is operational Orange The link is disabled by user Flashing orange The power on self test indicates a faulty port Off No signal is detected or there is a link configuration failure ACTIVE Indicates whether the uplink port is active or not Green The port is active Off The port is not active ACTIVE The LED to the right of the uplink ports is only used in switches with two supervisors The LED lights on the active supervisor m Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter1 Product Overview Supervisor Engines Gigabit Ethernet Uplink Ports The Gigabit Ethernet uplink ports operate in full duplex mode only GBICs have SC connectors to interface with multimode fiber MMF and single mode fiber SMP cable For more information about GBICs re
30. 08 Catalyst 4500 Series Switches Installation Guide m Chapter5 Troubleshooting Contacting the Cisco Technical Assistance Center Some problems can be solved by resetting the supervisor engine Use the hw module module n reset power cycle command to reset a switching module or remove and re insert the switching module which resets restarts and power cycles the switching module Pressing the reset button on the supervisor engine causes the software to reload but does not power cycle the supervisor engine Note When you power cycle or remove a supervisor engine in a redundant system the other supervisor engine becomes the active supervisor and the ports retain connectivity In a non redundant system all of the switching modules lose connectivity until the supervisor engine is reinserted and completely restarted The show diagnostics power on command may provide useful information for some supervisor engine problems Not all software versions support all supervisor engines If you are having trouble with a supervisor engine refer to the software release notes to be sure that it is supported by your software Contacting the Cisco Technical Assistance Center If you are unable to solve a startup problem after using the troubleshooting suggestions in this chapter contact a Cisco TAC representative for assistance and further instructions Before you call have the following information ready to help the Cisco TAC a
31. 1 3 1 7 1 11 1 15 troubleshooting 5 3 switching modules Catalyst 4503 supported 1 4 Catalyst 4506 supported 1 8 Catalyst 4507R supported 1 12 Catalyst 4510R supported 1 16 troubleshooting 5 3 T TAC contacting 5 16 temperature Catalyst 4503 switches 2 Catalyst 4506 switches A 3 Catalyst 4507 switches A 4 A 6 troubleshooting 5 6 boot process 5 2 fan assemblies 5 8 methodology 5 3 power supplies 5 6 startup 5 4 supervisor engines 5 3 switching modules 5 3 U uplink ports description 1 25 H Catalyst 4500 Series Switches Installation Guide 78 14409 08 Index UTILIZATION LEDs description table 1 24 v voltage specifications 10 A 13 W weight Catalyst 4503 switches table A 2 Catalyst 4506 switches table A 4 Catalyst 4507 switches table A 5 A 6 Catalyst 4500 Series Switches Installation Guide 78 14409 08 EIN Index Catalyst 4500 Series Switches Installation Guide 78 14409 08
32. 2905 BTUs hr data and voice 78 14409 08 Catalyst 4500 Series Switches Installation Guide Appendix A Specifications Catalyst 4500 Series Power Supplies Table A 8 1400 W DC Input Power Supply Specifications continued Item Specification Catalyst 4503 Specific Power Usage data only Maximum draw 475 W Maximum input 633 W Current draw at 40 5 V min voltage 15 6 A Current draw at 72 V max voltage 8 8 Max heat dissipation at 633 W 2160 BTUs Catalyst 4506 Specific Power Usage data only Maximum draw data only 850 W Maximum input 1133 W Current draw at 40 5 V min voltage 28 A Current draw at 72 V max voltage 15 8 A Max heat dissipation at 1133 W 3515 BTUs Catalyst 4507R Specific Power Usage data only Maximum draw data only 1080 W Max input is 1080 W 0 75 1440 W Current draw at 40 5 V min voltage 35 6 A Current draw at 72 max voltage 20 Max heat dissipation 1440 W 4910 BTUs H Catalyst 4500 Series Switches Installation Guide 78 14409 08 AppendixA Specifications Table A 9 Catalyst 4500 Series Power Supplies 1400 W DC Triple Input Power Supply Specifications Item Specification Minimum software requirement Cisco IOS Release 12 2 25 EW Power over Ethernet Not supported DC input voltage Domestic and international 48 to 60 VDC DC input current Input power Current
33. CAB USL620P C19 US 6 1 82 250 VAC 20 locking 200 240 VAC operation 120361 North America CAB US620P C19 US 6ft 1 82m 250 VAC 20A 6 20 non locking non locking 200 240 VAC operation Europe CAB CEE77 C19 EU 6 1 82 m 250 VAC 15A 7 7 International CAB IEC309 C19 INT 6 ft 1 82 m 250 16A 309 including Argentina and South Africa 120357 120360 Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Chapter2 Preparing for Installation Power Connection Guidelines for AC Powered Systems Table 2 1 AC Input Power Cord Options continued Locale Part Number Length Plug Rating Plug Type Australia CAB AS3112 C19 AUS 6ft 1 82m 250 15A AS NZZS 3112 Italy CAB CEI2316 C19 IT 6 ft 1 82 250 16A CEI23 16 United CAB BS1363 C19 UK 6ft 1 82m 250 15A BS 1363 Kingdom Israeli CAB SI32 C19 ISRL 6 ft 1 82 250 VAC 16 A UPS 220V CAB C19 C20 6 ft 1 82 250 VAC 20 A D s UPS 110V 19 14 6ft 1 82m 125 16A 60320 14 DP A Catalyst 4500 Series Switches Installation Guide 78 14409 08 EIN Chapter2 Preparing for Installation Power Connection Guidelines for DC Powered Systems Power Connection Guidelines for DC Powered Systems This section provides the basic guidelines for connecting
34. Catalyst 4500 Series Switches Installation Guide 78 14409 08 EN Chapter5 Troubleshooting Troubleshooting the Fan Assembly The 1400 W DC multi input supply can not be used with other power supply types but other power supplies in this product line work with the other types during an upgrade If you mix power supplies in a Catalyst 4500 series chassis the switch detects the type of power supply in power supply bay 1 PS1 and ignores the power supply in power supply bay 2 PS2 while issuing system messages and showing the power supply in bay 2 as in the err disable state in the output of the show power command When the power supply in bay 1 is removed the switch recognizes the power supply in bay 2 and you may then put a new matching power supply in bay 1 Both supplies should now resume normal function Troubleshooting the Fan Assembly Note Step 1 Step 2 Step 3 All fans must be operating or a failure will occur Environmental problems may initially appear to be problems with the fan tray To help isolate a fan assembly problem follow these steps Check the status LED on the fan tray Ifthe LED is off and the rest of the system is functioning the fan tray is not getting power or is not seated correctly on the backplane Ifthe LED is green the fans are operating normally There may be conditions impairing fan performance but they are minimal in impact If the LED is red one or m
35. Catalyst 4500 Series offers several internal supplies 1000 W AC data only 1400 W AC data only 1300 W data and PoE 1400 W DC data and PoE 2800 W data and PoE and 4200 W AC data and PoE When more than 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Chapter Product Overview System Architecture 4200 W of redundant data and PoE are required for a Cisco Catalyst 4500 Series chassis in an AC powered environment Cisco offers an external AC power shelf that houses two 2500 W AC power supplies When two power shelves are combined they can produce 7500 W the remaining 2500 W supply can be used for N 1 protection The Cisco Catalyst 4500 Series has two DC power options one is optimized for data only deployments in service provider central offices part number PWR C45 1400DC and the other is used for high power PoE deployments part number PWR C45 1400DC P Cisco Catalyst 4500 Series External AC Power Shelf and 1400 W DC Power Supply with Integrated Power Entry Module The external AC power shelf must be used in conjunction with the 1400 W DC power supply In addition to providing power for the chassis fans and non PoE line cards the 1400 W DC power supply contains a power entry module PEM The PEM is used to pass additional power to the chassis backplane power demanded by the PoE line cards The chassis power trace used for PoE is independent from the one used by the supervisor engine s
36. LX 48 port 10 100 1000B ASE T Gigabit Ethernet switching module WS X4448 GB RJ45 24 port IEEE 802 3af compliant PoE 10 100 1000BASE T RJ 45 switching module WS X4524 GB RJ45V 48 port 10 100 1000B ASE T Gigabit Ethernet switching module WS X4548 GB RJ45 48 port Gigabit Ethernet switching module WS X4448 GB SFP 48 port IEEE 802 3af compliant PoE 10 100 1000BASE T Gigabit Ethernet switching module WS X4548 GB RJ45V e Access Gateway Module WS X4604 GWY e Backplane channel module WS X4019 1 You will need to configure the 1400 W DC input current as appropriate for the model of switch Refer to Appendix A Specifications 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Chapter1 Product Overview Switch Features Catalyst 4507R Switch Features The Catalyst 4507R switch see Figure 1 3 is a seven slot switch designed for high performance high density wiring closet applications Figure 1 3 Catalyst 4507R Switch Front View Power pies Supervisor engine slot 1 Redundant supervisor engine slot 2 o o Switching modules slots 3 through 7 a m m a unu ununobDuDDODDDODDDDODDUOUDU DODDDDDDDDDDDODDDDDDDOUDU BODODDODODODDODODD
37. System Ground Connection Guidelines Connecting System Ground and Power Step 1 Step 2 Step 3 Step 4 This section describes how to connect the Catalyst 4500 series switches to earth ground The system ground connection is required if FXS modules are installed or if this equipment is installed in a US or European Central Office You must complete this procedure before connecting system power or turning on your switch To attach the grounding lug and cable to the grounding pad on your Catalyst 4500 series switch perform the following steps Using a wire stripping tool remove approximately 0 75 inches 19 mm of the covering from the end of the grounding wire Insert the stripped end of the grounding wire into the open end of the grounding lug Figure 3 17 Using a crimping tool secure the grounding wire in place in the grounding lug Locate the grounding pad on the switch See Figure 3 13 for the location of the grounding holes on the Catalyst 4503 switch Figure 3 14 for the location on the Catalyst 4506 switch Figure 3 15 for the location on the Catalyst 4507R switch and Figure 3 16 for the location on the Catalyst 4510R switch 78 14409 08 Catalyst 4500 Series Switches Installation Guide Bg Chapter3 Installing the Switch in a Rack System Ground Connection Guidelines Figure 3 17 Connecting System Ground on the Switch o o DODDDODDDDDOLDDDODDDDDLDUD
38. also enables businesses to isolate critical devices on a single power system so that the entire system can be supported by uninterruptable power supply UPS backup All new Cisco Catalyst PoE line cards can support 15 4 W of power per port simultaneously Not only do the cards support the IEEE standard including the optional power classifications but the Cisco pre standard power implementation is also supported to help ensure backward compatibility with existing Cisco powered devices The cards are compatible with any chassis and supervisor engine Most importantly the Catalyst 4500 series switch has the power supplies and accessories to support 15 4 W per port on every port simultaneously in any fully loaded chassis This requires an external power shelf or a 4200 W dual input power supply 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Chapter Product Overview System Architecture PoE Over subscription PoE Line Cards With the advent of powered devices requiring as much as 15 4 W and the different combinations of power supplies and chassis port densities it becomes quite possible to over subscribe the PoE capacity of the power supplies This temporary over subscription typically occurs when a power supply configured in combined mode fails or when the user has not kept track of the powered devices and plugs in one too many The best practice is to design a PoE system in which all devices receive the p
39. at input voltages greater 44 0 V DC the power supply delivers 1400 W maximum total output Table 1 8 provides output information for these modes given a single supply Table 1 8 Input Modes Input Input Maximum Total Output Mode Number Input Configuration Power I 1 1 12 5 386 W 40 5 V DC 412 W 44 0 V DC 2 2OR 3 1 15 466 W Q 40 5 V DC 495 W 44 0 V DC 3 1 2OR3 1x12 5A and 845 W 40 5 V DC 5 908 W 44 0 V DC 4 2 3 2 15 914 W 40 5 V DC 990 W 44 0 V DC 5 1 2 3 1 x 12 5A and 1294 W 40 5 V DC 2x15A 1400 W 44 0 V DC Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter1 Product Overview S Power Supplies The maximum total input current is 42 5A and the maximum ambient temperature is 55 C To determine total maximum input power to a supply add up the active individual module input power ratings Table 1 9 provides output information for these modes given two supplies working in combined mode Table 1 10 provides output information for these modes given two supplies working in redundant mode Table 1 9 Combined Mode Power Supply Configuration 2450 W Max Output Power Input Maximum Input Number Maximum Input Current Power 44 V DC 1 12 5 A 44 V DC 550 W 2 15 A 44 V DC 660 W 3 15 A 44 V DC 660 W Table 1 10 Dual Redundant Mode Power Supply Configuration 1400 W
40. draw At 40 5 V min voltage Current draw at 72 V max voltage Max heat dissipation at 1400 W Maximum KVA rating Power supply output DC supply DC input terminal block Output holdup time Max heat dissipation 42 5 A maximum 48 VDC input Input 1 12 5 at 48 to 60 VDC Input 2 15 A at 48 to 60 VDC Input 3 15 A at 48 to 60 VDC 1772 W 1400 W output power 42 5 25 1269 BTUs 1 77 at 1400 W load 12 V 8 A minimum 115 3 A maximum 3 3 V 1 2 A minimum 12 5 A maximum 1360 W 40 W redundant mode 2450 W maximum in combined mode Model Cooper Bussmann Magnum Accepts terminals with flat angle one hole tongue which accommodates 10 to 12 AWG size copper wire The connector the barrier spacing is 0 378 in 9 6 mm and the screw size is 8 32 8 ms 1269 BTUs hr 78 14409 08 Catalyst 4500 Series Switches Installation Guide AppendixA Specifications Catalyst 4500 Series Power Supplies Table A 9 1400 W DC Triple Input Power Supply Specifications continued Item Specification Catalyst 4503 Specific Power Usage data only Maximum draw Maximum input Current draw at 40 5 min voltage Current draw at 72 V max voltage Max heat dissipation at 609 W Two modules minimum required 40 5 VDC input One 15A module minimum required 44 VDC input 475 W 609 W total of modules W per module 15 A total of modules A pe
41. ft 4 3 m 250 16A CEE 7 7 120357 Catalyst 4500 Series Switches Installation Guide EN 78 14409 08 Chapter2 Preparing for Installation Power Connection Guidelines for AC Powered Systems Table 2 1 AC Input Power Cord Options continued Locale Part Number Length Plug Rating Plug Type International CAB AC 2800W INT 14 ft 4 3 250 16A 309 120360 Appliance Coupler PIN 120353 2800 W Power Supply PWR C45 2800ACV North America ICAB AC 2800W TWLK 14 ft 4 3 250 16 A NEMA L6 20 locking 200 240 VAC operation 120361 North America CAB AC 2800W 6 20 14 ft 4 3 m 250 16 NEMA 6 20 non locking non locking 200 240 VAC operation Europe CAB AC 2800W EU 14 ft 4 3 m 250 16A CEE 7 7 International CAB AC 2800W INT 14 ft 4 3 m 250 16A 309 120357 120360 Catalyst 4500 Series Switches Installation Guide 78 14409 08 EN Chapter2 Preparing for Installation Power Connection Guidelines for AC Powered Systems Table 2 1 AC Input Power Cord Options continued Locale Part Number Length Plug Rating Plug Type Appliance Coupler 4200 W Power Supply PWR C45 4200ACV J North America CAB US515P C19 US 6 ft 1 82 125 15A NEMA 5 15P 120 VAC operation 120354 North America
42. hw switches ps4324 tsd products su pport series home html Conventions This document uses the following conventions Convention Description boldface font Commands and keywords are in boldface italic font Arguments for which you supply values are in italics Elements in square brackets are optional xlylz Alternative keywords are grouped in braces and separated by vertical bars xlylz Optional alternative keywords are grouped in brackets and separated by vertical bars string A nonquoted set of characters Do not use quotation marks around the string because the string will include the quotation marks screen font Terminal sessions and information that the system displays are in screen font boldface screen font Information that you must enter is shown in boldface screen font italic screen font Arguments for which you supply values are in italic screen font 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Preface Conventions Convention Description Ctrl Ctrl represents the key labeled Control for example the key combination Ctrl D means to hold down the Control key while you press the D key lt gt Characters that do not print such as passwords are shown within angle brackets Notes use the following conventions Note Means reader take note Notes contain helpful suggestions or references
43. kit The cable guide attaches to the L bracket Attach the cable guide to the right side of the switch to prevent the cables from obscuring Attach the cable guide module LEDs Figure 3 6 for the Catalyst 4506 5 for the Catalyst 4503 switch See Figure 3 8 for the or Figure 3 gt switch Figure 3 7 for the Catalyst 4507R switch Catalyst 4510R switch Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter 3 Installing the Switch in a Rack the Switch Attaching the Cable Guide to the Catalyst 4503 Switch Figure 3 5 78164 aaaaaaaauaaauauaa oanaaaaanauaauauaa maaananauanauaaaaa nannanannunannuna nannnnnanannnann annud nnannnannn o o na cannananannac o nnu nnnannnnnnaa mnoaannananananas 0 0 0 uanmaaacaaaaaaanac o Sananeanananeaarn unnancananangane Catalyst 4500 Series Switches Installation Guide 78 14409 08 Rack Mounting the Switch Installing the Switch in a Rack Chapter3 Attaching the Cable Guide to the Catalyst 4506 Switch Figure 3 6 98164 ua tmr a o ananaaaaaaaanaaauauaaaaaauaaa nmaaaaanaanaaaaanaannauanauauna naa
44. provides information about the module and one numbered LED labeled LINK for each port on the module Figure 5 1 shows the Gigabit Ethernet port and status LEDs Figure 5 2 shows the 10 100BASE T port LEDs Table 5 1 describes the switching module LEDs and their expected behavior Figure 5 1 Gigabit Ethernet Port and Status LEDs STATUS 1000BASE X SWITCHING MODULE O O O lt 26854 Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Chapter5 Troubleshooting Figure 5 2 Troubleshooting Switching Modules 10 100BASE T Port LEDs WS X4148 F E NEUES EE METER uu uu OO 00 00 00 OO APORT la Y 10 100 B Table 5 1 Switching Module LEDs LED Color State Description STATUS Indicates the results of a series of self tests and diagnostic tests performed by the switch Green All the tests pass Red A test other than an individual port test failed Orange System boot self test diagnostics running or the module is disabled LINK Indicates the status of the port Green The port is operational a signal is detected Orange The link has been disabled by software Flashing The link has been disabled due to a
45. screws 79136 Figure 4 2 4200 W Dual Input AC Power Supply Captive screws AC input 1 on switch Se or AC input 2 on switch 130106 Catalyst 4500 Series Switches Installation Guide 78 14409 08 EN Removing and Replacing FRUs Chapter 4 Removing and Replacing the Power Supply DC Input Power Supply Figure 4 3 Main power switch z o 7 Q S i fa o 5 O gt so o 55 T go c BE o 5 7 o z o 9 o S gt E c 09164 1400 W DC Triple input Power Supply Figure 4 4 Captive screws 29902 FECERIS Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter4 Removing and Replacing FRUs Removing and Replacing the Power Supply Required Tools You will need a flathead or Phillips screwdriver to perform these procedures Removing an AC Input Power Supply Step 1 Step 2 Follow these steps to remove the AC input power supply Press the power switch on the AC input power supply down to the off O position see Figure 4 5 Figure 4 5 Powering Off the Power Switch Power switch 79138 Note There are two on off switches on 4200 W AC power supply one for each input Loosen the side clamp screw on the right side of the power cord plug see
46. steps to determine whether your system is operating properly Step 1 Check the power supply LEDs The LED labeled GOOD should turn green when power is applied to the supply The LED should remain on during normal system operation Ifthe LED labeled GOOD does not light or if the LED labeled FAIL lights see the Troubleshooting the Power Supply section on page 5 6 S Note If a power supply is installed and not connected to a power source power supply LEDs will indicate a failure Step2 Listen for the system fan assembly If you do not immediately hear it begin to operate see the Troubleshooting the Fan Assembly section on page 5 8 Step3 Check that the LEDs on the supervisor engine light as follows The LED labeled STATUS flashes orange once and stays orange during diagnostic boot tests It turns green when the module is operational online Ifthe system software is unable to start up this LED stays orange Ifthe LED labeled STATUS on the supervisor engine front panel is red or orange connect a console to the management port and use the show environment command to check for possible problems For more information see the Troubleshooting Supervisor Engines section on page 5 13 The Ethernet management port LED turns green when the module is operational online and a link is established with another network device If no signal is detected the LED labeled LINK turns off Catalyst 450
47. supply or a 1400 W DC input single or triple input power supply Optional redundant power supply 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Chapter Product Overview Switch Features Table 1 3 Features of the Catalyst 4507R Switch continued Feature Description Supervisor engine e Supports the Supervisor Engine II II IL 10GE IV V V T0GE support e Holds the ASIC based forwarding engine data path and the management processor and software control path e Features interface monitoring environmental status and SNMP and console Telnet interface Note Packets are not forwarded while the module is removed a system reboot occurs when a supervisor engine is reinserted Switching module e 32 port 10 100 Mbps Fast Ethernet plus 2 port Gigabit Ethernet switching support module WS X4232 GB RJ e 32 port 10 100 Mbps Fast Ethernet plus 2 port 1000BASE X Layer 3 Gigabit Ethernet routing module WS X4232 L3 e 32 port 10 100 Mbps Fast Ethernet switching module with modular uplink support WS X4232 RJ XX 4 port MT RJ uplink module WS U4504 FX MT optional e 2 port Gigabit Ethernet switching module WS X4302 GB 24 port 10 100BASE TX Fast Ethernet switching module WS X4124 RJ45 e 24 port 100 Fast Ethernet switching module WS X4124 FX MT 48 port 100 Fast Ethernet switching module WS X4148 FX MT 48 port IOOBASE LXI0O Fast Eth
48. the Catalyst 4500 series switch DC input power supplies to the site power source or AC power shelf All power connection wiring should conform to local and national codes DC and DC return terminals are evaluated for use with 1 0 AWG wire 1400W DC supply only The ground terminal is evaluated for use with 6 AWG wire 10 AWG for the multi input power supply DC and DC return wire lugs shall not exceed 0 83 inches in width 0 378 inches for the multi input power supply For DC power cables we recommend that you use commensurately rated high strand count copper wire cable Connection to the DC input power supply requires one earth ground cable one source DC and one source DC return The length of the cables depends on your switch location These cables are not available from Cisco Systems They are available from any commercial cable vendor The color coding of the source DC power cable leads depends on the color coding of the site DC power source Typically green or green and yellow indicate that the cable is a ground cable Because there is no color code standard for source DC wiring you must ensure that the power cables are connected to the DC input power supply terminal block in the proper and polarity In some cases the source DC cable leads might have a positive or a negative label This label is a relatively safe indication of the polarity but you must verify the polarity by measuri
49. the switch has already started up you may also verify the correct function of the new modules with the show logging command Catalyst 4500 Series Switches Installation Guide 78 14409 08 CHAPTER Troubleshooting If your system has problems during start up or operation use the information in this chapter to help isolate the cause Problems with the initial startup are often caused by a switching module that has become dislodged from the backplane or a power cord that is disconnected from the power supply Although temperature conditions above the maximum acceptable level rarely occur at initial startup some environmental monitoring functions are included in this chapter because they also monitor power supply output voltages Information about troubleshooting software features and configuration problems 18 not discussed in this chapter The information is presented in these sections e System Boot Verification page 5 2 e Problem Solving to the System Component Level page 5 3 Using LEDs to Identify Startup Problems page 5 4 Troubleshooting the Power Supply page 5 6 e Troubleshooting the Fan Assembly page 5 8 Troubleshooting Backplane Modules page 5 9 Troubleshooting Switching Modules page 5 10 Troubleshooting Supervisor Engines page 5 13 Contacting the Cisco Technical Assistance Center page 5 16 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter5 Troubleshooting
50. to material not covered in the publication Cautions use the following conventions A Caution Means reader be careful In this situation you might do something that could result in equipment damage or loss of data Catalyst 4500 Series Switches Installation Guide Em 78 14409 08 Preface Conventions Warnings use the following conventions Warning IMPORTANT SAFETY INSTRUCTIONS This warning symbol means danger You are in a situation that could cause bodily injury Before you work on any equipment be aware of the hazards involved with electrical circuitry and be familiar with standard practices for preventing accidents Use the statement number provided at the end of each warning to locate its translation in the translated safety warnings that accompanied this device Statement 1071 SAVE THESE INSTRUCTIONS Waarschuwing BELANGRIJKE VEILIGHEIDSINSTRUCTIES Dit waarschuwingssymbool betekent gevaar U verkeert in een situatie die lichamelijk letsel kan veroorzaken Voordat u aan enige apparatuur gaat werken dient u zich bewust te zijn van de bij elektrische schakelingen betrokken risico s en dient u op de hoogte te zijn van de standaard praktijken om ongelukken te voorkomen Gebruik het nummer van de verklaring onderaan de waarschuwing als u een vertaling van de waarschuwing die bij het apparaat wordt geleverd wilt raadplegen BEWAAR DEZE INSTRUCTIES Varoitus T RKEIT TURVALLISUUSOHJEITA
51. 0 Series Switches Installation Guide EIN 78 14409 08 Chapter5 Troubleshooting Using LEDs to Identify Startup Problems Step4 Verify that the LEDs labeled STATUS on each switching module are green when the supervisor engine completes initialization This LED indicates that the supervisor engine and switching modules are receiving power have been recognized by the supervisor engine and contain a valid Flash code version However this LED does not indicate the state of the individual interfaces on the switching modules If an LED labeled STATUS is red or orange try reseating the switching module or supervisor engine and restarting the switch If the problem persists contact Cisco TAC See the Contacting the Cisco Technical Assistance Center section on page 5 16 Stepb If the boot information and system banner are not displayed verify that the terminal is set for 9600 baud 8 data bits no parity and 1 stop bit and connected properly to the console port Catalyst 4500 Series Switches Installation Guide 78 14409 08 EN Chapter5 Troubleshooting Troubleshooting the Power Supply Troubleshooting the Power Supply Step 1 Step 2 Step 3 Step 4 Step 5 Step 6 Step 7 Step 8 Step 9 To help isolate a power subsystem problem follow these steps Check whether the power supply LED labeled GOOD is on or the LED labeled FAIL is on on the DC multi input power supply the LEDs are labeled INPUT 1
52. 00BASE T Gigabit Ethernet switching module WS X4448 GB RJ45 24 port IEEE 802 3af compliant PoE 10 100 1000BASE T RJ 45 switching module WS X4524 GB RJ45V 48 port 10 100 1000BASE T Gigabit Ethernet switching module WS X4548 GB RJ45 48 port Gigabit Ethernet switching module WS X4448 GB SFP 48 port IEEE 802 3af compliant PoE 10 100 1000BASE T Gigabit Ethernet switching module WS X4548 GB RJ45V e Access Gateway Module WS X4604 GWY 1 You will need to configure the 1400 W DC input current as appropriate for the model of switch Refer to Appendix A Specifications Catalyst 4500 Series Switches Installation Guide 78 14409 08 EE Product Overview Chapter 1 The Catalyst 4510 switch see Figure 1 4 is a ten slot switch designed for Power supplies high performance high density wiring closet applications Catalyst 4510R Switch Front View Catalyst 4510R Switch Features Switch Features Figure 1 4 78 14409 08 956 6 aaanaunanannunnunauaunaunananaanaunnun o naaananaunanaunnaununuunnunaununaunununa naaaananaunuanaunaananunannananaunauaununa anaaaananaanaaaaaaanaaaanaaaanaaaanaaa aaananaanauanunanunanaunuunanaununauauna maaaaaaauaaaaaaunaaaaaaaaaaaaaaaaaauaauna aaanaanaanaunaunnunaunaaauanananaunauauna maaaaaanunaanaaunnnaaaaanaaaauaa
53. 1400 W 2800 W or 4200W AC input power supply or a 1400 W DC input single input or triple input power supply Optional redundant power supply Supervisor engine support Supports the Supervisor Engine II H H 10GE III IV V Holds the ASIC based forwarding engine data path and the management processor and software control path Features interface monitoring environmental status and SNMP and console Telnet interface Note Packets not forwarded while the module is removed a system reboot occurs when a supervisor engine is reinserted 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter Product Overview Switch Features Table 1 1 Features of the Catalyst 4503 Switch continued Feature Description Switching module support 24 port 10 100BASE TX Fast Ethernet switching module WS X4124 RJ45 24 port 100BASE FX Fast Ethernet switching module WS X4124 FX MT 48 port Fast Ethernet switching module WS X4148 FX MT 48 port I00BASE L X10 Fast Ethernet switching module WS X4148 FE LX MT 48 port 10 100 Mbps Fast Ethernet switching module WS X4148 RJ 48 port IO0BASE BX10 D Fast Ethernet switching module WS X4148 FE BD LC 48 port 10 100 Mbps Fast Ethernet switching module WS X4148 RJ21 48 port Cisco pre standard Power over Ethernet PoE 10 100BASE TX switching module WS X4148 RJ45V 48 port
54. 36 System Architecture 1 40 Power Flow 1 40 Power over Ethernet 1 41 Management Flow 1 45 Switching Traffic Flow 1 46 cHAPTER 2 Preparing for Installation 2 1 Electrostatic Discharge 2 2 Preventing Electrostatic Discharge Damage 2 3 Site Power Requirements and Heat Dissipation 2 4 Power Connection Guidelines for AC Powered Systems 2 5 Power Connection Guidelines for DC Powered Systems 2 12 Calculating DC Input Current 2 13 H Catalyst 4500 Series Switches Installation Guide 78 14409 08 Contents Ventilation 2 14 Calculating System Heat Dissipation 2 15 Site Planning Checklist 2 16 Installing the Switch ina Rack 3 1 Checking the Shipping Container Contents 3 2 Rack Mounting the Switch 3 3 Required Installation Tools 3 3 Rack Mounting Catalyst 4500 Series Switches 3 4 CHAPTER 3 System Ground Connection Guidelines 3 18 Parts and Required Tools 3 22 Connecting System Ground and Power 3 23 Removing and Replacing FRUs 4 1 Removing and Replacing the Power Supply 4 2 Required Tools 4 5 Removing an AC Input Power Supply 4 5 Installing an AC Input Power Supply 4 8 Removing a DC Input Power Supply 4 11 Required Tools 4 11 Removal Procedure 4 11 Installing a DC Input Power Supply 4 16 Required Tools 4 16 Installation Procedure 4 16 Removing and Replacing the Chassis Fan Assembly 4 18 Required Tools 4 22 Removing the Fan Assembly 4 23 Installing the Fan Assembly 4 23 Verifying the Installation 4 2
55. 4 Catalyst 4500 Series Switches Installation Guide m cHAPTER 4 78 14409 08 Contents Replacing Backplane Modules on a Catalyst 4507R or 4510R Switch 4 24 Verify the New Modules 4 30 cHAPTER 5 Troubleshooting 5 1 System Boot Verification 5 2 Problem Solving to the System Component Level 5 3 Using LEDs to Identify Startup Problems 5 4 Troubleshooting the Power Supply 5 6 Troubleshooting Power Problems using Cisco lOS 5 7 Troubleshooting the Fan Assembly 5 8 Troubleshooting Backplane Modules 5 9 Troubleshooting Switching Modules 5 10 Troubleshooting Switching Modules Using Cisco lOS 5 12 Troubleshooting Supervisor Engines 5 13 Troubleshooting Supervisor Engines Using Cisco 105 5 14 Contacting the Cisco Technical Assistance Center 5 16 Serial Numbers 5 17 APPENDIX Specifications A 1 Catalyst 4503 Switch Specifications 2 Catalyst 4506 Switch Specifications A 3 Catalyst 4507R Switch Specifications 4 Catalyst 4510R Switch Specifications A 6 Catalyst 4500 Series Power Supplies A 7 APPENDIX B Repacking a Switch B 1 INDEX Catalyst 4500 Series Switches Installation Guide EUM 78 14409 08 Preface This preface describes the audience organization and conventions of the Catalyst 4500 Series Switches Installation Guide and provides information on how to obtain related documentation and technical assistance Audience Only trained and qualified service perso
56. 409 08 EUN Chapter4 Removing and Replacing FRUs Replacing Backplane Modules on a Catalyst 4507R 45108 Switch Step7 Pull out the module while holding the top left and top right corners See Figure 4 24 lt Note When handling the modules do not touch the chips or the gold edge contacts on the module Figure 4 24 Removing the Module A 4 Step8 Put the replacement module in at roughly 30 degree angle and gently push the module down Make sure you apply force evenly on the left and right See Figure 4 25 130660 Figure 4 25 Seating the Replacement Module Catalyst 4500 Series Switches Installation Guide 428 78 14409 08 130661 Chapter4 Removing and Replacing FRUs Replacing Backplane Modules on a Catalyst 45078 45108 Switch Step9 Make sure the module is fully seated See Figure 4 26 Figure 4 26 Correct Module Seating Good Bad liuunanazannsinnannssunnnn nnnc rin annn N 00000000000000000000000000 130662 Step 10 Push the module toward the back of the chassis and make sure it is clipped in by the levers on both sides S
57. 4409 08 Catalyst 4500 Series Switches Installation Guide m Chapter5 Troubleshooting Troubleshooting Supervisor Engines Table 5 2 Supervisor Engine LEDs continued LED Color State Description ACTIVE Indicates whether the uplink port is active or not Green The port is active Off The port is not active ACTIVE The LED to the right of the uplink ports is used to identify the active supervisor engine in switches with two supervisor engines Troubleshooting Supervisor Engines Using Cisco 105 Connect a terminal to the console port and look for any of the following system messages CAK CHASSIS 3 LINECARDMUXBUFFERTOSUPALIGNMENTWRON G SUPERVISOR 3 MUXBUFFERREADSUPERVISORSELECTIONF AILED CAK CHASSIS 3 TEMPERATURESENSORREADFAILED CAK HW 3 X2IDENTIFICATIONFAILURE CAK HW 3 X2O0UIREGREADFAILURE CAK HWACLMAN 4 CLASSIFCAMPARITYERROR CAK HWACLMAN 4 CLASSIFCAMREPLYPARITYERROR CAK HWACLMAN 4 CLASSIFCAMREQPARITYERROR CAK HWNETFLOWMAN 3 NETFLOWSTOPPED CAK HWNETFLOWMAN 4 FATALERRORINTERRUPTSEEN CAK HWNETFLOWMAN 4 NONFATALPARITYERRORINTERRUPTSE EN CAK IOSMODPORTMAN 4 NFLABSENT IOSMODPORTMAN 4 NFLIDPROMINVALID CAK IOSMODPORTMAN 4 NFLMISMATCH Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Chapters Troubleshooting Troubleshooting Supervisor Engines CAK REDUNDANCY 2 HANDSHAKE TIMEOUT REDUNDANCY 2 POSTFAIL RESET CAK REDUNDANCY 2 INCOMPATIBL
58. 500 Series Switches Installation Guide 78 14409 08 EE Chapter1 Product Overview Supervisor Engines Figure 1 9 Supervisor Engine III WS X4014 STATUS LED RESET button m1 EE Gigabit uplink ports Switch load indicators CONSOLE port Management port Compact Flash port Figure 1 10 Supervisor Engine IV WS X4515 STATUS LED RESET button Gigabit uplink 9 E ports EK Switch load Ethernet indicators management port CONSOLE Compact port Flash port Catalyst 4500 Series Switches Installation Guide i22 78 14409 08 Chapter Product Overview Supervisor Engines Figure 1 11 Supervisor Engine V WS X4516 STATUS LED RESET button MGE mem Gigabit uplink TC EE ports SAS 77509 Switch load Ethernet indicators management port CONSOLE Compact port Flash port Figure 1 12 Supervisor Engine V 10GE WS X4516 10GE CONSOLE port Ethernet STATUS LED management port Compact Flash port button Switch load 10 GE uplink Gigabit SFP indicators ports ports For information about the connectors LEDs and switches located on the front panel of the supervisor engine see these sections e LEDs page 1 24 Gigabit Ethernet Uplink Ports page 1 25 e 10 100BASE T Port page 1 26 Catalyst 4500 Series Switches Installation Guide 78 14409 08 EE Chapter Product Overview Supervisor Engines CONSOLE Port
59. 503 airflow is shown in Figure 1 13 Catalyst 4506 airflow is shown in Figure 1 14 Catalyst 4507R airflow is shown in Figure 1 15 Catalyst 4510R airflow is shown in Figure 1 16 P Caution You must install module filler plates on unused switching module slots to ensure proper airflow Catalyst 4500 Series Switches Installation Guide 78 14409 08 EE Chapter 1 Product Overview Fan Assembly Catalyst 4503 Airflow Figure 1 13 onanaunun maaana 99931995 iaanaa naanaanunr iii 59030940 naaaaaaaunuaunaaana nannnananngganan ouaaanaaunungwauua nmananuaaaaug noo O aaaaaunni o aaa 39909090301 ian naunuaunr 3303093991 o uaaananuaaauaunaa mganaaaaaaaaanaaaa Fan assembly Catalyst 4506 Airflow Figure 1 14 o naaaaaanaununur iamaaaaaauaaa o 3000009909090 nmaaaaaunnanuanu aaaaaananauncsanuaunaaaunauna aaaanannaaununaaunnamnauunnaaunad nmanananannannnujiinnannnannn uaaanaanaaauduns naanaananaunanr niaaanaaana o o o aaaaaunanauuaun o unnunmnuununr
60. Cisco SYSTEMS Catalyst 4500 Series Switches Installation Guide December 2005 Corporate Headquarters Cisco Systems Inc 170 West Tasman Drive San Jose CA 95134 1706 USA http www cisco com Tel 408 526 4000 800 553 NETS 6387 Fax 408 526 4100 Customer Order Number DOC 7814409 Text Part Number 78 14409 08 SS THE SPECIFICATIONS AND INFORMATION REGARDING THE PRODUCTS IN THIS MANUAL ARE SUBJECT TO CHANGE WITHOUT NOTICE ALL STATEMENTS INFORMATION AND RECOMMENDATIONS IN THIS MANUAL ARE BELIEVED TO BE ACCURATE BUT ARE PRESENTED WITHOUT WARRANTY OF ANY KIND EXPRESS OR IMPLIED USERS MUST TAKE FULL RESPONSIBILITY FOR THEIR APPLICATION OF ANY PRODUCTS THE SOFTWARE LICENSE AND LIMITED WARRANTY FOR THE ACCOMPANYING PRODUCT ARE SET FORTH IN THE INFORMATION PACKET THAT SHIPPED WITH THE PRODUCT AND ARE INCORPORATED HEREIN BY THIS REFERENCE IF YOU ARE UNABLE TO LOCATE THE SOFTWARE LICENSE OR LIMITED WARRANTY CONTACT YOUR CISCO REPRESENTATIVE FOR A COPY The following information is for FCC compliance of Class A devices This equipment has been tested and found to comply with the limits for a Class A digital device pursuant to part 15 of the FCC rules These limits are designed to provide reasonable protection against harmful interference when the equipment is operated in a commercial environment This equipment generates uses and can radiate radio frequency energy and if not installed and used in accordance with the instruction ma
61. DODODDDODDDODUDDDDDUDUDU a DODDDODDDUDDODODDDUDDDOUDU BDODDDDODLDDDDUOLDDDODDLDLUDLDUn UODODDDODUDDODUODDOUDUDUUODU DODDDODUODDDOLDDDDODDDDLDUD DODDDDDDODDDDODDDODDDDOUDU UDBODDDOBDDODDDUDUDDOUDUDUUu UDDDDDODDODDODDDODODUODODUDU uaoncunubcDunuucunuunnununu U BDDDDDOLDDUOLDDDDOLDDUDDUDUU o 79482 DDODDDDDDODDDODODDDUDDDOUDU o nonnnoDn nnuununuDDoDDunu o o gt Grounding lu ES Screws M4 Stepb Remove the label that covers the grounding pad Step6 Place the grounding lug against the grounding pad aligning the holes Insert the two screws through the holes in the grounding lug and grounding pad Figure 3 15 and Figure 3 17 Catalyst 4500 Series Switches Installation Guide EZE 78 14409 08 Chapter3 Installing the Switch in a Rack Step 7 Step 8 Step 9 System Ground Connection Guidelines Ensure that the gr
62. E SUPERVISORS CAK REDUNDANCY 2 IOS VERSION CHECK FAIL CAK REDUNDANCY 2 IOS VERSION INCOMPATIBLE REDUNDANCY 2 NON SYMMETRICAL REDUNDANT SYSTE M REDUNDANCY 2 POSTFAIL REDUNDANCY 2 POSTFAIL RESET REDUNDANCY 4 CONFIGSYNCFAIL CAK SUPERVISOR 2 SUPERVISORSEEPROMINVALID SUPERVISOR 3 RETIMERDISABLEFAILED SUPERVISOR 3 RETIMERINITFAILED CAK SUPERVISOR 3 SEEPROMREADFAILED SUPERVISOR 4 INLINEVOLTAGEOUTOFRANGE CAK SUPERVISOR 7 SEEPROMWRITEFAILED SWITCHMANAGER 3 SSOACTIVEPORTACKTIMEOUT CAK SYSMAN 2 POWERONSELFTESTFAIL These system messages indicate a problem with the supervisor engine Some problems will prevent a console connection and will not allow you to use messages in diagnosing a problem If you are unable to establish a terminal connection and the STATUS LED is red contact Cisco TAC immediately to order a replacement Problems with redundant supervisor systems are often due to mismatched active and standby supervisor engines Redundancy requires that both supervisor engines be the same model and running the same Cisco IOS release If one supervisor has a NetFlow service card the other must as well Some problems with supervisor engines are due to backplane connections that are not fully seated If removing and reinserting the supervisor engine and then restarting the switch does not solve the problem call Cisco TAC and replace the supervisor engine 78 14409
63. E T Gigabit Ethernet switching module WS X4448 GB RJ45 24 port IEEE 802 3af compliant PoE 10 100 1000BASE T RJ 45 switching module WS X4524 GB RJ45 V 48 port 10 100 1000BASE T Gigabit Ethernet switching module WS X4548 GB RJ45 48 port Gigabit Ethernet switching module WS X4448 GB SFP 48 port IEEE 802 3af compliant PoE 10 100 1000BASE T Gigabit Ethernet switching module WS X4548 GB RJA5V Access Gateway Module WS X4604 GWY Backplane channel module WS X4019 1 You will need to configure the 1400 W DC input current as appropriate for the model of switch Refer to Appendix A Specifications 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Chapter1 Product Overview Switch Features Catalyst 4506 Switch Features The Catalyst 4506 switch see Figure 1 2 is a six slot switch designed for high performance high density wiring closet applications Figure 1 2 Catalyst 4506 Switch Front View Power supplies Supervisor engine slot 1 Switching modules slots 2 through 6 7 Fan assembly
64. Engines and Switching Modules Installation Note Some supervisor engines use SFP modules m Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter Product Overview Switch Features for Gigabit Ethernet connections or X2 modules for 10 Gigabit Ethernet connections Refer to the installation note for your supervisor engine for more details on these modules Slot 1 is reserved for the supervisor engine only which provides switching local and remote management and switch status monitoring Slots 2 through 6 are available for switching modules Table 1 2 describes the features of the Catalyst 4506 switch Table 1 2 Features of the Catalyst 4506 Switch Feature Description Ethernet speeds e Ethernet LOBASE T interface to workstations and repeaters e Fast Ethernet 100 interface to workstations servers switches and routers Note Autonegotiation of link speed on each 10 100 port allows migration to from a IOBASE T installed base Gigabit Ethernet 1000BASE T and 1000BASE X interfaces for backbone interconnection of high performance switches and routers e 10 Gigabit Ethernet interfaces for backbone interconnection of high performance switches and routers Standard equipment e Six slot modular chassis with one slot reserved for a supervisor engine and five slots for switching modules One hot swappable fan assembly Two power supply bays
65. IAL CONSEQUENTIAL OR INCIDENTAL DAMAGES INCLUDING WITHOUT LIMITATION LOST PROFITS OR LOSS OR DAMAGE TO DATA ARISING OUT OF THE USE OR INABILITY TO USE THIS MANUAL EVEN IF CISCO OR ITS SUPPLIERS HAVE BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES CCSP CCVP the Cisco Square Bridge logo Follow Me Browsing and StackWise are trademarks of Cisco Systems Inc Changing the Way We Work Live Play and Learn and iQuick Study are service marks of Cisco Systems Inc and Access Registrar Aironet ASIST BPX Catalyst CCDA CCDP CCIE CCIP CCNA CCNP Cisco the Cisco Certified Internetwork Expert logo Cisco IOS Cisco Press Cisco Systems Cisco Systems Capital the Cisco Systems logo Cisco Unity Empowering the Internet Generation Enterprise Solver EtherChannel EtherFast EtherSwitch Fast Step FormShare GigaDrive GigaStack HomeLink Internet Quotient IOS IP TV iQ Expertise the iQ logo iQ Net Readiness Scorecard LightStream Linksys MeetingPlace MGX the Networkers logo Networking Academy Network Registrar Packet PIX Post Routing Pre Routing ProConnect RateMUX ScriptShare SlideCast SMARTnet StrataView Plus TeleRouter The Fastest Way to Increase Your Internet Quotient and TransPath are registered trademarks of Cisco Systems Inc and or its affiliates in the United States and certain other countries All other trademarks mentioned in this document or Website are the property of their respective owners The use of the wo
66. MP and console Telnet interface MAC addresses supported 32 768 per system Cisco IOS VLANS Up to 4 096 VLANs with IEEE 802 10 VLAN tagging on all ports and VLAN Trunking Protocol VTP Port aggregation PAgP for 100 Mbps and 1000 Mbps EtherChannel SNMP Full implementation including entity MIB all relevant standard MIBs and all relevant Cisco MIBs RMON The first four groups Ethernet statistics Alarms Events and History are on a per port basis without an optional RMON processing module SPAN Supported which allows you to redirect traffic from any port or VLAN to a SPAN destination port Performance management Information provided Catalyst 4500 Series Switches Installation Guide EN 78 14409 08 Chapter Product Overview Table 1 5 Feature Supervisor Engines MI Supervisor Engine Features continued Description Hot swappable Supported On non redundant systems packets are not forwarded while the supervisor engine is removed and a system reboot occurs when a supervisor engine is reinserted Gigabit Ethernet using a GBIC or SFP Includes two four on WS X4516 10GE and WS X4013 10GE Gigabit Ethernet 1000BASE X interfaces for backbone interconnection of high performance switches and routers 10 Gigabit Ethernet WS X4516 10GE and WS X4013 10GE Includes two 10 Gigabit Ethernet interfaces for backbone interconnection of high performance switches and r
67. Max Output Power Input Approximate Approximate Input Approximate Input Number Input Current Power 40 5 V Power 44 V DC 1 6 25 A 253 W 275 W 40 5 44 V DC 2 7 5 40 5 1304 W 330 W 44 V DC 3 7 5 40 5 304 W 330 W 44 V DC Note In a redundant configuration with all inputs supplied there must be a 100 W minimum system load or the OUTPUT FAIL LED shows a false failure The C4500 1400 W DC Triple Input SP Power Supply requires a minimum draw from the system that it is installed in Table 1 11 shows 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Chapter 1 Product Overview Power Supplies Table 1 11 Minimum Load Table PSU1 PSU2 12V 3 3V Minimum Minimum Input 1 Input2 Input 1 Input2 jInput3 Load Load Single Operation Mode 1 JON OFF OFF 1 33A 0 6A Mode 2 OFF ON OFF _ _ _ 1 33A 0 6A OFF OFF ON 1 33A 0 6A Mode 3 JON ON OFF _ _ 2 66 0 6A ON OFF ON 2 66 0 6A Mode 4 OFF ON ON 2 66 0 6A Mode 5 ON ON ON 4A 0 6A Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter1 Product Overview Power Supplies Table 1 11 Minimum Load Table continued PSU1 PSU2 12V 3 3V Minimum Minimum Input 1 Input2 Input 1 Input2 jInput3 Load Load Dual Redundant Operation Mode 1 JON
68. OFF OFF ON OFF OFF 2 66A 1 2A Mode 2 OFF ON OFF OFF ON OFF 2 66A 1 2A OFF OFF ON OFF OFF ON 2 66A 1 2A Mode 3 ON ON OFF ON ON OFF 5 32A 1 2A ON OFF ON ON OFF ON 5 32A 1 2A Mode 4 OFF ON ON OFF ON ON 5 32A 1 2A Mode 5 ON ON ON ON ON ON 8A 1 2A 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Chapter1 Product Overview System Architecture System Architecture This section describes the interaction between the various system components of Catalyst 4500 series switches A Catalyst 4503 only is shown in the examples Power Flow Figure 1 21 shows power ingress and flow through the system Figure 1 21 Power Flow Ingress to PS Ingress to PS PS1 PS2 Fan r tray AREE EM i Supervisor engine Switching module vY Y Switching module Backplane 2 MTH 3 12V 83V 48 V Power enters the switch through the power supplies Several types of power supplies are available depending on the power needs for your system and the power type available on your site All power supplies provide a 3 3 V circuit shown as a dash dot line to the components on the backplane and a 12 V circuit shown as a solid line that is carried over the backplane to the fans supervisor engine and switching modules Power supplies that support PoE 1300 W AC Catalyst 4500 Se
69. OUODUDODOU DDODDDDDDODDDODODDDUDDDOUDU DDODDODDODDODODDODDODOUDU ODDDODDODDODDDDDODODDODUDUDU uunDDDDDODDDDDDODDDDDDDDUDU uaoncnunubcunun ucun uununununu 68110 The Catalyst 4507R switch supports the Supervisor Engine 106 IV V and V 10GE The supervisor engine has two Gigabit Ethernet ports and a nonblocking full duplex switching fabric that provides connections between the supervisor engine and the switching modules The Gigabit Ethernet ports can be configured with any combination of copper 1000BASE T shortwave SX LX LH and ZX interfaces CWDM and DWDM GBICs For a description of GBICs refer to the Catalyst 4000 Series Module Installation Guide or the Catalyst 4500 Catalyst 4500 Series Switches Installation Guide EZE 78 14409 08 Chapter Product Overview Switch Features Series Supervisor Engines and Switching Modules Installation Note Some supervisor engines
70. S For more information on this command refer to the command reference publication for your switch If the LEDs or the show system command Catalyst Operating System or the show power command Cisco IOS output indicate a power problem or other system problem see Chapter 5 Troubleshooting for more information Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Chapter4 Removing and Replacing FRUs Removing and Replacing the Power Supply Removing a DC Input Power Supply This section describes how to remove a DC input power supply Required Tools You will need the following tools to perform this procedure e A Phillips screwdriver 10 mm wrench socket Removal Procedure A Warning Before performing any of the following procedures ensure that power is removed from the DC circuit Statement 1003 Follow these steps to remove a DC input power supply Step 1 Turn off the in line power switch Single input only The triple input power supply does not have this switch Step2 Turn off the main power switch Step3 Verify that power is off to the DC circuit on the power supply you are removing Step4 Loosen the screw on the terminal block cover and remove it from the terminal block see Figure 4 11 or Figure 4 12 The triple input power supply has two screws on the cover Catalyst 4500 Series Switches Installation Guide 78 14409 08 EXIN Chapter4 Removing and Rep
71. Switch in the Rack uuuuuunuubDnuDoununu ee D DDODDODUDUDDDDUDU Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Installing the Switch in a Rack Rack Mounting the Switch Chapter3 Installing a Catalyst 4506 Switch in the Rack Figure 3 10 18167 o aanaanannaaannaunaunauunanaa o o unanunnuununnauunauuannnauununa naaaaauanaaaunanaaununnaaunnaana naanaaananananaauaunnaaunanaa uaaaaananauauaaaaunaaauaaana nmnnaaaanannnaananuaaaanananaamn o unaq a nanaaaaaaaaadaaannuaaaaaunauuu o o mananaaaauaunanunuunuaunuuaununa o nanaaanannaanaananaanannanuanmn O un Fa ua nmaaaaananaanaaaaaanununuaaaaa
72. T m varoitusmerkki merkitsee vaaraa Tilanne voi aiheuttaa ruumiillisia vammoja Ennen kuin k sittelet laitteistoa huomioi s hk piirien k sittelemiseen liittyv t riskit ja tutustu onnettomuuksien yleisiin ehk isytapoihin Turvallisuusvaroitusten k nn kset l ytyv t laitteen mukana toimitettujen k nnettyjen turvallisuusvaroitusten joukosta varoitusten lopussa n kyvien lausuntonumeroiden avulla S ILYT N M OHJEET Catalyst 4500 Series Switches Installation Guide 78 14409 08 EN Preface Conventions Attention IMPORTANTES INFORMATIONS DE S CURIT Ce symbole d avertissement indique un danger Vous vous trouvez dans une situation pouvant entrainer des blessures ou des dommages corporels Avant de travailler sur un quipement soyez conscient des dangers li s aux circuits lectriques et familiarisez vous avec les proc dures couramment utilis es pour viter les accidents Pour prendre connaissance des traductions des avertissements figurant dans les consignes de s curit traduites qui accompagnent cet appareil r f rez vous au num ro de l instruction situ la fin de chaque avertissement CONSERVEZ CES INFORMATIONS Warnung WICHTIGE SICHERHEITSHINWEISE Dieses Warnsymbol bedeutet Gefahr Sie befinden sich in einer Situation die zu Verletzungen f hren kann Machen Sie sich vor der Arbeit mit Ger ten mit den Gefahren elektrischer Schaltungen und den blichen Verfahren zur Vorbeugung vor Un
73. The TAC Service Request Tool is located at this URL http www cisco com techsupport servicerequest For S1 or S2 service requests or if you do not have Internet access contact the Cisco TAC by telephone S1 or S2 service requests are those in which your production network is down or severely degraded Cisco engineers are assigned immediately to S1 and S2 service requests to help keep your business operations running smoothly To open a service request by telephone use one of the following numbers Asia Pacific 61 2 8446 7411 Australia 1 800 805 227 EMEA 32 2 704 55 55 USA 1 800 553 2447 For a complete list of Cisco TAC contacts go to this URL http www cisco com techsupport contacts Definitions of Service Request Severity To ensure that all service requests are reported in a standard format Cisco has established severity definitions Severity 1 S1 Your network is down or there is a critical impact to your business operations You and Cisco will commit all necessary resources around the clock to resolve the situation Severity 2 S2 Operation of an existing network is severely degraded significant aspects of your business operation are negatively affected by inadequate performance of Cisco products You and Cisco will commit full time resources during normal business hours to resolve the situation Severity 3 S3 Operational performance of your network is impaired but most business operatio
74. a Rack Chapter3 L Brackets on the Front Edge of the Catalyst 4510R Switch Figure 3 4 o Baanaauaanauunauauuanauauanaauaanuuunanu o aaaanaaaunaunanaaanaaaaaaaaaaaauaaaunuaa anaaaannaaauananaananaaunanaaanaaauunana naaaaaaaaannunuananauaaaaauuauaaaaaaaaaaauna uaaaauanaaauaaananaaaaaauunaaaauanaaauaunaaa aaauaaaaanauaaaaanaaaaauaaaaaaaaaaaaaana aaaaannaaaunnnaunuunnaaunanaaunnanauunana aaaaaggaaaauauauuuusaauaaaaaaaucguauaaua a a a a a a a a Sa a 9 aaaaananaaanaaauaanaaaaaanaaannaaaaanaana I 1 I nuanacanaunaunnuuurauaauununnuannauuauunua naanaaaaanauunanuuguaaaaaaunaaunnanauauaua naaacaananuunuunucoauanauunuununcaauauuaunna naoaunaaanaaauauaananuauuaauncauaaaaauana nnrannnnnnnnnnnrnnnnmnmumrnmumm nmuuunm 0 0 0 0 0 0 0 TO TORIC CD CRC T uuaaqaauaqqaapiaqiiuquaqqiquqriqq qquqqquaqq e e e e using the M3 screws provided in the cable if needed management
75. aaaaaaanananaunannaaaaunaaaaaaanaaaauana aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaanana aaannamnannauanaunnanannanuanaunananununana o naaaananaunanaunnaununaunnunaununaunununa naaaanaaannnnaaaaanaanaaaananaaaananaana uaaananaanaunnunnaunanaununnananaunaunanna nagaaannanaannanananaannananaaaananaaaanaa nmaaaaaaaaanaanauaaaaaaaunanaaaaanaaaaaaa naaaanaaannnmnaaaaananaauaananaaaananaaaa o anananannannananaunaunaunanananaunnananamn o Catalyst 4500 Series Switches Installation Guide 78 14409 08 APPENDIX Specifications Cable and technical specifications for Catalyst 4500 series switches are provided in the following sections Catalyst 4503 Switch Specifications page A 2 Catalyst 4506 Switch Specifications page A 3 Catalyst 4507R Switch Specifications page A 4 Catalyst 4510R Switch Specifications page A 6 Catalyst 4500 Series Power Supplies page A 7 Note Specifications for individual switching modules and supervisor engines including power consumption and thermal output information are in the Catalyst 4500 Series Module Installation Guide available online at http www cisco com univercd cc td doc product lan cat4000 hw doc mod inst index htm 78 14409 08 Catalyst 4500 Series Switches Installation Guide m AppendixA Specifications
76. aacdaaaa naaaaeceaaaaaaaaaanaaesdaaaa 1 1 9 unaumaaaaaunnuuuunnanuuunu o dauananaanaaaaaaacaagaunna naucaaaaaaaaaaaamaaaauaana 0 0 0 Q Q a SOOT Oo TOU aqc aaaaaeaaaaanuauaaaacuan o Waaannaenananenannanenan e Catalyst 4500 Series Switches Installation Guide 78 14409 08 Rack Mounting the Switch Installing the Switch in a Rack Chapter3 Attaching the Cable Guide to the Catalyst 4510R Switch Figure 3 8 o danananaananaunnaunaunnununaunanauununannmn o aaaaaaaauaaaanaauaauaaaaauanaaaauaaauauna aaaaannaaannnauaunnaaunanaaunnaanaununana aaaaauanaaaunanaunnuaunaauunanaaunnaaaunauna naaaaaaaaaaaannnauaaaaanaaannaaaaauauna naaaaaaaaaaaaunnauaaaaanaaaaaaaaaaanauna nmaaaauanaunaunauuucuaaauuaauauaaauaaaauaa uaaaaaaaunaaauanaauaaaaaaaaauaagaaaaauana n anaannannaananncanananaaananrianaanana uaaaaudaaaauunauosauaau
77. aaunnaug onnauaun 399999 399099 pnnaaaunannuunanaunnunnuuun innuaaaaauauuauuuuuuuuun 2000000 iaaanaaanaauanauaaaaunauanuu miw win rgiaaaaaanaaaaaaaaauaunuuanr nanananannmananaanauananaaananaunuanunan anaaaannacggaunannununnaaunnanaaunnnaaunngauna naanaaaadgaaaaununaaaaaaaaanaaaanu iaa aanauur iaG auaaaaaaaaaaaaaaaanu aaaaa0 aana D00000 huaaaaaanaaaaaaaaauannu WOOO anna i13aanaaaaaaananuuaunauant hnaaa 399903 ianua an Vaa Yon Y aaaaannaaaunaaunaunaauannnauaanaaaunaana o aanaananaaaannauaaaanaaanaaaaaaaaaanaana o Fan assembly Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter Product Overview Power Supplies Power Supplies Note For detailed specifications on all Catalyst 4500 series power supplies refer to the Catalyst 4500 Series Power Supplies section on page A 7
78. ached devices such as IP phones wireless base stations video cameras and other IEEE compliant appliances can use power provided by the PoE line cards This capability gives network administrators centralized control over power and eliminates the need to install outlets in ceilings and other out of the way places where a powered device may be installed Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter1 Product Overview System Architecture Although references to PoE inline power and voice power supplies and line cards are synonymous there are only two versions Cisco prestandard and IEEE 802 3af compliant Every Cisco Catalyst 4500 series chassis and PoE power supply supports the IEEE 802 3af standard and the Cisco prestandard power implementation ensuring backward compatibility with existing Cisco powered devices All IEEE 802 3af compliant line cards can distinguish an IEEE or Cisco prestandard powered device from an unpowered network interface card NIC ensuring that power is applied only when an appropriate device is connected All PoE line cards can distinguish an IEEE or Cisco prestandard powered device from an unpowered network interface card NIC to ensure power is applied only when an appropriate device is connected With a Cisco PoE network administrators can depend on a robust network that is safe to deploy and simple to maintain Deploying PoE on the Cisco Catalys
79. acting the Cisco Technical Assistance Center 105727 Catalyst 4500 Series Switches Installation Guide H Chapter 5 Troubleshooting Contacting the Cisco Technical Assistance Center Catalyst 4506 Serial Number Location Figure 5 4 62190 aaaaaanaaaaaaaanaannaaunauna o ananaannannaaunnnauununnauanunna aaaaannaaaannanaunaaaunauna aaaaannaaaunaaaaunnaaunnauna naanaanannanannaaaunaauananaa nmannnanannannnannanannnannn o aananaaaaaaaaaananauanauaaunuaa naaaaaaaaaaaaaaaaaaaaaaaaaaa o o o o o o o nmnannanaaannnnaannannaannnnnan 9 naaunaunaunaunununuanunaunuauua naaaaaaaaadaaaaaaaaaaaaaaaaa aaaanaaaanuaannunuaanauunauunuauaa naaaaaaananaaanaanaaauaunaauaa o unaaaaaaaaaaaaaaaaaaaaaaaaa manaaaaauauanaaaaaaaanaaaaaa Catalyst 4500 Series Switches Installation Guide 78 14409 08 Troubleshooting Contacting the Cisco Technical Assistance Center Chapters Catalyst 4507R Serial Number Location Figure 5 5 08 901 o aanananaanananaunnananana o aaaaannaaaunnnunaunnaaunna nanaaaannauaaunnaanununauuuna aaaaannaaannaununnauunna
80. allation Note Some supervisor engines use SFP modules for Gigabit Ethernet connections or X2 modules for 10 Gigabit Ethernet connections Refer to the installation note for your supervisor engine for more details on these modules Catalyst 4500 Series Switches Installation Guide EN 78 14409 08 Chapter Product Overview Switch Features Slot 1 is reserved for the supervisor engine only which provides switching local and remote management and switch status monitoring Slots 2 and 3 are available for switching modules Table 1 1 describes the features of the Catalyst 4503 switch Table 1 1 Features of the Catalyst 4503 Switch Feature Description Ethernet speeds Ethernet ITOBASE T interface to workstations and repeaters Fast Ethernet LOOBASE T interface to workstations servers switches and routers Note Autonegotiation of link speed on each 10 100 port allows migration to 100BASE T from a IOBASE T installed base Gigabit Ethernet 1000BASE T and 1000BASE X interfaces for backbone interconnection of high performance switches and routers e 10 Gigabit Ethernet interfaces for backbone interconnection of high performance switches and routers Standard equipment Three slot modular chassis with slot reserved for a supervisor engine and two slots for switching modules One hot swappable fan assembly Two power supply bays Power supplies e Supports a 1000 W 1300 W
81. anana o aaananaaaaanaaaaanaaaaanaaaaaaaaannaanma o Captive installation Screws Required Tools You will need a Phillips screwdriver for the following two procedures Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter4 Removing and Replacing FRUs Removing and Replacing the Chassis Fan Assembly Removing the Fan Assembly Warning When removing the fan tray keep your hands and fingers away from the spinning fan blades Let the fan blades completely stop before you remove the fan tray Statement 258 A Caution Never operate the system for an extended period if the fan assembly is removed or if it is not functioning properly An over temperature condition can cause severe equipment damage Follow these steps to remove the existing chassis fan assembly Step 1 Loosen the two captive installation screws on the fan assembly by turning them counterclockwise Step2 Grasp the fan assembly with both hands and pull it outward gently move it side to side if necessary to unseat it from the backplane Slide it out of the chassis and place it in a safe place Installing the Fan Assembly Follow these steps to install the new fan assembly Step 1 Hold the fan assembly with the fans facing to the right Step2 Place the fan assembly into the fan assembly bay so it rests on the chassis and then lift the fan assembl
82. and air conditioned environment To ensure normal operation maintain ambient airflow If the airflow is blocked or restricted or if the intake airis too warm an overtemperature condition can occur The switch environmental monitor can then shut down the system to protect the system components To ensure normal operation and avoid unnecessary maintenance plan your site configuration and prepare your site before installation After installation make sure the site maintains an ambient temperature of 0 to 40 C 32 to 104 F It is essential to keep the area around the chassis as free from dust and foreign conductive material such as metal flakes from nearby construction activity as is possible Multiple switches can be rack mounted with little or no clearance above and below the chassis However when mounting a switch in a rack with other equipment or when placing it on the floor near other equipment ensure that the exhaust from other equipment does not blow into the intake vent of the chassis Cooling air is drawn in through the right side of the chassis Keep the right side clear of obstructions including dust and foreign conductive material and away from the exhaust ports of other equipment Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Chapter2 Preparing for Installation Ventilation Appendix A Specifications lists the operating and nonoperating environmental site requirements for the sw
83. auna naanaaannnunannaununauunanaa 4 Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter 3 Installing the Switch in a Rack the Switch Installing a Catalyst 45078 Switch in the Rack Figure 3 11 91189 aaunnnnannuunuunuunaaannnn o mauanaanaaanaunanuaunaunaua aaaaannaaaunaununaunnauaunna aaaaannaaaunaanaannaaunna anaaaannaaaunaaananunnaaunna auauananaunaananaunananann aaaaannaaaunaununuannauunnna aaaaaaaaaaaaanaaaaaaaaana naaaaaaanauaaaaaaunauaadaaua aanaaanaananunnaaununnaununa DOODOOOOOOOOODOOOOOOOOOOO o aanaaaananauaanaaaununaununa aannaananannnananuununuann aanaaananaanuanaaauunnanuna Q g e Em gu Pen 288 Catalyst 4500 Series Switches Installation Guide 78 14409 08 Rack Mounting th
84. aunanaaannaa aanaaananaaannaanauanannananaaaunnauaaunnaa aanaaaaanaaannaaaanannuananaaauannaaaunna nauaaaaaaaaaaunnnaunaaaaanauunnaaaunaaaauna e o aaaaaaaaaaaaaaaaaaaaaanaaaaaaaaaaaaaaaa Grounding Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter3 Installing the Switch in a Rack System Ground Connection Guidelines Parts and Required Tools amp Note Some parts and required tools described in this section are not available from Cisco Systems The grounding lug and associated screws are included with the accessory kit To make an adequate grounding connection you will need the following parts and tools e Grounding lug The grounding lug has two 10 AWG holes spaced 0 63 in center to center A Panduit LCDX6 10A L or Pencom EL1033 lug may be used if the lug from the accessory kit has been misplaced Two M4 metric hex head screws One grounding wire 6 AWG recommended The length of the grounding wires depends on the location of your switch within the site and its proximity to proper grounding facilities e Number 2 Phillips screwdriver e Crimping tool This tool must be large enough to accommodate the girth of the grounding lug when you crimp the grounding cable into the lug e Wire stripping tool Catalyst 4500 Series Switches Installation Guide EZE 78 14409 08 Chapter3 Installing the Switch in a Rack
85. cations Figure 1 1 Catalyst 4503 Switch Front View Power supplies Supervisor engine slot 1 Switching modules slots 2 and 3 porrot O HEDODBBHEUEEODER nonununboubDunuuununuuOo oUUBDBDDODDDDUDUDD UBDBODDDBODDDDDUDUn UDDDDDDODDDODUDn 77980 ng oBBBDBBOBDOBDODUDUDBU Fan assembly The Catalyst 4503 switch supports the Supervisor Engine II IT TS 106 IV V and V 10GE The supervisor engine has a nonblocking full duplex switching fabric that provides connections between the supervisor engine and the switching modules The Gigabit Ethernet ports can be configured with any combination of copper 1000BASE T shortwave SX LX LH and ZX interfaces or CWDM and DWDM GBICs For a description of GBICs refer to the Catalyst 4500 Series Module Installation Guide or the Catalyst 4500 Series Supervisor Engines and Switching Modules Inst
86. ch that has two power supplies the redundant power feature causes the second power supply to produce full power 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter Product Overview Power Supplies To replace a power supply see the Removing and Replacing the Power Supply section on page 4 2 Power Supply LEDs Table 1 7 describes the power supply LEDs Table 1 7 Power Supply LEDs LED Color State Description INPUT OK Indicates whether the input voltage is within the required range Green Input voltage is within the required range Flashing Input voltage is present but is below required range Off Input voltage is below the required range or the power supply is off OUTPUT FAIL Red Output voltage is not within the specified range Off Output voltage is within the specified range FAN OK Indicates the status of the power supply fans Green The fans are operational Off The fans are not operational In line PWR for Green 48 V passthru output voltage is enabled and is greater than 1400 W DC single 39 V and less than 60 V input power supplies Off Indicates any of the following Passthrough breakers are not enabled DC input is less than 40 5 V One or more 48 V outputs is less than 39 V Amber Passthru breakers are enabled and input voltage exceeds 60 V Catalyst 4500 Series Switches Installation Guide EZE 78 14409 08 Chapter1
87. ction which often requires rack rewiring Management Flow Figure 1 22 shows management and status information flow through the system Figure 1 22 Management Flow PS1 PS2 Fan tray Supervisor engine Switching module Switching module Backplane Terminal 8 Each system component has that identifies it to the supervisor engine over a serial connection on the backplane which also passes along information like temperature fan speed power draw per slot and port and port activity LED status information is also sent to the supervisor engine which makes it available to an administrator through a terminal connection or management software All Catalyst 4500 series switches support e Hardware based multicast Protocol Independent Multicast PIM Internet Group Management Protocol IGMP Catalyst 4500 Series Switches Installation Guide 78 14409 08 a 145 Chapter Product Overview System Architecture Cisco Group Management Protocol support standards based and Cisco technology enhanced efficient multimedia networking Simple Network Management Protocol SNMP CiscoWorks which can manage critical network characteristics such as availability responsiveness resilience and security Cisco NetFlow Services The Cisco NetFlow Services Card for the Supervisor Engine IV and V support statistics capture in hardware for flow ba
88. d Options continued Locale Part Number Length Plug Rating Plug Type Italy CAB 7KACI 8ft 2 5m 250 VAC 16A 1 3 16 CEI 23 16 United CAB 7KACU 8ft 2 5m 250 VAC BS 89 13 Kingdom BS 1363 A Argentina CAB 7KACR 8ft 2 5m 250 VAC 10 IRAM 2073 c 8 Appliance Coupler Z e 1300 W PWR C45 1300ACV and 8 1400 W PWR C45 1400AC Power Supplies T North America CAB 7513AC 14 ft 4 3 125 VAC 20 NEMA 5 20 Australia CAB 7513ACA 14 ft 4 3 250 VAC 15 SAA 3 New Zealand AS NZZS 3112 1993 Europe except CAB 7513ACE 14 ft 4 3 250 16 CEE 7 7 Italy 99 8 SD 8 Catalyst 4500 Series Switches Installation Guide 78 14409 08 EN Chapter2 Preparing for Installation Power Connection Guidelines for AC Powered Systems Table 2 1 AC Input Power Cord Options continued Locale Part Number Length Plug Rating Plug Type Italy CAB 7513ACI 14 ft 4 3 250 16A 1 3 16 CEI 23 16 United CAB 7513ACU 14 ft 4 3 250 13A BS 89 13 Kingdom BS 1363 A Argentina CAB 7513ACR 14 ft 4 3 250 10 120356 North America CAB AC 2800W TWLK 14 ft 4 3 m 250 VAC 16 A locking 200 240 VAC operation 120361 North America CAB AC 2800W 6 20 14 ft 4 3 m 250 16 A NEMA 6 20 non locking non locking 200 240 VAC operation T Europe CAB AC 2800W EU 14
89. e WS X4248 RJ21V 32 port 10 100 Mbps Fast Ethernet plus 2 port Gigabit Ethernet switching module WS X4232 GB RJ e 32 port 10 100 Mbps Fast Ethernet plus 2 port 1000BASE X Layer 3 Gigabit Ethernet routing module WS X4232 L3 Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Chapter Product Overview Switch Features Table 1 4 Features of the Catalyst 4510R Switch continued Feature Description Switching module 32 port 10 100 Mbps Fast Ethernet switching module with modular uplink support continued support WS X4232 RJ XX 4 port MT RJ uplink module WS U4504 FX MT optional e 2 port Gigabit Ethernet switching module WS X4302 GB e 6 port 1000BASE X Gigabit Ethernet switching module WS X4306 GB e 6 port Gigabit Ethernet switching module WS X4506 GB T e 12 port I000BASE T plus 2 port 1000BASE X Gigabit Ethernet switching module WS X4412 2GB T e 18 port Gigabit Ethernet switching module WS X4418 GB 24 port 10 100 1000B ASE T Gigabit Ethernet switching module WS X4424 GB RJ45 e 48 port Gigabit Ethernet 1000 BASE LX SPF switching module WS X4448 GB LX 48 port 10 100 1000BASE T Gigabit Ethernet switching module WS X4448 GB RJ45 24 port IEEE 802 3af compliant PoE 10 100 1000BASE T RJ 45 switching module WS X4524 GB RJ45V 48 port 10 100 1000BASE T Gigabit Ethernet switching module WS X4548 GB RJ45 48 port Gigabit Ethernet swi
90. e Catalyst 4500 Series Switch Cisco IOS Software Configuration Guide version appropriate for your software Knowing the power requirements is useful for planning the power distribution system needed to support the switches You should consider the heat dissipation specifications when estimating the air conditioning requirements for an installation For all Catalyst 4500 series switches supervisor engines and switching modules in AC or DC environments see the Catalyst 4500 Series Module Installation Guide at http www cisco com univercd cc td doc product lan cat4000 hw doc mod inst Oaspecs htm wp1012188 Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter2 Preparing for Installation Power Connection Guidelines for AC Powered Systems Power Connection Guidelines for AC Powered Systems This section provides guidelines for connecting the Catalyst 4500 series switch AC power supplies to the site power source Basic guidelines include the following Make sure each chassis power supply has its own dedicated branch circuit Size the circuits according to local and national codes If you are using a 200 240 VAC power source in North America use a two pole circuit breaker to protect the circuit Place the source AC outlet within 6 feet 1 8 meters of the system and make sure it is easily accessible Make sure the AC power receptacles used to plug in the chassis are the grounding type The groundin
91. e Switch Installing the Switch in a Rack Chapter3 Installing a Catalyst 4510R Switch in the Rack Figure 3 12 Ov6v6 o daunnaunnuununauanaunuuuanauuauaaauuaunaunnu o maanaanaaaauaunnaunaauuanaaanauaaanauaaaaaaunuaa nanaaaaaaaaaaananaauuuuuuuuuuuaaaaaaaaaunuu naaaaaaauannaaunnauaaaaauuuaaaaaaauaaaaauna naaaaaaaaaaaanaauaaaaauuaaaaaaaaaaauuu aca aaaaannaaaunnaauuunnauunanuaanunaauunnana aaaaaaaauauaanauaaaaaaaaaaaaaaaaaaaaaa ganaannanaananunananaaunmananannanaannnna aaaaaanaaauanaunaunaaauananaaunnaaauanana aaaaaanaaaanaauaanaaaaananaaanaaaaanana aanaaannaanananaununaaunananaaunnaaunanauna aanaaananaaaanauanauanauananaauanaaaauunaua ica mmn o daunnaunanuuaaanaunauaununuuanaaaunauannnn o maaanaauanaunanaaanaaaanaaaaaanauaauaunuaa aanaaananaaunaunaaunanaanunaaaunnauaunana ananaaauanaaanaunaauaauauanaaauanauauaada naanaaananaaanaanaauuanaananaaaunnaaunanaa aaaaaaaauaaaaaaaaaauuuuununaaaaaaaaauaauua nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnan Make sure that the ejector levers are completely closed and the supervisor engine and switching modules are installed securely Step 4 Tighten any loose captive installation screws on the supervisor engine and the switching module Step 5 Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter3 Installing the Switc
92. e at http www cisco com en US products hw switches ps4324 products modul e installation guide book09186a008009c17d html for information about individual switching modules and supervisors Regulatory Compliance and Safety Information for the Catalyst 4500 Series Switches at http www cisco com en US products hw switches ps4324 products regula tory approvals and compliance09186a200800d7676 html The release note appropriate to your software version Release notes are at http www cisco com en US products hw switches ps4324 prod release no tes list html The software configuration guide appropriate to your software version Software configuration guides are at http www cisco com en US products hw switches ps4324 products install ation and configuration guides list html The command reference appropriate to your software version Command references are at http www cisco com en US products hw switches ps4324 prod command reference list html Catalyst 4500 Series Switches Installation Guide mua 78 14409 08 Preface Conventions The system message guide appropriate to your software version System message guides are at http www cisco com en US products hw switches ps4324 products system message guides list html There are a number of installation notes and technical tips available for this switch The top level Catalyst 4500 documentation and technical support page is at http www cisco com en US products
93. ed Item Specification Power supply output 2473 W maximum 1360 W 40 W redundant mode Data Power supply output AC supply 12 V 113 4 A 3 3 V 12 2 A Data Max heat dissipation 1048 BTUs hr Output holdup time 20 ms minimum 1 A Catalyst 4503 with a Catalyst 4500 series Supervisor Engine II Plus TS and 1400W AC power supply provides 158 4 W of to ports on the supervisor engine Switching modules in other slots will not be able to provide PoE A Caution Do not mix the 1400 W DC power supply with any other power supply even for a hot swap or other short term emergency Doing so can seriously damage your switch The 1400W DC Input power supply may be used with the Catalyst 4500 Series AC Power Shelf Documentation for the Catalyst 4500 Series AC Power Shelf is at http www cisco com univercd cc td doc product lan cat4000 inst nts 78 1506 8 htm Table A 8 1400 W DC Input Power Supply Specifications Item Specification Minimum software requirement Cisco IOS Release 12 1 19 EW Catalyst Operating System software version 7 5 1 Power over Ethernet Supported up to 7500 W minus power consumed for data 240 Cisco phones in combined mode DC input voltage Data only 48 to 60 VDC Inline devices 48 to 56 VDC Catalyst 4500 Series Switches Installation Guide EXIN 78 14409 08 AppendixA Specifications Table A 8 Catalyst 4500 Series Power Supplies 1400 W DC Input Power Suppl
94. ed Cisco com users can order technical documentation from 8 00 a m to 5 00 p m 0800 to 1700 PDT by calling 1 866 463 3487 in the United States and Canada or elsewhere by calling 011 408 519 5055 You can also order documentation by e mail at tech doc store mkpl external cisco com or by fax at 1 408 519 5001 in the United States and Canada or elsewhere at 011 408 519 5001 Catalyst 4500 Series Switches Installation Guide 78 14409 08 Preface Documentation Feedback Documentation Feedback You can rate and provide feedback about Cisco technical documents by completing the online feedback form that appears with the technical documents on Cisco com You can send comments about Cisco documentation to bug doc cisco com You can submit comments by using the response card if present behind the front cover of your document or by writing to the following address Cisco Systems Attn Customer Document Ordering 170 West Tasman Drive San Jose CA 95134 9883 We appreciate your comments Cisco Product Security Overview Cisco provides a free online Security Vulnerability Policy portal at this URL http www cisco com en US products products security vulnerability policy ht ml From this site you can perform these tasks Report security vulnerabilities in Cisco products e Obtain assistance with security incidents that involve Cisco products Register to receive security information from Cisco A curre
95. ee Figure 4 27 Figure 4 27 Securing the Module gt lt 130663 Step11 Repeat Step 4 to Step 10 for the other modules you need to replace Step 12 If you are installing a clock module secure the module to the backplane using the screws from the earlier removal Step 13 Replace the supervisor engines and switching modules to their previous slots Step14 Restore power to the switch Catalyst 4500 Series Switches Installation Guide 78 14409 08 ETIN Chapter4 Removing and Replacing FRUs Replacing Backplane Modules on a Catalyst 45078 or 45108 Switch Verify the New Modules After the switch is reassembled and power is restored connect a terminal to the supervisor engine and monitor the boot process Look for the following messages or any others which may indicate a problem with the replaced modules 00 00 20 SUPERVISOR 2 MUXBUFFERNOTPRESENT Mux buffer WS X4K MUX 3 is not present 00 00 20 SUPERVISOR 2 MUXBUFFERNOTPRESENT Mux buffer WS X4K MUX 4 is not present 00 00 20 SUPERVISOR 2 MUXBUFFERNOTPRESENT Mux buffer WS X4K MUX 7 is not present T T The above messages either at startup or output from a show logging command indicate that the mux buffer is not present in slots 3 4 and 7 You need to reinsert and reseat the modules in those slots If
96. eft Power supply Front to back Power PoE supplied 48 VDC Power to Modules and fans 12 VDC Power to backplane components 3 3 VDC Redundancy Supervisor engine yes Power supply 1 1 78 14409 08 Catalyst 4500 Series Switches Installation Guide m AppendixA Specifications Catalyst 45108 Switch Specifications Catalyst 4510R Switch Specifications Table A 4 lists the Catalyst 4510R switch specifications Table A 4 Catalyst 4510R Switch Specifications Item Specification Environmental Temperature ambient operating 32 to 104 F 0 to 40 C ambient nonoperating and storage 40 to 167 F 40 to 75 C Humidity RH ambient noncondensing operating 10 to 9096 nonoperating and storage 5 to 95 Altitude operating 500 to 6500 ft 150 to 2000 m nonoperating 1000 to 30 000 ft 300 to 9150 m Switching Components Backplane 88 Gbps full duplex with Supervisor Engine V 96 Gbps with Supervisor Engine 8 Gbps Uplinks with Supervisor Engine V 20 Gbps Uplinks with Supervisor Engine V 10GE Port density 340 maximum using a Supervisor Engine V and a WS X4302 GB in the Flex Slot 386 maximum using a Supervisor Engine V IOGE Inline power integrated support 820 W per line card Physical Characteristics Dimensions H x W x D 24 35 x 17 31 x 12 50 in 61 85 x 43 97 x 31 70 cm Weight Minimum weight 51 5 Ib 23 4 kg Ma
97. ement 1029 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Chapter4 Removing and Replacing FRUs Removing and Replacing the Power Supply Installing a DC Input Power Supply This section describes how to install a DC input power supply Required Tools You will need the following tools to perform this procedure A Phillips screwdriver 10 mm wrench socket Connectors and wire for the DC circuit or circuits Installation Procedure Warning Before performing any of the following procedures ensure that power is removed from the DC circuit Statement 1003 Warning A readily accessible two poled disconnect device must be incorporated in the fixed wiring Statement 1022 Warning This product requires short circuit overcurrent protection to be provided as part of the building installation Install only in accordance with national and local wiring regulations Statement 1045 Warning Use copper conductors only Statement 1025 Warning When stranded wiring is required use approved wiring terminations such as closed loop orspade type with upturned lugs These terminations should be the appropriate size for the wires and should clamp both the insulation and conductor Statement 1002 Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Chapter4 Removing and Replacing FRUs Step 1 Step 2 Step 3 Step 4 St
98. emoving and Replacing FRUs Removing and Replacing the Power Supply Step6 Using a screwdriver loosen and remove the captive screws on the power supply See Figure 4 15 which shows the single input power supply The triple input power supply has captive screws in the same location Figure 4 15 Loosening the Captive Screws Captive screws 79162 Step7 Grasp the power supply handle with one hand Place your other hand underneath as you slowly pull the power supply out of the bay see Figure 4 16 Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Chapter4 Removing and Replacing FRUs Step 8 Warning Removing and Replacing the Power Supply Figure 4 16 Handling a DC Input Power Supply 79163 ODDOOHNHAN rS Y t If the bay is to remain empty install a blank power supply filler plate over the opening and secure it with the mounting screws This protects the inner chassis from dust and prevents accidental contact with live voltage at the rear of the bay Blank faceplates and cover panels serve three important functions they prevent exposure to hazardous voltages and currents inside the chassis they contain electromagnetic interference EMI that might disrupt other equipment and they direct the flow of cooling air through the chassis Do not operate the system unless all cards faceplates front covers and rear covers are in place Stat
99. ent that you ordered such as network interface cables transceivers or special connectors Check the switching modules in each slot Ensure that the configuration matches the packing list and that all the specified interfaces are included Catalyst 4500 Series Switches Installation Guide EN 78 14409 08 Chapter3 Installing the Switch in a Rack Rack Mounting the Switch Rack Mounting the Switch A standard rack mount kit is included for mounting the switch in a standard 19 inch 48 3 cm equipment rack with two unobstructed outer posts with a nominal depth between the front and rear mounting posts of 19 25 inches 48 9 cm and a maximum depth of 32 inches 81 3 cm This is not suitable for racks with obstructions such as a power strip that could impair access to the field replaceable units FRUs of the switch Alternatively you can obtain a 23 inch rack mount kit Required Installation Tools You will need the following tools and equipment to install the chassis in a rack Number 1 and number 2 Phillips screwdrivers to tighten the captive installation screws on most systems 3 16 inch flat blade screwdriver for the captive installation screws on the supervisor engine and switching modules on some systems Antistatic mat or antistatic foam in case you need to remove switching modules to troubleshoot the installation Rack mount kit Tape measure Level Your own electrostatic discharge ESD grounding s
100. ep 5 Removing and Replacing the Power Supply Follow these steps to install a DC input power supply connect it to a power source and verify its operation Verify that power is off to the DC circuit or circuits on the power supply you are installing Grasp the power supply handle with one hand Place your other hand underneath it as you slowly insert the power supply into the bay as shown earlier in Figure 4 16 Using a screwdriver tighten the captive screws on the power supply see Figure 4 15 Before you connect the power supply to a power source ensure that all site power and grounding requirements have been met Connect the DC input wires to the power supply terminal block The proper wiring sequence is ground to ground positive to positive and negative to negative see Figure 4 13 or Figure 4 14 depending on your installation The 1400W triple input power supply has two grounding posts use the one that is most convenient for your installation Warning When installing or replacing the unit the ground connection must always be made first and disconnected last Statement 1046 Step6 Replace the terminal cover Step7 Connect the other end of the power cords to a DC power input source Caution In a system with multiple power supplies or a single triple input power supply connect each power supply to a separate DC power source In the event of a power source failure if the second source is still a
101. equirements described in the Site Preparation and Safety Guide have been met Step9 Plug the power cord into the power supply see Figure 4 9 Catalyst 4500 Series Switches Installation Guide EN 78 14409 08 Chapter4 Removing and Replacing FRUs Removing and Replacing the Power Supply Figure 4 9 Plugging the Power Cord into the Power Supply 79142 Step 10 Connect the other end of the power cord to an AC power input source A Caution Inasystem with multiple power supplies connect each power supply to a separate AC power source In the event of a power source failure if the second source is still available it can maintain maximum overcurrent protection for each power connection Step 11 Press the power switch down to the on 1 position see Figure 4 10 Figure 4 10 Powering On the Power Supply Power switch 79143 Catalyst 4500 Series Switches Installation Guide 78 14409 08 EN Chapter4 Removing and Replacing FRUs Removing and Replacing the Power Supply Step 12 Step 13 Step 14 Verify power supply operation by checking the power supply s front panel LEDs You should see the following The LED labeled GOOD is green The LED labeled FAIL is not lit The LED labeled FAN OK is green Check the power supply and system status from the system console by entering the show system command Catalyst Operating System or the show power command Cisco IO
102. ernet switching module WS X4148 FE LX MT 48 port 10 100 Mbps Fast Ethernet switching module WS X4148 RJ 48 port 5 10 Fast Ethernet switching module WS X4148 FE BD LC 48 port 10 100 Mbps Fast Ethernet switching module WS X4148 RJ21 48 port Cisco pre standard Power over Ethernet PoE 10 100BASE TX switching module WS X4148 RJ45V 48 port 100 Fast Ethernet switching module WS X4248 FE SFP Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter Product Overview Switch Features Table 1 3 Features of the Catalyst 4507R Switch continued Feature Description Switching module 24 port IEEE 802 3af compliant PoE 10 100BASE TX switching module support continued WS X4224 RJ45V 48 port IEEE 802 3af compliant PoE 10 100BASE TX RJ 45 switching module WS X4248 RJ45V 48 port IEEE 802 3af compliant PoE 10 100BASE TX RJ 21 switching module WS X4248 RJ21V e 6 port 1000BASE X Gigabit Ethernet switching module WS X4306 GB e 6 port Gigabit Ethernet switching module WS X4506 GB T e 12 port I000BASE T plus 2 port 1000BASE X Gigabit Ethernet switching module WS X4412 2GB T e 18 port Gigabit Ethernet switching module WS X4418 GB e 24 port 10 100 1000B ASE T Gigabit Ethernet switching module WS X4424 GB RJ45 e 48 port Gigabit Ethernet 1000 BASE LX SPF switching module WS X4448 GB LX 48 port 10 100 10
103. fallen vertraut Suchen Sie mit der am Ende jeder Warnung angegebenen Anweisungsnummer nach der jeweiligen bersetzung in den bersetzten Sicherheitshinweisen die zusammen mit diesem ausgeliefert wurden BEWAHREN SIE DIESE HINWEISE GUT AUF Avvertenza IMPORTANTI ISTRUZIONI SULLA SICUREZZA Questo simbolo di avvertenza indica un pericolo La situazione potrebbe causare infortuni alle persone Prima di intervenire su qualsiasi apparecchiatura occorre essere al corrente dei pericoli relativi ai circuiti elettrici e conoscere le procedure standard per la prevenzione di incidenti Utilizzare il numero di istruzione presente alla fine di ciascuna avvertenza per individuare le traduzioni delle avvertenze riportate in questo documento CONSERVARE QUESTE ISTRUZIONI Catalyst 4500 Series Switches Installation Guide EUM 78 14409 08 Preface Advarsel Aviso iAdvertencia Conventions VIKTIGE SIKKERHETSINSTRUKSJONER Dette advarselssymbolet betyr fare Du er i en situasjon som kan f re til skade p person For du begynner arbeide med noe av utstyret du oppmerksom farene forbundet med elektriske kretser og kjenne til standardprosedyrer for forhindre ulykker Bruk nummeret i slutten av hver advarsel for finne oversettelsen i de oversatte sikkerhetsadvarslene som fulgte med denne enheten TA VARE P DISSE INSTRUKSJONENE INSTRUGOES IMPORTANTES DE SEGURANCA Este s mbolo de aviso sig
104. fer to the Catalyst 4500 Series Module Installation Guide When two Supervisor Engine Vs are present in a Catalyst 4507R and Catalyst 4510R all four uplinks are active on both Primary active and Secondary standby supervisor engines by default or two uplinks will be active in a nonredundant configuration This limits access to slot 10 on the Catalyst 4510R to ports 3 and 4 only You can only use the 2 port Gigabit Ethernet switching module WS X4302 GB or the Access Gateway Module WS X4604 GW Y in slot 10 flex slot when a Supervisor Engine V is used 10 Gigabit Ethernet Uplink Ports The 10 Gigabit Ethernet uplink ports operate in full duplex mode only and are only on the WS X4516 10GE and WS X4013 10GE These ports use the hot swappable 10GBASE X2 optical transceivers The X2s have SC connectors to interface with multimode fiber and single mode fiber SMP cable On a Catalyst 4510R with a Supervisor Engine V 10GE the user has the option to use either four Gigabit Ethernet uplinks using SFPs or two 10 Gigabit Ethernet uplinks using X2s The user also has the option of using the Gigabit Ethernet and 10 Gigabit Ethernet uplinks simultaneously With this option the tenth slot can only support the WS X4302 GB switching module On a Catalyst 4507R the user can use the Gigabit Ethernet uplinks and 10 Gigabit Ethernet uplinks simultaneously When two Supervisor Engine V 10GEs are present in a Catalyst 4510R or Catalyst 4507R s
105. g conductors that connect to the receptacles should connect to protective earth ground at the service equipment Four types of AC input power supplies are available 1000 W Table 2 1 lists the AC input power cord options specifications Cisco part numbers and shows the different styles of 1000 W AC input power cord wall plugs that are available for North America and international locations as well as the appliance coupler that is attached to the power supply end of the power cord 1300 W Table 2 1 lists the AC input power cord options specifications and Cisco product numbers and shows the different styles of 1300 W AC input power cord wall plugs that are available for North America or various international locations as well as the appliance coupler that is attached to the power supply end of the power cord Note For North America the power cord plug types and appliance couplers on the power supplies are different for the 1000 W power supplies and the 1300 W power supplies for other countries the plugs shown are the same for the 1000 W and 1300 W power supplies 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter2 Preparing for Installation Power Connection Guidelines for AC Powered Systems 1400 W Table 2 1 lists the AC input power cord options specifications and Cisco product numbers and shows the different styles of 1400 W AC input power cord wall plugs that are availab
106. g f r att hitta dess vers ttning i de versatta s kerhetsvarningar som medf ljer denna anordning SPARA DESSA ANVISNINGAR FONTOS BIZTONS GI ELO R SOK Ez a figyelmezeto jel vesz lyre utal S r l svesz lyt rejto helyzetben van Mielott b rmely berendez sen munk t v gezte legyen figyelemmel az elektromos ramk r k okozta kock zatokra s ismerkedjen meg a szok sos balesetv delmi elj r sokkal A kiadv nyban szereplo figyelmeztet sek ford t sa a k sz l khez mell kelt biztons gi figyelmeztet sek k z tt tal lhat a ford t s az egyes figyelmeztet sek v g n l that sz m alapj n keresheto meg ORIZZE MEG EZEKET AZ UTAS T SOKAT To
107. g requirements 2 4 airflow Catalyst 4503 switches table A 2 Catalyst 4506 switches table A 4 Catalyst 4507 switches table 5 7 direction 1 27 figure 1 29 1 30 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Index autonegotiation Catalyst 4503 switches table 1 3 Catalyst 4506 switches table 1 7 Catalyst 4507 switches table 1 11 1 15 boot process troubleshooting 5 2 brackets See L brackets cables ESD 2 2 Catalyst 4503 switches attaching cable guides figure 3 12 3 13 attaching L brackets figure 3 6 chassis dimensions A 2 features 1 3 front view 1 2 installing in racks figure 3 14 power requirements 2 4 repacking B 1 specifications 2 Catalyst 4506 switches attaching cable guides figure 3 11 attaching L brackets figure 3 7 chassis dimensions A 4 features 1 7 front view 1 6 installing in racks figure 3 15 power requirements 2 4 repacking B 1 specifications 3 Catalyst 4507 switches attaching L brackets figure 3 8 3 9 chassis dimensions A 5 A 6 description 1 10 1 14 features 1 11 1 15 front view 1 10 1 14 installing in racks figure 3 16 3 17 power requirements 2 4 repacking B 1 specifications A 4 A 6 chassis dimensions See Catalyst 4503 switches Catalyst 4506 switches Catalyst 4507 switches checklists rack mount kits 3 5 site planning 2 16 components troubleshooting 5 3 to 5 17 connecting system ground 3 18
108. h in a Rack System Ground Connection Guidelines Step6 Connect the switch to an appropriate ground Refer to System Ground Connection Guidelines page 3 18 The system must have a ground connection before power is supplied to the switch System Ground Connection Guidelines A grounding pad with two system earth grounding holes is provided in an enclosure near the left power supply on the Catalyst 4500 series switches See Figure 3 13 for the location of the grounding holes on the Catalyst 4503 switch Figure 3 14 for the location on the Catalyst 4506 switch Figure 3 15 for the location on the Catalyst 4507R switch and Figure 3 16 for the location on the Catalyst 4510R switch Figure 3 13 Catalyst 4503 Grounding Holes Grounding DODDODDDUDDUDODDDOU DODDDDUODDDDUDDDUDU unu ununuuuunuunuuo DODDDODDDODULDDUDU 9 DODDDDUDDDUODDUDDU DDODODDDODDDODDUDU DODDDDODDDDDLDLDUDU DDODDODDDODOULDLDUDU O REGO asua Yam otDDDDDDDDDDDIEIDDDDO 30506065060000006086 Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Installing the Switch in a Rack Chapter3 System Ground Connection Guidelines 0876
109. hardware failure orange Off No signal is detected Port Indicates individual port status Status Green The port is operational a signal is detected Orange The link has been disabled by software Flashing The link has been disabled due to a hardware failure orange Off No signal is detected 1 Used on the WS X4232 L3 Ethernet routing module 2 LEDs labeled 1 through the number of ports on the switching module are the individual port link LEDs 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter5 Troubleshooting Troubleshooting Switching Modules Troubleshooting Switching Modules Using Cisco 105 Connect a terminal to the console port and look for any of the following system messages CAK CHASSIS 3 LINECARDMUXBUFFERTOSUPALIGNMENTWRON G CAK CHASSIS 3 LINECARDNOTVALIDINSLOT CAK CHASSIS 3 MODULENOTSUPPORTHALF C4K_IOSINTF 5 STALEPH YPORT C4K_IOSMODPORTMAN 4 INLINEPOWEROVERMAX If you observe any of these messages follow the suggestion for that message Some problems can be solved by resetting the switching module Use the hw module module lt n gt reset command to reset a switching module or remove and re insert the switching module which resets restarts and power cycles the switching module The show module and show diagnostics online module commands can also provide information useful in solving problems with ports on individual modules Not all software versions suppor
110. he front if the switching modules and supervisor engines are removed There are two types of redundancy modules and they are interchangeable The clock module replacement procedure is identical to the redundancy module replacement procedure the connectors are the same These modules are not hot swappable the switch must be taken out of service to replace them To replace the backplane modules Make sure you are grounded with an ESD strap Turn off the power to the chassis Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter4 Removing and Replacing FRUs Replacing Backplane Modules on a Catalyst 45078 45108 Switch Step3 Remove all supervisor engines and switching modules from the chassis and find the backplane modules you need to replace Note Keep record of switching moduleand their slots so that you can put them back correctly Note Generic switching module replacement procedures are documented at http www cisco com univercd cc td doc product lan cat4000 hw doc gmdcf nt htm wp2 1932 Figure 4 21 shows the front view of the backplane with supervisors and switching modules removed Catalyst 4500 Series Switches Installation Guide 78 14409 08 125 Chapter4 Removing and Replacing FRUs Replacing Backplane Modules on a Catalyst 45078 or 45108 Switch Figure 4 21 Catalyst 4507R Backplane Clock module
111. hes Installation Guide m Chapter3 Installing the Switch ina Rack System Ground Connection Guidelines Catalyst 4500 Series Switches Installation Guide 326 78 14409 08 Warning CHAPTER Removing and Replacing FRUs Read the installation instructions before connecting the system to the power source Statement 1004 Warning Only trained and qualified personnel should be allowed to install replace or service this equipment Statement 1030 Warning Warning This equipment must be grounded Never defeat the ground conductor or operate the equipment in the absence of a suitably installed ground conductor Contactthe appropriate electrical inspection authority or an electrician if you are uncertain that suitable grounding is available Statement 1024 Before working on equipment that is connected to power lines remove jewelry including rings necklaces and watches Metal objects will heat up when connected to power and ground and can cause serious burns or weld the metal object to the terminals Statement 43 Warning Ultimate disposal of this product should be handled according to all national laws and regulations Statement 1040 Catalyst 4500 Series Switches Installation Guide 78 14409 08 EN Chapter4 Removing and Replacing FRUs Removing and Replacing the Power Supply This chapter tells you how to remove and replace Cataly
112. ing FRUs Removing and Replacing the Chassis Fan Assembly Chapter4 Catalyst 4503 System Fan Assembly Figure 4 17 24164 naaaaaaanauaunna ouaaannauanaaaauna nGaaaaaaaaaauaunuaad qaqaq aaaaaaaauaaauuuaa mia aannnanananuanaun ouunauanunaunnauna E E M nmauaaaaanaunnauuuua ounaaaaaaanauaaauna nanaanaaaaaanaaano anaaaannaaauunauna naannauaannnauaunnaa aaaaaananaaununana o aaaaaaaanaaaauana naanaanaaanaaanaaa Captive installation Fan assembly Screws Catalyst 4500 Series Switches Installation Guide 78 14409 08 Removing and Replacing FRUs Chapter 4 Catalyst 4506 System Fan Assembly Removing and Replacing the Chassis Fan Assembly Figure 4 18 78 14409 08 12164 nmanuauaanauaauunaunaunaunuauauna o o uanaaaaaanaaanaauaauaaaaaaauna naunauaaaaaaaananaauaauaaaauaa uc a aanaaunnnaaanunaununnauunaauad aaaaaaaanaaaaaaaanauaaaaanaa jajaja alaa a laja ja a ta ja ja fa a a a fa o amnunaununnaaunnauununu uaunnnna o Bapneaanaanaaaanaagaanmaanon o o o aanaaanmnnaunannauununauunanaa o umauaunnauunnnuunnnnuununuununn O
113. ion Guide m Chapter1 Product Overview Supervisor Engines The Supervisor Engine IV and Supervisor Engine V support the Catalyst 4500 Series NetFlow Services WS F4531 The Supervisor Engine V 10GE supports NetFlow services without a NetFlow Services Card To install the supervisor engine refer to the procedure in the Catalyst 4500 Series Module Installation Guide The various supervisor engine models are shown in Figure 1 5 to Figure 1 12 Figure 1 5 Supervisor Engine Il WS X4013 STATUS LED RESET button Gigabit a R ports Switch load Ethernet indicators management port CONSOLE port RJ 45 Figure 1 6 Supervisor Engine II Plus WS X4013 STATUS LED RESET button Gigabit uplink ports Switch load indicators CONSOLE port RJ 45 Management port CompactFlash port m Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter Product Overview SupervisorEngines MI Figure 1 7 Catalyst 4500 Series Supervisor Engine Il Plus TS WS X4013 TS RESET button STATUS LED o Y PoE status Switch load Compact Flash port indicators Ethernet management port CONSOLE 9 port Figure 1 8 Supervisor Engine ll Plus WS X4013 10GE CONSOLE port Ethernet STATUS LED management port Compact Flash RESET Sm port button Switch load 10 GE uplink Gigabit SFP indicators ports ports 120474 Catalyst 4
114. itches To maintain normal operation and ensure high system availability maintain an ambient temperature and clean power at your site The environmental ranges listed in Appendix A Specifications are those within which the switch will continue to operate however a measurement that approaches the minimum or maximum of a range indicates a potential problem You can maintain normal operation by anticipating and correcting environmental anomalies before they exceed the maximum operating range Calculating System Heat Dissipation Note To calculate the expected heat dissipation from a switch add the total amount of power drawn from power supply by the system s configuration then divide the total amount of power by the efficiency of the power supply Multiply the result by 3 415 to get the system heat dissipation in BTUs hr First example System without any powered devices Components Output Power 1 Catalyst 4506 with fans 50W 1 Supervisor Engine IV 145 W 1 WS X4248 RJ45V with no phones 72 W total output power 267 W Total heat dissipated by system 267 75 3 415 1215 BTUs hr All Catalyst 4000 4500 power supplies have different efficiencies An average efficiency figure of 7596 was chosen Second example same system but this time with one IEEE class 3 device Components Output Power 1 Catalyst 4506 with fans 50W 1 Supervisor Engine IV 145 W 1 WS X4248 RJ45V with no phones 72 W
115. lacing FRUs Removing and Replacing the Power Supply Figure 4 11 DC Input Power Supply Main power switch In line power switch Captive screw Serial communication connector Captive screw sp 79160 Figure 4 12 DC Triple input Power Supply Captive screw Output Fail LED Fan OK LED Input OK 1 2 3 LEDs Plus Minus Ero ODOB 120913 Terminal block Power switch 1 2 3 Ground lugs m Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter4 Removing and Replacing FRUs Removing and Replacing the Power Supply Stepb Disconnect the DC input wires from the terminal block Disconnect the ground wire last see Figure 4 13 or Figure 4 14 A Warning When installing or replacing the unit the ground connection must always be made first and disconnected last Statement 1046 Figure 4 13 Connecting the DC Input Wires RS 485 serial communnication connector DC input wires Negative _ Positive Ground _ 5 Grounding lug Grounding lug nuts Figure 4 14 Connecting the DC Input Wires Triple input Power Supply 2098 Sears DC input wires ss Negative Positive B Der 9 6 59 Grounding lugs 2 Ground Grounding lug nut Catalyst 4500 Series Switches Installation Guide 78 14409 08 EX Chapter4 R
116. le for North America or various international locations as well as the appliance coupler that is attached to the power supply end of the power cord 2800 W Table 2 1 lists the AC input power cord options specifications and Cisco part numbers and shows the different styles of 2800 W AC input power cord wall plugs that are available for North America and international locations as well as the appliance coupler that is attached to the other end of the 2800 W power supply power cord 4200 W Table 2 1 lists the AC input power cord options specifications and Cisco part numbers and shows the different styles of 4200 W AC input power cord wall plugs that are available for North America and international locations as well as the appliance coupler that is attached to the other end of the 4200 W power supply power cord Table 2 1 AC Input Power Cord Options Locale Part Number Length Plug Rating Plug Type Appliance 1000 W Power Supply PWR C45 1000AC Coupler North America CAB 7KAC 8ft 2 5m 125 15 Australia CAB 7KACA 8ft 2 5m 250 VAC 15 SAA 3 New Zealand AS NZS 3112 1993 Europe except CAB 7KACE 8ft 2 5m 250 7 7 Italy 8 NS 8 Catalyst 4500 Series Switches Installation Guide EN 78 14409 08 Chapter2 Preparing for Installation Power Connection Guidelines for AC Powered Systems Table 2 1 AC Input Power Cor
117. m Specification Power PoE supplied 48 VDC Power to Modules and fans 12 VDC Power to backplane components 3 3 VDC Redundancy Supervisor engine no Power supply 1 1 Catalyst 4506 Switch Specifications Table A 2 lists the Catalyst 4506 switch specifications Table A 2 Catalyst 4506 Switch Specifications Item Specification Environmental Temperature ambient operating 32 to 104 F 0 to 40 C ambient nonoperating and storage 40 to 167 F 40 to 75 C Humidity RH ambient noncondensing operating 10 to 9096 nonoperating and storage 5 to 95 Altitude operating 500 to 6500 ft 150 to 2000 m nonoperating 1000 to 30 000 ft 300 to 9150 m Switching Components Backplane 60 Gbps full duplex 4 Gbps Uplinks Port density 240 max Inline power integrated support 820 W per line card Catalyst 4500 Series Switches Installation Guide 78 14409 08 wa AppendixA Specifications Catalyst 45078 Switch Specifications Table A 2 Catalyst 4506 Switch Specifications continued Item Specification Physical Characteristics Dimensions H x W x D 17 38 x 17 31 x 12 50 in 44 13 x 43 97 x 31 70 cm Weight Minimum weight 40 5 Ib 18 4 kg Maximum weight 100 Ib 45 4 kg Chassis and backplane 36 5 Ib 16 5 kg Fan tray 4 0 Ib 1 8 kg Airflow Switch Right to left Power supply Front to back Power PoE sup
118. module WS X4148 RJ45V e 24 port IEEE 802 3af compliant PoE 10 100BASE TX switching module WS X4224 RJ45V 48 port IEEE 802 3af compliant PoE 10 100BASE TX RJ 45 switching module WS X4248 RJA5V 48 port IO0BASE X Fast Ethernet switching module WS X4248 FE SFP 48 port IEEE 802 3af compliant PoE 10 100BASE TX RJ 21 switching module WS X4248 RJ21V Catalyst 4500 Series Switches Installation Guide EIN 78 14409 08 Chapter Product Overview Switch Features Table 1 2 Features of the Catalyst 4506 Switch continued Feature Description Switching module support continued 32 port 10 100 Mbps Fast Ethernet plus 2 port Gigabit Ethernet switching module WS X4232 GB RJ 32 port 10 100 Mbps Fast Ethernet plus 2 port 1000BASE X Layer 3 Gigabit Ethernet routing module WS X4232 L3 32 port 10 100 Mbps Fast Ethernet switching module with modular uplink support WS X4232 RJ XX 2 port Gigabit Ethernet switching module WS X4302 GB e 6 port 1000BASE X Gigabit Ethernet switching module WS X4306 GB e 6 port Gigabit Ethernet switching module WS X4506 GB T e 12 port 1000 plus 2 port 1000BASE X Gigabit Ethernet switching module WS X4412 2GB T e 18 port Gigabit Ethernet switching module WS X4418 GB 24 port 10 100 1000B ASE T Gigabit Ethernet switching module WS X4424 GB RJ45 e 48 port Gigabit Ethernet 1000 BASE LX SPF switching module WS X4448 GB
119. n expired encryption key The correct public key to use in your correspondence with PSIRT is the one linked in the Contact Summary section of the Security Vulnerability Policy page at this URL http www cisco com en US products products security vulnerability policy ht ml The link on this page has the current PGP key ID in use Obtaining Technical Assistance Cisco Technical Support provides 24 hour a day award winning technical assistance The Cisco Technical Support amp Documentation website on Cisco com features extensive online support resources In addition if you have a valid Cisco Catalyst 4500 Series Switches Installation Guide 78 14409 08 Preface Obtaining Technical Assistance service contract Cisco Technical Assistance Center TAC engineers provide telephone support If you do not have a valid Cisco service contract contact your reseller Cisco Technical Support amp Documentation Website Note The Cisco Technical Support amp Documentation website provides online documents and tools for troubleshooting and resolving technical issues with Cisco products and technologies The website is available 24 hours a day at this URL http www cisco com techsupport Access to all tools on the Cisco Technical Support amp Documentation website requires a Cisco com user ID and password If you have a valid service contract but do not have a user ID or password you can register at this URL htt
120. naaaaauna o aananaaaaaannauaaaanaaaaaaaaanaaaaunamnaa o supervisor engine has a nonblocking full duplex switching fabric that provides connections between the supervisor engine and the switching modules The Gigabit Ethernet ports can be configured with any combination of copper 1000BASF T shortwave SX LX LH and ZX interfaces or CWDM and DWDM The Catalyst 4510R switch supports the Supervisor Engine V and V 10GE The GBICs For a description of GBICs refer to the Catalyst 4500 Series Module Catalyst 4500 Series Switches Installation Guide oc er ELA 55 E 25 595 29 Cs o2 562 2 x EZ ot 2 c 29e gt gt gt gt 8 85 5 5 20 o Chapter Product Overview Switch Features Installation Guide or the Catalyst 4500 Series Supervisor Engines and Switching Modules Installation Note Some supervisor engines use SFP modules for Gigabit Ethernet connections or X2 modules for 10 Gigabit Ethernet connections Refer to the installation note for your supervisor engine for more details on these modules Slot 1 is reserved for the supervisor engine only which provides switching local and remote management and switch status monitoring Slot 2 is reserved for a redundant supervisor engine only Slots 3 through 9 are available for switching modules When using a Supervisor Engine V slot 10 is a flex slot for use
121. naaannnaaannnauununauunnanaa naanaaananaanannauaunnaaunaaua maaa aa a Va a a a a a a a a a a a fa a La Va a La Ta Ca Pa a o DOOOOOSIDO00000DDNN 10000000 8 nanaaangananaaananaansaaqnqaaaqnaqn et o o o o 4 o _ nnnuacgaaannaanaannraaauannnunmn 0 8 4 4 4 o n ua 6aaaaaaadaaaaaaaaaaaadag o Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter 3 Installing the Switch in a Rack the Switch Attaching the Cable Guide to the Catalyst 45071 Switch Figure 3 7 71189 aanananauanananaunanunanmnn aaaaannaaaannaunaunnaaunna naaaaaanauaaununuanununauuuna naaaaaaaaaaaaauananuauaunununa naununcgauaaanununuugiuauna nmauanagamwuauaaaaaaaa
122. ndant mode In redundant mode both power supplies must have identical inputs and all inputs must be at the same voltage If the input voltages are mismatched choose the value matching the weaker of the two power supplies Table A 14 Redundant Mode Output 12V 3 3V 50V Total 110 660 40 700 1050 110 110 or 220 1360 40 1850 2100 220 220 1360 40 3700 4200 Table A 15 shows the wattage output possible with the 4200W power supply in conbined mode Table A 15 Combined Mode Output 12V 3 3V 50V Total Both sides at 110 1200 40 1200 1873 110 110 other side 110 1360 40 2000 2728 220 220 1360 40 3100 3782 Both sides at 110 110 1360 40 3100 3782 Both sides at 220 1360 40 4700 5493 Both sides at 220 220 1360 40 6800 7600 Catalyst 4500 Series Switches Installation Guide EX 78 14409 08 Step 1 Step 2 Step 3 Step 4 Step 5 APPENDIX Repacking a Switch If you need to return your Catalyst 4500 series switch to the factory use the instructions in this appendix to repack your switch in preparation for shipping To repack the switch using the original packaging material follow these steps Slide the pieces of the packing foam over the Catalyst 4500 series switch See Figure B 1 Place the documentation and accessory kit in the box or poly bag provided Place the box or poly bag containing the documentation and accessory kit on top of the packing material Place the
123. ng the voltage between the DC cable leads When making the measurement the positive lead and the negative lead must always match the and labels on the DC input power supply terminal block Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Chapter2 Preparing for Installation Power Connection Guidelines for DC Powered Systems Calculating DC Input Current Step 1 Step 2 Step 3 Step 4 Step 5 Complete power usage tables are in the Catalyst 4500 Series Module Installation Guide To calculate the DC input current needed for data and inline power applications use the following steps the example shows the DC input current requirement in a Catalyst 4503 with a Supervisor Engine II and two WS X4306 GB modules and assumes a DC input voltage of 48 VDC Add the power requirement for each component in your system Catalyst 4503 uses 54 W e Supervisor Engine II uses 147 W e WS X4306 GB uses 2 X 47 94 W Total DC input power 295 W After the entries for all components have been added together divide that number by the DC input voltage to determine the DC input current Input current 295 W A8 VDC 6 14 A for data only Step 3 to Step 5 are for applications requiring inline power If your configuration does not include inline power devices the DC input current is the result of Step 2 If you want to add an inline capable module WS X4148 RJ45V with 10 inline device
124. nifica perigo Voc est em uma situac o que poder ser causadora de les es corporais Antes de iniciar a utilizac o de qualquer equipamento tenha conhecimento dos perigos envolvidos no manuseio de circuitos el tricos e familiarize se com as pr ticas habituais de preven o de acidentes Utilize o n mero da instruc o fornecido ao final de cada aviso para localizar sua traduc o nos avisos de seguranca traduzidos que acompanham este dispositivo GUARDE ESTAS INSTRUCOES INSTRUCCIONES IMPORTANTES DE SEGURIDAD Este s mbolo de aviso indica peligro Existe riesgo para su integridad f sica Antes de manipular cualquier equipo considere los riesgos de la corriente el ctrica y familiar cese con los procedimientos est ndar de prevenci n de accidentes Al final de cada advertencia encontrar el n mero que le ayudar a encontrar el texto traducido en el apartado de traducciones que acompa a a este dispositivo GUARDE ESTAS INSTRUCCIONES 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Preface Conventions Varning Figyelem VIKTIGA S KERHETSANVISNINGAR Denna varningssignal signalerar fara Du befinner dig i en situation som kan leda till personskada Innan du utf r arbete n gon utrustning m ste du vara medveten om farorna med elkretsar och k nna till vanliga f rfaranden f r att f rebygga olyckor Anv nd det nummer som finns i slutet av varje varnin
125. nnel as defined in IEC 60950 and AS NZS3260 should install replace or service the equipment Organization This guide is organized as follows Chapter Title Description Chapter 1 Product Overview Describes the hardware features components interfaces and functionality of the Catalyst 4500 series switches Chapter 2 Preparing for Describes how to prepare your site for the installation of the Installation switch Chapter 3 Installing the Switch Describes how to install the Catalyst 4500 series switches in a Rack Provides procedures for removing and installing chassis components Catalyst 4500 Series Switches Installation Guide 78 14409 08 Em Preface Related Documentation Chapter Title Description Chapter 4 Removing and Describes how to remove and replace field replaceable units Replacing FRUs FRUs Chapter 5 Troubleshooting Provides troubleshooting guidelines for the initial hardware installation and suggests steps to help isolate and resolve problems Appendix A Specifications Lists the cable and technical specifications of the Catalyst 4500 series switches Appendix B Repacking a Switch Provides instructions for repacking your Catalyst 4500 series switch in the event that you have to return it to the factory Related Documentation Refer to the following documents for additional Catalyst 4500 series information Catalyst 4500 Series Module Installation Guid
126. ns remain functional You and Cisco will commit resources during normal business hours to restore service to satisfactory levels Severity 4 S4 You require information or assistance with Cisco product capabilities installation or configuration There is little or no effect on your business operations Catalyst 4500 Series Switches Installation Guide 78 14409 08 Preface Obtaining Additional Publications and Information Obtaining Additional Publications and Information Information about Cisco products technologies and network solutions is available from various online and printed sources Cisco Marketplace provides a variety of Cisco books reference guides documentation and logo merchandise Visit Cisco Marketplace the company store at this URL http www cisco com go marketplace Cisco Press publishes a wide range of general networking training and certification titles Both new and experienced users will benefit from these publications For current Cisco Press titles and other information go to Cisco Press at this URL http www ciscopress com Packet magazine is the Cisco Systems technical user magazine for maximizing Internet and networking investments Each quarter Packet delivers coverage of the latest industry trends technology breakthroughs and Cisco products and solutions as well as network deployment and troubleshooting tips configuration examples customer case studies certificati
127. nt list of security advisories and notices for Cisco products is available at this URL http www cisco com go psirt If you prefer to see advisories and notices as they are updated in real time you can access a Product Security Incident Response Team Really Simple Syndication PSIRT RSS feed from this URL http www cisco com en US products products_psirt_rss_feed html 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Preface Obtaining Technical Assistance Reporting Security Problems in Cisco Products Cisco is committed to delivering secure products We test our products internally before we release them and we strive to correct all vulnerabilities quickly If you think that you might have identified a vulnerability in a Cisco product contact PSIRT e Emergencies security alert cisco com An emergency is either a condition in which a system is under active attack or a condition for which a severe and urgent security vulnerability should be reported All other conditions are considered nonemergencies e Nonemergencies psirt cisco com In an emergency you can also reach PSIRT by telephone 1877 228 7302 e 1 408 525 6532 Tip We encourage you to use Pretty Good Privacy PGP or a compatible product to encrypt any sensitive information that you send to Cisco PSIRT can work from encrypted information that is compatible with PGP versions 2 x through 8 x Never use a revoked or a
128. nual may cause harmful interference to radio communications Operation of this equipment in a residential area is likely to cause harmful interference in which case users will be required to correct the interference at their own expense The following information is for FCC compliance of Class B devices The equipment described in this manual generates and may radiate radio frequency energy If it is not installed in accordance with Cisco s installation instructions it may cause interference with radio and television reception This equipment has been tested and found to comply with the limits for a Class B digital device in accordance with the specifications in part 15 of the FCC rules These specifications are designed to provide reasonable protection against such interference in a residential installation However there is no guarantee that interference will not occur in a particular installation Modifying the equipment without Cisco s written authorization may result in the equipment no longer complying with FCC requirements for Class A or Class B digital devices In that event your right to use the equipment may be limited by FCC regulations and you may be required to correct any interference to radio or television communications at your own expense You can determine whether your equipment is causing interference by turning it off If the interference stops it was probably caused by the Cisco equipment or one of its peripheral devices If the eq
129. on and training information and links to scores of in depth online resources You can access Packet magazine at this URL http www cisco com packet iQ Magazine is the quarterly publication from Cisco Systems designed to help growing companies learn how they can use technology to increase revenue streamline their business and expand services The publication identifies the challenges facing these companies and the technologies to help solve them using real world case studies and business strategies to help readers make sound technology investment decisions You can access iQ Magazine at this URL http www cisco com go iqmagazine or view the digital edition at this URL http ciscoiq texterity com ciscoiq sample 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Preface Obtaining Additional Publications and Information Internet Protocol Journal is a quarterly Journal published by Cisco Systems for engineering professionals involved in designing developing and operating public and private internets and intranets You can access the Internet Protocol Journal at this URL http www cisco com ipj Networking products offered by Cisco Systems as well as customer support services can be obtained at this URL http www cisco com en US products index html Networking Professionals Connection is an interactive website for networking professionals to share questions suggestions and inf
130. opening Secure the filler plate with the two mounting screws and tighten them with a screwdriver Catalyst 4500 Series Switches Installation Guide 78 14409 08 EN Chapter4 Removing and Replacing FRUs Removing and Replacing the Power Supply Installing an AC Input Power Supply Warning Theplug socket combination must be accessible at all times because it serves as the main disconnecting device Statement 1019 Follow these steps to install an AC input power supply Step 1 Make sure that the power supply you are installing is not plugged in to a power outlet and that the power cord is not connected to the power supply Step2 Remove the two Phillips head screws from the power supply filler plate if a filler plate is present Step3 Remove the power supply filler plate if one is present and set it aside A Caution Use both hands to grasp a power supply Step4 Grasp the power supply handle with one hand Place your other hand underneath to support the bottom of the power supply as shown earlier in Figure 4 8 Step5 Slide the power supply all the way into the power supply bay Step6 Using a screwdriver tighten the two captive installation screws see Figure 4 1 on the front panel of the AC input power supply Step7 sure the power supply power switch is in the off position Step8 Before you connect the power supply to a power source ensure that all site power and grounding r
131. or out of the uplink on the supervisor engine Over subscription Switching modules that have 24 or 48 Gigabit Ethernet 1000BASE T ports over subscribe on a Catalyst 4500 switch by grouping the ports with an additional mux buffer on the switching module which creates a single nonblocking full duplex Gigabit Ethernet connection to the internal switch fabric For each group of ports frames received are buffered and sent to the common Gigabit Catalyst 4500 Series Switches Installation Guide 78 14409 08 ET Chapter Product Overview System Architecture Ethernet link to the internal switch fabric If the amount of data received for a port begins to exceed buffer capacity flow control sends pause frames to the remote port to temporarily stop traffic and prevent frame loss Each port in the group shares the bandwidth of a Gigabit Ethernet link However each port operates independently so that flow control or configuration of one port does not block or degrade the performance of another port in that group Switching modules that have up to six 1000BASE T ports do not use over subscription The amount of over subscription can be controlled by varying the number of ports used at 1000 Mbps All ports can use Cisco Gigabit EtherChannel technology or IEEE 802 3ad for high speed interconnection applications All over subscribed ports use the standard IEEE 802 1x flow control PAUSE frame mechanism to control Gigabit Ethernet ho
132. ore fans have failed Connect a terminal and determine the fan tray status shown by the show environment status CLI command Look for system messages reporting a temperature problem or problem with the fans Individual messages may suggest different solutions Connect a terminal to the console port and look for any of the following system messages CAK CHASSIS 2 INSUFFICIENTFANSDETECTED CAK CHASSIS 2 INSUFFICIENTFANSSHUTDOWN IOSMODPORTMAN 4 CRITICALTEMP CAK IOSMODPORTMAN 4 FANTRAYBAD m Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapters Troubleshooting Step 4 Step 5 Step 6 Step 7 Step 8 Step 9 Troubleshooting Backplane Modules CAK IOSMODPORTMAN 4 FANTRAYPARTIALFAILURE CAK IOSMODPORTMAN 4 FANTRAYREMOVED SUPERVISOR 3 FANTRAYREADFAILED SUPERVISOR 3 FANTRAYSEEPROMREADFAILED SUPERVISOR 3 FANTRAYSEEPROMINVALID IOSMODPORTMAN 4 TEMPHIGH IOSMODPORTMAN 4 TEMPUNDERCRITICAL CAK CHASSIS 2 OVERHEATINGSHUTDOWN Determine whether the airflow is restricted or if the ambient temperature in the room is too warm Determine whether the power supply is functioning properly See the Troubleshooting the Power Supply section on page 5 6 Verify that the fan assembly is properly seated in the backplane by loosening the captive installation screws removing the fan assembly and reinstalling it Restart the system Verify that all fans are operating
133. ore its acceptance as a standard by the Electronic Industries Alliance EIA and Telecommunications Industry Association TIA The RESET button is used to restart the switch Catalyst 4500 Series Switches Installation Guide EZE 78 14409 08 Chapter Product Overview Fan Assembly lt Note Use paper clip or other small pointed object to press the Reset button CompactFlash Port The CompactFlash port accepts a Type 1 CompactFlash card You can use it for file transfer tasks such as loading a new software image The CompactFlash card is optional and can be obtained from third party suppliers For more information refer to Using the Compact Flash on the Catalyst 4000 Family Supervisor Engine III and IV at the following URL http www cisco com univercd cc td doc product lan cat4000 inst_nts ol 2788 htm Fan Assembly Note For complete environmental specifications including airflow requirements see Appendix A Specifications The system fan assembly provides cooling air for the internal chassis components The fan assembly is a tray of fans that you can insert and remove from the chassis while the system is on line The Catalyst 4503 fan assembly has two fans the Catalyst 4506 fan assembly has four fans the Catalyst 4507R fan assembly has six fans and the Catalyst 4510R fan assembly has eight fans The fans draw in fresh air from one side and exhaust air on the other side Catalyst 4
134. ormation about networking products and technologies with Cisco experts and other networking professionals Join a discussion at this URL http www cisco com discuss networking e World class networking training is available from Cisco You can view current offerings at this URL http www cisco com en US learning index html Catalyst 4500 Series Switches Installation Guide 78 14409 08 CHAPTER 1 Product Overview This chapter provides an overview of the features and components of the Catalyst 4500 series switches The Catalyst 4500 series switches are the Catalyst 4503 switch the Catalyst 4506 switch the Catalyst 4507R switch and the Catalyst 4510R switch The information is presented in these major sections e Switch Features page 1 1 e Supervisor Engines page 1 18 Fan Assembly page 1 27 Power Supplies page 1 31 System Architecture page 1 40 Switch Features The following sections describe the features of the Catalyst 4500 series switches Catalyst 4503 Switch Features page 1 2 e Catalyst 4506 Switch Features page 1 6 Catalyst 4507R Switch Features page 1 10 Catalyst 4510R Switch Features page 1 14 Catalyst 4500 Series Switches Installation Guide 78 14409 08 EN Chapter1 Product Overview Switch Features Catalyst 4503 Switch Features The Catalyst 4503 switch see Figure 1 1 is a three slot switch designed for high performance high density wiring closet appli
135. ounding lug and the attached wire will not interfere with other switch hardware or rack equipment Tighten the screws to secure the grounding lug to the grounding pad Repeat steps 1 through 3 to prepare the other end of the grounding wire and connect it to an appropriate grounding point at your site to ensure adequate earth ground for the switch Connect the power supply cords The switch comes on when the cords are connected and the power supply on off switch is on This equipment is suitable for connection to intra building wiring only If you are using a DC power supply the DC return connection to this system should remain isolated from the system frame and chassis DC I This completes the installation of the Catalyst 4500 series switches At this point you should use the RJ 45 to RJ 45 rollover cable to connect the console port to a PC that runs terminal emulation software Configure your terminal emulation program for 9600 baud 8 data bits no parity and 1 stop bit With this console connection you can configure the switch as discussed in the software configuration guide appropriate for your switch s software release and monitor the software as the switch goes through its startup routine The pinout for the console port is detailed in the module installation guide at http www cisco com univercd cc td doc product lan cat4000 hw doc mod inst Oaspecs htm wp 1003732 78 14409 08 Catalyst 4500 Series Switc
136. ounting posts to ensure that itis 17 75 inches 45 09 cm wide The chassis is 17 25 inches 43 8 cm wide and must fit between the mounting posts d Open the rack mount kit and check the component checklist in Table 3 1 to verify that all parts are included Catalyst 4500 Series Switches Installation Guide EIN 78 14409 08 Chapter3 Installing the Switch in a Rack Step 2 Rack Mounting the Switch Table 3 1 Rack Mount Kit Checklist Quantity Part Description 2 L brackets 6 MA Phillips pan head screws 6 12 24 x 3 4 inch Phillips binder head screws Note Some equipment racks provide a power strip along the length of one of the rear posts If your rack has this feature consider the position of the strip when planning fastener points Before installing the L brackets on the chassis determine whether to install the chassis from the front or the rear of the rack Install the L brackets which connect the chassis to the rack as follows a Remove the screws from the front of the switch side cover panels b Attach the left and right L brackets using the six Phillips pan head screws three screws per side provided in the rack mount kit See Figure 3 1 for the Catalyst 4503 switch Figure 3 2 for the Catalyst 4506 switch or Figure 3 3 for the Catalyst 4507R switch or Figure 3 4 for the Catalyst 4510R switch 78 14409 08 Catalyst 4500 Series Switches Installation Guide m
137. outers Forwarding Layer 2 3 and 4 forwarding Cisco IOS only Supervisor Engine II 24 Gbps 18 Mpps full duplex Gigabit Ethernet switching engine Supervisor Engine II Plus 64 Gbps 48 Mpps with Catalyst 4506 and 4507R or 28 Gbps 21 Mpps with Catalyst 4503 full duplex Gigabit Ethernet switching engine Supervisor 64 Gbps 48 Mpps with Catalyst 4503 only full duplex Gigabit Engine II Plus TS Ethernet switching engine Supervisor 108 Gbps 81 Mpps full duplex Gigabit Ethernet switching engine Engine II Plus 10GE Supervisor Engine III 64 Gbps 48 Mpps with Catalyst 4506 and 4507R or 28 Gbps 21 Mpps with Catalyst 4503 full duplex Gigabit Ethernet switching engine Supervisor Engine IV 64 Gbps 48 Mpps with Catalyst 4506 and 4507R or 28 Gbps 21 Mpps with Catalyst 4503 full duplex Gigabit Ethernet switching engine Supervisor Engine V 96 Gbps 72 Mpps with Catalyst 4510R 68 Gbps 51 Mpps with Catalyst 4507R 64 Gbps 48 Mpps with Catalyst 4506 28 Gbps 21 Mpps with Catalyst 4503 full duplex Gigabit Ethernet switching engine Supervisor Engine V 10GE 136 Gbps 101 Mpps with Catalyst 4510R 68 Gbps 51 Mpps with Catalyst 4507R 64 Gbps 48 Mpps with Catalyst 4506 28 Gbps 21 Mpps with Catalyst 4503 full duplex Gigabit Ethernet switching engine 1 PAgP Port Aggregation Protocol 2 SPAN switched port analyzer 78 14409 08 Catalyst 4500 Series Switches Installat
138. ower needed at all times When a power supply is over subscribed more power is being drawn from it than it can supply the power supply shuts down There are several ways to predictably manage a temporary PoE over subscription 1 Configure unused ports to never receive PoE This prevents a user from inadvertently plugging a powered device into a port and causing problems for other powered devices 2 Configure ports to be in static mode This is for ports that have highest priority such as phones for executives or wireless access points If ports need to be disabled because of a power shortage auto ports are disabled before static ports 3 Configure the maximum wattage on ports to be less than the default based on the maximum power consumption of the powered device This disallows devices demanding unexpected amounts of power and also stretches the finite resources of the power supplies For example the default port wattage is 15 4 W By configuring a maximum of 7 W twice as many PoE powered devices can be supported with the same power supply The Cisco Catalyst 4500 series offers line cards power supplies and accessories required to deploy and operate a standards based PoE internetwork PoE provides 48 V DC power over standard Category 5 unshielded twisted pair UTP cable up to 100 meters when an IEEE 802 3af compliant or Cisco pre standard powered device is attached to the PoE line card port Instead of requiring wall power att
139. own the power supply An instance of substantial input overvoltage greater than 75 V DC continuous can damage the power supply input circuitry and can cause it to shut down permanently 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Chapter Product Overview Power Supplies For a 1400 W DC power supply the main power switch has an input range of 40 5 to 72 V DC while the 48 V PoE operates over a range of 40 5 to 56 V DC The PoE either fails to start or shuts down if exposed to greater than 56 V DC input PoE recovers after you recycle input power within the proper voltage range If the PoE shuts down due to input overvoltage greater than 56 V DC the main converter section does not shut down The supervisor engine monitors the status of each power supply and provides a status report through the switch software For more details on how the supervisor engine monitors the power supplies refer to the Environmental Monitoring and Power Management chapter of the Catalyst 4500 Series Switch Cisco IOS Software Configuration Guide 1400 W DC Triple input Power Supply Operational Modes The C4500 1400 W DC Triple Input SP Power Supply data only allows added redundancy by providing terminals for two DC inputs rated at 15 A and one rated at 12 5 A per power supply This power supply has five operational modes depending on the inputs receiving power When all three inputs are active
140. p tools cisco com RPF register register do Use the Cisco Product Identification CPI tool to locate your product serial number before submitting a web or phone request for service You can access the CPI tool from the Cisco Technical Support amp Documentation website by clicking the Tools amp Resources link under Documentation amp Tools Choose Cisco Product Identification Tool from the Alphabetical Index drop down list or click the Cisco Product Identification Tool link under Alerts amp RMAs The CPI tool offers three search options by product ID or model name by tree view or for certain products by copying and pasting show command output Search results show an illustration of your product with the serial number label location highlighted Locate the serial number label on your product and record the information before placing a service call Submitting a Service Request Using the online TAC Service Request Tool is the fastest way to open S3 and S4 service requests S3 and S4 service requests are those in which your network is minimally impaired or for which you require product information After you describe your situation the TAC Service Request Tool provides recommended 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Preface Obtaining Technical Assistance solutions If your issue is not resolved using the recommended resources your service request is assigned to a Cisco engineer
141. plied 48 VDC Power to Modules and fans 12 VDC Power to backplane components 3 3 VDC Redundancy Supervisor engine no Power supply 1 1 Catalyst 4507R Switch Specifications Table A 3 lists the Catalyst 4507R switch specifications Table A 3 Catalyst 4507R Switch Specifications Item Specification Environmental Temperature ambient operating ambient nonoperating and storage 32 to 104 0 to 4090 240 to 167 F 40 to 75 C m Catalyst 4500 Series Switches Installation Guide 78 14409 08 AppendixA Specifications Catalyst 45078 Switch Specifications Table A 3 Catalyst 4507R Switch Specifications continued Item Specification Humidity RH ambient noncondensing operating 10 to 9096 nonoperating and storage 5 to 95 Altitude operating 500 to 6500 ft 150 to 2000 m nonoperating 1000 to 30 000 ft 300 to 9150 m Switching Components Backplane 60 Gbps full duplex 4 Gbps Uplinks with Sup II Sup and Sup IV 8 Gbps Uplinks with Supervisor Engine V Port density 240 max Inline power integrated support 820 W per line card Physical Characteristics Dimensions H x W x D 19 19 x 17 31 x 12 50 in 48 74 x 43 97 x 31 70 cm Weight Minimum weight 44 25 b 20 1 kg Maximum weight 100 Ib 45 4 kg Chassis and backplane 40 0 Ib 18 1 kg Fan tray 4 2 Ib 1 9 kg Airflow Switch Right to l
142. r module 8 5 A total of modules A per module 2078 BTUs Catalyst 4506 Specific Power Usage data only Maximum draw data only Maximum input Current draw at 40 5 V min voltage Current draw at 72 V max voltage Max heat dissipation at 1076 W Two modules minimum required 44 VDC input Three modules minimum required 40 5 VDC input 850W 1076 W total of modules W per module 26 6 A total of modules A per module 15 A total of modules A per module 3671 BTUs Catalyst 4507R Specific Power Usage data only Maximum draw data only Max input is 1080 W Current draw at 40 5 V min voltage Current draw at 72 V max voltage Max heat dissipation 1367 W Three modules minimum required 1080 W 1367 W total of modules W per module 33 75 total of modules A per module 19 A total of modules A per module 4665 BTUs H Catalyst 4500 Series Switches Installation Guide 78 14409 08 AppendixA Specifications Catalyst 4500 Series Power Supplies Table A 10 Input Modes Input Input Maximum Total Output Mode Number Input Configuration Power 1 1 1 12 5 386 W 40 5 VDC 412 W Q 44 0 VDC 2 2OR 3 1 15 466 W 40 5 VDC 495 W 44 0 VDC 3 1 2OR3 12 5 A and 845 W 40 5 VDC 5 908 W 44 0 VDC 4 2 3 2x15A 914 W Q 40 5 VDC 990 W 44 0 VDC 5 1 2 3 x 12 5 A and 1294 W Q
143. rcuits for redundant power supplies UPS for power failures Grounding evaluation Circuit breaker size Cable and interface equipment evaluation Cable type Connector type e Cable distance limitations Interface equipment transceivers EMI evaluation Distance limitations for signaling e Site wiring RFI levels 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter2 Preparing for Installation Site Planning Checklist Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 P Warning P Warning P Warning Note CHAPTER Installing the Switch in a Rack This unit is intended for installation in restricted access areas A restricted access area can be accessed only through the use of a special tool lock and key or other means of security Statement 1017 Only trained and qualified personnel should be allowed to install replace or service this equipment Statement 1030 To prevent personal injury or damage to the chassis never attempt to lift or tilt the chassis using the handles on modules such as power supplies fans or cards these types of handles are not designed to support the weight of the unit Statement 1032 This chapter describes how to install Catalyst 4500 series switches in a rack For first time installations perform the procedures in the following sections in the order listed
144. rd partner does not imply a partnership relationship between Cisco and any other company 0502R Catalyst 4500 Series Switches Installation Guide Copyright 2002 2005 Cisco Systems Inc All rights reserved CONTENTS Preface ix Audience ix Organization ix Related Documentation x Conventions xi Obtaining Documentation xvii Cisco com xvii Product Documentation DVD xviii Ordering Documentation xviii Documentation Feedback xix Cisco Product Security Overview xix Reporting Security Problems in Cisco Products xx Obtaining Technical Assistance xx Cisco Technical Support amp Documentation Website xxi Submitting a Service Request xxi Definitions of Service Request Severity xxii Obtaining Additional Publications and Information xxiii CHAPTER 1 Product Overview 1 1 Switch Features 1 1 Catalyst 4503 Switch Features 1 2 Catalyst 4506 Switch Features 1 6 Catalyst 4507R Switch Features 1 10 Catalyst 4510R Switch Features 1 14 Catalyst 4500 Series Switches Installation Guide 78 14409 08 Contents Supervisor Engines 1 18 LEDs 1 24 Gigabit Ethernet Uplink Ports 1 25 10 Gigabit Ethernet Uplink Ports 1 25 SFP Ports 1 26 10 100BASE T Port 1 26 CONSOLE Port 1 26 RESET Button 1 26 CompactFlash Port 1 27 Fan Assembly 1 27 Power Supplies 1 31 Power Supply LEDs 1 34 Power Supply Fan 1 35 Load Sharing Feature 1 35 Environmental Monitoring Feature 1 35 1400 W DC Triple input Power Supply Operational Modes 1
145. ries Switches Installation Guide EZE 78 14409 08 Chapter1 Product Overview System Architecture 2800 W AC 4200 W AC or 1400 W DO also provide a 48 V circuit shown as a dashed line to PoE enabled switching modules which is then available to the powered device connected to the switching module Note The Supervisor Engine II Plus TS has internal DC to DC converters that use the 12 V circuit to provide PoE to powered devices connected to the Supervisor engine only If your system has a Supervisor Engine II Plus TS in slot 1 you still need a PoE enabled power supply to provide PoE to the other slots All Catalyst 4500 series switches support dual power supplies configurable as combined mode or redundant mode In combined mode the switch has available the combined rated wattage of both power supplies less some expected efficiency loss In redundant mode one power supply provides power to the system and the other supply is on standby should there be a failure in either the power supply or the input voltage source it is connected to Power over Ethernet The Cisco Catalyst 4500 Series switches support the Cisco pre standard and 802 3af standard for PoE on 10 100 or 10 100 1000 ports enabling customers to support telephones wireless base stations video cameras and other appliances PoE makes it possible to place devices in unique locations without having to provide new outlets and costly electrical circuits PoE
146. rs Troubleshooting Problem Solving to the System Component Level Problem Solving to the System Component Level The key to success when troubleshooting the system is to isolate the problem to a specific system component Your first step is to compare what the system is doing to what it should be doing Because a startup problem can usually be caused by a single component it is more efficient to isolate the problem to a subsystem rather than troubleshoot each separate component in the system The switch consists of the following subsystems Power supply Includes the power supplies and power supply fans If you suspect problems with the power supplies see the Troubleshooting the Power Supply section on page 5 6 Fan assembly The system fan assembly should be operating whenever system power is on You should be able to hear the fan assembly when the system is operating If you determine that the fan assembly is not operating see the Troubleshooting the Fan Assembly section on page 5 8 Supervisor engine The supervisor engine contains the operating system software so check the supervisor engine if you have trouble with the system software Status LEDs on the supervisor engine indicate whether the supervisor engine has initialized correctly If there is a problem with the supervisor engine try reseating the supervisor engine in the chassis and restarting the switch For more information about LED meanings refer to the
147. s such as IP Phones to your system calculate the DC output power sent to inline devices 10 6 3 W 63 W for inline devices 6 3 Watts is correct for a Cisco IP phone Wattage consumption will depend on the inline device used Find the DC input power using the DC output power e 63 96 efficiency 65 W of DC input power Divide the DC input power by the DC voltage input of 48 V to find the DC input current used by inline devices 65 48 1 4 Amps for inline devices 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter2 Preparing for Installation Ventilation Step6 Add the DC input current used by data and the DC input current used by inline devices to find the total DC input current Total DC input current 6 14 1 4 7 54 A Ventilation Planning a proper location for the switch and the layout of your equipment rack or wiring closet is essential for successful system operation You should install the switch in an enclosed secure area ensuring that only qualified personnel have access to the switch and control of the environment Equipment placed too close together or inadequately ventilated can cause system overtemperature conditions In addition poor equipment placement can make chassis panels inaccessible and difficult to maintain The switch operates as a standalone system mounted in a rack in a secure wiring closet It requires a dry clean well ventilated
148. s URL http www cisco com public countries languages shtml 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Preface Obtaining Documentation Product Documentation DVD Cisco documentation and additional literature are available in the Product Documentation DVD package which may have shipped with your product The Product Documentation DVD is updated regularly and may be more current than printed documentation The Product Documentation DVD is a comprehensive library of technical product documentation on portable media The DVD enables you to access multiple versions of hardware and software installation configuration and command guides for Cisco products and to view technical documentation in HTML With the DVD you have access to the same documentation that is found on the Cisco website without being connected to the Internet Certain products also have pdf versions of the documentation available The Product Documentation DVD is available as a single unit or as a subscription Registered Cisco com users Cisco direct customers can order a Product Documentation DVD product number DOC DOCDVD2 from Cisco Marketplace at this URL http www cisco com go marketplace Ordering Documentation Beginning June 30 2005 registered Cisco com users may order Cisco documentation at the Product Documentation Store in the Cisco Marketplace at this URL http www cisco com go marketplace Nonregister
149. sed and VLAN based statistics monitoring This data can be exported collected and analyzed for virus detection and mitigation network traffic accounting usage based network billing network planning network monitoring and data mining capabilities Cisco NetFlow Services is integral to the Supervisor Engine V 10GE Switching Traffic Flow Figure 1 23 shows switching traffic flow through the system Catalyst 4500 Series Switches Installation Guide EZE 78 14409 08 Chapter Product Overview System Architecture Figure 1 23 Switching Traffic Flow MUN 2 Gigabit Ethernet uplinks 6 Gbps up 6 Gbps down 24 Gbps 1000BASE T 8 1 oversubscribed Supervisor Il III IV V JI Ji JI rO w Clock mm mj 6 p up 6 Gbps down lt 1 1 mum 120921 Frames flow into the switch through interfaces on the switching modules Each switching module connects to a mux buffer on the backplane that supports a connection of up to 6 Gbps up Tx to the supervisor engine and 6 Gbps from Rx the supervisor engine When a frame reaches the supervisor engine it is examined and either sent out of an interface in one of the other slots
150. ssist you as quickly as possible Date you received the switch e Chassis serial number refer to Figure 5 3 to Figure 5 6 for serial number locations Type of software and release number Maintenance agreement or warranty information Brief description of the problem Brief explanation of the steps you have already taken to isolate and resolve the problem Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Chapters Troubleshooting See the Obtaining Technical Assistance section on page xx for more information about contacting the TAC Serial Numbers When you contact Cisco Technical Assistance have the serial number of your switch available Refer to Figure 5 3 to 5 6 to locate the serial number on your switch You may also get the serial number from the output of a show version command Figure 5 3 Catalyst 4503 Serial Number Location o O DDODDODDDDDUDUOUDU DODDODDDDDDDOUDU 88668 UDBDDODDOBDUDDDUDDU DDODDDODDDDDDUDUDU 78 14409 08 Cont
151. st 4500 series field replaceable units FRUs The information is presented in these sections Removing and Replacing the Power Supply page 4 2 e Removing and Replacing the Chassis Fan Assembly page 4 18 e Replacing Backplane Modules on a Catalyst 4507R or 4510R Switch page 4 24 For instructions on installing and replacing supervisor engine and switching modules refer to the Catalyst 4500 Series Module Installation Guide Removing and Replacing the Power Supply This section describes how to remove and install the AC input power supply and DC input power supply for the Catalyst 4500 series switches This information is presented in the following sections Required Tools page 4 5 e Removing an AC Input Power Supply page 4 5 Installing an AC Input Power Supply page 4 8 Removing a DC Input Power Supply page 4 11 Installing a DC Input Power Supply page 4 16 Warning Hazardous voltage or energy is present on the backplane when the system is operating Use caution when servicing Statement 1034 Figure 4 1 and Figure 4 2 show the AC input power supplies Figure 4 3 and Figure 4 4 show a the DC input power supplies Locate your power supply and notice the location of the captive installation screws Catalyst 4500 Series Switches Installation Guide EN 78 14409 08 Chapter4 Removing and Replacing FRUs Removing and Replacing the Power Supply Figure 4 1 AC Input Power Supply Captive
152. st traffic Supervisor Redundancy The Cisco Catalyst 4507R and Catalyst 4510R switches support 1 1 supervisor engine redundancy for integrated resiliency Redundant supervisor engines help minimize network downtime With the support of stateful switchover SSO the secondary supervisor engine serves as a backup to immediately take over after a primary supervisor failure During the switchover Layer 2 links are maintained transparently without the need to renegotiate sessions As a result business critical applications such as Voice over IP VoIP calls are not dropped The Nonstop Forwarding NSF Aware feature in Cisco IOS software is also supported providing the ability to interface with NSF capable devices and to continue forwarding packets as routing information is updated upon a supervisor engine switchover Catalyst 4500 Series Switches Installation Guide EZE 78 14409 08 P Warning P Warning P Warning CHAPTER 2 Preparing for Installation This unit is intended for installation in restricted access areas A restricted access area can be accessed only through the use of a special tool lock and key or other means of security Statement 1017 Only trained and qualified personnel should be allowed to install replace or service this equipment Statement 1030 This equipment must be grounded Never defeat the ground conductor or operate the equipment in the absence of a suitably ins
153. switch with packing foam pieces into the packing carton Fold in the top flaps of the packing carton and seal with packing tape 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Appendix B Repacking a Switch Figure B 1 Catalyst 4500 Series Switch Packing Mlaterial Documentation and N accessories Packing foam Packing carton S Packing foam Packing foam 68117 Catalyst 4500 Series Switches Installation Guide EIN 78 14409 08 INDEX Numerics A 10 100BASE T AC input power cords port LEDs 5 11 product numbers table 2 6 1000BASE T AC input power supplies interfaces 1 3 1 7 1 11 1 15 description 1 31 1000BASE X Ethernet interfaces 1 19 port and status LEDs figure 5 10 1000 W power supplies power cord plugs 2 5 power cords table 2 6 100BASE T interfaces 1 3 1 7 1 11 1 15 Interfaces 1 3 1 7 1 11 1 15 1300 W power supplies power cord plugs 2 5 2 6 power cords table 2 7 1400 W power supplies power cord plugs 2 5 2 6 power cords table 2 7 2800 W power supplies power cord plugs 2 6 power cords table 2 9 2 10 environmental monitoring 1 35 figure 1 31 1 32 4 3 handling figure 4 7 installing 4 8 removing 4 5 replacing 4 8 source circuit requirements 2 5 troubleshooting 5 6 verifying operation 4 10 See also DC input power supplies ACTIVE LED description table 1 24 air conditionin
154. t 4500 Series When the switch is properly configured implementing PoE is easy when itis used with a Cisco powered device that supports Cisco Discovery Protocol All PoE line cards automatically detect an attached powered device the moment it is installed Also the switch returns unused port power to the system power budget for use by other devices because it supports the IEEE802 3af optional power classifications The Cisco Catalyst 4500 series offers internal power supplies and external power devices for multiple deployment scenarios These scenarios include small and large deployments in AC or DC environments for data only configurations and scalability of up to 15 4 W per port for PoE configurations The switches share a common power supply form factor Each Cisco Catalyst 4500 Series chassis is designed for 1 1 power protection while meeting the needs of PoE demands In addition to power resiliency the Cisco Catalyst 4500 Series includes 1 1 supervisor engine redundancy Cisco Catalyst 4507R and Catalyst 4510R only and software based fault tolerance Integrated resiliency in both hardware and software minimizes network downtime helping ensure workforce productivity portability and customer success All available Cisco Catalyst 4500 Series power supplies can be used for data only deployments which typically require just a few hundred watts For deployments that dictate support for PoE power Cisco offers several options The Cisco
155. t all switching modules If you are having trouble with a module refer to the software release notes to be sure that it is supported by your software Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Chapters Troubleshooting Troubleshooting Supervisor Engines Troubleshooting Supervisor Engines This section only addresses problems with hardware Problems with features or configuration are not covered here Refer for your software configuration guide and release notes for information on configuring features or identifying known problems Table 5 2 describes the supervisor engine LEDs Check the LEDs on your supervisor and compare them to the described LED behaviors Table 5 2 Supervisor Engine LEDs LED Color State Description STATUS Indicates the results of a series of self tests Green All diagnostic tests passed Red A test failed Orange System boot or diagnostic test is in progress Off Module is disabled UTILIZATION Green 1 100 If the switch is operational this display indicates the current traffic load over the backplane as an approximate percentage LINK Indicates the status of the 10 100BASE T Green Orange Flashing orange Off Ethernet management port or uplink ports The link is operational The link is disabled by user The power on self test indicates a faulty port No signal is detected or there is a link configuration failure 78 1
156. t bus connectors areproperly seated 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter2 Preparing for Installation Site Power Requirements and Heat Dissipation A When removing a component use any available ejector levers or captive installation screws to release the bus connectors from the backplane or midplane Handlecarriers by available handles or edges only avoid touching the printed circuit boards or connectors Place a removed component board side up on an antistatic surface or in a static shielding container If you plan to return the component to the factory immediately place it in a static shielding container e Avoid contact between the printed circuit boards and clothing The wrist strap only protects components from ESD voltages on the body ESD voltages on clothing can still cause damage Never attempt to remove the printed circuit board from the metal carrier Caution For safety periodically check the resistance value of the antistatic strap The measurement should be between 1 and 10 megohm Mohm Site Power Requirements and Heat Dissipation This section provides module power requirements and heat dissipation specifications for the Catalyst 4500 series switches You should verify site power before you install the switch For more information about power management and planning refer to the Environmental Monitoring and Power Management chapter in th
157. tallation Guide 78 14409 08 Chapter5 Troubleshooting Troubleshooting the Power Supply If you are unable to resolve the problem or if you determine that either a power supply or backplane connector is faulty contact the Cisco Technical Assistance Center TAC for instructions Troubleshooting Power Problems using Cisco 105 Check for system messages related to the power supply and refer to the system message guide for your software release You may need to add a power supply or upgrade to a larger one for your current configuration or verify that the switches are set properly Connect a terminal to the console port and look for any of the following system messages C4K_CHASSIS 2 INLINEPOWEROFF C4K_CHASSIS 2 INSUFFICIENTPOWERDETECTED C4K_CHASSIS 2 INSUFFICIENTPOWERSHUTDOWN C4K_CHASSIS 3 INSUFFICIENTPOWER C4K_CHASSIS 3 INSUFFICIENTPOWERSUPPLIESDETECTED C4K_CHASSIS 3 MIXINPOWERDETECTED C4K_IOSMODPORTMAN 3 UNKNOWNPOWERSUPPLY CAK IOSMODPORTMAN 4 INLINEPOWEROVERMAX IOSMODPORTMAN 4 INLINEPOWERSUPPLYBAD CAK IOSMODPORTMAN 4 POWERSUPPLYBAD IOSMODPORTMAN 4 POWERSUPPLYFANBAD CAK SUPERVISOR 3 POWERSUPPLYSTATUSREADFAILED CAK SUPERVISOR 3 POWERSUPPLYSEEPROMREADFAILED CAK SUPERVISOR 3 POWERSUPPLYSEEPROMINVALID SUPERVISOR 4 INLINEVOLTAGEOUTOFRANGE You may also use the show environment status powersupply show module all and show power commands to monitor PS status load and activity
158. talled ground conductor Contact the appropriate electrical inspection authority or an electrician if you are uncertain that suitable grounding is available Statement 1024 Warning Class 1 laser product Statement 1008 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter2 Preparing for Installation Electrostatic Discharge If you will be using your switch as a PoE source the following warning applies Warning Voltages that present a shock hazard can exist on inline power circuits if interconnections are made by using uninsulated exposed metal contacts conductors or terminals Avoid using such interconnection methods unless the exposed metal parts are in a restricted access location and users and service people who are authorized to access the location are made aware of the hazard Arestricted access area can be accessed only through the use of a special tool lock and key or other means of security Statement 1072 This chapter describes how to prepare your site for the installation of the switch The information is presented in these sections e Electrostatic Discharge page 2 2 e Site Power Requirements and Heat Dissipation page 2 4 Power Connection Guidelines for AC Powered Systems page 2 5 e Site Planning Checklist page 2 16 Note See the Site Planning Checklist at the end of this chapter to help ensure that you complete all site planning activities before yo
159. tches Installation Guide EXE 78 14409 08 AppendixA Specifications Catalyst 4500 Series Power Supplies Table A 13 4200 W AC Input Power Supply Specifications Item Specification Minimum software requirement Cisco IOS Release 12 2 25 EWA Power over Ethernet Supported up to 4200 W AC input type Autoranging input with power factor corrector AC input voltage 100 to 240 10 for full range AC input current 16 A maximum at 200 VAC AC input frequency 50 60 Hz nominal 3 for full range Maximum KVA rating 5 25 KVA Power supply output 4200 W maximum 230 VAC 12 V 115 3 A 3 3 V 912 5 A Data 50 V Q 77 1 A PoE with two inputs 2100 W maximum 230 VAC 12 V 9115 3 A 3 3 V 912 5 A Data 50 V Q 38 5 A PoE with one input 2100 W maximum 120 VAC 12 V 9115 3 A 3 3 V 912 5 A Data 50 V Q 38 0 A PoE with two inputs 1050 W maximum 120 VAC 12 V 55 9 A 3 3 V 912 5 A Data 50 V 14 6 A PoE with one input Max heat dissipation 3583 BTUs hr Output holdup time 20 ms minimum S Note The 4200 W AC power supply should not be used in mixed voltage configurations All the inputs in a chassis must be at the same voltage 110 VAC or 220 VAC Catalyst 4500 Series Switches Installation Guide 78 14409 08 ES AppendixA Specifications Catalyst 4500 Series Power Supplies Table A 14 shows the wattage output possible with the 4200W power supply in redu
160. tching module WS X4448 GB SFP 48 port IEEE 802 3af compliant PoE 10 100 1000BASE T Gigabit Ethernet switching module WS X4548 GB RJ45V e Access Gateway Module WS X4604 GWY 1 You will need to configure the 1400 W DC input current as appropriate for the model of switch Refer to Appendix Specifications 2 The 1000 W AC and 1300 W AC power supplies for the Catalyst 4500 series will fit and function a Catalyst 4510R however power management may be required in high density configurations Catalyst 4500 Series Switches Installation Guide 78 14409 08 EE Chapter Product Overview Supervisor Engines Supervisor Engines The following supervisor engines are available for the Catalyst 4500 series switches e Supervisor Engine II WS X4013 Figure 1 5 e Supervisor Engine II Plus WS X4013 Figure 1 6 e Supervisor Engine II Plus TS WS X4013 TS Figure 1 7 e Supervisor Engine II Plus IOGE WS X4013 10GE Figure 1 8 e Supervisor Engine III WS X4014 Figure 1 9 e Supervisor Engine WS X4515 Figure 1 10 Supervisor Engine WS X4516 Figure 1 11 e Supervisor Engine V 10GE WS X4516 10GE Figure 1 12 The Catalyst 4500 series supervisor engines have the following features Table 1 5 Supervisor Engine Features Feature Description Data path and control Available on all network interfaces Management functions Interface monitoring Environmental status SN
161. to 3 25 conventions warnings xiii H Catalyst 4500 Series Switches Installation Guide 78 14409 08 D DC input power supplies connecting system ground 3 23 description 1 31 environmental monitoring 1 35 figure 1 32 1 33 4 4 handling figure 4 15 installing 4 16 removing 4 11 replacing 4 16 See also AC input power supplies troubleshooting 5 6 verifying operation 4 18 dimensions Catalyst 4503 switches table A 2 Catalyst 4506 switches table 4 Catalyst 4507 switches table A 5 A 6 disconnecting ground connections warning 4 13 documentation conventions xi electrostatic discharge see ESD environmental monitoring power supplies 1 35 Index ESD cabling and preventing damage 2 2 2 3 Ethernet management ports figure 1 22 LEDs 5 4 troubleshooting 5 4 F FAIL LEDs checking 4 10 verifying power supply status 4 18 fan assemblies booting 5 2 Catalyst 4503 switches figure 1 3 Catalyst 4506 switches figure 1 7 Catalyst 4507 switches figure 1 11 1 15 description 1 27 installing 4 23 power supplies 1 35 removing 4 23 replacing 4 22 troubleshooting 5 8 verifying installation 4 24 FAN OK LED checking 4 10 description 1 34 Fast Ethernet See 100 78 14409 08 Catalyst 4500 Series Switches Installation Guide Bg Index field replaceable units See FRUs Flash code troubleshooting 5 5 FRUs AC input power supplies 4 5 to 4 10 DC inp
162. tor corrector 100 to 240 10 for full range 16 A 100 VAC 7 A 240 VAC 50 60 Hz nominal 3 Hz for full range 1 76 KVA H Catalyst 4500 Series Switches Installation Guide 78 14409 08 AppendixA Specifications Catalyst 4500 Series Power Supplies Table A 6 1300 W AC Input Power Supply Specifications continued Item Specification Power supply output 1300 W maximum 1000 W 40 W redundant mode Data 1667 W maximum in combined mode Data 800 W maximum each in redundant mode PoE 1333 W maximum in combined mode PoE Power supply output AC supply 12 V 84 7 A 3 3 V 12 5 A Data 50 V 16 7 A PoE Max heat dissipation 1568 BTUs hr Output holdup time 20 ms minimum Table A 7 1400 W AC Input Power Supply Specifications Item Specification Minimum software requirement Cisco IOS Release 12 2 18 EW Catalyst Operating System software version 8 3 1 GLX Power over Ethernet Not supported AC input type Autoranging input with power factor corrector AC input voltage 100 to 240 10 for full range AC input current 16 A 100 VAC 7 A 240 VAC AC input frequency 50 60 Hz nominal x3 Hz for full range Maximum KVA rating 1 76 KVA Catalyst 4500 Series Switches Installation Guide 78 14409 08 wa AppendixA Specifications Catalyst 4500 Series Power Supplies Table A 7 1400 W AC Input Power Supply Specifications continu
163. trap or the disposable ESD strap included with the system 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Chapter3 Installing the Switch ina Rack Rack Mounting the Switch Rack Mounting Catalyst 4500 Series Switches Warning To prevent bodily injury when mounting or servicing this unit in a rack you must take special precautions to ensure that the system remains stable The following guidelines are provided to ensure your safety e This unit should be mounted at the bottom of the rack if it is the only unit in the rack When mounting this unit in a partially filled rack load the rack from the bottom to the top with the heaviest component at the bottom of the rack e Ifthe rack is provided with stabilizing devices install the stabilizers before mounting or servicing the unit in the rack Statement 1006 Follow these steps to install a Catalyst 4500 series switch in a rack Step 1 Prepare for installation as follows a Place the chassis on the floor or on a sturdy table as close as possible to the rack Leave enough clearance to allow you to move around the chassis b Use a tape measure to measure the depth of the rack Measure from the outside of the front mounting posts to the outside of the rear mounting strip The depth must be at least 19 25 inches 48 9 cm but not greater than 32 inches 81 3 cm c Measure the space between the inner edges of the left front and right front m
164. u install the switch Electrostatic Discharge Electrostatic discharge is common on Category 5E and Category 6 cabling systems Category 5E and Category 6 cables have higher capacitance than Category 5 cables As a result Category 5E and Category 6 cables can store higher voltages than Category 5 cables and are more prone to damaging networking equipment if a differential discharge event occur Unshielded twisted pair cables can store high voltages When these charged cables are connected to networking equipment energy is discharged into the networking equipment this is known as electrostatic discharge ESD Networking equipment is commonly designed and tested to withstand common mode ESD events of up to 2000 V The design for the common mode event is based on the expectation that the discharge is delivered to all pins of a port at once Catalyst 4500 Series Switches Installation Guide EN 78 14409 08 Chapter2 Preparing for Installation Electrostatic Discharge Sometimes voltage is discharged to some of the pins of the connector and not others or to some pins on the connector before others This is known as a differential discharge event which can damage the networking equipment being connected You can take the following measures to prevent ESD cable damage e Ground the cable before connecting the networking equipment You can create a grounding cable using an RJ 45 patch cable by doing the following
165. uipment causes interference to radio or television reception try to correct the interference by using one or more of the following measures Turn the television or radio antenna until the interference stops Move the equipment to one side or the other of the television or radio Move the equipment farther away from the television or radio Plug the equipment into an outlet that is on a different circuit from the television or radio That is make certain the equipment and the television or radio are on circuits controlled by different circuit breakers or fuses Modifications to this product not authorized by Cisco Systems Inc could void the FCC approval and negate your authority to operate the product The Cisco implementation of TCP header compression is an adaptation of a program developed by the University of California Berkeley UCB as part of UCB s public domain version of the UNIX operating system All rights reserved Copyright O 1981 Regents of the University of California NOTWITHSTANDING ANY OTHER WARRANTY HEREIN ALL DOCUMENT FILES AND SOFTWARE OF THESE SUPPLIERS ARE PROVIDED AS IS WITH ALL FAULTS CISCO AND THE ABOVE NAMED SUPPLIERS DISCLAIM ALL WARRANTIES EXPRESSED OR IMPLIED INCLUDING WITHOUT LIMITATION THOSE OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT OR ARISING FROM A COURSE OF DEALING USAGE OR TRADE PRACTICE IN NO EVENT SHALL CISCO OR ITS SUPPLIERS BE LIABLE FOR ANY INDIRECT SPEC
166. use SFP modules for Gigabit Ethernet connections or X2 modules for 10 Gigabit Ethernet connections Refer to the installation note for your supervisor engine for more details on these modules Slot 1 is reserved for the supervisor engine only which provides switching local and remote management and switch status monitoring Slot 2 is reserved for a redundant supervisor engine only Slots 3 through 7 are available for switching modules Table 1 3 describes the features of the Catalyst 4507R switch Table 1 3 Features of the Catalyst 4507R Switch Feature Description Ethernet speeds e Ethernet ITOBASE T interface to workstations and repeaters e Fast Ethernet 100BASE T interface to workstations servers switches and routers Note Autonegotiation of link speed on each 10 100 port allows migration to 100BASE T from a IOBASE T installed base e Gigabit Ethernet 1000 and 1000BASE X interfaces for backbone interconnection of high performance switches and routers 10 Gigabit Ethernet interfaces for backbone interconnection of high performance switches and routers Standard equipment Seven slot modular chassis with one slot reserved for a supervisor engine one slot reserved for a redundant supervisor engine and five slots for switching modules Two power supply bays One hot swappable fan assembly Power supplies e Can supporta 1000 W 1300 W 1400 W 2800 W or 4200W AC input power
167. ut power supplies 4 11 to 4 18 fan assemblies 4 18 to 4 24 G Gigabit Ethernet See 1000BASE T See 1000BASE X GOOD LEDs checking 4 10 troubleshooting 5 6 verifying power supply status 4 18 grounding connecting systems 3 23 ground wire figure 4 13 heat dissipation description table 2 4 supervisor engines 2 4 switch chassis 2 4 switching modules 2 4 help See TAC hot swapping fan assemblies 4 18 humidity Catalyst 4503 switch specifications table A 2 Catalyst 4506 switch specifications table A 3 Catalyst 4507 switch specifications table A 5 A 6 INPUT OK LED description table 1 34 installing AC input power supplies 4 5 to 4 10 DC input power supplies 4 11 to 4 18 fan assemblies 4 18 to 4 24 installing switches in racks 3 3 to 3 25 L labels chassis serial number See serial numbers L brackets rack mounting switches 3 5 LEDs m Catalyst 4500 Series Switches Installation Guide 78 14409 08 checking power supplies 5 4 checking supervisor engines 5 2 See also specific types of LEDs Link LED description table 1 24 LINK LEDs table 5 11 load sharing power supplies 1 35 MAC addresses supported on Catalyst 4503 switches table 1 18 management local on Catalyst 4503 switches 1 3 local on Catalyst 4506 switches 1 7 local on Catalyst 4507 switches 1 11 1 15 remote on Catalyst 4503 switches 1 3 remote on Catalyst 4506 switches 1 7 remote on Catalyst 4507 s
168. uuuauuauacaaauaaaaaa daaannnaaanaaaaunucuuuaaaaaaaaaaanaaaanunud o uaaaaanaaauanauaaaaauunuanuaraaaaaanana nnnnnnnnnnnnmnmnnmnnmmnmnnnmnmmnnmnmnmmmnmnmminmn 1 0 0 0 a n TO TO Ge OC 3duu aancaananaannmaaananaunnaacanaananeauna AOA o n v co nmancanaananncananannnanannr E LIC LI LI CI CD Install the chassis in the rack as follows Step 3 Insert the rear of the chassis between the mounting posts See Figure 3 9 to see how to install the Catalyst 4503 switch in a rack See Figure 3 10 to see how to install the Catalyst 4506 switch in a rack See Figure 3 11 to see how to install the Catalyst 4507R switch in a rack See Figure 3 12 to see how to install the Catalyst 4510R switch in a rack Catalyst 4500 Series Switches Installation Guide b Align the mounting holes in the L bracket with the mounting holes in the equipment rack 78 14409 08 Chapter3 Installing the Switch in a Rack Rack Mounting the Switch c Secure the chassis using at least six three per side 12 24 x 3 4 inch screws through the elongated holes in the L bracket and into the threaded holes in the mounting post d Useatape measure and level to ensure that the chassis is installed straight and level Figure 3 9 Installing a Catalyst 4503
169. vailable it can maintain maximum overcurrent protection for each power connection Catalyst 4500 Series Switches Installation Guide 78 14409 08 Chapter4 Removing and Replacing FRUs Removing and Replacing the Chassis Fan Assembly Step 8 Step 9 Step 10 Verify power supply operation by checking the power supply s front panel LEDs You should see the following The LED labeled INPUT OK is green The LED labeled OUTPUT FAIL is not lit Check the power supply and system status from the system console by entering the show system command Catalyst Operating System or the show power command Cisco IOS For more information on these commands refer to the command reference publication for your switch and software If the LEDs or the show system command Catalyst Operating System or the show power command Cisco IOS output indicate a power problem or other system problem see Chapter 5 Troubleshooting for more information Removing and Replacing the Chassis Fan Assembly This section describes how to remove and install the chassis fan assembly for the Catalyst 4500 series switches See Figure 4 17 for the Catalyst 4503 system fan assembly Figure 4 18 for the Catalyst 4506 system fan assembly Figure 4 19 for the Catalyst 4507R system fan assemblies and Figure 4 20 for the Catalyst 4510R system fan assemblies Catalyst 4500 Series Switches Installation Guide EXE 78 14409 08 Removing and Replac
170. witch or two Supervisor Engine II Plus 10GEs are present in a Catalyst 4507R one X2 uplink is active on both the primary active and secondary standby supervisor engines by default or two uplinks will be active in a nonredundant configuration 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Chapter Product Overview Supervisor Engines SFP Ports Gigabit Ethernet SFP ports operate in full duplex mode only and are present on the WS X4013 TS WS X4516 10GE and WS X4013 10GE supervisors as well as some switching modules These ports use the 1000BASE SX 1000BASE LX Cisco Coarse Wave Division Multiplexing CWDM SFPs 1000BASE T SFP and 1000BASE ZX SFP SFP connectors vary with interface type and may use multimode fiber MMP single mode fiber SMF cable or copper Ethernet cables 10 100BASE T Port The 10 100BASE T port supports emergency image recovery The 10 100BASE T port supports image downloads from the ROMMON You can use this feature when the onboard Flash memory does not contain any IOS images usually after all images were accidentally deleted from onboard Flash CONSOLE Port The CONSOLE port has an EIA TIA 232 RJ 45 connector The CONSOLE port allows you to perform the following functions Configure the switch from the CLI e Monitor network statistics and errors e Configure SNMP agent parameters Note RESET Button EIA TIA 232 was known as recommended standard RS 232 bef
171. witches 1 11 1 15 Media Access Control addresses See MAC addresses Mux buffers 4 24 5 9 O OUTPUT FAIL LED environmental monitoring 1 35 Index P packaging materials B 1 port status LEDs 5 11 power requirements 2 4 power cords See AC input power cords power supplies LEDs 5 4 load sharing 1 35 See AC input power supplies DC input power supplies external power supplies preventing ESD damage 2 3 rack mounting checklist 3 5 switches 3 4 Redundancy modules 4 24 5 9 removing AC input power supplies 4 5 DC input power supplies 4 11 repacking switches B 1 replacing AC input power supplies 4 8 to 4 10 DC input power supplies 4 16 to 4 18 fan assemblies 4 23 78 14409 08 Catalyst 4500 Series Switches Installation Guide m Index s serial numbers 5 16 shipping instructions B 1 show system command 4 10 site planning checklist 2 16 slots Catalyst 4503 switches figure 1 3 Catalyst 4506 switches figure 1 7 Catalyst 4507 switches figure 1 11 1 15 specifications Catalyst 4503 switches table A 2 Catalyst 4506 switches table A 3 Catalyst 4507 switches table 4 A 6 startup troubleshooting 5 4 STATUS LED description table 1 24 Supervisor Engine III front panels figure 1 22 Supervisor Engine IV front panels figure 1 22 1 23 supervisor engines Catalyst 4503 switches 1 3 Catalyst 4506 switches 1 8 1 12 1 16 description 1 18 LEDs table 1 24 slot locations
172. with the 2 port Gigabit Ethernet switching module WS X4302 GB or the Access Gateway Module WS X4604 GW Y only When using a Supervisor Engine V 10GE any supported module may be used in slot 10 Table 1 4 describes the features of the Catalyst 4510R switch Table 1 4 Features of the Catalyst 4510R Switch Feature Description Ethernet speeds e Ethernet ITOBASE T interface to workstations and repeaters e Fast Ethernet 100BASE T interface to workstations servers switches and routers Note Autonegotiation of link speed on each 10 100 port allows migration to 100BASE T from a IOBASE T installed base e Gigabit Ethernet 1000BASE T and 1000BASE X interfaces for backbone interconnection of high performance switches and routers 10 Gigabit Ethernet interfaces for backbone interconnection of high performance switches and routers Standard equipment Ten slot modular chassis with one slot reserved for a supervisor engine one slot reserved for a redundant supervisor engine and eight slots for switching modules Two power supply bays One hot swappable fan assembly Power supplies e Can support a 1400 W 2800 W or 4200 W AC input power supply or a 1400 W DC input single or triple input power supply i Optional redundant power supply 78 14409 08 Catalyst 4500 Series Switches Installation Guide H Chapter Product Overview Switch Features Table 1 4 Features of the Catal
173. ximum weight 108 Ib 45 4 kg Chassis and backplane 45 5 Ib 20 6 kg Fan tray 6 0 Ib 2 7 kg Catalyst 4500 Series Switches Installation Guide EN 78 14409 08 AppendixA Specifications Catalyst 4500 Series Power Supplies Table A 4 Catalyst 4510R Switch Specifications continued Item Specification Airflow Switch Right to left Power supply Front to back Power PoE supplied 48 VDC Power to Modules and Fans 12 VDC Power to backplane components 3 3 VDC Redundancy Supervisor engine yes Power supply 1 1 Catalyst 4500 Series Power Supplies Tables A 5 through A 12 list the specifications for the Catalyst 4500 series power supplies Note All Catalyst 4500 series switch AC input power supplies require single phase source AC The source AC can be out of phase between multiple power supplies or multiple AC power plugs on the same power supply because all AC power supply inputs are isolated Each chassis power supply should have its own dedicated branch circuit 15 A or 20 A for North America and circuits sized to local and national codes for International locations For more information about power management and planning refer to the Environmental Monitoring and Power Management chapter in the Catalyst 4500 Series Switch Cisco IOS Software Configuration Guide version appropriate for your software Catalyst 4500 Series Switches Installation Guide
174. y Specifications continued Item Specification DC input current Input power Current draw At 40 5 V min voltage Current draw at 72 V max voltage Max heat dissipation at 1866 W Maximum KVA rating Power supply output DC supply DC input terminal block Output holdup time Max heat dissipation Data only 31 A 60 VDC Data and inline devices 180 A maximum 48 VDC input Note The input power is configurable in the CLI The Cisco IOS command is power dc input The Catalyst Operating Sysytem command is set power DC input Configure the switch software to match the requirements of your switch To learn how to calculate the DC input current for your system refer to the Calculating DC Input Current section on page 2 13 1866 W Data only 46 A 25 9 A 5760 BTUs 179 A max 48 VDC 1 87 data 9 15 data and voice Data 12 V 9120 A 3 3 V 10A Inline devices 140 A total maximum 35 A maximum each 5 channels 48 to 60 VDC input 1367 W 40 W redundant mode Data 2267 W maximum in combined mode Data 7500 W maximum each in redundant mode PoE 7280 W maximum in combined mode PoE Accepts FCI p n YAV25L2TC14FX90 or equivalent barrel type lug terminals with 90 degree angle two hole tongue which accommodates 1 0 AWG size copper wire The connector tongue width is 0 82 in the stud hole spacing is 5 8 in and the hole size is 1 4 in 4 ms 1591 BTUs hr data
175. y up slightly aligning the top and bottom guides Step3 Slide the fan assembly into the chassis until the two captive installation screws make contact with the chassis Step4 Using a screwdriver tighten the two captive installation screws by turning them clockwise Catalyst 4500 Series Switches Installation Guide 78 14409 08 ET Chapter4 Removing and Replacing FRUs Replacing Backplane Modules on a Catalyst 45078 or 45108 Switch Verifying the Installation lt Note Step 1 Step 2 Step 3 To check the operation of the fans you need to power up the chassis Follow these steps to verify that the new fan assembly was installed correctly Listen for the fans you should immediately hear them operating If you do not hear them ensure that the fan assembly is inserted completely in the chassis and that the faceplate is flush with the switch back panel The fan tray LED should light and be green If after several attempts the fans do not operate or if you experience trouble with the installation for instance if the captive installation screws do not align with the chassis holes contact the Cisco TAC for assistance Replacing Backplane Modules on a Catalyst 4507R or 4510R Switch Step 1 Step 2 There are 5 redundancy modules also called mux buffers and 1 clock module on a Catalyst 4507R chassis backplane A Catalyst 4510 has 8 redundancy modules on its backplane They are accessible from t
176. yst 4510R Switch continued Feature Description Supervisor engine e Supports the Supervisor Engine V and V 10GE support e Holds the ASIC based forwarding engine data path and the management processor and software control path Features interface monitoring environmental status and SNMP and console Telnet interface Note Packets are not forwarded while the module is removed a system reboot occurs when a supervisor engine is reinserted Switching module 24 port 10 100BASE TX Fast Ethernet switching module support WS X4124 RJ45 24 port 100 Fast Ethernet switching module WS X4124 FX MT 48 port 1 5 Fast Ethernet switching module WS X4148 FX MT 48 port LOOBASE LX10 Fast Ethernet switching module WS X4148 FE LX MT 48 port 10 100 Mbps Fast Ethernet switching module WS X4148 RJ 48 port 5 10 Fast Ethernet switching module WS X4148 FE BD LC 48 port 10 100 Mbps Fast Ethernet switching module WS X4148 RJ21 48 port Cisco pre standard Power over Ethernet PoE 10 100BASE TX switching module WS X4148 RJ45V 24 port IEEE 802 3af compliant PoE 10 100BASE TX switching module WS X4224 RJ45V 48 port IEEE 802 3af compliant PoE 10 100BASE TX RJ 45 switching module WS X4248 RJ45V 48 port 100 Fast Ethernet switching module WS X4248 FE SFP 48 port IEEE 802 3af compliant PoE 10 100BASE TX RJ 21 switching modul

Download Pdf Manuals

Related Search

Related Contents

Ventilateur Brumisateur / Ventilatore nebulizzatore  Am186CC Microcontroller Power Management Circuit Application  Radix 10/15 USER`S MANUAL  二つの世界記録を更新  Trendnet TV-IP422W/4PROM surveillance camera  E984--38X Sys Plan - Guillevin Industrial Automation Group  RT0700C - Makita  取扱説明書（PDFファイル） - サラヤ株式会社 企業・法人向けサイト  Intl Wine Storage UCG Horiz_Mutlilang.qxp:UCG - SUB-ZERO    

Copyright © All rights reserved. Failed to retrieve file