Home
Prime and PrimeG
Contents
1. Lowest Set Highest temperature temperature temperature Gradient The maximum temperature gradient range which can be set is 29 C depending on block type and the minimum is 1 C the lowest temperature is 30 C and the hottest temperature is 80 C Examples are given in the table below Lowest temperature Set temperature Highest temperature Gradient C C C C 50 55 60 10 40 5 55 69 5 29 50 5 65 79 5 29 A gradient calculator is included in the Settings module so the user can obtain an accurate estimation of the temperature of each column during the gradient stage The temperatures for any particular gradient are calculated from an algorithm stored in the block firmware 21 OLIGONUCLEOTIDE Ty CALCULATOR One of the most important parameters in a PCR is the annealing temperature of the reaction This can be determined theoretically using various software programmes to calculate the melting temperature Tm of the primers The Tm is defined as the temperature at which half the DNA strands are single stranded and half are double stranded when base paired to a complimentary strand Using annealing temperatures that are well below the T of the primers can result in mismatching false priming and may lead to primer dimer artefacts Annealing temperatures that are significantly higher than the primer T may result in reduced priming or prevent priming altogether The Prime uses the Nearest Neighbour method for calculati
2. Temperature Log nd Final Extension 72 C 00 05 00 Back Library ag femplate ae Er ever used a Q erature Log 129163305559374364 temperaturelog e Log 129163305559374364 temperaturelogdata e Log 129163305577 186522 temperaturelog e Log 129163305577 186522 temperaturelogdata e Log 129163305588123812 temperaturelo e Log 129163305588123812 temperaturelogda d do LILSSLLSSES gasa un eeeeecees 555555 3 e Log 129163305601717301 temperaturelog erature Log 129163305601717301 temperaturelogda Cyclerprogram 2 Step Template cyclerprogram 3 Step Template cyclerprogram 3 step cyclerprogram ALU 2 cyclerprogram ALU 2 steps cyclerprogram ie kr Te gl Te br Te W Te e Te jak Te Ik el dg Te Ind srl srl ira ail srl ES auf au a 3 When opening a temperature log file the Temperature amp Log Monitor screen will be displayed To view the complete temperature log drag the mouse across the screen to scroll through the data points The view will show a graphical representation of the actual temperature changes second by second throughout thermal cycling program Clicking on the Program View button of this screen will display the program that generated the temperature log For further information on using the Techne Workbench software see the separate user manual which can be downloaded from www techne com COPYING FILES Files can either be
3. This equipment is fitted with RFI suppression circuitry Any check of the electrical insulation by means of high voltage dielectric testing for example as in BS EN 61010 1 must be carried out using only a DC voltage This unit contains semiconductor components which may be damaged by electric field effects 64 ACCESSORIES The following accessories can be obtained from Bibby Scientific Ltd or your Techne distributor Product code Description 5PrimeX USB Prime base gradient upgrade REPLACEMENT PARTS The following replacement parts can be obtained from Bibby Scientific Ltd or your Techne distributor Note that block removal can only be performed by a qualified service engineer Product code Description HH179 S UK 230V mains lead with plug HH180 S European mains lead with plug FCABLEUS US mains lead with plug Prime 02 B Prime block 96 x 0 2ml Prime 05 B Prime block 60 x 0 5ml Prime 384 B Prime block 384 well plates Prime C B Prime Combi Block 65 Declaration of Conformity Thermal Cycler Models Prime Prime Prime Elite Prime Elite Satellite These products comply with the requirements of the EU Directives listed below 2004 108 EC EMC Directivo 2006 95 EC Low voltage Directive LVD Compliance with the requirements of these Directives is claimed by meeting the following standards EN 61326 1 2006 Electrical Equipment for Measurement Control and Laboratory use EN 61010 1 2001 Safety Requirements Electr
4. 41 Passwords A password can be created to protect the program from being edited and deleted by other users The password will be requested if a user attempts to edit or delete the program e To create a password touch the None button next to Password e Enter the required password then touch OK The password is case sensitive e Touch Cancel to return to Program Options without entering a password e Touch the Program button to return to the Programming screen e To change or remove the password from the Password Required Program Options screen touch the button next to Before changing or removing the password from this program please Password enter the current password e On the Password Editing screen touch the None button and enter the password Remove DB Change Password Cancel e To remove the password touch Remove Password Required Password Before changing or removing the password from this program please enter the current password e To change the password touch Change Password and type in the new password followed by OK The password is correct e Touch Cancel to return to the Program Options screen if no change is required Cancel 42 SETTINGS e Touch the Settings button to view the instrument defaults as set up in the instrument Settings module Preheat Lid Any of these parameters can be edited by touching the Euer appropriate button and will be saved for the current program
5. Bibby Scientific Middle East Ltd PO Box 27887 Engomi 2433 Nicosia Cyprus Tel 357 22 660 423 Fax 357 22 660 424 e mail sales bibby scientificme com 15 North and South America Bibby Scientific US Inc t a Techne Inc 3 Terri Lane Suite 10 Burlington N J 08016 USA Toll Free in NA 800 225 9243 Tel 1 609 589 2560 Fax 1 609 589 2571 E mail labproducts techneusa com www techneusa com Asia Bibby Scientific Singapore Prudential Tower Level 26 30 Cecil Street Singapore 049712 Tel 65 6631 2976 Fax 44 0 1785 810405 e mail info bibby scientific com www bibby scientific com PRIME SPECIFICATION TEMPERATURE Block temperature range Block uniformity at 55 C Temperature accuracy at 55 C Gradient availability PrimeG only Maximum gradient PrimeG only Minimum gradient PrimeG only Column uniformity with a 10 C gradient PrimeG only Pre run sample cooling Temperature set point adjustment HEATING COOLING RATE Maximum heating rate Minimum heating rate Maximum cooling rate Minimum cooling rate HEATED LID Selectable heated lid temperature Lid uniformity Pre heat lid Warm up time from ambient Over temperature cut out Regulated heated lid pressure 4 C 10 C during cycling to 100 C lt 0 3 C lt 0 25 C Between 30 C and 80 C 29 C 25 C Combi Block 19 C 384 well block 1 C lt 0 3 C Yes 4 C 0 1 C 3 4 C s 0 1 C s 1 0 C s 0 1
6. 234 entered twice below Administrator Password Confirm passworc e Touch None entered and enter the new password e Touch the second None entered to confirm the new password Cancel Note It is recommended that the administrator keeps ee a record of the new password e Touch OK to return to the menu or Cancel to return without making any changes 32 R re F r in estore Facto y Sett gs Restore Factory Settings All changes to the instrument defaults and settings can The administrator password is required again to restore factory settings to be removed and the unit returned to its factory the instrument settings Password e From the Administrator menu touch Restore Factory Settings e Touch the None button and enter the administrator password e Touch Restore Settings and the unit will be reset to factory defaults e Touch Cancel to return to the Settings menu without making any changes PROGRAM DEFAULTS Restore Settings Cancel The program default settings will apply to every new program created on the Prime However individual programs can be edited as required Heated Lid Use this to set the heated lid temperature to Heated Lid approximately 10 C higher than the hottest block temperature in the program e Touch On Off to toggle between settings Preheat Lid e Touch the temperature button to set the required lid temperature 35 C to 115 C Sample Cooling Preheat lid Set to On to pre h
7. A 38 INSERT DELETE A STEP e Touch Insert a new step to insert the next step in the current stage e Edit the new step temperature hold time and ramp rate as required RU ner Delete a step e To delete a step touch the step area to highlight it Ineart a nau ctana INSERT DELETE A PAUSE Insert a pause e To insert a pause between stages touch Insert a pause The hold temperature will be that of the previous step a The unit will not continue with the remainder of the program until it is manually un paused by the user i 00 01 00 Delete a pause e To delete a pause touch the pause button to highlight it and then touch Delete Note To insert a pause between two previously programmed stages it is necessary to first delete the later stages to where the pause is required PROGRAM OPTIONS e Touch this to view the program defaults as set up in MN Se the Settings module Any of these parameters can be edited by touching the appropriate button and will be saved for the current program only e Touch Program to return to the programming screen Password 39 User User names can be entered and linked to the program to help in searching and identifying programs User None selected Create a new user e To enter a user name touch the None selected button next to User e User names that have already been created will then be listed e Tocreate a new user name touch the Create a new user
8. administrator to remove passwords from password protected programs change the Administrator password and restore the unit to its factory settings eae Administrator Password Required The administrator password is required to access administrator settings The password is correct e Touch None and enter the administrator password The default password is 1234 e Touch OK to enter the Administrator Settings menu e Touch Cancel to return to the menu without making any changes Remove Passwords e From the Administrator menu touch Remove Passwords e Touch the file with the password to be removed e Touch Remove Password Program 2 Step Template Keywords None selected User None selected Used Today 10 02 PM Program Ice Bucket Keywords None selected User None selected Search By Keyword Select All Remove Password Program 3 Step Template ds None selected one selected ever used Program on 15 C words None selected Used Never used a Program The password will now be removed and the program Sete Keywords None selected can be deleted if required User None selected Used Never used Program e Touch Close to return to the menu Io e selected Change Administrator Password E e Change Administrator Password This allows the administrator to change the default To change the administrator password the new password must be e From the Administrator menu touch Change Bia password 1
9. angeschlossen ist 1 Alle Ger te von Techne werden mit einem Netzkabel geliefert das entweder eingesteckt wird oder fest mit dem Ger t verbunden ist Vor dem Anschluss bitte kontrollieren ob die Stromversorgung den Angaben auf dem Typenschild auf der Ger ter ckseite entspricht Um die elektrische Sicherheit zu gew hrleisten muss dieses Ger t geerdet werden Schlie en Sie das Netzkabel entsprechend der folgenden Tabelle an einen geeigneten Stecker an Anschluss 220 240V 50 60Hz 110V 120V 50 60Hz 3 NUR F R GROSSBRITANNIEN der mit dem Netzkabel gelieferte Sicherungsstecker enth lt eine 5 Amp Sicherung zum Schutz des Ger ts und des Anwenders 4 Die MaBeinheiten werden veranschlagen um an 100 240V 50 60Hz zu funktionieren Stellen Sie das Ger t auf einen geeigneten ebenen Tisch oder in einem Abzugsschrank auf und sorgen Sie daf r dass die Lufteinlassschlitze auf der Ger teunterseite nicht blockiert sind Stecken Sie das Netzkabel in die Buchse auf der Ger ter ckseite ein Schalten Sie das Instrument unter Verwendung des Schalters an der auf der R ckseite der Ma einheit gelegen ist Ersatzkabel Bei einem eventuellen Austausch des Netzkabels wird ein Kabel vom Typ HO5VV F mit 1 mm Adernquerschnitt und Europastecker IEC 320 ben tigt IM ZWEIFELSFALL EINEN ELEKTRO FACHMANN HINZUZIEHEN UMWELTBEDINGUNGEN Der Prime ist f r den Einsatz unter folgenden Bedingungen ausgelegt Gebrauch in Innen
10. button e Type in the user name and touch OK Matt The new user name will be added to the list e To select a user name touch the button to highlight it Touch it again to de select it e To delete a user name from the list select the user name and touch Delete e Touch Done to return to Program Options Program The user name will now appear in the Program Options screen e Touch the Program button to return the programming screen Password Cancel 40 Keywords Keywords can be entered and linked to the program to help in searching for related programs Keywords None selected Create a new keyword e To enter a keyword touch the None selected button next to Keywords With gradient e Other keywords that have already been created will then be listed e To create a new keyword touch the Create a new keyword bution Cancel e Type in the keyword and touch OK Wheat Lab SRE 2 rr i ee The new key word will be added to the list Keywords 2009 Wheat Lab e To select a keyword touch the button to highlight it si a new keyword Touch it again to de select it More than one keyword can be selected With gradient e To delete a keyword from the list select the keyword s and touch Delete Wheat Lab e Touch Done to return to Program Options The keyword s will now appear on the Program Options screen e Touch the Program button to return the programming screen Cancel
11. by keyword e Search by user e Search by keyword and user 2 Step Template A 1 Used Yesterday 1 48 PM 3 Step Template n 9 Used Yesterday 1 48 PM RT PCR Template n 3 Create a new Used Yesterday 1 45 PM program Settings e To search for a file saved on the unit touch View Ice Bucket A Used 19 04 2010 A Current status Files to open the File Manager screen Version 1 117 v2 1 1 View files Sort By Programs And Search By Search By Logs Program Keyword pu Select All Name ABC Search from a list e Touch Programs And Logs to display either programs only temperature logs only or both e Use the up and down arrow buttons to scroll through the list of saved files e Touch Sort By Program Name to list the programs in order The options are Program Name ABC ZYX Recently Used ABC ZYX Most Used ABC ZYX User ABC ZYX Search the files by keyword e Touch Search By Keyword and this will open the list of keywords stored on the unit e Select one or more keywords by touching the buttons to highlight them Touch again to de select e When all keywords have been selected touch Done to return to the File Manager screen Only the files with the selected keyword s saved with them will be listed e To clear the keyword search touch Clear Keyword Search 53 Temperature Log from 123456 2 Step Template Keywords None selected User None selected Created Yesterday 1 44 PM Temperatu
12. incluyendo pero sin estar limitado a ello p rdidas de tiempo materiales y gastos o p rdida de uso beneficios producci n ingresos ahorros previstos u oportunidades comerciales Si desea realizar una reclamaci n p ngase en contacto con el suministrador del equipo Esta garant a complementa y no afecta a sus derechos legales Este manual se ha preparado con una finalidad informativa para los clientes de Techne y ninguna parte del manual se deber considerar como una garant a condici n o reflejo con respecto a la descripci n comerciabilidad idoneidad para un fin determinado o de otro tipo de la unidad o sus componentes Con independencia de la descripci n y las especificaciones del instrumento que se indican en el manual del operario Techne se reserva el derecho de realizar cambios en el instrumento o en cualquiera de sus componentes cuando lo estime oportuno 14 CONTACT INFORMATION For technical sales or servicing information contact your local Techne dealer or UK Bibby Scientific Ltd Beacon Road Stone Staffordshire ST15 OSA UK Tel 44 0 1785 812121 Fax 44 0 1785 810405 E mail sales bibby scientific com www techne com France Bibby Scientific Limited Batiment Le Deltaparc Parc Silic PN2 7 rue du Canal BP 55437 VILLEPINTE 95944 ROISSY Charles de Gaulle France Tel 33 0 148 63 78 03 Fax 33 0 148 63 78 01 E mail ventes bibby scientific com www bibby scientific com Middle East
13. number of individual steps that can be cycled repeated a defined number of times Insert a new stage i i es e To insert a stage in a program touch Insert a new stage A stage with one step will be inserted ge 1 1 cycle Stage 1 e Touch this to give the stage a name optional Enter the name using the text entry screen u ANS e Touch this to edit the number of cycles repeats for ER the stage Enter the required number of cycles then touch OK Temperature h e Touch the temperature button to edit the temperature of the step and add any increment decrement or gradient features Note The minimum step temperature that can be programmed during cycling stages is 10 C If the step temperature is above or below the valid gradient range PrimeG only then the gradient function is disabled Time e Touch the time button to edit the hold time of the step and to add any increment decrement time features Maximum 1121314151617189 10 Ramp rate e Touch the ramp rate setting to adjust the ramp rate The range is 0 1 C s minimum to 3 4 C s maximum Minimum Maximum for heating and 1 0 C s for cooling The value can be entered to 1 decimal place Ramp rate will affect the heating or cooling rate from the previous step to the e To delete a stage touch the stage area to highlight it and then touch Delete 95 0 C 00 01 00 e Once set touch OK to return to the Programming screen Delete a stage
14. only e Touch Program to return to the programming screen Cancel VIEW e Touch View to see a graphical representation of the program e If the program has more stages and steps than are displayed on the screen scroll through the program by dragging a finger across the touch screen The centre of the screen shows each temperature step 94 C 95 C 60 C 72 C 72 C and hold time not to scale Stages are indicated by a y pia vi ie ni white bar spanning the steps within the stage Program The bottom of the screen shows the name of the Med program and the expected end time if it was started 02 12 2011 14 40 immediately Note The program is not saved at this point e Touch Start to start the program e Touch Edit to edit the program e Touch Back to return to the Programming Screen Note The temperature log will remain blank until the program has been started If a step has a gradient programmed into it the bar will be shown thicker and indicate the upper and lower temperatures of the gradient range If a step has an incremented or decremented temperature this will be indicated by a white spot next axe 57 5 C 72 C 60 Ce 72 C to the temperature 00 00 40 00 01 00 00 00 40 00 01 00 00 00 40 00 01 006 If a step has an incremented or decremented time this will be indicated by a white spot next to the time 43 DELETE This is used to delete an entry First touch the required s
15. pas obstru s 6 Raccorder le c ble d alimentation la prise situ e l arri re de l appareil 7 Allumer l appareil utilisant le commutateur situ l arri re de l unit Cable de rechange S il s av re n cessaire de remplacer le cordon d alimentation utiliser un cable de 1 mm conforme a la norme HO5VV F reli une prise IEC320 EN CAS DE DOUTE CONSULTER UN ELECTRICIEN QUALIFIE CONDITIONS ENVIRONNEMENTALES Le Prime est concu pour fonctionner dans les conditions suivantes Pour un usage interieur seulement Temperature ambiante 5 C a 40 C Altitude inferieure a 2000m Humidite relative ne depassant pas 80 Fluctuations de l alimentation n exc dant pas 10 de la valeur nominale Categorie Il IEC 60364 4 443 de surtension Degre de pollution 2 Remarque Les parametres sont indiques pour une temperature ambiante de 20 C Ces caract ristiques peuvent se d t riorer en dehors d une temp rature ambiante de 10 a 30 C L appareil a ete test en mati re de radiofr quences et est certifi selon la norme EN61326 GARANTIE Bibby Scientific Ltd garantit cet instrument contre tout vice de mati re et de fabrication quand il est utilis dans des conditions normales de laboratoire pendant quatre 4 ans En cas de r clamation justifi e Bibby Scientific Ltd procedera gratuitement au remplacement de tout l ment d fectueux ou au remplacement de l appareil Cette garantie ne s applique pas aux dommages provo
16. procedure Turn on the Prime unit On the home screen touch Settings and then More Settings followed by Add Gradient Feature Go to the address www techne com Click on Support then Technical Support Under Further Information click on Thermal Cycler Gradient Upgrade Insert the serial number from the Prime into the website twice as instructed Insert the upgrade code printed on the certificate into the website Click Show confirmation number Insert the upgrade code and confirmation number into the Prime and touch Validate The Prime is now upgraded service Settings A Add Gradient Feature Oligo Tm Calculator More Settings Cancel Serial number 50226 Confirmation Code Validate 60 REPLACING BLOCKS Please note that thermal blocks in Prime and PrimeG thermal cyclers are not interchangeable Thermal blocks can be replaced under warranty in case of product breakdown and mechanical or electrical failure but this must be performed by a Qualified Bibby Scientific Service Engineer and may require the unit to be returned to the factory 61 Q1 Ai Q2 A2 Q3 A3 Q4 A4 Q5 A5 Q6 A6 Q7 A7 FAQS How do adjust the pressure of the heated lid for my tubes or plates For thermal cyclers with lid adjustment knobs rotate the knob anticlockwise until there is no pressure on the consumable then close the lid and latch it To obtain the correct pressure genily rotate the
17. software which can be downloaded free of charge from www techne com e See the directions given in the next section for copying files to a USB memory stick e Copy the files to a PC and open the Workbench software e Use Settings to select the path for the saved files or click on Open to browse for the saved files e Select the required temperature log and click Open Note Since the temperaturelogdata file is a text file itcan also be opened in applications such as Excel for further analysis 55 i Only Fa By Programs rogram Name ABC Program Alu opt 2 step Keywords Alu opt User Jayne Used 30 03 2010 Program Ice Bucket Keywords None selected User None selected Used 19 04 2010 Program pBR Keywords None selected User Jayne Used 13 04 2010 Program RT PCR Template Keywords None selected User None selected Used Yesterday 1 45 PM Initial Denaturation 94 C 00 05 00 Preheat Lid 105 C Program GAPDH End time Today 2 59 PM New Program Open Program 2 Step Open Keywords O Search By Search By Program Alu opt 3 step Keywords Alu opt User Jayne Used 30 03 2010 Program Ligation 15 C Keywords None selected User None selected Never used Program pBR fast Keywords None selected User Jayne Used 13 04 2010 Program GAPDH Keywords None selected User Jayne Never used 60 C 00 00 40 72 C 00 01 00 95 C 00 00 30 35 cycles 4 Edit Delete
18. the columns are paired as it is not possible to individually control 24 columns Therefore only 12 column temperatures are available across this block OLIGO Ty CALCULATOR The oligo T calculator can be used to estimate the T of the PCR primers and help in selecting an appropriate annealing temperature for the thermal cycling program e Touch Enter The Oligo Sequence in order to input the sequence of the primer Enter The Oligo Sequence Primer Concentration Enter the concentration of the primer in pM Salt Concentration Enter the salt concentration in mM e Touch the AC GT buttons to enter the primer sequence DNA Base Entry e Touch DEL to delete the last character Bases e Touch CLR to delete the whole sequence ATIGIAATICGTACIeRADAE e Use the arrow keys to scroll through the sequence e Touch OK to return to the calculator screen 39 Enter the primer concentration in the PCR mix ACGGCAATTGTAATTCGTAC Enter the monovalent salt concentration of the PCR MIX Primer Concentration Enter the concentration of the primer in pM Touch Calculate to calculate the Tm of the primer Salt Concentration Enter the salt concentration in mM To check the T of another primer with the same primer and salt concentrations touch Back and enter the new primer sequence Tm Calculation 50mM salt and 0 5pM primer ACGGCAATTGTAATTCGTAC Touch Reset to clear the entries Touch Back to return to the Settings men
19. C s 35 to 115 C or off 5 C Yes lt 2 min Yes Manually adjustable The heated lid is only operational if the block temperature is set above 35 C PROGRAMMING Program interface Maximum number of programs stored Maximum number of stages per program Maximum number of steps Maximum number of cycles per stage Programmable ramp rate Maximum hold time Minimum hold time Gradient calculator PrimeG only Incremented decremented temperature Incremented decremented time Pause facility Program naming Password protection Keyword selection Run completion time End of program alarm Auto resume on power failure Oligonucleotide Tm calculator Software updates 5 7 colour VGA LCD touch screen 1000 10 10 99 Yes 0 1 C s steps 4h 59m 59s 1s Yes Yes Yes Yes Alpha numeric plus symbols Yes Yes Yes Yes Yes always or never Yes based on the Nearest Neighbour method Free of charge from www techne com Breslauer K J Frank R Blocker H and Marky L A 1986 Proc Natl Acad Sci USA 83 pp 3746 3750 16 COMMUNICATION PORTS USB port on front of unit USB port on rear of unit DIMENSIONS Height mm Width mm Length mm Weight kg POWER Voltage Power 17 Connection for USB memory stick Connection for servicing and calibration only 240 240 420 9 4 100 240V 50 60Hz 425W INSTALLATION See also the Safety Information sections on pages 5 to 14 Front vi
20. ER PREFERENCES Language e Touch the language button to set the required language The options are English French Spanish Italian and German Temperature Display e Touch the temperature button to set the required temperature units The options are C and F Home Screen File List Sort This sets the user preference for listing the program shortcuts on the Home Screen e Touch the button to set the required sorting preference The options are recently used first or most used first e Touch More Settings for further user preferences Select Multiple Items in File Manager This allows either multiple files or only single files to be selected for copying and deleting when using the File Manager in the View files module e Touch to select On or Off e Touch Back to return to the Settings menu User Preferences Instrument Settings Program Defaults More Settings Language English French Spanish Italian German English Temperature Display Celsius C Fahrenheit F Celsius C Home Screen File List Sort Recently Most Used First Recently Used First Used First More Settings Select Multiple Items in File Manager On Off More Settings 30 INSTRUMENT SETTINGS Temperature Log Recording Temperature Log Recording To record the temperature logs block temperature Always Never profile of each run touch the button to set this to Always If temperature logs are not required s
21. FORMACION DE SEGURIDAD Lea atentamente este manual antes de utilizar el Prime ADVERTENCIA LAS ALTAS TEMPERATURAS SON PELIGROSAS ya que pueden ocasionar quemaduras graves a los operarios y prender el material combustible Los usuarios deben conocer los posibles riesgos e TENGA CUIDADO Y LLEVE GUANTES DE PROTECCION PARA PROTEGERSE LAS MANOS e NO utilice sustancias combustibles cerca de objetos calientes e NO utilice el instrumento cerca de l quidos o gases inflamables e NO coloque un l quido directamente en el instrumento SEGURIDAD DEL OPERARIO Todos los usuarios de equipos Techne deben disponer de la informaci n necesaria para asegurar su seguridad De acuerdo con las instrucciones contenidas en este manual y con las normas y procedimientos generales de seguridad es muy importante que s lo personal debidamente capacitado opere estos aparatos De no ser as la protecci n que el equipo le proporciona al usuario puede verse reducida Todos los equipos Techne han sido dise ados para cumplir con los requisitos internacionales de seguridad y traen incorporados un sistema de desconexi n en caso de sobre temperatura En caso de que surgiera un problema de seguridad desconecte el equipo de la red INSTALACI N El instrumento se debe transportar con las dos manos No mueva ni lleve el instrumento cuando se utilice o est conectado al suministro el ctrico principal 1 Todos los instrumentos Techne se suministran con un
22. G e im r dP n a e im r P L A U N A M RS O y A R E P O C fi ti cien S Dy b B CONTENTS INTRODUCTION BEFORE USE Unpacking SAFETY INFORMATION English Francais Deutsch Italiano Espa ol CONTACT INFORMATION PRIME SPECIFICATION INSTALLATION GENERAL SOFTWARE FEATURES Introduction Template programs Incremented decremented time and temperature Gradient PrimeG only Oligonucleotide Tm calculator PROGRAMMING TEXT TEMPERATURE AND TIME Text entry Temperature entry Time entry INSTRUMENT SETTINGS AND DEFAULTS User preferences Instrument settings Program defaults service settings Gradient calculator Oligonucleotide T calculator CREATE A NEW PROGRAM Name the program Insert delete a stage Insert delete a step Insert delete a pause Program options Settings View Delete Up and down arrows Save Cancel RUN A PROGRAM Running a program from the shortcut list The pre run screen The run screen Searching for a program not in the shortcut list Running a program not on the shortcut list EDITING A PROGRAM Editing saved programs Editing templates Editing password protected programs CURRENT STATUS VIEW FILES File searching Viewing a program file Viewing a temperature log file Copying files Deleting files UPDATING THE PRIME SOFTWARE UPGRADING FROM PRIME TO PRIMEG REPLACING BLOCKS FAQs TECHNICAL SUPPORT AND SERVICING ADDITIONAL INFO
23. GRAM NOT IN THE SHORTCUT LIST There are four ways to search for a program if it is not in the shortcut list Search from the complete list of saved programs Search by keyword Search by user Search by both keyword and user Search from a list e To search for a program saved on the unit touch Run a Program to open the Program Selection Screen 2 Step Template Used Today 3 43 PM e Use the and buttons to scroll up and down the Ku Never used Choose a program Sort By EN Choose program Program dallo Name ABC Keyword Search By User list of stored programs Select an item from the list to see Ice Bucket program details Used Today 4 19 PM Ligation 15 C e Touch Sort By Program Name to list the programs in order The options are aver used RT PCR Template Program Name ABC ZYX Used Last Friday 1 27 PM Recently Used 123 321 Most Used 123 321 User ABC ZYX Search the programs by keyword e Touch Search by Keyword and this will open the list of keywords stored on the unit Keywords 2009 Wheat Lab Create a new keyword e Select one or more keywords by touching the buttons to highlight them Touch again to de select With gradient e When all keywords have been selected touch Done to return to the Program selection screen Wheat Lab Only the programs with the selected keyword s saved with them will be listed e To clear the keyword search touch Clear Keyword Searc
24. ING A PROGRAM NOT ON THE SHORTCUT LIST e Once the required program has been identified s touch it to highlight it Pr ted Lid Preheat Lid The Program Selector Screen will show a summary of PESEE srr rel Extension FinalHal the program the instrument settings and a graphical Used Today 3 43 PM x nta representation of the thermal cycling program 3 Step Template on 00 05 00 94 C Never usec Off Ice Bucket e Touch Edit to edit the program if required Used Today 4 19 PM e Touch Back to return to the Home Screen ae RT PCR Template e Touch Start to proceed to the Pre run Screen Used Last Friday 1 27 PM e From the Pre run Screen touch Start to run the program See THE RUN SCREEN on page 46 for further information on instrument status and progress during a run Initial Denaturation 94 C 72 C 10 C 00 05 00 00 05 00 Final Extension Final Hold ss 30 Cycles Program 2 Step Template Start End time Edit Back Today 10 45 AM 49 EDITING A PROGRAM EDITING SAVED PROGRAMS First select the required program by searching the Run a program module e To edit a selected program touch the Edit button Any of the Program Options Settings or thermal cycling parameters can be edited e Once all the required changes have been made touch Save Note this will overwrite the existing program To copy a program for editing please see section VIEW FILES EDITING TEMPLATES Editing template
25. RMATION User Maintenance Fault Finding Fuses Insulation Testing ACCESSORIES REPLACEMENT PARTS DECLARATION OF CONFORMITY 46 47 49 50 50 50 51 52 53 53 99 59 56 58 59 60 61 62 63 64 64 64 64 64 65 65 66 INTRODUCTION The Prime is a stand alone flexible and versatile thermal cycler designed to accurately control the temperatures of samples between 4 C and 100 C It has many scientific applications including PCR reverse transcription ligation and sequencing It has a flexible range of block options to allow for most commonly used consumables including 0 2ml x 96 well plates 0 2ml tubes 0 5ml tubes and 384 well plates A Combi Block version is also available which can accept either 33 x 0 2ml or 33 x 0 5ml tubes The heated lid is fully adjustable to accommodate a wide range of different consumables BEFORE USE Before using the Prime please ensure you have read this manual carefully If there is any doubt relating to the proper use of this equipment the staff at Bibby Scientific Ltd or your supplier will be happy to assist you UNPACKING When unpacking the unit please ensure that the following have been removed from the packaging e Prime with block e Mains cables UK EU and US e Operator s manual e Warranty card The user is advised to keep the original packaging in case the instrument ever needs to be returned for service or repair Bibby Scientific Ltd accepts no responsibility for da
26. Touch On Off to toggle between settings e Touch the time button to set the required hold time e Touch the temperature button to set the required temperature Final Hold This will hold the block at the set temperature at the end of a program until the user manually stops the unit e Touch On Off to toggle between settings e Touch the temperature button to set the required temperature e Touch More Settings to return to the top of the Program Defaults menu or Back to return to the Settings menu SERVICE SETTINGS Initial Denaturation Hot Start More Settings Aue 00 05 00 Extension Final Hold More Settings The service settings are for the use of authorised service engineers only A service engineer s password is required to access these settings 34 GRADIENT CALCULATOR PRIMEG ONLY The Gradient Calculator can be used to calculate the temperature for each column of the block for a user specified temperature and gradient range e Touch the Target Temperature button and enter the required temperature Target Temperature Enter the temperature used for the gradient e Touch OK Temperature Gradient e Touch the Temperature Gradient button and enter MENS ETC the required gradient range followed by OK e Touch OK 50 7 51 2 52 3 53 3 54 3 54 9 55 5 56 2 56 9 58 1 59 2 59 7 The calculated temperatures for each of the columns of the block will now be displayed Note With the 384 well block
27. are a 100 240V 50 60Hz Collocare l unit su un banco piano idoneo o in una cappa aspirante se necessario assicurandosi che gli sfiati delle prese d aria nella parte inferiore non siano ostruiti 6 Inserire il cavo di rete nella presa che si trova sul retro dello strumento 11 7 Accendere lo strumento per mezzo dell interruttore situato sulla parte retro dell unit Cavo di ricambio Qualora occorra sostituire il cavo di rete si dovr utilizzare un cavo di 1mm codice armonizzato HO5VV F collegato ad una spina IEC 320 IN CASO DI DUBBIO RIVOLGERSI A UN ELETTRICISTA QUALIFICATO CONDIZIONI AMBIENTALI Il Prime stato progettato per funzionare nelle seguenti condizioni uso interno range di temperatura ambiente da 5 C a 40 C altitudine massima 2000 m umidit relativa non superiore all 80 oscillazione dell alimentazione di rete non superiore al 10 categoria di sovratensione ll IEC 60364 4 443 grado di inquinamento 2 Nota le specifiche di controllo sono indicate ad una temperatura ambiente di 20 C Le specifiche potrebbero peggiorare fuori da una temperatura ambiente compresa tra 10 C e 30 C Lo strumento stato collaudato per interferenze da radiofrequenze ed certificato secondo la norma EN61326 GARANZIA Bibby Scientific Ltd garantisce che per un periodo di quattro 4 anni e se utilizzato nelle normal condizioni di laboratorio questo strumento non presentera alcun difetto dei materiali o di fabbri
28. cable de alimentaci n que puede ser integrado o enchufable _ Antes de conectar el instrumento al suministro el ctrico compruebe que el voltaje coincida con el indicado en la placa de r gimen situada en la parte trasera de la unidad El instrumento debe disponer de una toma de tierra para garantizar la seguridad el ctrica adecuada Conecte el cable de alimentaci n a un enchufe adecuado seg n la siguiente tabla 220 240V 50 60Hz 110V 120V 50 60Hz 3 S LO PARA EL REINO UNIDO El enchufe suministrado con el cable de alimentaci n incluye un fusible de 5 amperios para ofrecer protecci n al instrumento y al usuario 4 Las unidades se clasifican para funcionar en 100 240V 50 60Hz Sit e la unidad sobre una mesa plana o en una campana de laboratorio si es necesario y aseg rese de que los orificios de ventilaci n situados en la parte inferior no tienen ninguna obstrucci n 6 Conecte el cable de alimentaci n en el enchufe situado en la parte trasera del instrumento 13 7 Encienda el instrumento usando el interruptor situado en la parte posterior de la unidad Cable de repuesto Si es necesario sustituir el cable de alimentaci n se debe utilizar un cable de 1mm de c digo armonizado HO5VV conectado a un enchufe IEC320 EN CASO DE DUDA PONGASE EN CONTACTO CON UN ELECTRICISTA CONDICIONES AMBIENTALES El Prime est dise ado para utilizarse en las condiciones siguientes Uso en interior Intervalo
29. cazione In caso di reclamo giustificato Bibby Scientific Ltd sostituira qualsiasi componente difettoso o rimpiazzera l unita in modo gratuito Questa garanzia non si applica ai danni causati da incendio incidenti utilizzo improprio negligenza regolazioni o riparazioni scorrette danni dovuti a installazione non corretta adattamenti modifiche o installazione di parti non approvate oppure riparazioni eseguite da personale non autorizzato La responsabilita di Bibby Scientific Ltd e limitata al costo della riparazione o della sostituzione del prodotto ed esclude in particolare qualsiasi perdita indiretta o secondaria danno costo o spesa ivi inclusi a titolo di esempio e in modo non esaustivo perdite di tempo materiali e spese oppure perdite di utilizzo profitto produzione ricavo risparmio atteso o avviamento Per esporre un reclamo contattare il fornitore dello strumento Questa garanzia in aggiunta ai diritti di legge e non ha alcun effetto su di essi Il presente manuale stato preparato ad uso dei clienti di Techne e niente di quanto in esso contenuto costituisce garanzia condizione o rappresentanza riguardo la descrizione la commerciabilit l idoneit allo scopo o altrimenti dell unit o dei componenti Nonostante la descrizione e le specifiche dello strumento contenuti nel manuale dell operatore Techne si riserva il diritto di apportare le modifiche ritenute opportune agli strumenti o a qualsiasi loro componente 12 IN
30. ch CLR To delete the last character touch DEL TEMPERATURE ENTRY When touching a temperature parameter a temperature entry screen will open There are two forms of temperature entry screen A simple form for adjusting the temperature of the instrument parameters such as the heated lid and program parameters such as initial denaturation and final extension An advanced form when programming step temperatures within a cycling stage that includes the options for introducing an incremented decremented step temperature for example in touchdown PCR or a temperature gradient Simple temperature entry Enter the temperature type in the required value The decimal point can be used for 0 1 C resolution H d Lid To clear the entry press DEL eated Li If an entered temperature is invalid a prompt will 105 0 indicate the acceptable range o Once the temperature is correct touch OK to return 1234567890 to the previous screen Touch Cancel to return to the previous screen if no changes are required 23 Advanced temperature entry e First ensure the number of cycles for the stage has been set then enter the required hold temperature as described above Note Increase Decrease Per Cycle will be inactive unless the number of cycles set is greater than 1 To increase the step temperature per cycle e For an increase in temperature per cycle touch the button below Increase Per Cycle to turn this function on Next t
31. ch OK again to return to the programming screen e Touch Cancel to return to the programming screen if no changes are required 26 The temperature value will now appear orange in the Baie programming screen indicating that it contains a _ modified function 00 01 00 Insert a new step TIME ENTRY When touching a time parameter a time entry screen will open There are two forms of time entry screen e A simple form for adjusting the time of the program parameters such as initial denaturation and final extension e An advanced form when programming step hold times within a cycling stage that includes the options for introducing incremented decremented time for example in long PCR Simple time entry e Enter the time using the or buttons to increase or decrease the number of hours minutes or seconds Final Extension Time Final Extension Time e Using the button with the value set at 0 will scroll to the maximum permitted value Minutes e Touching Hide Hours will remove the hour time selector and just display selectors for minutes and seconds e Once the time is correct touch OK to return to the previous screen e Touch Cancel to return to the previous screen if no changes are required Advanced time entry e First ensure the number of cycles for the stage has been set then enter the required hold time as described above Note Increase Decrease Per Cycle will be inactive unless the n
32. clear the entry e If an entered decremented temperature is invalid a prompt will indicate the acceptable range e Touch OK to return to the previous screen The decrease in temperature per cycle will now be displayed e Touch OK again to return to the programming screen e Touch Cancel to return to the programming screen if no changes are required 29 The temperature value will now appear orange in the programming screen indicating that it contains a modified function 95 0 C 00 01 00 Note It is not possible to both increase and decrease the temperature of the same step 55 0 C 00 01 00 Ineart a nau rtann Ineara nanon To enter a temperature gradient on a step PrimeG 39 0 DEL only On the PrimeG an additional Temperature Gradient button is available e Touch the button below Temperature Gradient to turn this function on Next touch the temperature entry button below this A new screen will open which is similar to the simple temperature entry screen The maximum temperature gradient based on the set hold temperature and the e orature Gradient temperature limits of the unit will be shown Maximum gradient is 29 0 C e Enter the required value e Touch DEL to clear the entry e f an entered gradient temperature is invalid a prompt will indicate the acceptable range e Touch OK to return to the previous screen The temperature gradient for the step will now be displayed e Tou
33. copied onto the unit for editing or to and from a USB memory stick To copy files to the unit e Select one or more files for copying by touching the appropriate file button Note Multiple file selection is optional and can be set up in the User Preferences section of the Settings Module or e Touch Select All to select all files e Touch Copy A message box will confirm that the files have been copied The copied file s will now be highlighted and listed as Copy of and can be edited as required Program PCN End time Today 15 38 Program p Template rds Defra 2009 es Used 10 11 2009 Pro gram Ice Bucket Keywords None bidge saturday Copying Files 1 file copied Progress 00 11 41 01 07 12 Instrument search BY Select All Program e Template vords Defra 2008 Bates day 6 59 PM Prograrn Copy of 2 Step Template Prograrn Ligation 15 C k s IPCA 3 one selected Last Thursday 6 59 PM 96 To copy files to a USB memory stick SE Host de ines ten e Insert a USB memory stick into the port on the front im you like view any programs or temperature logs on the USB flash of the unit drive using the file manager A message screen will appear confirming that the USB memory stick has been inserted e Touch Cancel to return to the File Manager screen e Select one or more files for copying by touching the appropriate file button ao or e Touch Select All
34. d to the mains electricity supply 1 All Techne instruments are supplied with a power cable this may be integral or plug in 2 A Before connecting the instrument to the mains electricity supply check the voltage i against the rating plate located on the back of the unit Please note that the unit must be earthed to ensure proper electrical safety Connect the mains cable to a Suitable plug according to the table below 220 240V 50 60Hz 110V 120V 50 60Hz 3 UK ONLY The fused plug supplied with the mains cable is fitted with a 5 amp fuse to protect the instrument and the operator 4 The units are rated to operate at 100 240V 50 60Hz 5 Place the unit on a suitable flat bench or in a fume cupboard if required ensuring that the air inlet vents on the underside are free from obstruction 6 Plug the mains cable into the socket on the back of the instrument 7 Switch on the instrument using the switch located on the back of the unit Replacement cable Should the mains lead need replacement a cable of 1mm of harmonized code HO5VV F connected to an IEC320 plug should be used IF INDOUBT CONSULT A QUALIFIED ELECTRICIAN 5 ENVIRONMENTAL CONDITIONS The Prime is designed operate under the following conditions Indoor use Ambient temperature range 5 C to 40 C Altitude to 2000m Relative humidity not exceeding 80 Mains supply fluctuations not exceeding 10 Over voltage category Il IEC 60364 4 443 Pollution
35. de temperatura ambiente 5 C a 40 C Altitud hasta 2000 m Humedad relativa no superior al 80 Fluctuaciones del suministro el ctrico no superiores al 10 Categoria de sobrevoltaje Il IEC 60364 4 443 Nivel de contaminacion 2 Nota Las especificaciones de control corresponden a una temperatura ambiental de 20 C Las especificaciones pueden empeorar si se utiliza el instrumento fuera del intervalo de temperatura comprendido entre 10 C y 30 C Se han realizado pruebas para comprobar la interferencia de radiofrecuencia del instrumento el cual cumple la normativa EN61326 GARANTIA Bibby Scientific Ltd garantiza que este equipo estara libre de defectos de materiales y mano de obra si se utiliza en condiciones normales de laboratorio durante un periodo de cuatro 4 anos En caso de reclamacion justificada Bibby Scientific Ltd sustituira cualquier componente defectuoso o cambiara la unidad gratuitamente Esta garantia no es aplicable si los da os han sido ocasionados por incendios accidentes usos inapropiados negligencias ajustes o reparaciones incorrectas asi como si se trata de danos ocasionados por la instalacion adaptacion modificacion o incorporacion en el instrumento de piezas no aprobadas o su reparaci n por personal no autorizado La responsabilidad de Bibby Scientific Ltd se limita al coste de la reparaci n o sustituci n del producto y excluye espec ficamente p rdidas da os costes o gastos indirectos o accidentales
36. degree 2 Note The control specifications are quoted at an ambient temperature of 20 C The specification may deteriorate outside an ambient temperature of between 10 C and 30 C The instrument has been tested for radio frequency interference and is certified under EN61326 WARRANTY Bibby Scientific Ltd warrants this instrument to be free from defects in material and workmanship when used under normal laboratory conditions for four 4 years In the event of a justified claim Bibby Scientific Ltd will replace any defective component or replace the unit free of charge This warranty does not apply if damage is caused by fire accident misuse neglect incorrect adjustment or repair damage by incorrect installation adaption modification fitting of non approved parts or repair by unauthorised personnel Bibby Scientific Ltd liability is limited to the cost of repair or replacement of the product and excludes in particular indirect and consequential loss damage costs or expenses including but not limited to wasted time materials and expenditure or loss of use profit production revenue expected savings or goodwill To make a claim please contact the supplier of the instrument This warranty is in addition to and does not affect any statutory rights This manual has been prepared for the convenience of Techne s customers and nothing in this manual shall be taken as a warranty condition or representation concerning the description m
37. e Decrease Per Cycle fm 00 00 00 00 00 00 A new screen will open which is similar to the simple time entry screen The maximum decrease in hold time per cycle based on the number of cycles and AN i i ycie the time limits of the unit will be shown Maximum decrease per cycle is 00 00 08 e Enter the required value Minutes e f an entered decremented time is invalid a prompt will indicate the acceptable range e Touch OK to return to the previous screen The decrease in hold time per cycle will now be displayed e Touch OK again to return to the programming screen e Touch Cancel to return to the programming screen if no changes are required Increase Per Cycle Decrease Per Cycle Um 00 00 00 00 00 05 The time value will now appear orange in the programming screen indicating that it contains a modified function Note It is not possible to both increase and decrease the time of the same step 99 0 C SEL Maximum Cancel Insarta nau ctaann Inear a nanon A 29 INSTRUMENT SETTINGS AND DEFAULTS Touch the Settings button to access the instrument Settings menu e Touch any of the buttons to view and edit the settings e Touch More Settings to access further options e Once all the settings and defaults have been set as required touch Save to save the changes and return to the Home Screen e f you do not wish to change any settings touch Cancel to return to the Home Screen US
38. eat the lid to the set temperature before the thermal cycling program begins More Settings e Touch On Off to toggle between settings Sample Cooling Set to On to cool the block to 42C while the lid preheats e Touch On Off to toggle between settings e Touch More Settings for further program defaults or Back to return to the Settings menu Pause This will cause the unit to pause before the program Starts at the ambient temperature of the block unless Sample Cooling has been set to On In this case the unit will pause with the block held at 4 C and the program will not commence until the unit is manually un paused e Touch On Off to toggle between settings 33 105 0 C Initial Denaturation Use this to denature the sample and or activate the enzyme before the thermal cycling program begins e Touch On Off to toggle between settings e Touch the time button to set the required hold time e Touch the temperature button to set the required temperature Hot Start This will cause the unit to pause at the set temperature The program will not continue until the unit is manually un paused e Touch On Off to toggle between settings e Touch the temperature button to set the required temperature e Touch More Settings for further program defaults or Back to return to the Settings menu Final Extension Use this to add a final extension step to the program to ensure complete amplification of the products e
39. egment followed by Delete UP AND DOWN ARROWS Use these buttons to scroll through a program SAVE Touch this button to save the program CANCEL Touch this button to cancel changes to the program and return to the Home Screen 44 RUN A PROGRAM From the Home Screen touch one of the shortcuts to run one of the listed programs or touch Run a program to search and select from other programs and templates saved on the unit Selected programs can be run directly or edited before running RUNNING A PROGRAM FROM THE SHORTCUT LIST On the Home Screen the Run a program area displays shortcuts to four programs User Preferences in the Settings module can be used to select whether this displays the four most recently used programs or the four most frequently used programs e Torun one of the programs in the shortcut list Run a program touch the button to open the Pre run Screen 2 Step Template A 4 Used Yesterday 1 48 PM 3 Step Template a gt Used Yesterday 1 48 PM RT PCR Template n 3 Create a new Settings Used Yesterday 1 45 PM program ice Bucket a4 Used 19 04 2010 Current status Version 1 117 v2 1 1 View files THE PRE RUN SCREEN The Pre run Screen shows a graphical representation of the program allowing for a rapid check of the temperature parameters The centre of the screen shows each temperature step and hold time not to scale Stages are indicated by a white bar spanning the steps withi
40. entally over the number of cycles in a stage Incrementation of extension time is used with Long PCR which is when large template fragments are to be amplified e g 27kb lambda DNA 40kb genomic DNA Decremented temperature is used for protocols such as Touchdown PCR where the first cycle starts with a high annealing temperature and over the number of cycles in the stage there is a gradual decrease in the temperature This ensures that only the specific product is amplified What is a gradient thermal cycler Gradient blocks enable a particular temperature step in a protocol to be programmed so that the temperature varies across the block By specifying a temperature and the gradient to be applied each column will achieve a different temperature The set temperature is in the middle of the block the lowest on the left and the highest on the right The gradient is the total difference across the block for example if the set temperature was 60 C and the gradient 10 C then the temperatures would range from approximately 55 C to 65 C from left to right Why is a temperature gradient required The annealing temperature of the specific primers used in DNA amplification often requires optimisation Instead of running multiple experiments with different annealing temperatures the gradient thermal cycler PrimeG allows the testing of up to 12 different annealing temperatures simultaneously 62 TECHNICAL SUPPORT AND SERVICING If you require
41. erchantability fitness for purpose or otherwise of the unit or components Notwithstanding the description and specification s of the instruments contained in the operators manual Techne reserves the right to make such changes as it sees fit to the instruments or to any of the components L INFORMATION DE SURETE Veuillez lire attentivement toutes les instructions de ce document avant d utiliser le Prime AVERTISSEMENT Les TEMPERATURES ELEVEES SONT DANGEREUSES car elles peuvent provoquer de graves br lures chez l op rateur et enflammer les mat riaux combustibles Les utilisateurs doivent porter une attention toute particuliere aux points suivants e PROCEDER AVEC PRUDENCE ET PORTER DES GANTS POUR SE PROTEGER LES MAINS e NE PAS utiliser de mat riaux combustibles aupres d objets chauds e NE PAS utiliser l appareil a proximit de liquides ou de gaz inflammables e NE PAS verser de liquides directement dans l appareil SECURITE DE L OPERATEUR Tous les utilisateurs de produits Techne doivent avoir pris connaissance des consignes et instructions n cessaires la garantie de leur s curit Important cet appareil doit imp rativement tre manipul par un personnel qualifi et tre utilis selon les instructions donn es dans ce document en accord avec les normes et proc dures de s curit g n rales Dans le cas o cet appareil ne serait pas utilis selon les consignes pr cis es par Bibby Scientific Ltd la p
42. es will also depend on ambient temperature The status of the block is indicated by the step bars which display the activity of the block i e ramping to temperature paused or the count down time of the step Progress through the program is indicated by the Stage bar s which show at which cycle of the program the unit is currently at e Touch Stop to stop the program A prompt will ask you to confirm the stop e Touch Temperature log to view the block temperatures The previous two minutes of temperature readings can be viewed by scrolling across the screen using a finger Note The complete log is written and saved on the 00 06 35 00 06 35 unit only if Temperature Log Recording is selected as 59 9 Always in the Instrument Settings sc 00 06 00 Note Touch Program View to return to the program Program status 2 Step Template End time e Touch Pause to pause the program Today 12 16 PM e f paused touch Continue to un pause the program e Touch Back to return to the Home Screen Note It is possible to access all modules of the software while the unit is running a program Once the run has finished Program Finished will be displayed instead of End time 46 From the Home Screen This Instrument ID TCPrime65535 e Touch Current status Status Running Program 2 Step Template End time Today 9 17 AM e Touch the area for the instrument Accessed Today 8 16 AM e Touch View SEARCHING FOR A PRO
43. et to Never Auto Resume On Power Loss Always Never Auto Resume On Power Loss This determines whether the unit will restart after a power failure Setting Auto Resume to Always will Date and Time Settings always allow the unit to re start irrespective of the length of the power failure More Settings Date and Time Settings nni Set Date Current date is 15 12 2011 Use these settings to set the current date time and date format on the unit Time e When set touch Back to return to the Settings Current time is 13 59 menu Date Format dd mm yy dd mm yy 15 12 11 mm dd yy 12 15 11 More Settings Set Time Date e Touch Set Date in order to enter the current date e Use the and keys to set the date values e When the correct date has been set touch OK to return to the previous screen e Touch Cancel to return to the previous screen if no changes are required Time e Touch Time in order to enter the current time using the 24 hour clock e Use the and keys to set the time values e When the correct time has been set touch OK to return to the previous screen e Touch Cancel to return to the previous screen if no changes are required pw ma 31 Date Format Touch the date button to set the required date format The options are dd mm yy or mm dd yy e Touch More Settings for further date and time settings or Back to return to the Settings menu Administrator Settings This allows an
44. ew 1 Lid adjustment knob 2 Lid release latch 3 5 7 colour VGA LCD touch screen display 4 USB port for memory stick Rear view 1 Mains cable inlet 2 On Off rocker switch 3 USB port for service and calibration only Installation 1 Place the unit on a suitable flat bench ensuring that the air inlet vents on the sides are free from obstruction 2 Note that block removal can only be performed by a qualified service engineer 3 Note that when using the Combi Block only tubes of one type should be used either 0 2ml or 0 5ml Plug the mains cable into the socket on the back of the instrument Connect to the mains electricity supply with the plug provided or one wired correctly for the supply Switch the power ON using the switch located on the rear of the unit The front display will then light up 18 8 9 19 Release the heated lid by lifting the latch forward and use it to lift the lid To close the lid lower the lid onto the block and press the latch to secure in place Place the samples in the block If individual tubes or strip tubes are being used space these out evenly across the block to equalise the pressure from the heated lid The heated lid has a rotating knob to adjust the lid pressure on the samples allowing for a variety of consumables to be used To adjust the pressure Place the samples in the block and place the lid in the down position Y Y Adjust t
45. further technical or application assistance please contact Techne at E mail technehelp bibby scientific com Phone 44 0 1785 810433 Fax 44 0 1785 810405 For servicing information please contact Service Department Bibby Scientific Ltd Beacon Road Stone Staffordshire ST15 OSA E mail service bibby scientific com Phone 44 0 1785 810475 Fax 44 0 1785 810405 In the USA please contact service techneusa com or call 1 609 589 2560 We are continually striving to improve our products and software If you have any comments and suggestions on how we can do things better please send them to us at techne bibby scientific com 63 ADDITIONAL INFORMATION USER MAINTENANCE Before cleaning your unit disconnect it from the power supply The outer case of the Prime may be cleaned with a cloth dipped in water or ethanol hexane or 50 methanol can also be used No part of the case or cover should be immersed in the solvents Do not use aggressive solvents such as acetone or abrasive cleaners The block may be wiped with water ethanol or propan 2 ol and may be decontaminated by wiping with 2 Neutracon or 1 bleach solution Before using any cleaning or decontamination method except those recommended here the responsible person should check with Techne that the proposed method will not damage the equipment FAULT FINDING Note that this equipment should only be dismantled by properly trained personnel Removing the o
46. g vor Verwendung des Prime bitte sorgfaltig durch ACHTUNG HOHE TEMPERATUREN STELLEN EINE GEFAHRENQUELLE DAR Sie k nnen schwere Brandverletzung verursachen und brennbare Stoffe entz nden Der Benutzer sollt sich mit den m glichen Gefahren vertraut machen e UMSICHTIG VORGEHEN UND SCHUTZHANDSCHUHE TRAGEN e KEINE brennbaren Stoffe in der N he hei er Gegenst nde verwenden e Das Ger t NICHT in der N he entz ndlicher Fl ssigkeiten oder Gase betreiben e Fl ssigkeiten NICHT direkt auf das Ger t auftragen SICHERHEIT DES BEDIENPERSONALS Alle Benutzer von Techne Ger ten m ssen Zugang zu der entsprechenden Literatur haben um ihre Sicherheit zu gew hren Es ist wichtig da diese Ger te nur von entsprechend geschultem Personal betrieben werden das die in dieser Gebrauchsanweisung enthaltenen Ma nahmen und allgemeine Sicherheitsbestimmungen und vorkehrungen beachtet Wenn das Ger t anders eingesetzt wird als vom Hersteller empfohlen kann dies die pers nliche Sicherheit des Anwenders beeintr chtigen Die Ger te von Techne entsprechen den internationalen Sicherheitsbestimmungen und sind mit einem automatischen Ubertemperaturabschalter ausgestattet Wenn ein Sicherheitsproblem auftreten sollte mu das Ger t ausgeschaltet und vom Stromnetz getrennt werden INBETRIEBNAHME Das Ger t mit beiden H nden tragen Das Ger t unter keinen Umst nden transportieren wenn es in Betrieb ist oder w hrend das Ger t noch am Netz
47. gen und des Firmenwerts Um einen Garantiefall zu melden wenden Sie sich bitte an den Vertriebspartner des Ger ts Diese Garantie gilt zus tzlich zu und nicht anstelle von geltendem Recht Diese Anleitung wurde zur Information der Kunden von Techne erstellt und stellt in keinster Weise eine Gew hrleistung Bedingung oder Darstellung bez glich der Beschreibung Marktg ngigkeit oder Zweckdienlichkeit dieser Ger te oder Bauteile dar Unabh ngig von Beschreibung und Spezifikation en des hier beschriebenen Ger ts beh lt sich Techne das Recht vor Anderungen an diesem Ger t oder dessen Bauteilen vorzunehmen 10 INFORMAZIONI DI SICUREZZA Leggere attentamente il presente manuale prima di usare il Prime AVVERTENZA Le ALTE TEMPERATURE SONO PERICOLOSE in quanto possono provocare serie ustioni agli operatori e dare fuoco al materiale combustibile Gli utenti devono conoscere i seguenti pericoli potenziali e PRESTARE ATTENZIONE ED INDOSSARE GUANTI PROTETTIVI PER LE MANI e NON usare sostanze combustibili vicino ad oggetti caldi e NON mettere in funzione lo strumento nei pressi di liquidi o gas infiammabili e NON collocare alcun tipo di liquido direttamente nello strumento SICUREZZA DELL OPERATORE Il personale che utilizza l apparecchiatura Techne deve avere a disposizione la documentazione necessaria al fine di assicurare la loro incolumit E importante che solo personale adeguatamente addestrato utilizzi questo apparecch
48. gram GAPDH Keywords gradient User Jayne e Select one or more keywords by touching the Used Today 3 56 PM buttons to highlight them Touch again to de select S RIE GAPDH Keywords gradient User Jayne e When all keywords have been selected touch Created Today 3 56 PM Done to return to the Program selection screen Only the programs with the selected keyword s saved with them will be listed e Touch Search By User and this will open the list of user names saved with previously keyword searched files e Select the required user name by touching the appropriate button to highlight it Touch again to de select e When the user name has been selected touch Done to return to the File Manager screen Only the files with both the selected user name and key words saved with them will be listed 54 VIEWING A PROGRAM FILE e Touch Programs And Logs to display Only Programs e Search for the required program file and touch it to highlight it e Touch View to open the temperature profile Pre run Screen of the program e Touch Start to start the program e Touch Edit to edit the program e Touch Back to return to the previous screen Note The temperature log will remain blank until the program has been started VIEWING A TEMPERATURE LOG FILE lt is not possible to view a temperature log file on the Prime It must first be copied to a USB memory stick then viewed on a PC using the Techne Workbench
49. h 47 Cancel e Touch Search by User and this will open the list of user names stored on the unit GERE e Select the required user name by touching the appropriate button to highlight it Touch again to de select e When the user name has been selected touch Done to return to the Program selection screen Only the programs with the selected user name saved with them will be listed e To clear the user name search touch Clear User Search Search the programs by keyword and user Soft By Een oe e Touch Search by Keyword and this will open the re Name ABC Search list of keywords stored on the unit Heated Lid Preheat Lid Test 1 Ue n e Select one or more keywords by touching the Used Today 3 Be Coot ES buttons to highlight them Touch again to de select ee ae ie ee Used Today 10 35 AM Off e When all keywords have been selected touch Done to return to the Program selection screen Only the programs with the selected keyword s saved with them will be listed e Touch Search by User and this will open the list of user names saved with previously keyword searched programs e Select the required user name by touching the appropriate button to highlight it Touch again to de select e When the user name has been selected touch Done to return to the Program selection screen Only the programs with both the selected user name and key word s saved with them will be listed 48 RUNN
50. he orange rotating knob anticlockwise to Y give the least pressure then close the lid fully Y WY YY X Gently rotate the knob clockwise until you can feel pressure beginning to be applied lt io Rotate the knob a further quarter of a turn and this will give the correct pressure Do not over tighten Once the pressure has been set it does not need to be adjusted unless a different consumable is used GENERAL SOFTWARE FEATURES INTRODUCTION The Prime software allows the user to quickly and easily create thermal cycling programs using a simple and clear touch screen format The software is structured into five modules which are accessed from the Home Screen These allow the user to e Run an existing program selecting from templates or programs saved on the unit Run a program 2 Step Template e Create a new program Used Yesterday 1 48 PM Fi 1 3 Step Template A gt e Set instrument and program defaults and Used Yesterday 1 48 PM preferences Includes calculator tools RT PCR Template A3 Create a new Used Yesterday 1 45 PM program e View the current status of the unit EEE 5 Version 1 117 v2 1 1 e View and search for files stored on the unit View files TEMPLATE PROGRAMS To help with programming a number of program templates are installed on the unit which are available to copy and edit or can be run directly without changes Details of the installed program templates are given below Instru
51. ical Equipment for Measurement Control and Laboratory use EN 61010 2 010 2003 Particular Requirements for Laboratory Equipment for Heating of Materials CE mark affixed 2012 Signed Mr 5 Marriott Date amp nile Authority Technical Directos Bibby Scientific Lid 5 A Li Le PR E a Bib ntifie BOOY Scientific Lid Stone Staffs 5T15 OSA UK Tel 44 0 1785 812121 Fax 4d 0 1785 813748 66
52. io in conformit alle istruzioni contenute in questo manuale e nel rispetto delle normative e procedure generali di sicurezza Se l apparecchio utilizzato in modo non specificato da Bibby Scientific Ltd la protezione fornita dall apparecchiatura all utilizzatore potrebbe essere a rischio Tutte le unit Techne sono state progettate in conformit ai requisiti internazionali di sicurezza e sono equipaggiate con un interruttore anti surriscaldamento Se si dovesse verificare qualche problema di sicurezza disconnettere l apparecchio dalla rete INSTALLAZIONE Occorre trasportare lo strumento usando entrambe le mani Non spostare n trasportare lo strumento quando in funzione o collegato all alimentazione elettrica di rete 1 Tutti gli strumenti Techne sono forniti con un cavo di alimentazione pu essere integrale o plugin _ Prima di collegare lo strumento all alimentazione elettrica di rete controllare la tensione confrontandola con la targhetta riportante i valori nominali si trova sul retro dell unit Notare che al fine di garantire la corretta sicurezza elettrica occorre che l unit sia messa a terra Collegare il cavo di rete ad una presa idonea secondo la tabella riportata alla pagina successiva 220 240V 50 60Hz 110V 120V 50 60Hz 3 SOLO REGNO UNITO la spina con fusibile fornita con il cavo di rete dotata di un fusibile da 5 Amp per proteggere lo strumento e l utente Le unit sono stimate funzion
53. isted as a separate program in the program list 51 CURRENT STATUS The Current Status area of the Home Screen provides status information on the Prime and is used to access the Run Screen On the Home Screen the Current status area shows Ben the versions of software and firmware loaded on the unit 2 Step Template Used Yesterday 1 48 PM A 1 e Touch the Current status button to view the 3 Step Template Status of the Prime Used Yesterday 1 48 PM ni 2 Settings RT PCR Template n 3 Create a new Used Yesterday 1 45 PM program Version 1 117 v2 1 1 Ice Bucket a4 Used 19 04 2010 Current status D ra The Prime status will be shown Current status If a unit is running a program as shown by the status MSN ID TCPrime65535 the Run Screen can be viewed Runs can then be Status Running paused or stopped as required Bier Accessed Today 8 15 AM e Touch the area to select the unit e Touch View e Touch Cancel to return to the Home Screen Cancel 52 VIEW FILES The View files module opens the File Manager and allows access to all the program and temperature log files From here it is possible to copy program files to the unit for editing Files can also be deleted or copied to a USB memory stick for transfer to a PC or storage FILE SEARCHING There are four ways to search for a file Run a program e Search program files or temperature logs from the complete list of saved files e Search
54. knob clockwise until it is possible to just feel the pressure being applied Finally rotate the knob a further quarter of a turn the lid is now at the correct pressure for use with the consumable Ensure that all consumables used in the block are of the same height and are spread evenly across the block Insert empty dummy tubes if necessary to spread the pressure of the heated lid evenly What is the Pause function at the start of the program used for Some users prefer to preheat the heated lid before placing the samples into the unit The pause feature is used to pause the unit after the 2 minute heated lid preheat step What is Sample Cooling Sample cooling can be applied during the lid pre heat phase This maintains the block at 4 C while the lid is heating to temperature and avoids any increase in sample temperature due to the heated lid before the thermal cycling program begins What is Hot start The Hot Start step is used to pause the machine at a specific temperature typically around 70 C after the initial template denaturation The reason is to allow the manual addition of unmodified Tag DNA polymerase which may lose activity if added during the initial denaturation step Heat activated Tag or Hot Start enzymes do not require this step What is the incremented time and temperature function for Incremented decremented time and temperature are used to increase or decrease either the time or temperature increm
55. mage incurred unless the unit is correctly packed and transported in its original packaging SAFETY INFORMATION Please read all the information in this manual before using the Prime WARNING HIGH TEMPERATURES ARE DANGEROUS they can cause serious burns to operators and ignite combustible material Users should be aware of the following potential hazards e USE CARE AND WEAR PROTECTIVE GLOVES TO PROTECT HANDS e DO NOT use combustible substances near hot objects e DO NOT operate the instrument in the vicinity of inflammable liquids or gases e DO NOT place any liquid directly into the instrument OPERATOR SAFETY All operators of Techne equipment must have available the relevant literature needed to ensure their safety It is important that only suitably trained personnel operate this equipment in accordance with the instructions contained in this manual and with general safety standards and procedures If the equipment is used in a manner not specified by Bibby Scientific Ltd the protection provided by the equipment to the operator may be impaired All Techne instruments are designed to conform to international safety requirements and are fitted with an over temperature cut out If a safety problem should be encountered switch off the unit at the mains socket and remove the plug from the electricity supply INSTALLATION The instrument should be carried using both hands Never move or carry the instrument when in use or connecte
56. ment and program defaults Parameter ___2 Step Template _ 3 Step Template RT PCR Template Heated Lid i 72 0 C 01m00s 20 The Ice Bucket and Ligation programs are simple temperature holds with the former having an infinite hold at 10 C and the latter at 15 C In both of these programs the heated lid is switched off and the initial denaturation hot start and final extension functions disabled INCREMENTED DECREMENTED TIME AND TEMPERATURE The software allows the user to either increment or decrement the time and or temperature of a step within a cycling stage These features are used with applications such as touchdown PCR where the annealing temperature is gradually decreased during the cycling process and long PCR where due to the size of the product long annealing extension times are required and the extension time is increased by 15 to 20s per cycle during the final stages of the reaction GRADIENT PRIMEG ONLY The gradient feature of the PrimeG can be useful in optimising the annealing conditions for primers A gradient can be set around a temperature in any step of a program The set temperature is the temperature in the middle columns of the block and the gradient is the variation at the two extremes of the block the left hand columns being the coolest and the right hand columns the hottest 12345 6 7 8 9101112 00000000000 00000000000 0000000000C0O 2222225522595 00000000000 898989000000 LONNMOOWX gt
57. n the stage The bottom of the screen shows the program name the date and the expected end time if it was started immediately en Final Extension Finai Hold 94 C 94 C 60 C 12 C 10 C Touch Start to start the program 00 05 00 00 00 30 00 01 00 00 05 00 stages 30 cycles e Touch Edit to edit the program 2 Step Template e Touch Back to return to the previous screen End time O Beck Today 10 45 AM Note The temperature log will remain blank until the program has been started 45 THE RUN SCREEN The Run Screen will be displayed after a program has been started It shows the instrument status and the progress of a run Once the program has been started the timers in the top right hand corner of the screen will indicate how long the program has been running and the total run time The progress bar at the top of the screen also indicates how far the run has progressed Ad a pt i ve ra m p rate dal ura ion Final Extension The first time a program is run the unit estimates the 94 C 94 C foe total run time based on the ramp rates set in the ll BEN program After the first cycle has completed the actual time taken to complete the cycle is then used to re ee calculate the total run time Subsequent runs of the 2 Step Template same program will therefore have a more accurate Today 12 16 PM estimate of total run time The estimate also takes into account the ambient room temperature therefore run tim
58. ng the T of an oligonucleotide The Tm is calculated using the following equation T AH x 1000 A AS R In C 4 273 15 16 6 x log Na Where AH The sum of the Nearest Neighbour enthalpy changes Kcal mol A Helix initiation correction constant AS The sum of the Nearest Neighbour entropy changes cal K mol R The Gas Constant 1 99 cal K mol C Concentration of the oligo M Na Concentration of monovalent ions M Breslauer K J Frank R Blocker H and Marky L A 1986 Proc Natl Acad Sci USA 83 pp 3746 3750 The Oligonucleotide T calculator can be found in the Settings module where the user can input the oligonucleotide sequence its concentration in the reaction and the salt concentration of the reaction mix 22 PROGRAMMING TEXT TEMPERATURE AND TIME This section gives instructions for the basic programming of text temperature and time which are required in later sections TEXT ENTRY When giving a name to a program or stage or when entering a keyword or a password a text entry screen will be opened Touch individual characters to create the name Once the name is complete touch OK For words with all upper case letters touch CAPS Touch SHIFT if only the first letter is required in upper case For numbers touch 123 For commonly used symbols touch SYM Touch the space bar not labelled for spaces between characters To clear the typed name tou
59. ouch the temperature entry button below this A new screen will open which is similar to the simple temperature entry screen The maximum increase in temperature per cycle based on the number of cycles and the temperature limits of the unit will be shown e Enter the required value e Touch DEL to clear the entry e f an entered incremented temperature is invalid a prompt will indicate the acceptable range e Touch OK to accept and return to the previous screen The increase in temperature per cycle will now be displayed e Touch OK again to return to the programming screen e Touch Cancel to return to the programming screen if no changes are required Increase Per Cycle Maximum increase per cycle is 1 6 C 24 The temperature value will now appear orange in the programming screen indicating that it contains a modified function Test 1 Program Options 95 0 C 00 01 00 To decrease the step temperature per cycle e For a decrease in temperature per cycle touch the button below Decrease Per Cycle to turn this 4 3150104 92 92 0 function on Next touch the temperature entry o __ A new screen will open which is similar to the simple temperature entry screen The maximum decrease in temperature per cycle based on the number of cycles di i i Decrease Per Cycle and the temperature limits of the unit will be shown En decrease per cycle is 1 9 C e Enter the required value e Touch DEL to
60. qu s par les incendies accidents m susages n gligences r glages ou r parations incorrects aux dommages dus une installation incorrecte adaption modification au montage de pi ces non homologu es ou r paration par un personnel non autoris La responsabilit de Bibby Scientific Ltd se limite aux co ts de r paration ou de remplacement du produit et exclut en particulier les pertes dommages co ts ou d penses indirects et con cutifs parmi lesquels mais sans s y limiter les pertes de temps de mat riaux et les d penses ou perte d utilisation de profit de production de chiffre d affaires d conomies escompt es ou carts d acquisition En cas de r clamation veuillez prendre contact avec le fournisseur de cet appareil Cette garantie s ajoute vos droits l gaux et n affecte en rien ces derniers Le pr sent manuel a t exclusivement r dig l attention des clients de la marque Techne et rien dans son contenu ne doit tre pris comme une garantie une condition ou une affirmation concernant la description la commercialisation l ad quation un usage particulier de l appareil ou de ses composants Malgr la description et les caract ristiques techniques des appareils donn es dans le manuel de l utilisateur la soci t Techne se r serve le droit d apporter les changements n cessaires a l appareil ou tout l ment qui entre dans sa composition SICHERHEITS INFORMATIONEN Lesen Sie diese Anleitun
61. r umen Umgebungstemperatur zwischen 5 C to 40 C H he bis zu 2000 m Relative Feuchte nicht ber 80 Netzspannungsschwankungen nicht ber 10 berspannungsklasse 2 IEC 60364 4 443 Verschmutzungsgrad 2 Hinweis Die Ger tespezifikationen beziehen sich auf eine Umgebungstemperatur von 20 C und k nnen sich au erhalb des Bereichs 10 C bis 30 C verschlechtern Das Ger t wurde auf HF St reinfl sse gepr ft und entspricht den EMV Bedingungen nach EN61326 GARANTIE Bibby Scientific Ltd gew hrleistet dass dieses Ger t vier 4 Jahre lang keine Material oder Herstellungsfehler aufweist wenn es unter normalen Laborbedingungen verwendet wird In einem berechtigten Garantiefall wird Bibby Scientific Ltd alle defekten Komponenten oder das Ger t kostenlos austauschen Diese Garantie gilt nicht wenn der Schaden durch ein Feuer einen Unfall Missbrauch Nachl ssigkeit falsche Einstellungen oder Reparaturen falsche Installation Adaptierung Ver nderung den Einbau nicht zugelassener Teile oder die Reparatur durch nicht autorisiertes Personal verursacht wurde Die Garantie von Bibby Scientific Ltd ist beschr nkt auf die Kosten der Reparatur oder den Austausch des Produkts und schlie t ausdr cklich indirekte und nachfolgende Verluste Sch den Kosten oder Ausgaben aus einschlie lich aber nicht beschr nkt auf Zeit Material und Geldverlust oder den Verlust des Gebrauchs von Gewinn Produktion Einkommen erwarteten Einsparun
62. re Log from 123456 2 Step Template Keywords None selected UserNone selected Created Today 9 30 AM Temperature Log from 123461 2 Step Template Keywords None selected User None selected Created Today 9 30 AM Temperature Log from 3 Step Template Keywords None selected UserNone selected Created 29 03 2010 ords 2009 Wheat Lab Create a new keyword With gradient W h ea IE je a b Program 2 Step Template Keywords None selected User None selected Used Today 9 30 AM Temperature Log from 123456 2 Step Template Keywords None selected User None selected Created Yesterday 1 48 PM Temperature Log from 3 Step Template Keywords None selected User None selected Created 29 03 2010 Program 3 Step Template Keywords None selected User None selected Used Today 9 31 AM Cancel e Touch Search By User and this will open the list of user names stored on the unit EEE e Select the required user name by touching the appropriate button to highlight it Touch again to de select e When the user name has been selected touch Done to return to the File Manager screen Only the programs with the selected user name saved with them will be listed e Toclear the user name search touch Clear User Search Search the files by keyword and user Programs and Sot8y Clear i rogram eywor e Touch Search By Keyword and this will open the Logs Name ABC Search list of keywords stored on the unit Pro
63. rom the unit or a USB memory stick Confirm Delete Are you sure you would like to delete these files Once a file has been deleted it cannot be recovered e Select one or more files for deleting by touching the appropriate file button Note Multiple file selection is optional and can be set up in the User Preferences section of the Settings Module or e Touch Select All to select all files Cancel e Touch Delete A message box will appear asking for confirmation of delete e Touch Yes to confirm the delete Deleting Files 1 file deleted e Touch Cancel to abort the delete If the delete is confirmed a message box will confirm that the files have been deleted e Touch OK 08 UPDATING THE PRIME SOFTWARE The Prime software can be updated by downloading the latest version from the Techne website www techne com You will need a USB memory stick on which to save the update Note that the update tool requires at least Windows XP SP2 and the Microsoft Net Framework 3 5 SP1 which if needed can be downloaded from http www microsoft com downloads details aspx familvid AB99342F 5D1A 413D 8319 81DA479AB0D7 amp displaylang en e From the website click on Support followed by Software Downloads K amp Techne Prime Update Tool 1 198 99 99 Choose a USB memory stick to use for the update To update a Prime you ll need a USB memory stick with at least SMB of free space o Select the Prime Upda
64. rotection pour l utilisateur ne serait alors plus garantie Tous les appareils Techne sont con us pour r pondre aux normes de s curit internationales et sont dot s d un coupe circuit en cas de surchauffe En cas de probleme de s curit couper l alimentation lectrique au niveau de la prise murale et enlevez la prise connect e l appareil INSTALLATION Porter l appareil deux mains Ne jamais d placer ou transporter l appareil lorsqu il est en fonctionnement ou branch l alimentation lectrique 1 Tous les appareils Techne sont livr s avec un c ble d alimentation qui peut tre int gr l appareil ou raccorder Avant de raccorder l appareil l alimentation lectrique sur secteur v rifier la tension requise indiqu e sur la plaque d identification situ e au dos de l appareil Il est important que l appareil soit reli a la terre pour assurer la protection lectrique requise Brancher le c ble secteur sur une prise appropri e voir tableau ci apr s 220 240 V 50 60 Hz 110 120 V 50 60 Hz 3 ROYAUME UNI SEULEMENT La prise avec fusible int gr fournie avec le c ble secteur est munie d un fusible 5A destin prot ger l appareil et l utilisateur 4 Les unit s sont valu es pour fonctionner 100 240V 50 60Hz 5 Placer l appareil sur une surface plane ou si n cessaire sous une hotte d aspiration veiller ce que les trous d a ration situ s sous l appareil ne soient
65. s can be a quick method of creating a program by just changing a few key parameters However it is not possible to save changes to the templates installed on the thermal cycler If the edited program is a template touching Save will open the message box shown opposite e Touch the None button next to New Program Name and enter a name for the edited program e Touch Save As New Program to save the changes The re named program will now be listed in the program list Test 1 Program Options Amplification 95 0 C 00 00 30 60 0 C 00 00 40 ZE 00 01 00 Maximum This Program ls A Template A template is a program which comes installed on the thermal cycler and cannot be changed You can save the changes made to the template Save As New Program Cancel 90 EDITING PASSWORD PROTECTED PROGRAMS If the edited program is password protected touching N This Program Is Locked Save will open the message box shown opposite To You can save any changes made by entering the password or save the save the changes either new program details as a new program with a different name e Touch the None buiton next to Password and enter the correct password followed by Save Note this will overwrite the existing program or e Touch the None button next to New Program Name and enter a new name for the edited Save As New c ancel program followed by Save as a New Program Program The re named program will now be l
66. te and choose the Use the following steps opti on to run th e fi le 1 Choose a USB memory stick you would like to use for the update A folder called Update will be copied to the memory stick 2 Turn the Prime off and put the stick into one of the front USB ports O Insert a USB memory stick into the PC and 3 Turn the Prime on and follow the instructions on screen click to select e Click on Prepare the USB memory stick This will copy the update to the USB memory Stick Please insert a USB memory stick e Turn the Prime off and insert the USB stick into the front USB port e Turn the Prime on and follow the instructions on the screen The update will take several minutes When finished the home screen will be displayed e Remove the USB memory stick from the Prime 59 UPGRADING FROM PRIME TO PRIMEG The standard Prime thermal cycler can be easily and quickly upgraded to the gradient PrimeG version by purchasing the PrimeX USB upgrade The upgrade consists of a license certificate printed with a unique upgrade code which allows gradient functionality to be installed on any non gradient Techne Prime thermal cycler Purchase of this license certificate authorises the owner of any non gradient Techne Prime thermal cycler to lawfully utilise the gradient capability of that thermal cycler in all European and American geographies The license is machine specific and non transferable Gradient upgrade
67. to select all files e Touch Copy A message screen will appear giving the option of Save a copy of the file s Pen ny inserted USB flash saving the files to the unit or to the USB memory stick e Touch the upper button to save the file s to the USB memory stick Save a copy of the file s on this Prime e Touch Cancel to return to the File Manager screen The file s will be saved on the USB memory stick ina Cancel folder called FileSystem as a cyclerprogram file To copy files from a USB memory stick on ee Search By I grams a Keywiore Iser e Insert a USB memory stick into the port on the front MIA CHG IU ss of the unit Program Copy of GAPDH Keywords wheat gradient User Jayne A message screen will appear confirming that the Never used USB memory stick has been inserted e Touch Yes to view the programs on the USB memory stick in the File Manager A USB button will be visible in the top right corner indicating that the files are being read from the USB memory stick e Select one or more files for copying by touching the appropriate file button or e Touch Select All to select all files e Touch Copy A message screen will appear giving the option of saving the files to the unit or to the USB memory stick e Touch the upper button to save the file s to the Prime unit e Touch Cancel to return to the File Manager screen 57 DELETING FILES Unused or old files can be permanently deleted f
68. u LS 94 C Calculate Once all the settings and defaults have been set as required touch Save to save the changes and return to the Home Screen If you do not wish to change any settings touch Cancel to return to the Home Screen 36 CREATE ANEW PROGRAM From the Home Screen touch the Create A New Program button This will open a screen where you can build a program by adding stages and steps and define the temperatures and hold times The function of each of the buttons on this screen is Name te pregam mn O i Name the program Program Options Settings described below Cancel NAME THE PROGRAM e Touch this button to give the program a name est 1 CLR DEL Dima e Type in the required name using the text entry screen e Once the name is complete touch OK to return to pearoni kim e Touch Cancel to return to the programming screen ns if no changes are required SHIFT lt When saving the program if the chosen name has O An isca already been used for another program the message The program name is already in use by another program Please choose a box shown opposite will appear different program name e Touch OK to return to the Programming screen e Touch the program name and enter a different name e Once the name is complete touch OK to return to the programming screen e Touch Save to save the program 3 INSERT DELETE A STAGE A stage is a section of a program that consists of a
69. umber of cycles set is greater than 1 27 To increase the step hold time per cycle Minutes e For an increase in hold time per cycle touch the button below Increase Per Cycle to turn this function on Next touch the time entry button below this Increase Per Cycle Decrease Per Cycle pm 00 00 00 00 00 00 A new screen will open which is similar to the simple time entry screen The maximum increase in hold time per cycle based on the number of cycles and a u i 7 ncrease Per Cycle the time limits of the unit will be shown Maximum increase per cycle is 02 56 27 e Enter the required value using the and buttons Minutes e f an entered incremented time is invalid a prompt will indicate the acceptable range e Touch OK to return to the previous screen The increase in hold time per cycle will now be displayed e Touch OK again to return to the programming screen Increase Per Cycle Decrease Per Cycle e Touch Cancel to return to the programming screen e if no changes are required The time value will now appear orange in the programming screen indicating that it contains a modified function 95 0 C Maximum 55 0 C Maximum Ineart a nmu ctana incart a nanon 28 To decrease the step hold time per cycle Hours Minutes e For a decrease in hold time per cycle touch the button below Decrease Per Cycle to turn this function on Next touch the time entry button below this Increase Per Cycl
70. uter cover exposes potentially lethal mains voltages There are no user serviceable parts within this equipment Should you have any problems with your Prime which cannot be easily remedied you should contact your supplier and return the unit if necessary Please include details of the fault observed and remember to return the unit in its original packing Bibby Scientific Ltd accepts no responsibility for damage to units which are not properly packed for shipping if in doubt contact your supplier giving the full serial number of the unit FUSES If the display on the front panel is not lit one of the two fuses may have blown Check that there is no external cause such as a faulty plug or lead Check both fuses and replace the faulty fuse with a new one of the correct value fuse values are given on the label next to the power inlet Note that fuses should only be replaced by a qualified electrician The holder for the two fuses is built into the mains input socket First remove the power cable and then gently prise the fuse drawer open with a flat bladed screwdriver or similar tool Each fuse can be removed by using the screwdriver as a lever Exchange the faulty fuse in the fuse holder for a working fuse of the correct value Finally replace the fuse drawer in the fuse compartment and push the drawer shut Fuses which blow repeatedly indicate a serious fault and you should return the unit to your supplier for repair INSULATION TESTING
Download Pdf Manuals
Related Search
Related Contents
PDFファイル - 医薬品医療機器総合機構 Samsung Samsung S3350 Manual de utilizare comm de presse Saison culturelle 2012x Models - Assurance Overhead Doors of Tulsa Telefone Sem Fio ATEL AWP-L300 Manual do Usuário Thermal Management - Emerson Network Power Sistema di navigazione Columbus Istruzioni d`uso 各部の名称 本商品の取扱説明書について 箱の LevelOne 10-Slot Media Converter Chassis with Redundant Power Installation Guide - NTP Software QFS for NAS Hitachi Edition_rev1.0 Copyright © All rights reserved.
Failed to retrieve file