Home

Philips 170B5 CD Player User Manual

image

Contents

1. W I i i I i CICICICICI X P i i i i O Ui E UJ NJ HM CIE EI E II IILILILI 3 3 LI LI ID E OOOO CU CI II n n n UU UU O O O O CI i i i N i i 10 i i 11 12 3 LP 9 E E U UU UU UU U UU UU UU U UU UUULUL U FOU CID CC TEE CODE i i i eel i i i IL Ot Ot i E i i i ETE ETE EE 13 14 II I i i CQ Co U UU I i UU Ut i LJ 1 E O Windows 95 98 2000 M Windows 95 98 2000 Me XP U Ut file D My 20Docurents dfu W7 tai wan 170bb install gt start htm 3 of 3 2004 09 24 x Un E 04 25 53 F Irst Choice Warranty 0 J First Choice F Irst Choice IUUUUU UU 000 Liechtenstein HOUGUUO CI F 175 Choice
2. UL PI F LC S GAGA A amp aaa moon 3 C3 DODODO gt 00000 ao gt III 2 OOOO na 0205 SConoooo oo Se len sn on 5 nnn N M TWO N 00 Windows 95 1 1 1 1 Windows 98 1 1 1 1 1 file D My 20Documents dfu W7 taiwan 170b5 install gt_start htm 1 of 3 2004 09 24 x Un E 04 25 53 Getting Started Windows Me o LJ Oo a o L o LJ Oo DJ o a a o L o a o L Oo a o a CJ 1 CJ LA CJ CJ CJ CJ CJ CJ CJ CJ UUUUUUUUUUUUUUUUO I I I I I F ITT ITT L L JL DO OT OT 11 1 indowseMe Oo oo o Windows 2000 Indows 2000 UUUUUUUUUUUUUUUUO UOUUUUU UU UUUUUUUUUUUUUUU file D My 20Documents dfu W7 taiwan 170b5 install gt_start htm 2 of 3 2004 09 24 x Un E 04 25 53 Getting Started Windows XP indows 1 IUUUUUUUUUUUU UUOLUDUUUDUUULDUUUUUULUUUDUUULUUULUUUULUUULUL
3. O 0 107100 U DUDU rese pee ee ec a i Pn een n Pes A lh EREN es GK Gab E es o pe pe epa eri ea ENE ETE 216 E Ea ex i file D My 20Docurents dfu W7 taiwan 170b5 safety saf_faq htm 1 of 8 2004 09 24 Ux E 04 25 28 FAQs F requently Asked Questions 0 00 000000 000 LCDIUD U SUOUUUUUUUUUL 0 80pgd0000 000 ul UU UD HOU 85000 CDU I 00 inf icm pO 0000000000 cr DL D HBO BDO DO DO BD ODO DO DO ODO DO DO EBUOEUODLDLULML LL UL UUUUUUUUUUUUUUUUUUUUUUUOU 000 iem DL D D D E U U l Oo Oo OO OO OO O O U H BUB D UO D LI UI 5 98 1 tut 0900040 00000 000000006 0 0 0000 500000000 Rested DUDUUULDUUULLL 0 00 Auto 0000060 0 000 AUTOUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU OSD 7 U LCDOUUUUOUUUUUUUL file D My 20Docurents dfu W7 taiwan 170b5 safety saf_faq htm 2 of 8 2004 09 24 Ux E 04 25 28 FAQs F requentl y Aske
4. file D My 20Docurents dfu W7 taiwan 170b5 install connect htm 4 of 4 2004 09 24 x Ux E 04 25 51 T he base LU ULL N 200000 AAA aaa a file D My 20Documents dfu W 7 tai wan 170b5 instal base htm 1 of 4 2004 09 24 Un E 04 25 51 T he base 2000000000 0 OOL UU UU e VESA TU D LU L file D My 20Docurrents dfu W 7 tai wan 170b5 i nstal base htm 2 of 4 2004 09 24 x Un E 04 25 51 T he base Safe surface o 40040000000 ECDI file D My 20Documents dfu W7 tai wan 170b5 install base htm 3 of 4 2004 09 24 x Un E 04 25 51 T he base file D My 20Docurents dfu W7 taiwan 170b5 install base htm 4 of 4 2004 09 24 Ux E 04 25 51 Getting Started 7 U 044000000 nf 0 0 Windows 95 98 2000 Me XP O O O En Io Io CI 000000 U Philips I 0 0 0 0 Windows 95 98 2000 M e XPT U U nf L Windows Philips 0000 O VESA DDC2BII O O Windows 95 98 2000 M e XPT elease 2 98 2000 J L VU D D B D HI HU UO D DT U D
5. es E 1 1 AUTOLDILDUULDLULLULULDLU AUT OTI file D My9c20Documents dfu W7 tai wan 170b5 safety saf troub htm 1 of 3 2004 09 24 x Ux E 04 25 29 Troubleshooting e AUTO e 1 OSD CONTROLS LL EL EL BJ E DJ U Horizontal Position Vertical Position E E E E D 0 e 00000000000000 L e AUTO e O OSD MAIN CONTROLSI VIDEO NOISE CLOCK AD UST MENTI I 1 EH DDD e AUTO e O OSD MAIN CONTROLSI VIDEO NOISE PHASE AD USTMENT I 1 H EB DDD file D My 20Docurents dfu W7 tai war 170b5 safety saf_troub htm 2 of 3 2004 09 24 x Ux E 04 25 29 0000100 Regulatory Information e TCO 99 Regulatory Information Information 99 Environmental Requirements TCO 99 Information CO 03 Information Recycling Congratulations You have just purchased a TCO 99 approved Information for and labeled product Your choice has provided you with a product Customers developed for professional use Your purchase has also contributed to reducing the burden on the environment and also to the further develo
6. 00000 5401 0 D 41 104 file D M y 20Documents dfu W7 taiwan 170b5 safety safety htm 1 of 2 2004 09 24 Un 04 24 52 About T his Manual ara e e es pee OOOO L UUgut UUUUUUUUUUUUUUUUUUUUUUUUUU UUUUUUUUUUUUUUUUUUUUUUUUUUU UUUUUUUUUUUUUU UUgut e 0pd00 00 UUOUDUULDUUDULUULDUULUUUDULUULNLN e e 0000 0000000000000000 e O00000 BOB ADO DO DD ODO 000000000 e 0000 00000000000000 e uu e DU 0000000 e 0O OOL LU UL I UUUUUUUUUUUUUUUUUUU U B UU HU H UUUUUUUUU DUOUOULUOULD A file Dj M y 20Documents dfu WV7 tai wan 170b5 about about htm 1 of 2 2004 09 24 Un E 04 24 55 About T his Manual AN ZN UU gut O 2004 Koninklijke D LL D D D l DADO DO DO DO DU BD ODO DO DO DO DO DO DO UL file D My
7. Instalacja elektryczna pomiesscicnta powinna zawierac w prewatbae farowym rezeraxmva pred xwarciamt w postaci bezpeeczntik o wartasci znamianawe me wiekszej nz 16 amper vw W cela calkowitego wylaceenia urzadzenia 2 sieci zasilania nalezy wyj wtyczk kabla zasilajacepa z griazdka kt re powinno sig pobli u i v dar oi Znak bezpiecze stwa B potwierdza zgodno urzadzenia z wymagandami bezpiecze stwa Romania awa w PEUT ZT PB 216251 Pozosta e instrukcje bezpieczenstwa Nie nalezv usxywac wiyezek adaplerowech lub usuwa kolka obwodu ochronnego z wtyczki Jeseli konseczne jest pezedlusacza pa nalezy uzy preodludacia 3 zylenwego z prawidiowo polsezory przewodem cehrayi System kompulerowy nale y zabezpieczy przex nag ymi chwilowymi wzrostama lub spad kama napeect uzvwajac eliminatora przepeec dopasawujacegi lub bezzakbitemowegi zasilani Malezy upewnid sig aby nic me lezalo na kablach systemu komputerowego oraz aby kable me byly uinieszceone w iniegseu gdzie mona byloby mie nadepoywad lub porykac sig o me Die nalezy rozlewad napa and ey ch pondre Ba Mie nalezv wpychad zadnych przedaact w de gate systern kompwemweza edys maze ka powodowa pedar lub porasenie podem poprzex zwarcie elemento wewnetrznych System kommputerowy powinden znapdewa sig z dala od grzejnik w i zr del ciepla Parda
8. U OOUU0 LCDUUOUUUUL U TFTOUUUOUU EDO DO DO DO DDD ODO OD DD OD 00000000 TFT IBDUUDEUOUOUUUDLUEUDLUEUULUUUDLULUULULuLtutueututtultl file D My 20Docurents dfu W7 taiwan 170b5 safety saf_faq htm 6 of 8 2004 09 24 Ux E 04 25 28 FAQs F requentl y Asked Questions al Y pL N E LILI en OA 1 C3 s oot rr O x OS E 1 ES 1 1 1 1 1 1 1 1 KE 1 1 1 1 O a Pe LL H o lt 1 L3 5 J LCDUUULDUDUUUDUDDULD 60000 1 1 zu 1 a O E LL E 1 1 1 A O 1 1 OB 00D ODO DD ODO DD O EEPOOO0 0000000 ECDITDIL DL UO D DUE UL UO D HI UE U D L LCDOIUUUUUUUUUUUUUUUUUUUUUUUUUUUU 0 0 CRT DIL L LOD D D file D My 20Docurents dfu W7 taiwan 170b5 safety saf_faq htm 7 of 8 2004 09 24 Ux E 04 25 28 FAQs F requentl y Asked Questi ons Uti 0 00 CEQUU GEI EL D LI LI D UL LI O 73 LJ ECDITDILBL DO D DUE UL U D HI UE U D L HOUUUO ECDIUD LU LUUU 000000 MPR I ID T CO 99 UUUUUUUUUY Uti file D My 20Docurents dfu W7 taiwan 170b5 safety saf_faq htm 8 of 8 2004 09 24 x Ux 04 25 28 E LUU D LUUDLU Troubleshooting JU Ud UUUUUUUUUUUUUUUUUUUUUUUUUOUUUUUUUU
9. Ul Ul First Choice 00000060 se E E gt E E E y EX EC i wa er zu a ooo du ooo Ge ooo E Ze ooo ES ES Gen E Ej Seee E E E e aca O m nooo n EE YA ma YA ma masa ooog cud CODE oo Soomoomoogm aaa p O mnoooooooso P 1 iss Bs m ma a EHE es fm ESSE ES 1 1 1 1 3 E Er E E E uu ES ESI om Te se E m ESSE ES UU ULUUL UL file D My 20Documents dfu W7 tai wan warranty WAR_1ST HT 1 of 2 2004 09 24 x E 04 26 01 F Irst Choice Warranty U www philips conysupport UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU M O www philips comsupport UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU HHUUL Ull 1 286 386 486 P enti umP ro 1 O o D d d Windows DOS OS 2 MAC o 010000 e UUUDUUUUI UUUUUUUUUUUUUU e UUDUDUUUDUUUDUUDUUDUUDUUDUUDUUDUI e I LUUUUUUDLUULULUUUULUUUULUUULUL UUUUUUUUUUUUUUUUU httpz www philips com support file Dj My 20Documents dfu W7 tai wan warra
10. Product Information e 1000 UUUUUUUUUUUUOUUUUUUUUOUUUUUU Hone Monier and SIDA AIVA TATA e General file D M y 20Documents dfu W7 taiwan 170b5 product smart htm 3 of 5 2004 09 24 x Un E 04 25 41 SmartM anage dior and RIVA INTE med E Bene Mens imu Pedi EEE Ro A y AA A non UD 1 SmartManagd SmartControl SmartManagd OO Lu ODO B LB HH HH D D 00000000000 SmartControl LU O E OOO EEE O CEE O GE OUG UU U GU EEE DEEL U 2 5 7 5 5 O U Ul 3 0 0 0 Smertcontrolf 000000000 00000000000 BOBO DO DO DO l0 lll ULL UDOUUUULDLL d4000000000000 Properties gt Hardware gt OO 0 0 0 U OU Plug and Play Monitor BL II DO D D 7 U U U uuu Bu Bu i O 1 O 1 martControl 0 0 L SmertControl 0000000 000000000 00000000 4 UU SrertContral YO UDO dd OB O DB
11. au jene IE mr ooo o o o cce n umm ooo L3 01010109 noo L3 Lf63rarr3 X ODO OY oooO o o 5 q L3 20000 a Qi Aroma ooo OOOH o ooo e 3 noooooo ooo a Wama o Kawa 0 noo 2 3 ooo a gt r3 ES E E3 E3 o E3 GG Ez d L3 E Ed E43 ao ag H o L3 E EJ 1 o o o o zu 1 C C3 Ed E3 c3 H OOOO e IE EE Ey ER d L3 E E3 E3 aog H 3 o E EJ E Oooo Dom oO Jones qc unan O III O E OOO H dE ei a un j 3 3 ES fa me ml m 3 mea pem a Pe DOO E al EEE file D My 20Documents dfu W 7 taiwan 170b5 product pixel htm 1 of 3 2004 09 24 x Ux E 04 25 43 Philips Pixel Defect Policy 00000000000 0 0 00000000000 0 0 0 TRAUE 0 0 00000 800000000 U 0000000 000000000000 uum 0000060 UUUDUULDULULLL 200000000 lo o 2002 00 00080 0000 lo ER DB EDS file D My9c20Documents dfu W7 tai wary 170b5 product pi xel htm 2 of 3 200
12. ala he C CI 3 r3 L3 Oo a o Cr E pn oO oF O CC C O o a E Ui og a a 92 Ho os SHE a m 8 es AA es a ao 20 CH me Lr See E 20 Lu Ex 2 E EE eu Oo 1 Oo 1 5 B aa o H O Ono OO ono x O r4 CC D D gt HO Oo Oo 2 A 2 ODG I Oy oo E E si nm a E a Pi a D mnm m nooo y Ex y oo oo m HEGE Oo 20 E sooo y Oo L3 5 a OSCO oo aa ea 3 So OOOO y LI oo O 5 So QOO a A os no vi E 9A 2 0000 y O m oo 5 c g7 2000 p0 d ng n mum ES a O pj 2000 op D 037 2 So po 2000 ot E 5 muuu Ho o O o a 5 Cim ao mr vo OF OOO oo 3 3 E ojo Oo oo a O 5 oc oC oo S E E Q O gt a D Product Information DU DI 1280 x 1024 75Hz 7000000 1280 x 1024 60Hz 300000000000 15000010000 31 5 640 350 70 31 5 720 400 70 31 5 640 480 60 35 0 640 480 67 37 5 640 480 75 35 2 800 600 56 37 9 800 600 60 46 9 800 600 75 49 7 832 624 75 48 4 1024 768 60 60 0 1024 768 75 69 0 1152 870 75 71
13. 0 no CC O O 00000 CIC CIC O L Seer Eel eee CT E oo CIC mo OO oO e 3 2 5 no D 20 al O 5 Ey LI O om DD mma gi mm oo L1 SE oo oo oo oo E J m oo O OD Og L1 L3 CDD Do E ou O rr rr M Hu 2g OO oo gt II o x oO D oOo O United States Guarantee e JODODODODOUDDDDO Ul IA DA 877 835 1838 00000000 919 573 UUDDUUL 877 835 1838 919 573 7855 OO El OO El UUUUUUUUUL UUUUUU 800 479 6696 file D My 20Docurents dfu W7 tai wan warranty WAR_USA HT M 2 of 3 2004 09 24 x Ux 04 26 04 United States Guarantee uugumasuuagaudusuuulHuumy iBiusuutriitultiulutltltLlutl Philips
14. DI 0O O L EDID file D M y 20Documents dfu W7 tai wan 170b5 glossary glossary htm 1 of 3 2004 09 24 Un 04 25 15 Glossary 1 es 1 a CJ CJ CJ 1 1 a 1 1 L Z 2 CJ 1 1 1 1 DUU a un U J E O O ke Y 5 D as DUU LCD D D LI LU DUU vertical Refresh Rate 0000 file D My 20Docurrents dfu W7 taiwan 170b5 glossary glossary htm 2 of 3 2004 09 24 Un 04 25 15 Download and Print E a E Odo djust L3 EE E ECH 000000 UJ 9 200 Mex xP 0000000060 e DD PC drivers 0 inf icmy cat 2 10 0 DD OO Driver installO2 txt Ut PAD 00000000 Acrobat Reader 1 L1 0000000 Adobe amp Acrobat Reader 00000000000 PCO Adobe Acrobat Reader Macintosh Adobe Acrobat Reader UU DUDU 1 U 95 992000MeXP I JI 170B5 pdf 170P5 pdf 17055 pdf 20000000000 00000 0 00000 000000 L file Dj M y 20Documents dfu W7 tai wan download download htm 1 of 3 2004 09 24 Un 04 25 18 Download and Prin
15. 0 D H U U D D CDI 000000000 UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUOUUUUUUOUUU O 1L file D My 20Docurents dfu W7 taiwan 170b5 install install htm 2 of 3 2004 09 24 x Un E 04 25 04 On Screen Display UU OD uiu UUUUUUOUUUUL E SSS pe aaa ao 5 AWooooo MAIN CONTROLS ADJU ST POSITION BRIGHTNESS amp CONTRAST VIDEO NOISE ADJUST COLOR OSD SETTINGS PRODUCT INFORMATION RESET TO FACTORY SETTINGS INPUT SELECTION EXIT MAIN CONTROLS Si 3 11 em mw ett Ex e va HE MOVE SELECTION THEN Ug file D My 20Documents dfu W7 taiwan 170b5 0sd osddesc htm 1 of 4 2004 09 24 xt Un E 04 25 08 On Screen Display First Level Second Level LANGUAGE ENGLISH ESPA OL FRAN AIS DEUTSCH ITALIANO bi ADJUST POSITION HORIZONTAL VERTICAL BRIGHTNESS amp CONTRAST BRIGHTNESS CONTRAST VIDEO NOISE PHASE CLOCK ADJUST COLOR ORIGINAL PANEL COLOR 9300K FOR CADYCAM nn FOR IMAGE MANAGEMENT 5 USER PRESET RED GREEN BLUE OSD SETTINGS HORIZONTAL WERTICAL PRODUCT INFORMATION SERIAL HO RESOLUTION VIDEO INPUT RESETTO FACTORY SETTINGS NO INPUT SELECTION ANALOG DIGITAL EXIT MAIN CONTROLS file
16. 2765 Fax 91 20 712 1558 BOMBAY Philips India Customer Relation Centre Bandbox House 254 D Dr A Besant Road Worli Bombay 400 025 CALCUTTA Customer Relation Centre 7 justice Chandra Madhab Road Calcutta 700 020 MADRAS Customer Relation Centre 3 Haddows Road Madras 600 006 NEW DELHI Customer Relation Centre 68 Shivaji Marg New Dehli 110 015 file D My 20Documents dfu W7 taiwan warranty W ARCIC HTM 7 of 11 2004 09 24 HUGE 04 27 12 Consumer Information Centers INDONESIA Philips Group of Companies in Indonesia Consumer Information Centre Jl Buncit Raya Kav 99 100 12510 Jakarta Phone 021 794 0040 798 4255 ext 1612 Fax 021 794 7511 794 7539 KOREA Philips Korea Ltd Philips House C P O box 3680 260 199 Itaewon Dong Yongsan Ku Seoul 140 202 Phone 080 600 6600 Local toll free Fax 02 709 1245 MALAYSIA Philips Malaysia Sdn Berhad Service Dept No 51 sect 13 Jalan University 46200 Petaling Jaya Selagor P O box 12163 50768 Kuala Lumpur Phone 03 7950 5501 02 Fax 03 7954 8504 PAKISTAN KARACHI Philips Electrical Ind of Pakistan Consumer Information Centre F 54 SITE P O Box 7101 75730 KARACHI Philips Consumer Service Centre 168 F Adamjee Road Rawalpindi Cantt Phone 021 7731927 Fax 021 7721167 file D My 20Documents dfu W7 taiwan warranty W ARCIC HTM 8 of 11 2004 09 24 HUGE 04 27 12 Consumer Information Centers PHIL
17. 3 Figtree Drive Homebush Bay NSW 2140 Phone CIC 1300 363 391 PCE Service 1300 361 392 toll free Fax 61 2 9947 0063 NEW ZEALAND Philips New Zealand Ltd Consumer Help Desk 2 Wagener Place Mt Albert P O box 1041 Auckland Phone 0800 477 999 toll free Fax 0800 288 588 toll free file Dl My 20Documents dfu W7 taiwan warranty W ARCIC HTM 5 of 11 2004 09 24 04 27 12 Consumer Information Centers BANGLADESH Philips Service Centre 100 Kazi Nazrul Islam Avenue Kawran Bazar C A Dhaka 1215 Phone 02 812909 Fax 02 813062 CHINA BEIJING Beijing Authorized Service Centre Consumer Information Centre Building 6 West Street Chong Wen Men Beijing Jin Bang Co Led 100051 BEIJING GUANGZHOU Philips Authorized Service Centre 801 Dong Feng Road East Guangzhou 510080 SHANGHAI Philips Service Logistic Centre Consumer Information Centre P O Box 002 027 Nextage Department Store Pudong New District 200002 SHANGHAI Philips Authorized Service Centre Consumer Information Centre 148 Fu Jian Road M 200001 Shanghai Phone 800 820 5128 toll free Fax 21 656 10647 file D My 20Documents dfu W7 taiwan warranty W ARCIC HTM 6 of 11 2004 09 24 HUGE 04 27 12 Consumer Information Centers HONG KONG Philips Hong Kong Limited Consumer Information Centre 16 F Hopewell Centre 17 Kennedy Road WANCHAI Phone 2619 9663 Fax 2481 5847 INDIA Phone 91 20 712 2048 ext
18. Tel 36 1 2426331 Email inbox serware hu Website www serware hu SLOVAKIA Philips Authorised Service Center Datalan Servisne Stredisko Puchovska 8 SK 831 06 Bratislava Tel 421 2 49207155 Email servis datalan sk file DI My 20Documents dfu W7 taiwan warranty W ARCIC HTM 1 of 11 2004 09 24 XxUXE 04 27 12 Consumer Information Centers SLOVENIA Philips Authorised Service Center PC HAND Brezovce 10 SI 1236 Trzin Tel 386 1 530 08 24 Email servis pchand si POLAND Philips Authorised Service Center Zolter ul Zytnia 1 PL 05 500 Piaseczno Tel 48 22 7501766 Email servmonitor zolter com pl Website www zolter com pl RUSSIA Consumer Information Center Tel 7 095 961 1111 Tel 8 800 200 0880 Website www philips ru TURKEY Consumer Information Center Turk Philips Ticaret A S Yukari Dudullu Org San Bolgesi 2 Cadde No 22 34776 Umraniye Istanbul Tel 0800 261 33 02 file DI My 20Documents dfu W7 taiwan warranty W ARCIC HTM 2 of 11 2004 09 24 XxUXE 04 27 12 Consumer Information Centers ANTILLES Philips Antillana N V Kaminda A J E Kusters 4 Zeelandia P O box 3523 3051 Willemstad Curacao Phone 09 4612799 Fax 09 4612772 ARGENTINA Philips Antillana N V Vedia 3892 Capital Federal CP 1430 Buenos Aires Phone 011 4544 2047 BRASIL Philips da Amaz nia Ind Elet Ltda Av Luis Carlos Berrini 1400 Sao Paulo SP Phone 0800 701 020
19. 20Documents dfu W7 tai wan 170b5 about about htm 2 of 2 2004 09 24 x Un 04 24 55 e VHUUUUUL SmartManage 40004 O 170B5 Product Information i B HIRB I B H IH H HBH H H H B MATAA oldo L1 L1 e 1 1 1 1 1 1 1 ooldoolLldooo UU 1 43 2 cm 337 9 x 270 3 mm 1600 0 264 x 0 264 rm UD DOdoDoO UU HUUU UDUDDUDUI HOUUUUU file D My 20Documents dfu W7 tai wan 170b5 product product htm 1 of 9 2004 09 24 x Un E 04 25 00 Product Information p LL EB EE UL U 56 Hz 76 Hz e 0000060 130 kHz 82 kHz m Bu UU E BEN aon e 000000 IVpp 2 HOUUUUU UUODDUUL ELLE BUD 6 00000 X 0000 I 2WRMSxz2 300 Hz13 kHz 16 ohm PMPO UL E 0000 3 50m0 000 000000 35mmg 000 un e 45010 D 0 00 c UU 250cd men 0000 00000 60000 x 0 283 y 0 297 9300 DP x 0 313 y 0 329 6500 x 0 313 y 0 329 SRGB file D My 20Documents dfu W7 tai wan 170b5 product product htm 2 of 9 2004 09 24 x Un E 04 25 00 Product Information O LIK LA r3 ES Oo el CO 1 LIK Io a ES Ou no CI HO 3 oo un c H Oo
20. 865 521 4322 RETURN TO TOP OF THE PAGE CE Declaration of Conformity Philips Consumer Electronics declare under our responsibility that the product is in conformity with the following standards EN60950 2000 Safety requirement of Information Technology Equipment EN55022 1998 Radio Disturbance requirement of Information Technology Equipment EN55024 1998 Immunity requirement of Information Technology Equipment EN61000 3 2 1995 Limits for Harmonic Current Emission EN61000 3 3 1995 Limitation of Voltage Fluctuation and Flicker following provisions of directives applicable 73 23 EEC Low Voltage Directive 89 336 EEC EMC Directive 93 68 EEC Amendment of EMC and Low Voltage Directive and is produced by a manufacturing organization on ISO9000 level The product also comply with the following standards 1 09241 3 1809241 7 I809241 8 Ergonomic requirement for Visual Display 15013406 2 Ergonomic requirement for Flat panels GS EK1 2000 GS specification prEN50279 1998 Low Frequency Electric and Magnetic fields for Visual Display MPR II MPR 1990 8 1990 10 Low Frequency Electric and Magnetic fields TCO 95 TCO 99 TCO 03 Requirement for Environment Labelling of Ergonomics Energy Ecology and Emission TCO Swedish Confederation of Professional Employees for TCO versions RETURN TO TOP OF THE PAGE Energy Star Declaration PHILIPS 170B5 file DI My 20Documents dfu W7 taiwan 170b5
21. Customer Care Center P O Box 2976 Longview T X 75601 file D M y9 amp 20Documents dfu W7 tai wan warranty WAR_USA HT M 3 of 3 2004 09 24 x Ux E 04 26 04 Flrst Choice Contact Information Telephone numbers Austria 01 546 575 603 Belgium 02 275 0701 Cyprus 800 92256 Denmark 35 25 8 61 France 03 8717 0033 Germany 0696 698 4712 Greece 00800 3122 1223 Finland 09 2290 1908 Ireland 01 601 1161 Italy 02 48 27 11 53 Luxembourg Netherlands Norway Portugal Sweden Switzerland Spain United Kingdom file DI My 20Documents dfu W7 taiwan warranty warfirst htm2004 09 24 HUME 04 26 32 026 84 3000 053 482 9800 22 082 50 0800 831 363 08 632 0016 02231021 16 09 17 45 62 46 0207 949 0069 Consumer Information Centers Consumer Information Centers Antilles Argentina Australia Bangladesh Brasil Canada Chile China e Colombia Czech Republic Dubai Egypt e Hong Kong Hungary India Indonesia Korea Malaysia Mexico e Morocco New Zealand Pakistan Paraguay Peru Philippines Poland Russia e Singapore Slovakia Slovenia e South Africa Taiwan Thailand Turkey Uruguay Venezuela Eastern Europe CZECH REPUBLIC Philips Authorised Service Center Xpectrum Luzna 591 4 CZ 160 00 Praha 6 Tel 800 100 697 Email info xpectrum cz Website www xpectrum cz HUNGARY Philips Authorised Service Center Serware Szerviz Vizimoln r u 2 4 HU 1031 Budapest
22. Dj M y 20Documents dfu W7 tai wan 170b5 osd osddesc htm 2 of 4 2004 09 24 x Un 04 25 08 On Screen Display First Level Second Level LANGUAGE ENGLISH ESPA OL FRANCAIS DEUTSCH ITALIANO dus BRIGHTNESS amp CONTRAST BRIGHTNESS L CONTRAST ORIGINAL PANEL COLOR ADJUST COLOR 9300K FOR CADICAM 6500K FOR IMAGE MANAGEMENT USER PRESET RED GREEN BLUE OSD SETTINGS HORIZONTAL VERTICAL PRODUCT INFORMATION SERIAL NO RESOLUTION VIDEO INPUT RESET TO FACTORY SETTINGS NO L YES IMPUT SELECTION ANALOG DIGITAL EXIT MAIN CONTROLS file Dj M y 20Documents dfu W7 tai wan 170b5 osd osddesc htm 3 of 4 2004 09 24 x Un 04 25 08 Customer Care amp Warranty UL UUUU 0O OOL file D M y 20Documents dfu W7 tai wan warranty warranty htm2004 09 24 Un E 04 25 11 Glossary UU ABCDEFGHIJKLMNOPORSTUVWXYZ C Color T errperature UL DUU D D SUB UO DUO OO D Sub 00 1100 U U Digital Visual Interfacer HOUUUUUUU DV I I Ut DUDU EDI III O III O O
23. Dooooo 11 4 Sense GND 12 0000000 SDAL 5 000 13 0000 00000 6 14 0000 7 O00000 15 00000 05 0 8 UD UU UUUUUUUUUUUUUUUUUUUUUU JD file D M y 20Documents dfu W 7 tai wan 170b5 product product htm 7 of 9 2004 09 24 Ux 04 25 00 oo m yp 0000 1 00000 9 200 file D My 20Documents dfu W7 tai wan 170b5 product product htm 8 of 9 2004 09 24 x Un E 04 25 00 Product Information 300060 70mm UD file D My 20Documents dfu W7 tai wan 170b5 product product htm 9 of 9 2004 09 24 x Un E 04 25 00 Installing Your LCD Monitor a 0 0 0 0000000 000000 OSD H uU B 000 B H Bu 00000000000 OSDJ Du UUUU 0 U m UBiulDEUtutubltt VOLUME VOLUME 00O 0 000000000 OKUUDUUUDDOSDULULD UUUUUUUUUUUU AUTO file D My 20Docurrents dfu W7 taiwan 170b5 install install htm 1 of 3 2004 09 24 x Un 04 25 04 Installing Your LCD Monitor Kensington VGA I DVI D PCI DO U 00060 ACIIIL lJ OU U N MH 0000 e O0D000 0000000000 1280x1024 60 j popgo0000 00 00000 0000000000000 ER RESOLUTION OOOO HOU 000000 FPadjust
24. O OB O DB O DU DU U 00 smercontrol UO O O O 5 file D M y 20Documents dfu W7 tai wary 170b5 product smart htm 4 of 5 2004 09 24 x Ux 04 25 41 SmartM anage Ult SmartControl HUU S UD SmartControl LightFrame 000000000 LightFramel 0 0 SmartControl sRGB 5 5 LightF rame 0 000 file D My 20Documents dfu W7 taiwan 170b5 product smart htm 5 of 5 2004 09 24 x Ux 04 25 41 Philips Pixel Defect Policy SmartManage B H D OUUU Boma rg o o 3 a Poe ooo 3 o o o c 0 q Som 00 ooo Eu IPS ES ooo 3 ooo ES mie g OOF 5 GOOG tn O a ge 3 ooo 3 g og 3 noo 5 3 a Eg D Ru E ooo g ag LJ 9 r3 3 A ooo EL EIE o o o Ed HEHE ooo
25. Only Class B Device AREAS Bx 7171 sz 19422 aha 5 8 CU pmo 548 die FE FE AAA EH Please note that this device has been approved for non business purposes and may be used in any environment including residential areas RETURN TO TOP OF THE PAGE file DI My 20Documents dfu W7 taiwan 170b5 safety regs regulat htm 8 of 12 2004 09 24 MUME 04 25 31 Regulatory Information Polish Center for Testing and Certification Notice The eguipment should draw power from a socket with an attached protection circuit a three prong socket All eguipment that works together computer monitor printer and so on should have the same power supply source The phasing conductor of the room s electrical installation should have a reserve short circuit protection device in the form of a fuse with a nominal value no larger than 16 amperes A To completely switch off the equipment the power supply cable must be removed from the power supply socket which should be located near the equipment and easily accessible A protection mark B confirms that the equipment is in compliance with the protection usage requirements of standards PN 93 T 42107 and PN 89 E 06251 Wymagania Polskiego Centrum Badan i Certyfikacji Lirzaklzerie powinno byt zasilane z griazd z praybagzanym obwoden ochronaym gniazdo z Wapolpracugqee zie soba urzadzenia komputer monitor drukarka powinny by zasilane e
26. fetus development may occur The relevant TCO 99 demand requires that plastic components weighing more than 25 grams must not contain flame retardants with organically bound bromine or chlorine Flame retardants are allowed in the printed circuit boards since no substitutes are available Cadmium Cadmium is present in rechargeable batteries and in the color generating layers of certain computer displays Cadmium damages the nervous system and is toxic in high doses The relevant TCO 99 requirement states that batteries the color generating layers of display screens and the electrical or electronics components must not contain any cadmium Mercury Mercury is sometimes found in batteries relays and switches lt damages the nervous system and is toxic in high doses The relevant TCO 99 requirement states that batteries may not contain any mercury It also demands that mercury is not present in any of the electrical or electronics components associated with the labeled unit CFCs freons Regulatory Information The relevant TCO 99 requirement states that neither CFCs nor HCFCs may be used during the manufacture and assembly of the product CFCs freons are sometimes used for washing printed circuit boards CFCs break down ozone and thereby damage the ozone layer in the stratosphere causing increased reception on earth of ultraviolet light with increased risks e g skin cancer malignant melanoma as a consequence Lead Lead
27. 1 Regulatory Information Emissions e Electromagnetic fields e Noise emissions Ecology e The product must be prepared for recycling and the manufacturer must have a certified environmental management system such as EMAS or ISO 14 000 e Restrictions on o chlorinated and brominated flame retardants and polymers o heavy metals such as cadmium mercury and lead The requirements included in this label have been developed by TCO Development in co operation with scientists experts users as well as manufacturers all over the world Since the end of the 1980s TCO has been involved in influencing the development of IT equipment in a more user friendly direction Our labelling system started with displays in 1992 and is now requested by users and IT manufacturers all over the world For more information please visit www tcodevelopment com RETURN TO TOP OF THE PAGE Recycling Information for Customers Philips establishes technically and economically viable objectives to optimize the environmental performance of the organization s product service and activities From the planning design and production stages Philips emphasizes the important of making products that can easily be recycled At Philips end of life management primarily entails participation in national take back initiatives and recycling programs whenever possible preferably in cooperation with competitors There is currently a system of recycling up and running i
28. 3 CHILE Philips Chilena S A Avenida Santa Maria 0760 P O box 2687Santiago de Chile Phone 02 730 2000 Fax 02 777 6730 COLOMBIA Industrias Philips de Colombia S A Division de Servicio CARRERA 15 Nr 104 33 Bogota Colombia Phone 01 8000 111001 toll free Fax 01 619 4300 619 4104 file DI My 20Documents dfu W7 taiwan warranty WARCIC HTM 3 of 11 2004 09 24 HUGE 04 27 12 Consumer Information Centers MEKICO Consumer Information Centre Norte 45 No 669 Col Industrial Vallejo C P 02300 Mexico D F Phone 05 3687788 9180050462 Fax 05 7284272 PARAGUAY Philips del Paraguay S A Avenida Artigas 1513 Casilla de Correos 605 Asuncion Phone 021 211666 Fax 021 213007 PERU Philips Peruana S A Customer Desk Comandante Espinar 719 Casilla 1841 Limab18 Phone 01 2136200 Fax 01 2136276 URUGUAY Ind Philips del Uruguay S A Luis Alberto de Herrera 1248 Customer Help Desk 11300 Montevideo Phone 02 6281 111 Fax 02 6287777 file DI My 20Documents dfu W7 taiwan warranty WARCIC HTM 4 of 11 2004 09 24 HUGE 04 27 12 Consumer Information Centers VENEZUELA Industrias Venezolanas Philips S A Apartado Postal 1167 Caracas 1010 A Phone 02 2377575 Fax 02 2376420 CANADA Philips Electronics Ltd 281 Hillmount Road Markham Ontario L6C 253 Phone 800 479 6696 AUSTRALIA Philips Consumer Service Customer Information Centre
29. 4 09 24 x Ux E 04 25 43 Philips Pixel Defect Policy soooooooo o Jj o Jj o m pem UU 1940000000 00000 Philips J 1S013406 20 UU file D My9c20Documents dfu W7 tai wary 170b5 product pi xel htm 3 of 3 2004 09 24 x Ux E 04 25 43 Connecting to Your PC UU LU ULL ult e ee j j el a E EY n Denn p E DFU a O 200000 000 ne LU UL UU file D My 20Documents dfu W7 tai wan 170b5 install connect htm 1 of 4 2004 09 24 x Un E 04 25 51 Connecting to Y our PC 000000 Apple I UUUUU O E L 1 1 CC A 1 CC file D M y 20Documents dfu W7 tai wan 170b5 i nstall connect htm 2 of 4 2004 09 24 x Ux E 04 25 51 Connecting to Your PC SES mo oe 3 E3 oOo file D My 20Docurrents dfu W 7 tai wan 170b5 i nstal connect htm 3 of 4 2004 09 24 Un E 04 25 51 Connecting to Y our PC 1 cales e 5 ARA waw i imi 00000050 0 000000000060 d
30. 70b5 safety saf_faq htm 4 of 8 2004 09 24 x Ux E 04 25 28 FAQs F requently Asked Questions 1 1 1 1 E 1 1 1 1 1 1 1 1 1 N E UN D e Uti LCDUOUU 0 00p0000 1 9 U Coa file D My 20Docurents dfu W7 taiwan 170b5 safety saf_faq htm 5 of 8 2004 09 24 Ux E 04 25 28 FAQs F requently Asked Questions gj ECDTFTO DO DO DL UO D DEL UL UO 000000 e U UUUUUOUUUL e VUUUUUUUL LOUE e LODO DO DO DU DD ODO DL e UL e UDUUDUDDUDUDUDUUID UI e 0000000000 FFTILI DL TH DUUCLLULULUL 18 TF 7 00000 JU OB OB DO DO DO DD ODO DO DO DD ODO DO DO DDODO DL 0 00 LCDUUUUUN ECDDI UU L EEPOOO BDO OB DO OD ODO DDD OO DDD OD ODO DD 00000000 DO ODO BDO BDO DO DO DD ODO DO DO OD ODO DU DD UU UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUOUN ECbI DUO L
31. 8 1152 900 76 63 9 1280 1024 60 80 0 1280 1024 75 SAN 00000000000 DPMS DO BO BD OO DO 0D 0000000 file D My 20Documents dfu W7 tai wan 170b5 product product htm 4 of 9 2004 09 24 x Un E 04 25 00 Product Information ENERGY STARS 0000 ENERGY STAR 0000000090 ENERGY STAR 0 D D D B D DI UU UU 0000x 00 61 UUM U x 250 125 000000 00 100 2400 0000 50 600 00 400 00000 ET 40 00000 O D 201 60 00000 Dnnn 20 1 80 6 000000000 5 CCFL 40K 00 KI DU D HL UE U D LI USBI file D My 20Documents dfu W7 taiwan 170b5 product product htm 5 of 9 2004 09 24 x Un E 04 25 00 Product Information 0 000000000000 241000000 810 0000 000000000 UU UUW 0000 0000 HUL 0000 1 inh 2 9 nm 17 imd 0 ndi 2 115 1 E 0 B put 2 4 s ne 130 0 0 5 4 000 2 000 20 000 5 000 13 000 21 pun mnn E I dnd pesas pen EST Pini H f 5 S DLL Ps MODO lea 2 00 0041500010 0000000 file D M y 20Documents dfu W 7 tai wan 170b5 product product htm 6 of 9 2004 09 24 Ux 04 25 00 Product Information 2 5 10 3
32. Education Initiative RETURN TO TOP OF THE PAGE Information for UK only WARNING THIS APPLIANCE MUST BE EARTHED Important This apparatus is supplied with an approved moulded 13A plug To change a fuse in this type of plug proceed as follows 1 Remove fuse cover and fuse 2 Fit new fuse which should be a BS 1362 5A A file DI My 20Documents dfu W7 taiwan 170b5 safety regs regulat htm 11 of 12 2004 09 24 HUME 04 25 31 Regulatory Information S T A or BSI approved type 3 Refit the fuse cover If the fitted plug is not suitable for your socket outlets it should be cut off and an appropriate 3 pin plug fitted in its place If the mains plug contains a fuse this should have a value of 5A If a plug without a fuse is used the fuse at the distribution board should not be greater than 5A Note The severed plug must be destroyed to avoid a possible shock hazard should it be inserted into a 13A socket elsewhere How to connect a plug The wires in the mains lead are coloured in accordance with the following code BLUE NEUTRAL N BROWN LIVE L GREEN 8 YELLOW EARTH E 1 The GREEN AND YELLOW wire must be connected to the terminal in the plug which is marked with the letter E or by the Earth symbol or coloured GREEN or GREEN AND YELLOW 2 The BLUE wire must be connected to the terminal which is marked with the letter N or coloured BLACK 3 The BROWN wire mus
33. IPPINES Philips Electronics and Lighting Inc 106 Valero St Salcedo Village Makati Metro Manilla Phone 02 888 05 72 Domestic toll free 1 800 10 PHILIPS or 1 800 10 744 5477 Fax 02 888 05 71 SINGAPORE Philips Singapore Private Ltd Consumer Service Dept Lorong 1 Toa Payoh P O box 340 Singapore 1231 Phone 6882 3999 Fax 6250 8037 TAIWAN Philips Taiwan Ltd Consumer Information Centre 13F No 3 1 Yuan Qu St Nan Gang Dist Taipei 115 Taiwan Phone 0800 231 099 Fax 02 3789 2641 THAILAND Philips Electronics Thailand Ltd Philips Service Centre 209 2 Sanpavut Road Bangna Bangkok 10260 Phone 02 652 8652 Fax 02 614 3531 file DI My 20Documents dfu W7 taiwan warranty W ARCIC HTM 9 of 11 2004 09 24 XxUXE 04 27 12 Consumer Information Centers MOROCCO Philips Electronigue Maroc 304 BD Mohamed V Casablanca Phone 02 302992 Fax 02 303446 SOUTH AFRICA South African Philips S V Div 195 Main R D Martindale Johannesburg P O box 58088 Newville 2114 Phone 27 11 471 5000 Fax 27 11 471 5020 Middle East DUBAI Philips Middle East B V Consumer Information Centre P O Box 7785 DUBAI Phone 04 335 3666 Fax 04 335 3999 EGYPT Philips Egypt Consumer Information Centre 10 Abdel Rahman El Rafei Mohandessin Cairo P O Box 242 DOKKI Phone 02 3313993 Fax 02 3492142 file D My 20Documents dfu W7 taiwan w
34. arranty W ARCIC HTM 10 of 11 2004 09 24 XxUXE 04 27 12
35. can be found in picture tubes display screens solders and capacitors Lead damages the nervous system and in higher doses causes lead poisoning The relevant TCO 99 requirement permits the inclusion of lead since no replacement has yet been developed Bio accumulative is defined as substances which accumulate within living organisms Lead Cadmium and Mercury are heavy metals which are bio accumulative RETURN TO TOP OF THE PAGE TCO 03 Information Optional only available for TCO 03 version TCODevelopment Congratulations The display you have just purchased carries the TCO 03 Displays label This means that your display is designed manufactured and tested 0 according to some of the strictest quality and environmental requirements in the world This makes for a high performance product designed with DISPLAYS the user in focus that also minimizes the impact on our natural Ben Some of the features of the TCO 03 Display requirements Ergonomics e Good visual ergonomics and image quality in order to improve the working environment for the user and to reduce sight and strain problems Important parameters are luminance contrast resoluction reflectance colour rendition and image stability Energy e Energy saving mode after a certain time beneficial both for the user and the environment e Electrical safety file DI My 20Documents dfu W7 taiwan 170b5 safety regs regulat htm 3 of 12 2004 09 24 MUME 04 25 3
36. d Questions UBB OB DO DO DO DD ODO DO DO DD ODO DO ld 0 0000 LCD Cl UUUUUUUUUUUUN 2 AD000 00000000 cm E E co Co rp DJ E cg A cy ET UU NW LCDOUUU 0 0000000 ECDI JU BB OB DO DO DO BDO DO DO DD ODO DO DO DD dll DODO DO DO DD ODO DO DO Ll U DO0OUUUDUUUDUDUDUUULDUUULLN 1 0 0 0 Philips BrillianceLCDJ DO D D BU DL OO LOD 0 VESATT DUU 5 ARMII III II I U Philips Dn DD D D D EU L Uti Ut co 000 FPadust J FPadutD DO OOOO 000 DDD O BOO OOO DDD 0 00000000000 file D My 20Docurents dfu W7 taiwan 170b5 safety saf_faq htm 3 of 8 2004 09 24 Ux E 04 25 28 FAQs F requently Asked Questions U OBO0B0 DO DO DO DD ODO ull O 1280x1024 60H27 0 00 LCDUUUUUUUUUUUUUUUUUUUUUUUOUUU Uti 9 O LC 0 000 0000 00000 95 980 2000 Mel OO 98 990000000 0000 000 0 00 USBI 0000000 3 file D My 20Docurents dfu W7 taiwan 1
37. e Manual Philips LCD Monitor Electronic User s Manual SEMT SPRARRE LCD Monitor file DI My 20Documents dfu W7 taiwan 170b5 index htm2004 09 24 BUDE 04 24 49 Safety and T roubleshooting Information LA LA ES LA LA ei LA LJ LJ LJ 1 1 1 1 1 LA LIL 1 LIL LIL CJ CJ LIL LIL LIL LIL 1 CA LIL LIL LIL LIL I 3 LJ A r3 03 ogo o a prr oo oco o o coo oo o o 1 o o CODE CODE CODE CODE CODE CODE HHHH E ele CODE CODE LI LI LI LI LI A 03 03 03 03 03 23 03 03 03 03 A 23 53 D LUUT LUUT A A A A A A A A A A A A IE IE D LUUT LUUT A 03 53 03 03 03 23 03 53 03 03 O 11 11 11 1 LUUT 03 23 53 03 03 03 23 03 03 03 03 A 23 D o 0 e o 0 0 0 0 DADO DO DO DO DO DO DO DO DO DO DO lil LL LU UL e re e e ca o mai E E er EA De e Ee pn e jo e Ee E mm ma o E ua um je ee 1 1
38. ee htm 2 of 2 2004 09 24 x Un 04 26 02 International Guarantee U http www philips com file D My 20Docurrents dfu W7 tai wan warranty WAR_INT L HT 2004 09 24 x Un E 04 26 03 United States Guarantee O L3 L3 L3 oO L3 L3 L3 OO L3 3 L3 2g L3 Ej L3 O OO L3 L3 L3 2g L3 L3 L3 20 L3 E L3 2g L3 3 L3 O 2g L3 L3 L3 20 L3 noo 20 zo L3 paa oo Du m L3 paa oo Du Q a oOo oo oo DC 3 Ha L3 Lic Aa O OO s mn L3 CO O O GOO ala y no oo mo rr oo 5 A mn Oo OOo r1 oO OC a oo ge oo oo oo 9 O mn L3 r3 noo oo DO Du 11 Oo O oOo OU A oaoa E O Oo rr DO 5 E OO E oo oo oo d ca cr oo O SES CO DO oo 5 O 5 o ot EXE A ooooooo e 8 pH LL O CODE a pH L1 Thom ma Memel CI a Hu no oo ooooooooo Et y pa aa Sa El maa es o ele le i gt
39. l interference to radio or television reception which can be determined by turning the equipment off and on the user is encouraged to try to correct the interference by one or more of the following measures e Reorient or relocate the receiving antenna e Increase the separation between the equipment and receiver e Connect the equipment into an outlet on a circuit different from that to which the receiver is connected e Consult the dealer or an experienced radio TV technician for help Changes or modifications not expressly approved by the party responsible for compliance could void the user s authority to operate the equipment Use only RF shielded cable that was supplied with the monitor when connecting this monitor to a computer device file DI My 20Documents dfu W7 taiwan 170b5 safety regs regulat htm 6 of 12 2004 09 24 HUR 04 25 31 Regulatory Information To prevent damage which may result in fire or shock hazard do not expose this appliance to rain or excessive moisture THIS CLASS B DIGITAL APPARATUS MEETS ALL REQUIREMENTS OF THE CANADIAN INTERFERENCE CAUSING EQUIPMENT REGULATIONS RETURN TO TOP OF THE PAGE Commission Federale de la Communication FCC Declaration Cet quipement a t test et d clar conforme auxlimites des appareils num riques de class B aux termes de l article 15 Des regles de la FCC Ces limites sont concues de facon a fourir une protection raisonnable contre les i
40. n the European countries such as The Netherlands Belgium Norway Sweden and Denmark In U S A Philips Consumer Electronics North America has contributed funds for the Electronic Industries Alliance EIA Electronics Recycling Project and state recycling initiatives for end of life electronics products from household sources In addition the Northeast Recycling Council NERC a multi state non profit organization focused on promoting recycling market development plans to implement a recycling program In Asia Pacific Taiwan the products can be taken back by Environment Protection Administration EPA to follow the IT product recycling management process detail can be found in web site www epa gov tw For help and service please contact Consumers Information Center or F1rst Choice Contact Information Center in each country or the following team of Environmental specialist can help Mr Job Chiu Environment manager file DI My 20Documents dfu W7 taiwan 170b5 safety regs regulat htm 4 of 12 2004 09 24 HUR 04 25 31 Regulatory Information Philips Electronics Industries Taiwan Ltd Monitor Business Unit E mail job chiu philips com Tel 886 0 3 454 9839 Mr Maarten ten Houten Senior Environmental Consultant Philips Consumer Electronics E mail marten ten houten philips com Tel 31 0 40 27 33402 Mr Delmer F Teglas Philips Consumer Electronics North America E mail butch teglas philips com Tel 1
41. ngs to category D devices as described in EN 55022 unless it is Sech call stated that it is a Class A device on tha specification label The following applias to davices in Class A of EM 55022 radius of protection up to 30 meters Tha user of tha device is obliged to take all stapa necessary to remove sources of interference io tala communication ar other devices Pokud nani na typov m amp itku po ita e uvedeno de spad do do tfidy podle EN 5502 spad automaticky do tfidy B podle EN 55022 Pro zafizeni zafazen do tHidy A chrann p srno 30m podie EN 55022 plati n amp sledujici Dojde li k ru eni telekomunikanich nabo Bnych zafizeni je Wivatal povinnen prov st takov opatfgni aby ru en odstranil file DI My 20Documents dfu W7 taiwan 170b5 safety regs regulat htm 7 of 12 2004 09 24 MUME 04 25 31 Regulatory Information RETURN TO TOP OF THE PAGE VCCI Notice Japan Only This is a Class B product based on the standard of the Voluntary Control Council for Interference VCCI for Information technology equipment If this equipment is used near a radio or television receiver in a domestic environment it may cause radio Interference Install and use the equipment according to the instruction manual Class B ITE RA MA ER NE VCC oo 6 CST BERET D REH S RER CHIHI SANE L Cu ARTA ORAR FT LT WSA E MEME ASAS e wher AIRES TE LALA a n RETURN TO TOP OF THE PAGE MIC Notice South Korea
42. nie nalezy atwor w wentylacyjnych Nalezy unik t kladzensa luzny h paperia pod kamputer riz umieszczania komputera w ciasmym miepscu bez mazl wasc cyrkulacji powi elrza wako miese RETURN TO TOP OF THE PAGE North Europe Nordic Countries Information Placering Ventilation VARNING FORSAKRA DIG OM ATT HUVUDBRYTARE OCH UTTAG AR LATATKOMLIGA NAR DU STALLER DIN UTRUSTNING PAPLATS file DI My 20Documents dfu W7 taiwan 170b5 safety regs regulat htm 9 of 12 2004 09 24 MUME 04 25 31 Regulatory Information Placering Ventilation ADVARSEL SORG VED PLACERINGEN FOR AT NETLEDNINGENS STIK OG STIKKONTAKT ER NEMT TILG ENGELIGE Paikka llmankierto VAROITUS SIJOITA LAITE SITEN ETT VERKKOJOHTO VOIDAAN TARVITTAESSA HELPOSTI IRROTTAA PISTORASIASTA Plassering Ventilasjon ADVARSEL N R DETTE UTSTYRET PLASSERES M DU PASSE P AT KONTAKTENE FOR STOMTILFORSEL ER LETTE RETURN TO TOP OF THE PAGE BSMI Notice Taiwan Only C Ra RETURN TOP PAGE Ergonomie Hinweis nur Deutschland Der von uns gelieferte Farbmonitor entspricht den in der Verordnung ber den Schutz vor Sch den durch R ntgenstrahlen festgelegten Vorschriften Auf der R ckwand des Ger tes befindet sich ein Aufkleber der auf die Unbedenklichkeit der Inbetriebnahme hinweist da die Vorschriften ber die Bauart von St rstrahlern nach Anlage Ill 5 Abs 4 der R ntgenver
43. nterf rences nuisibles dans le A cadre d une installation r sidentielle CET appareil produit utilise et peut mettre des hyperfr quences qui si l appareil n est pas install et utilis selon les consignes donn es peuvent causer des interf rences nuisibles aux communications radio Cependant rien ne peut garantir l absence d interf rences dans le cadre d une installation particuli re Si cet appareil est la cause d interf rences nuisibles pour la r ception des signaux de radio ou de t l vision ce qui peut tre d cel en fermant l quipement puis en le remettant en fonction l utilisateur pourrait essayer de corriger la situation en prenant les mesures suivantes R orienter ou d placer l antenne de r ception Augmenter la distance entre l quipement et le r cepteur Brancher l quipement sur un autre circuit que celui utilis par le r cepteur Demander l aide du marchand ou d un technicien chevronn en radio t l vision mati re de conformit est susceptible d interdire l utilisateur l usage du pr sent 2 Toutes modifications n ayant pas recu l approbation des services comp tents en quipement N utiliser que des c bles RF arm s pour les connections avec des ordinateurs ou p riph riques CET APPAREIL NUMERIQUE DE LA CLASSE B RESPECTE TOUTES LES EXIGENCES DU REGLEMENT SUR LE MATERIEL BROUILLEUR DU CANADA RETURN TO TOP OF THE PAGE EN 55022 Compliance Czech Republic Only This device belo
44. ntrol SmartControl SmartManage 0 0 0 Philip 00000000 000000000000 10000 ID UDO OD OD nVIDIA TNT 2 GeForce 0 ATI Radeon D 0000000000 DDC CI O Windows 20001 XP I J DDC CI O O Philips O file D M y 20Documents dfu W7 taiwan 170b5 product smart htm 1 of 5 2004 09 24 x Ux 04 25 41 SmartM anage 20000 smartControl U U O O SmartControl Installation j 1 O http www philips com pcstuff 2000000000000 3 00 0000 000 0 Manuals drivers 4 000000 5 1 0 U SmartControl SmartControl VO 000000000090 6 Philips SmartControl O 020000009090 3 Philips SmartControl e UU Properties e O00 Gettings 000000 Advanced e Philips SmartControl 4 SmartControl e 0 Display and Sound pnuggamupuagupguagaugugggaguagguuglidtt iutlelutattu DVI br pn d i a d B 7E U L Mordor ond t RIVA TATE EA Gene Taa Maeagemet Intimes ai Position Po file D My 20Documents dfu W7 taiwan 170b5 product smert htm 2 of 5 2004 09 24 u Un E 04 25 41 SmartManage 1 arl orior and IDIA TATE Med
45. nty WAR 1ST HT M 2 of 2 2004 09 24 x Ux E 04 26 01 Your Guarantee in Central and Eastern Europe C C C C C C C C Phil Philips 00000 ipsi D D UI UI UI D UU Phil Il 1 1 1 En es CJ CJ CJ CJ 1 E es 1 1 e 1 1 1 CJ E a zu 1 1 E 1 1 es 1 CJ E 1 3 Io Io Io Io Io Io Io Io Io 3 Io ono An oo Ko oo oo oo oo as aa nooo oo Be nooo oo nooo oo nooo oo nooo oo i EA ES s LUUT A A A LI LI LI LI D LUUT LUUT LUUT LIL A LI LI LI LI D Street A E EE EA AA LUUT CICICICICICICICIOI ITU e o 0 0 0 000000 www philips comsupport file D My 20Documents dfu W7 taiwar warranty war_ee htm 1 of 2 2004 09 24 x Un E 04 26 02 Your Guarantee in Central and Eastern Europe 000 Patipesspod00000000000 Phlpsr rptu uL O O Atto www philips com support file D My 20Docurents dfu W7 tai wan warranty war_
46. ordnung erf llt sind Damit Ihr Monitor immer den in der Zulassung geforderten Werten entspricht ist darauf zu achten file DI My 20Documents dfu W7 taiwan 170b5 safety regs regulat htm 10 of 12 2004 09 24 HUME 04 25 31 Regulatory Information daB 1 Reparaturen nur durch Fachpersonal durchgef hrt werden 2 nur original Ersatzteile verwendet werden 3 bei Ersatz der Bildr hre nur eine bauartgleiche eingebaut wird Aus ergonomischen Gr nden wird empfohlen die Grundfarben Blau und Rot nicht auf dunklem Untergrund zu verwenden schlechte Lesbarkeit und erh hte Augenbelastung bei zu geringem Zeichenkontrast w ren die Folge Der arbeitsplatzbezogene Schalldruckpegel nach DIN 45 635 betr gt 70dB A oder weniger NETZSTECKER UND NETZKABELANSCHLUB LEICHT ZUG NGLICH SIND IN ACHTUNG BEIM AUFSTELLEN DIESES GER TES DARAUF ACHTEN DAB RETURN TO TOP OF THE PAGE End of Life Disposal Your new monitor contains materials that can be recycled and reused Specialized companies can recycle your product to increase the amount of reusable materials and to minimize the amount to be disposed of Please find out about the local regulations on how to dispose of your old monitor from your local Philips dealer For customers in Canada and U S A This product may contain lead and or mercury Dispose of in accordance to local state and federal regulations For additional information on recycling contact www eia org Consumer
47. pment of environmentally adapted electronics products CE Declaration of Conformity Energy Star Declaration Why do we have environmentally labeled computers Federal Communications In many countries environmental labeling has become an established method for encouraging the Commission adaptation of goods and services to the environment The main problem as far as computers and FCC Notice U Other electronics equipment are concerned is that environmentally harmful substances are used S Only both in the products and during their manufacture Since it is not so far possible to satisfactorily recycle the majority of electronics equipment most of these potentially damaging substances sooner e Commission or later enter nature Federale de la Communication There are also other characteristics of a computer such as energy consumption levels that are FOC important from the viewpoints of both the work internal and natural external environments Since Declaration all methods of electricity generation have a negative effect on the environment e g acidic and EN 55022 climate influencing emissions radioactive waste it is vital to save energy Electronics equipment in Compliance offices is often left running continuously and thereby consumes a lot of energy Czech Republic Only What does labeling involve e VCCI Class 2 Notice Japan This product meets the requirements for the TCO 99 scheme which provides for in
48. safety regs regulat htm 5 of 12 2004 09 24 MUME 04 25 31 Regulatory Information This monitor is eguipped with a function for saving energy which supports the VESA Display Power Management Signaling DPMS standard This means that the monitor must be connected to a computer which supports VESA DPMS to fulfill the reguirements in the NUTEK specification 803299 94 Time settings are adjusted from the system unit by software NUTEK VESA State LED Indicator Power Consumption Normal operation ON Green lt 40 W typ Power Saving Alternative 2 One step OFF Amber lt 1W i As an ENERGY STAR Partner PHILIPS has determined that this product meets the ENERGY STAR guidelines for energy efficiency A We recommend you switch off the monitor when it is not in use for quite a long time RETURN TO TOP OF THE PAGE Federal Communications Commission FCC Notice U S Only This equipment has been tested and found to comply with the limits for a Class B digital device pursuant to Part 15 of the FCC Rules These limits are designed to provide reasonable protection against harmful interference in a residential A installation This equipment generates uses and can radiate radio frequency energy and if not installed and used in accordance with the instructions may cause harmful interference to radio communications However there is no guarantee that interference will not occur in a particular installation If this equipment does cause harmfu
49. t 2UUUUUUUUU IU 00000000 UO 0 00 ood U 0 UU DUDU LUOUUUUULDUUDUULUULUUULUUULULN DUU FPadjusti OULU e 0000 SI 0 O0 9 200 Me0000000000 FPadjust U e 000000000 FPadjust O 00000000000000 200MeXP 0000000 Setup04 exe 44 n E HN HOUOU 00000 DUDU Hu un Uti FP adj ust U 0000 L 1L 1 ReadmeOAtxt file Dj M y 20Documents dfu W7 tai wan download download htm 2 of 3 2004 09 24 x Un 04 25 18 FAQs F requently Asked Questions FAQS I I E U Cannot display this video mode 00000000 0 00000000 0 000 1700000000000 1280x1024 6042 LODO0O0D00 00000 0000000000000 0000000 200000000000 0000000000 0 O0 gd 0d 08d 000 00000 000000000000 0000 1280 1024 0 171 3 DU 0000 UU 000 00 60000000 OK 4 PO HL DOLO D DO DD DDD 0000000000 1280x1024 60H gt 0 0 0 000000000000000000000 Philips o JH UO D EL ELO D DL EE U D L 0 0000000 THIS IS 85HZ OVERDRIVE CHANGE COMPUTER DISPLAY INPUT TO 1280 x 1024 60HZO 0 85 1280x 1024 60HZ 0000000 PC 00000 e5Hz
50. t be connected to the terminal which marked with the letter L or coloured RED Before replacing the plug cover make certain that the cord grip is clamped over the sheath of the lead not simply over the three wires RETURN TO TOP OF THE PAGE file DI My 20Documents dfu W7 taiwan 170b5 safety regs regulat htm 12 of 12 2004 09 24 HUME 04 25 31 Other Related Information 000000113 LUUUUUUUUU DUDU HOUUUU BUUSVTUSITUULLDUDUL 191 150 0 120000006 000000 2301 0130000000000 SOU 20000000 000000 2301 250100000000 fi le D My 20Docurents df u W7 tai wan 170b5 safety saf other htm2004 09 24 x Ux 04 25 32 SmartM anage e0000 SmartM anage uum SmartM anage Philips SmartControl martManag n Philips SmartManage 0000000000 OOOO Philip 00000000000 UU Administrator Philips SmartControl Agent Philips SmartManage Philips Altiris 000000 SmartManage 0 Philips SmertManage DOO I DO DO DO DO DO DO OOO DU L HOUUUOUUUUUUUUUUUUUUO Philips SmartManage 000000000 1 2 SmartControl ODO 00000 0000000000 4 SmartManage ID 000000000 Philipsi 00000 Philips SmartCo
51. t of the reduction of electric and magnetic fields physical and visual ergonomics and good usability file D My9620Documents dfu W7 taiwan 170b5 safety regs regulat htm 1 of 12 2004 09 24 04 25 31 DLT AF Eme de Philip ENO O Life Di Below you will find a brief summary of the environmental requirements met by this product The complete environmental criteria document may be ordered from TCO Development SE 114 94 Stockholm Sweden Fax 46 8 782 92 07 Email Internet development tco se Current information regarding TCO 99 approved and labeled products may also be obtained via the Internet using the address htip www tco into com RETURN TO TOP OF THE PAGE Environmental Requirements Flame retardants Flame retardants are present in printed circuit boards cables wires casings and housings Their purpose is to prevent or at least to delay the spread of fire Up to 30 of the plastic in a computer casing can consist of flame retardant substances Most flame retardants contain bromine or chloride and those flame retardants are chemically related to another group of environmental toxins PCBs Both the flame retardants containing bromine or chloride and the PCBs are suspected of giving rise to severe health effects including reproductive damage in fish eating birds and mammals due to the bio accumulative processes Flame retardants have been found in human blood and researchers fear that disturbances in
52. ternational and Only environmental labeling of personal computers The labeling scheme was developed as a joint effort e MIC Notice by the TCO The Swedish Confederation of Professional Employees Svenska South Korea Naturskyddsforeningen The Swedish Society for Nature Conservation and Statens Only Energimyndighet The Swedish National Energy Administration Polish Center for Testing and Certification Notice North Europe Approval requirements cover a wide range of issues environment ergonomics usability emission of electric and magnetic fields energy consumption and electrical and fire safety The environmental demands impose restrictions on the presence and use of heavy metals brominated and chlorinated flame retardants CFCs freons and chlorinated solvents among other Nordic things The product must be prepared for recycling and the manufacturer is obliged to have an Countries environmental policy which must be adhered to in each country where the company implements its Information operational policy BSMI Notice Taiwan Only The energy requirements include a demand that the computer and or display after a certain period Ergonomie of inactivity shall reduce its power consumption to a lower level in one or more stages The length of Hinweis nur time to reactivate the computer shall be reasonable for the user Deutschland Labeled products must meet strict environmental demands for example in respec

Download Pdf Manuals

image

Related Search

Related Contents

Hamilton Beach All-Metal Blender User's Manual  Timloc Building Products TIMLOC CAVITY CLOSERS    Lenco TAB-1014 8GB Black tablet    GE 169233 User's Manual  • Setup • Installation • Programming • Operation • User's Guide Intelli  INVITE SEP_080212.indd  Electric Blanket Manual Manual for BioSmart Electric Infrared Blanket  American Standard 2742.428 User's Manual  

Copyright © All rights reserved.
Failed to retrieve file