Home

ViroSeq™ HIV-1 Genotyping System

Contents

1. Item Part Number HIV Sample Prep Module 4306027 HIV Sequencing Module Prt 5 RT 4305611 HIV RNA Control Prt 5 RT v2 4315236 The HIV 1 Genotyping System comprises four modules The volumes listed are approximate and exceed volumes needed for 48 reactions Sample Prep Module Volume per Color of No of Tube Name Tube mL Tube Cap Tubes Viral Lysis Buffer 15 Clear 2 RNA Diluent 2 Clear 3 Store this module at 15 to 25 C in a manual defrost freezer that is designated amplicon free ViroSeq RT PCR Module Prt 5 RT v2 Volume Color of No of Tube Name pL Tube Cap Tubes AmpliTaq Gold 27 5 Gold 1 RNase Inhibitor 55 White 1 MuLV Reverse 55 Purple 1 Transcriptase HIV PCR Mix v2 1650 Blue 1 HIV RT Mix v2 450 Blue 1 RNA Diluent 2000 Clear 1 AmpErase UNG 55 Green 1 DTT 100 mM 25 Yellow 1 Low Mass Ladder mix 55 Clear 1 Agarose Gel Loading 275 Clear 1 Buffer Store this module at 15 to 25 C in a manual defrost freezer that is designated amplicon free clean Introduction 1 17 Sequencing Module Prt 5 RT Volume Color of No of Tube Name pL Tube Cap Tubes Formamide 2000 Clear 1 Loading buffer 1000 Clear 1 HIV SEQ MIX A 600 White 1 HIV SEQ MIX B 600 White 1 HIV SEQ MIX C 600 White 1 HIV SEQ MIX D 600 White 1 HIV SEQ MIX F 600 Red 1 HIV SEQ MIX G 600 Red 1 HIV SEQ MIX H 6
2. To set up a run continued Step Action 6 From the Lanes list select the correct number of lanes for the gel you are running that is 24 36 and so forth Note You must select the number of lanes before selecting the sample sheet 7 Select the correct comb type for the gel you are using a Click the Sample Sheet field to display a pop up menu of sample sheets stored in the Sample Sheet folder b Select the sample sheet for the current run The Run File is automatically filled with information from the selected sample sheet 9 From the Instrument File list select the instrument file that was made with the dRhodamine Matrix Standards Kit on the instrument you are running 10 In the Well to Read Distance box make sure that 36 cm is selected Prerunning the To prerun the 36 48 and 64 lane gel 36 48 and 64 lane Gel Step Action 1 Add 1X TBE buffer to both lower and upper buffer chambers about 1500 mL total 2 Use a syringe and needle to rinse 1X TBE buffer around the comb removing air bubbles 3 Attach the heat plate and hoses Close the instrument door Click Prerun The Scan window is displayed 6 Prerun the gel for approximately 20 minutes or until the temperature reaches 50 C Note While prerunning the gel you can denature your samples Using the 377 DNA Sequencer 6 7 Denaturing the Samples Denaturing the B
3. Default Settings Remove this set Save this set as 6 14 Using the 377 DNA Sequencer To create a new Basecaller Setting continued Step Action 4 Click the Save this set as button The following dialog box opens Save this set as HI 580 save 5 Enter HIV 580 in the text box and click Save Using the 377 DNA Sequencer 6 15 Analyzing HIV Sequencing Data Introduction In This Chapter This chapter describes how to use the ViroSeq HIV 1 Genotyping System Software to perform genotyping and mutation analysis of HIV 1 IMPORTANT The sample files must be correctly processed using the ABI PRiSM DNA Sequencing Analysis software before the HIV 1 Genotyping System Software can be used The following topics are covered in this chapter Topic See Page Installing the Software 7 2 Using the ViroSeq HIV 1 Genotyping System Software 7 6 Tutorial Using the HIV 1 Genotyping System Software 7 10 HIV Genotyping Folder Organization 7 14 About Projects and Sequence Segments 7 15 Starting the Software 7 16 Creating a New Project 7 17 Opening a Previously Created Project 7 18 Reviewing the Assembled Sequence 7 20 Editing the Sequence 7 27 Editing the Consensus Sequence Using the View Edit Window 7 28 Reconciling Segment Mismatches 7 38 Saving Projects 7 40 Printing a Report 7 41 Setting Aut
4. Make sure that the RT reactions were set up on ice or on a cold block 8 2 Troubleshooting Troubleshooting Table continued Observation Possible Causes Recommended Action A1 8kb PCR band with an intensity greater than the 2 0 kb mass ladder band And Nonspecific bands on the agarose gel which are gt 10 of the 1 8 kb PCR band But RNA control has a clear and well defined band And Mass ladder is clear and well defined Too much RNA input into the RT PCR Dilute RNA 1 10 with RNA Diluent then repeat RT PCR All of the following RT PCR bands appear smeared on the agarose gel RNA control bands appear smeared Mass ladder is clear and well defined Reagents and or samples were not kept at 2 6 C until the start of the RT reaction PCR product samples were heated at high temperature then quickly cooled resulting in denatured PCR product Keep all samples and reagents on ice Move tubes quickly to the thermal cycler which is prewarmed to 42 C Reheat samples then slowly cool to allow reformation of double stranded DNA Any of the above conditions when the mass ladder is either absent or abnormal in any way Poor agarose gel conditions Use new agarose running buffer loading buffer and ethidium bromide Rerun the agarose gel Troubleshooting 8 3 Troubleshooting Table continued Ob
5. tart Sequencing Analysis Softwar oy N Yew A 0 7 N Preparing the Instrument For First Time Users Run Modules About the Dye Set Primer File Obtaining the Dye Set Primer File If you are using the HIV Genotyping System for the first time you Will need to install the appropriate run modules May need to Make a dRhodamine matrix file Install the appropriate dye set primer mobility file Arun module is a file that is used to define the run conditions during data collection on the 377 DNA Sequencer Run conditions include electrophoresis voltage temperature and run time Use the run module named HIV Run Module 377 36 that is included on the CD ROM provided with the HIV Genotyping System This module is used for all gel formats on the 377 DNA Sequencer Do not use the other run modules on this CD ROM because they define run conditions that are inappropriate for the current kit configuration A dye set primer file is used by the DNA Sequencing Analysis software to compensate for the mobility effects that different dyes impart on the fragments of the sequence ladder during electrophoresis Use of the proper dye set primer file will result in more evenly spaced peaks in the electropherograms For the sequences generated with the HIV Genotyping System use the dye set primer file named DT BD Set Any Primer If you do not already have the dye set primer file named DT BD Se
6. gt gt lt Note You may also use the Reverse Arrow on the Macintosh computer expanded keyboard Home arrow Click to move to the first 5 most active position of interest lt lt End arrow Click to move to the last 3 most active position of interest Auto jump on edits checkbox If Then you select this the cursor moves checkbox in the to the next View Edit window position of interest to the right after you click the IUB code button for the replacement base 7 36 Analyzing HIV Sequencing Data View Edit menu Cursor Controls continued Control Feature on the View Edit menu Take this action Reverse jump checkbox If Then you select this the current checkbox in the position of interest View Edit window automatically jumps to the next position of interest to the left Note This works only when the checkboxes labeled Reverse jump and Auto jump on edits are selected This occurs after you click the IUB code button for the replacement base Cursor Control Using the Navigation Window For more information see Features of the Navigation Window on page 7 21 Control Feature To Then Navigation Bar move the current click on a position of position of interest to interest in the that location assembled sequence graphic Analyzing HIV Sequencing Data 7 37 Reconciling Segment Mis
7. 315 amino acids of the RT gene Provides the required MicroAmp Reaction Tubes and Microcon YM 100 microconcentrators Includes ViroSeq HIV 1 Genotyping System Software Introduction 1 5 Uses either the ABI PRISM 377 DNA Sequencer or the ABI PRISM 310 Genetic Analyzer from Applied Biosystems Is optimized for use on the GeneAmp PCR System 9600 and 9700 thermal cyclers from Applied Biosystems The Genotyping The process of HIV 1 genotyping with the HIV 1 Genotyping System Process has five main stages Stage Process 1 Isolating the HIV particles from plasma samples followed by the purification of viral RNA 2 Performing a reverse transcription of the HIV genome using a single primer 3 Performing PCR amplification of the protease and RT genes from the cDNA made in the reverse transcription reaction 4 Direct sequencing of the PCR amplification product using six or seven custom sequencing mixes 5 Identifying mutations in the protease or RT genes using the ViroSeq HIV 1 Genotyping System Software This process includes Assembling the multiple sequences into a single contiguous sequence Manual reviewing and editing of the assembled sequence in comparison to a reference sequence pNL4 3 strain of HIV 1 recommended by the AIDS Clinical Trials Group ACTG Identifying mutations known to be related to drug resistance mutation and novel mutations with no previously identified ef
8. Cover 1 22 Introduction sequencing is given below Sequencing Equipment and Consumables Sequencing A list of equipment and consumables that you must supply for Description Supplier Part Number General Materials dRhodamine Matrix Standards Kit Applied Biosystems 403047 Materials Needed If Using the ABI Prism 31 0 DNA Sequencer 310 Capillaries Applied Biosystems 402840 61 cm x 50 pm POP 6 Performance Applied Biosystems 402844 Optimized Polymer with TSR Genetic Analyzer Applied Biosystems 401956 Septa for 0 5 mL Sample Tubes Genetic Analyzer Applied Biosystems 401957 Sample Tubes 0 5 mL 10X Genetic Analyzer Applied Biosystems 402824 Buffer with EDTA Genetic Analyzer Applied Biosystems 402866 Retainer Clips 310 Glass Syringe Applied Biosystems 604418 1 0 mL Materials Needed If Using the ABI Prism 377 DNA Sequencer Front Glass Plate Applied Biosystems 401840 36 cm Rear Glass Plate Applied Biosystems 401839 36 cm Step Glass Plate Applied Biosystems 4305384 36 cm For 96 well gels only Gel Spacers 36 cm Applied Biosystems 401836 0 2 mm thick Introduction 1 23 1 24 Introduction Sequencing Equipment and Consumables continued Description Supplier Part Number Shark tooth Combs Applied Biosystems 0 2 mm thick one of 36 well 401828 the following 48 w
9. HL mL 3 0 M Sodium acetate 2 0 182 pH 4 6 100 Ethanol 50 4 550 Final Volume 52 4 732 a Prepare about 10 more solution than you need 4 Add 52 uL of the sodium acetate ethanol solution to each labeled 1 5 mL microcentrifuge tube 5 Transfer the 20 pL of each sequencing reaction to the corresponding labeled microcentrifuge tube from step 4 and close the tube cap 6 Vortex for 3 5 seconds IMPORTANT Thorough mixing atthis step is essential for efficient precipitation 7 Spin at room temperature and maximum speed greater than 12 500 x g for 30 minutes 8 Remove the sodium acetate ethanol mixture from each tube by carefully aspirating the solution 9 Add 250 uL of cold 70 v v ethanol to the tube and close the tube cap 10 Vortex for 3 5 seconds 11 Spin at room temperature and maximum speed greater than 12 500 x g for 5 minutes 12 Remove all of the ethanol by carefully aspirating the solution 13 Dry the pellets in the preheated 95 C heat block for 2 minutes IMPORTANT Do not overdry the pellets HIV Genotyping Chemistry Protocol 4 25 To purify the sequencing reactions in tubes continued Step Action 14 If you Then plan to perform electrophoresis now for instructions see Chapter 5 Using the 310 Genetic Analyzer Chapter 6 Using the 377 DNA Sequencer do not plan to perform e
10. Procedure The following table describes two ways to open a project To open projects Take this action listed in the Project Status window You can either Result a Select the project that you want to open The Navigation b Click Open window opens Double click the project name 7 18 Analyzing HIV Sequencing Data To open projects Take this action present in other folders a In the Project Status window select Find This opens a standard Macintosh computer navigation box b Navigate to the folder that contains the project that you want to open c Select the project and click Open Analyzing HIV Sequencing Data 7 19 Reviewing the Assembled Sequence About This Step Whether you have created a new project or opened an existing project the next step in the genotyping procedure is to review the assembled sequence Reviewing Process The following table defines the steps in your reviewing process Step Action 1 Use the features in the Navigation window to review the entire assembled project 2 You will use the View Edit window to trim poor quality data edit the assembled sequence and generate a consensus sequence The Navigation and View Edit windows are linked so that a change in analysis settings results in corresponding changes in the Navigation window The Navigation About the Navigation Window Window The Navigati
11. Use primer A first because it works well with the majority of sequences If Then primer A does not give good repeat the procedure using results primer D D This primer extends more efficiently than primer A for some sequences The disadvantage of primer D is that the first 4 to 8 codons of the protease gene are not sequenced in the forward direction Enzymes The following table describes the four different enzymes provided with the HIV 1 Genotyping System Enzyme Description MULV reverse transcriptase Produces single stranded cDNA from viral RNA AmpliTaq Gold DNA Polymerase Generates double stranded DNA fragments from the cDNA Amplifies the double stranded DNA Provides hot start for improved PCR performance AmpliTaq DNA Polymerase FS Creates extension products during the cycle sequencing reaction AmpErase Uracil N glycosylase Cleaves uracil containing PCR UNG products reducing contamination from previous PCR reactions 1 10 Introduction RNase Inhibitor Controls Included with the HIV 1 Genotyping System is an RNase inhibitor that protects RNA against degradation by RNases For more information about how to prevent RNA degradation see page 2 2 and Appendix B Preventing RNA Degradation About the Controls Positive and negative controls are provided with the HIV 1 Genotyping System The controls are introduced into the genoty
12. above the range of the assay Make a larger dilution of the PCR product prior to sequencing Repeat the sequencing reactions Dye blobs are present at the beginning of the sequence obscuring the electropherogram peaks Incomplete removal of unincorporated BigDye Terminators Make sure that you adequately vortex samples during the washing steps 8 4 Troubleshooting Troubleshooting Table continued Observation Possible Causes Recommended Action Noise in the sequencing data Residual ethanol supernatant was left in the reaction during pelleting and washing steps Carefully remove the ethanol supernatant following the instructions at each step Poor matrix Make another matrix each time your instrument has been serviced especially if adjustments were made to the optical system Runa BigDye sequencing standard P N 4304154 to verify gel quality Troubleshooting 8 5 Quality Standards The quality of your genotyping data depends on many factors Before producing a final report examine the quality standards described below and evaluate whether your report will meet these standards Introduction Quality of the Primer Sequence Reasons for A sequence file from an individual primer should pass these quality standards Data was analyzed using the ABI100 basecaller ABI PRISM 377 DNA Sequencer or the ABI CE 1 ABI PRISM 310
13. software data flow diagram 1 12 DNA Sequencing Analysis software 1 13 HIV Genotyping software changing analysis settings 7 38 to 7 39 editing the sequence about 7 27 using the View Edit window 7 28 to 7 37 folder organization 7 14 generating areport 7 41 installing 7 2 to 7 5 opening a project 7 18 overview 7 6 to 7 9 projects and sequence segments about 7 15 quality standards judging A 1 to A 2 reviewing the assembled sequence 7 20 to 7 26 saving projects 7 40 starting the software 7 16 tutorial using the software 7 10 to 7 13 partnumber 1 16 sterilizing microcentrifuge tubes 2 9 T technical support 1 25 to 1 30 e mail address 1 25 Internet address 1 29 telephone fax 1 26 to 1 28 thermocyclers programming 3 3 Toggle Position Cursor command 7 30 trays using to purify DNA 4 27 to 4 28 trimming sequence segments 7 33 troubleshooting table 8 1 to 8 5 tutorial using the software 7 10 to 7 13 U ultraviolet UV light and destruction of DNA 2 6 V viral CDNA amplifying by PCR 4 13 to 4 15 generating by reverse transcription 4 9 to 4 12 preparation of 1 20 W work area amplified DNA work area 2 11 DNA extraction work area 2 9 to 2 10 evidence handling work area 2 9 PCR setup work area 2 10 WWW address Documents on Demand 1 30 Applied Biosystems 1 29 Index 5 Headquarters 850 Lincoln Centre Drive Foster City CA 94404 USA Phone 1 650 638 5800 Toll Free 1 800 345 5224 Fax 1 650
14. 2 RNase inhibitor 1 11 run modules 310 Genetic Analyzer 5 3 to 5 5 377 DNA Sequencer 6 3 to 6 7 S safety guidelines preparing sequencing samples 2 13 to 2 14 sample naming conventions 1 14 Sample Sheet completing 310 Genetic Analyzer 5 6 377 DNA Sequencer 6 5 samples amplifying viral cDNA by PCR 4 13 to 4 15 Index 4 generating viral cDNA by reverse transcription 4 9 to 4 12 guidelines for preparing sequencing samples 2 2 isolating vial RNA from blood plasma 4 4 to 4 8 loading volume 6 9 performing the cycle sequencing reactions 4 21 to 4 22 planning your work 4 2 to 4 3 preparing DNA for sequencing reaction 4 16 to 4 20 purifying dye labeled DNA ethanol precipitation in 96 well plates or trays 4 27 to 4 28 using 96 well Centri Sep plate 4 29 to 4 30 purifying dye labeled DNA in microcentrifuge tubes 4 23 to 4 26 safety guidelines 2 13 to 2 14 saving projects 7 40 segment defined Glossary 2 sequencing amplifying viral cDNA by PCR 4 13 to 4 15 generating viral cDNA by reverse transcription 4 9 to 4 12 guidelines for preparing samples 2 2 isolating viral RNA from blood plasma 4 4 to 4 8 performing the cycle sequencing reactions 4 21 to 4 22 planning your work 4 2 to 4 3 preparing DNA for sequencing reactions 4 16 to 4 20 purifying dye labeled DNA in microcentrifuge tubes 4 23 to 4 26 in plates or trays 4 27 to 4 28 using 96 well Centri Sep plate 4 29 to 4 30 safety guidelines 2 13 to 2 14 troubleshooting 8 4 to 8 5
15. 47 23 12 05 75 Poland Lithuania Latvia 48 22 866 40 10 48 22 866 40 20 and Estonia Warszawa Portugal Lisboa 351 0 22 605 33 14 351 0 22 605 33 15 Russia Moskva 7 095 935 8888 7 095 564 8787 South East Europe Zagreb Croatia 385 1 34 91 927 385 1 34 91 840 Spain Tres Cantos 34 0 91 806 1210 34 0 91 806 1206 Sweden Stockholm 46 0 8 619 4400 46 0 8 619 4401 Switzerland Rotkreuz 41 0 41 799 7777 41 0 41 790 0676 The Netherlands Nieuwerkerk a d IJssel 31 0 180 331400 31 0 180 331409 To Reach Technical Support Through the Internet Telephone Fax Region Dial Dial United Kingdom 44 0 1925 825650 44 0 1925 282502 Warrington Cheshire All other countries not 44 0 1925 282481 44 0 1925 282509 listed Warrington UK Japan Japan Hacchobori Chuo Ku Tokyo 81 3 5566 6006 81 3 5566 6505 Latin America Del A Obregon Mexico 305 670 4350 305 670 4349 http www appliedbiosystems com techsupp We strongly encourage you to visit our Web site for answers to frequently asked questions and for more information about our products You can also order technical documents or an index of available documents and have them faxed or e mailed to you through our site The Applied Biosystems Web site address is To submit technical questions from North America or Europe S
16. 9 4 8 HIV Genotyping Chemistry Protocol Reverse Transcription Reactions About the During the reverse transcription RT reaction the Moloney murine Reaction leukemia virus MuLV reverse transcriptase generates a single stranded cDNA from the HIV 1 RNA Overview To Set up the RT reactions you will perform the following steps Prepare an RT master mix Add one of the following HIV 1 RNA sample Positive RNA Control Negative Control RNA Diluent Incubate in a thermal cycler to perform the RT reaction Store the single stranded cDNA or go directly to the PCR step HIV Genotyping Chemistry Protocol 4 9 Preparing the RT To avoid pipetting small volumes do not prepare single reactions Master Mix IMPORTANT Set up the reactions on ice or on a cold block To prepare the RT master mix Step Action 1 Thaw all reagents and samples and immediately place them on ice IMPORTANT Samples and reagents must be kept cold at all times Do not leave samples and reagents to thaw unattended Place the RNase Inhibitor and MuLV Reverse Transciptase on ice a Thaw the HIV RT mix and DTT solution at room temperature b Vortex them briefly to mix c Place them on ice Prepare the RT master mix in a RNase free 1 5 mL microcentrifuge tube and on ice as follows Volume for Volume for 1 16 Reactions Reagent Reaction
17. Dial Dial Africa and the Middle East Africa English Speaking and West Asia Fairlands South Africa 27 11 478 0411 27 11 478 0349 South Africa Johannesburg 27 11 478 0411 27 11 478 0349 Middle Eastern Countries and North Africa Monza Italia 39 0 39 8389 481 39 0 39 8389 493 Introduction 1 27 1 28 Introduction Telephone Fax Region Dial Dial Eastern Asia China Oceania Australia Scoresby 61 3 9730 8600 61 3 9730 8799 Victoria China Beijing 86 10 64106608 86 10 64106617 Hong Kong 852 2756 6928 852 2756 6968 Korea Seoul 82 2 593 6470 6471 82 2 593 6472 Malaysia Petaling Jaya 60 3 758 8268 60 3 754 9043 Singapore 65 896 2168 65 896 2147 Taiwan Taipei Hsien 886 2 2358 2838 886 2 2358 2839 Thailand Bangkok 66 2 719 6405 66 2 319 9788 Europe Austria Wien 43 0 1 867 35 750 43 0 1 867 35 75 11 Belgium 32 0 2 712 5555 32 0 2 712 5516 Czech Republic and Slovakia Praha 420 2 61 222 164 420 2 61 222 168 Denmark Naerum 45 45 58 60 00 45 45 58 60 01 Finland Espoo 358 0 9 251 24 250 358 0 9 251 24 243 France Paris 33 0 1 69 59 85 85 33 0 1 69 59 85 00 Germany Weiterstadt 49 0 6150 101 0 49 0 6150 101 101 Hungary Budapest 36 0 1 270 8398 36 0 1 270 8288 Italy Milano 39 0 39 83891 39 0 39 838 9492 Norway Oslo 47 23 12 06 05
18. Dye Set Primer pop up menu select DT BDSet AnyPrimer Select the appropriate instrument matrix file in the Instrument File pop up menu Using the 377 DNA Sequencer 6 5 To fill out the sample sheet continued Step Action 7 Fill down the Dye Set Primer and Instrument File columns by clicking the column headings and selecting the Fill Down command from the Edit menu Enter additional information into the Project and Comment columns if desired Save the sample sheet into the Sample Sheet folder Performing a Plate Perform a plate check to make sure that the plates are clean Check To perform the plate check Step Action 1 Mount the gel in the instrument 2 Click Plate Check 3 Examine the baseline data If Then each of the four color continue with the procedure baselines is flat one or more of the baselines remove the plates from the are noisy instrument clean them and repeat the plate check IMPORTANT Do not use the gel Setting Up a Run To set up a run Step Action 1 From the File menu select New Click Sequence Run This opens the Run window Select Plate Check E from the Plate Check Module list Select Seq PR 36E 1200 from the Prerun Module list 0 P Select HIV Run Module 377 36 from the Run Module list 6 6 Using the 377 DNA Sequencer
19. Genetic Analyzer Data was analyzed with DNA Sequencing Analysis software version 3 1 to 3 3 The peak spacing is between 9 1 and 14 inclusive Repeat the sequencing from the appropriate primer if there is Repeating the Disagreement in any base call between forward and reverse Sequencing primers that cannot be reconciled If there is any disagreement repeat the forward and reverse primer reactions The presence of one or more insertion or deletion in the sequence of one primer that have not been verified by the opposite sense primer Quality Standards A 1 Quality of the The characteristics of a high quality consensus sequence are that Consensus Sequence A 2 Quality Standards There are no unresolved ambiguities Ns There are data from sequences in both orientations for each base reported in the consensus except at the 3 most end and the 5 most end if only the D primer sequence is used in the consensus Base mixtures are verified by sequencing in both orientations In at least one orientation The smaller peak should be at least 30 of the maximum peak height Both peaks should be clearly visible in the second orientation but do not have to meet the 30 criteria All the individual sample files used to generate the consensus meet the individual quality criteria Preventing RNA Degradation Introduction How RNA Is Degraded Sources of Contamination To be success
20. List Step Action 1 From the File menu select New 2 Select Sequence Injection List The Injection List dialog box opens 3 a Click the Sample Sheet field to display a pop up menu of sample sheets stored in the Sample Sheet folder b Select the sample sheet you want to use for the run The injection list is automatically filled with information from the selected sample sheet Select the HIV 310 RunModuleH from the Module pop up menu The blank row inserted at the bottom of the injection list must remain blank If you need to add a blank row highlight the last row of the injection list and select Clear from the Edit menu All items are cleared from the row 6 Set the capillary read length to 50 cm Using the 310 Genetic Analyzer 5 7 Denaturing the Samples and Starting the Run Denaturing the Before loading the samples they must be dissolved in Template Dye Labeled DNA Suppression Reagent TSR and denatured Fragments To denature the samples Step Action 1 Add 20pL of TSR to each sample pellet IMPORTANT Only prepare the number of samples that can be run within 48 hours Do not leave samples in TSR for longer than 48 hours Close the tubes or cover the wells Vortex for 3 5 seconds Pulse spin at room temperature for 5 10 seconds to collect the contents at the bottom of the tube Heat the samples in a thermal cycler at 95 C for 2
21. Long Ranger Singel pack contains ammonium persulfate acrylamide formaldehyde and urea In addition the Long Ranger Singel pack may contain one or more crosslinkers that have various toxicological effects Contact FMC for further information about the composition of your Lot Ammonium persulfate is an oxidizer and contact with other materials may cause a fire Exposure causes burns to the eyes skin and respiratory tract Acrylamide is harmful if in contact with the skin or if swallowed It may cause eye skin and respiratory tract irritation Exposure to acrylamide may cause damage to the nervous system and reproductive system Acrylamide may also cause an allergic reaction is a possible cancer and birth defect hazard and may cause kidney damage Formaldehyde may cause an allergic reaction and is a probable human cancer hazard Urea may cause eye skin and respiratory tract irritation Please read the Long Ranger Singel pack MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves To fill out the sample sheet Step Action 1 Start the Data Collection software 2 From the File menu select New A Create New message box opens 3 Click Sequence Sample 4 Enter the names of your samples into the Sample Name column using the naming convention sample ID visit date lab code primer analysis date For more information about sample naming conventions see page1 14 In the
22. Part Number Centrifuge benchtop nonrefrigerated Eppendorf 5415 or equivalent Centrifuge refrigerated with plate holder if needed Eppendorf 5403 Jouan CR422 GR 422 or equivalent RNase free microcentrifuge tubes Sarstedt or MLS 1 5 mL Vortex mixer MLS Pipettes filter plugged tips MLS Conical tubes 15 mL and 50 mL MLS Introduction 1 21 Thermal Cycling A list of materials that you must supply for thermal cycling is shown below You will not need to use all of the materials listed because you can choose whether to contain your samples in Individual MicroAmp Reaction Tubes in a MicroAmp Base MicroAmp 8 Strip Reaction Tubes in MicroAmp Trays MicroAmp Optical 96 Well Reaction Plates for the GeneAmp PCR System Thermal Cycling Materials Description Supplier Part Number Thermal cycler Applied Biosystems N801 001 9600 GeneAmp PCR N805 001 9700 System 9600 or 9700 MicroAmp Reaction Applied Biosystems N801 0540 Tubes with Caps 0 2 mL MicroAmp 8 Strip Applied Biosystems N801 0580 Reaction Tubes MicroAmp Caps Applied Biosystems N801 0535 8 Strip MicroAmp Cap Applied Biosystems N801 0438 Installing Tool MicroAmp Base Applied Biosystems N801 0531 MicroAmp 9600 Applied Biosystems N801 5530 Tray Retainer Set 403081 MicroAmp Optical Applied Biosystems N801 0560 96 Well Reaction Plate MicroAmp Full Plate Applied Biosystems N801 0550
23. Sep 96 Plate Princeton Separations PN CS 961 This plate has 96 prepackaged hydrated spin columns that remove excess dye terminators and nucleotides from the sequencing reactions Following the spin column centrifugation step the sequencing reactions are dried in a vacuum centrifuge speed vac dissolved in a loading buffer and loaded onto the 377 instrument Procedure To purify the sequencing reactions Step Action 1 Allow the Centri Sep 96 plate to come to room temperature approximately 2 hours Remove the adhesive foil sealing film from the bottom of the Centri Sep 96 plate and then from the top a Place the Centri Sep 96 plate on top of a MicroAmp Optical 96 Well Reaction Plate tape the two plates together with a base and centrifuge at 700 x g for 2 minutes b Discard the remaining liquid in the Optical 96 Well Reaction Plate by shaking it vigorously c Wash and save the MicroAmp Optical 96 Well Reaction Plate for future use as a wash plate Transfer the sequencing reactions 20 pL to the individual wells in the Centri Sep 96 plate Carefully place samples on the centers of the gel beds Do not place the samples on the side of the wells Avoid touching the gel bed with the pipette tips Note Use a multichannel pipettor to transfer the sequencing reactions This will minimize the chance of sample mix up during the transfer process Place a 96 well collection plate a thin walled plat
24. and adding DNA to the PCR reaction tubes If possible use a dedicated area such as a biological safety cabinet with an ultraviolet UV source for RT PCR setup The UV germicidal lamps in most biological safety cabinets quickly damage any DNA left on exposed surfaces making it unsuitable for subsequent amplification All equipment and supplies used for RT PCR setup should be kept in this cabinet or a dedicated clean area at all times Do not use these items to handle amplified DNA Strict physical isolation must be maintained between the area designated for handling amplified DNA and the other areas to avoid transfer of amplified DNA out of the designated work area 2 6 Laboratory Guidelines The Amplified DNA Work Area should be in a separate room and must have a dedicated sink It may make it easier to contain PCR product within this laboratory area if you Use color coded tape to identify the supplies and reagents used for handling PCR product Post signs to indicate the use of PCR product in the Amplified DNA Work Area Because of the equipment used in the Amplified DNA Work Area a relatively large space is required This space requirement exceeds the space requirement for RNA extraction and RT PCR setup A common mistake is to allocate more space for DNA extraction and RT PCR setup than for PCR amplification and PCR product detection Amplified DNA or equipment and supplies used to handle amplified DNA should not be ta
25. are all saved in the same run folder by the Data Collection software One run folder is created for each sample sheet filled out in the Data Collection software Therefore when you fill out the sample sheet take into consideration the sample data that you want to include in a given project Plasma samples may contain multiple strains of HIV so it is possible that more than one genotype may be present in a single sample In such cases some base positions will have more than one nucleotide present these positions are referred to as multibase positions During analysis the HIV 1 Genotyping System Software identifies multibase positions based on a 30 threshold level This means that if the peak height of a second nucleotide at any position is present at 30 or greater of the peak height of the main nucleotide that position will be labeled as a multibase Conventional multibase nomenclature based on IUB codes are used to label the multibases For more information about IUB Codes see Appendix E IUB Codes To run the HIV 1 Genotyping System Software you will need A Power Macintosh computer or later using Macintosh system software Mac OS 8 0 through 9 0 or equivalent and running at 150 mHz or higher At least 64 MB of RAM with 32 MB available At least 500 MB of hard disk memory available A CD ROM drive A color printer gt gt gt Introduction 1 15 Materials and Equipment Contents of the The HI
26. cannot be handled by trimming In this situation you may want to repeat the sequencing for that segment and then manually add it to the project as described above see Adding Segments to a Project on page 7 24 The original sample name was incorrect Analyzing HIV Sequencing Data 7 25 Procedure To remove segments from a project Step Action 1 In the Alignment View click the segment that you want to remove The segment becomes highlighted with a black bold line 2 Select Remove Segment 6 R from the Edit menu The progress window appears describing the process of removing the segment from the project The segment is removed from the graphic and the project The History The History window displays a current summary of the number of Window known and unknown nucleotide variants relative to the reference sequence Subtotals of the number of known and unknown variants in the protease and RT genes are also shown These numbers are updated only when changes are saved to the Project file History QA10 as Known variants 3s Unknown variants Protease Protease s RT Mon Aug 23 12 43 26 PDT 1999 added segment 33eQA10 F 2 Mon Aug 23 12 43 26 PDT 1999 added segment 29eQ410 A 2 Mon Aug 23 12 43 26 PDT 1999 added segment 32eQ410 D 2 Mon Aug 23 12 43 26 PDT 1999 added segment 34eQ410 G 2 Mon Aug 23 12 43 26 PDT 1999 added segment 300eQ410 B 2 Mon Aug 23 12 43 26 PDT 19
27. consult the MSDS Do not leave chemical containers open Use only with adequate ventilation Check regularly for chemical leaks or spills If a leak or spill occurs follow the manufacturer s cleanup procedures as recommended on the MSDS Comply with all local state provincial or national laws and regulations related to chemical storage handling and disposal Site Preparation and Safety Guide About MSDSs Ordering MSDSs A Site Preparation and Safety Guide is a separate document sent to all customers who have purchased a Applied Biosystems instrument Refer to the Guide written for your instrument for information on site preparation instrument safety chemical safety and waste profiles Some of the chemicals used with this instrument may be listed as hazardous by their manufacturer When hazards exist warnings are prominently displayed on the labels of all chemicals Chemical manufacturers supply a current MSDS before or with shipments of hazardous chemicals to new customers and with the first shipment of a hazardous chemical after an MSDS update MSDSs provide you with the safety information you need to store handle transport and dispose of the chemicals safely We strongly recommend that you replace the MSDSs in your files each time you receive one packaged with hazardous chemicals WARNING CHEMICAL HAZARD Be sure to familiarize yourself with the MSDSs before using reagents or solvents You can order fr
28. into the buffer reservoir 11 Load the autosampler with the following reagents Reagent Autosampler Position 1X Genetic Analysis Buffer 1 Water in the buffer vial 2 Water in a 1 5 mL microcentrifuge 3 tube with the cap removed Using the 310 Genetic Analyzer 5 5 Preparing the Sample Sheet and Injection List Preparing the To prepare the sample sheet Sample Sheet Step Action 1 From the File menu select New 2 Select the sequence sample sheet that corresponds to the autosampler tray that you are using either 48 or 96 well The Sample Sheet window opens Enter the names of your samples into the Sample Name column using the naming convention sample ID visit date lab code primer analysis date For more information about sample naming conventions see page1 14 In the Dye Set Primer list select DT POP6 BD Set Any Primer a Click the Dyeset Primer column heading to select the entire column b From the Edit menu select Fill Down Cmd D In the Matrix list select the appropriate matrix file For more information see page 5 4 From the File menu select Save Enter a name for your sample sheet Save your sample sheet in the Sample Sheet folder within the 310 Collection Software folder 10 Click Save 5 6 Using the 310 Genetic Analyzer Preparing the To prepare the injection list Injection
29. minutes Transfer each denatured sequencing reaction to a 0 5 mL Genetic Analyzer Sample Tube Place a Genetic Analyzer Septum on each Genetic Analyzer Sample Tube Load the autosampler tray with the Genetic Analyzer Sample Tubes Click Start in the Injection List The run will begin after the heat plate has reached 50 C 5 8 Using the 310 Genetic Analyzer Analyzing the Sequencing Data DNA Sequencing The following table lists the settings to use in the Sample Manager Analysis Software window of the ABI PRISM DNA Sequencing Analysis software Settings Creating a New Basecaller Setting Sample Manager Choose Basecaller ABI CE1 Basecaller Settings HIV 580 See Creating a New Basecaller Setting below Dye Set Primer file DT POP6 BD Set Any Primer Instrument file The file you have generated on the ABI PRISM 310 Genetic Analyzer using the dRhodamine Matrix Standards Kit the HIV 310 Run ModuleH and POP 6 polymer For additional instructions see Analyzing the Sequencing Data on page 6 13 About Basecaller Settings The Basecaller setting in DNA Sequencing Analysis software allows you to define automatically the number of bases that you want to process in your sequence data files For the data files generated with the ViroSeq HIV 1 Genotyping System all sequences should be processed to stop at 580 bases Procedure To create a new Basecaller Sett
30. of interest are the only positions in the project that can Interest be edited Selection These positions are defined by the user in the Feature option of the View Edit window Procedure To set active positions of interest Step Action i You can either Result click the feature selection The feature selection window button in the View Edit window appears select Analysis from the Window menu O Feature Selection 0A1 8 pH Global Settings Novel variants from reference MMultibase positions MMismatches between segments O Show saved edits O Insertions Features from Gene Profile O Show Resistance positions Make the check boxes of your choice Deselect all the other checkboxes 7 34 Analyzing HIV Sequencing Data Editing Bases To set active positions of interest continued Step Action 4 Click the Close box to close the window In the assembled sequence graphic of the Navigation window only those positions of interest corresponding to the above selections are identified Active positions of interest are indicated by red vertical lines If mismatches occur between overlapping segments you will need to perform manual editing to reach agreement To edit the consensus base at a position of interest Step Action 1 Click the position of interest 2 In the Editing Palette window se
31. on each tube cap 11 Increase the temperature in the centrifuge to 15 25 C room temperature Lysing the Viruses To lyse the viruses Step Action 1 Add 600 pL of Viral Lysis Buffer to each pellet and screw on the tube cap Vortex each tube gently for 3 5 seconds Incubate at 15 25 C room temperature for 10 minutes Precipitating Viral To precipitate viral RNA RNA Step Action 1 Add 600 pL of 100 isopropanol to each tube and screw on the tube cap WARNING CHEMICAL HAZARD Isopropyl alcohol is a flammable liquid and vapor It may cause eye skin and upper respiratory tract irritation Prolonged or repeated contact may dry skin and cause irritation It may cause central nervous system effects such as drowsiness dizziness headache etc Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Vortex each tube gently for 3 5 seconds Centrifuge samples at room temperature and 12 500 15 000 x g for 15 minutes 4 6 HIV Genotyping Chemistry Protocol To precipitate viral RNA continued Step Action 4 Without disturbing the pellets which may not be visible remove the supernatants with a fine tipped transfer pipette WARNING BLOODBORNE INFECTIOUS WASTE HAZARD Discard the supernatants following recognized disinfection procedures and in ac
32. pL pL HIV RT Mix 8 128 RNase Inhibitor 1 16 MuLV Reverse Transcriptase 1 16 DTT 100 mM 0 4 6 4 Final volume of RT master 10 4 166 4 mix CAUTION CHEMICAL HAZARD Dithiothrietol DTT may cause eye skin and respiratory tract irritation central nervous system depression and damage to the kidneys Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Prepare sufficient volume for 1 2 extra reactions as some of the mix will be lost during pipetting Mix the solution thoroughly by flicking the tube with your fingertip Pulse spin the RT master mix at low speed for 5 10 seconds to collect the contents at the bottom of the tube 4 10 HIV Genotyping Chemistry Protocol Preparing the RT Use the RT master mix to set up the RT reactions with the viral RNA Reactions preps These reactions should be prepared in precooled 200 pL MicroAmp Reaction Tubes IMPORTANT Keep all tubes on ice or a cold block while preparing these reactions Do not freeze and thaw the RNA control more than four times To prepare the RT reactions Step Action 1 Add 10 uL of RT master mix to each MicroAmp Reaction Tube You will need one tube for each HIV sample plus two tubes for the controls a Add 10 uL of the negative control positive control or viral RNA to each of the MicroAmp Reaction Tubes from step 1 b Close the tube cap
33. project 7 17 Open an existing project 7 18 7 16 Analyzing HIV Sequencing Data Creating a New Project Procedure To create a new project Step Action 1 Click New in the Project Status window 0 5 project Status HH Status Project Name This opens the standard Macintosh computer navigation box Gp PE 310 Hard Drive 310 assem Eject 63041 7L021599 A 630417L021599 B 630417L021599 C 630417L021599 F 630417L021599 G 630417L021599 H 2 Navigate to the folder that contains the samples you want to use to create a project 3 Select any file in the folder and click Open The HIV 1 Genotyping System Software creates the projects from all the sample files that are in the folder assembles and analyzes them and displays the data Analyzing HIV Sequencing Data 7 17 Opening a Previously Created Project Where Projects The software saves previously created projects in the Completed folder Are Saved All the projects that are in this folder are listed in the Project Status window 0 EE project Status SOE Status Project Name PE 623 PE 6238 projects QA18 The following table describes the values for the Status field If Status is Then OK the segments were found at the expected locations one or more input segments were not identified by the software
34. ready to perform the PCR for at least 10 minutes or store at 15 to 25 C 4 12 HIV Genotyping Chemistry Protocol Amplifying Viral cDNA by PCR About the PCR Procedure Overview For convenience and to minimize contamination PCR is performed in the same tube as the reverse transcription reaction Using the single stranded cDNA products of the reverse transcription step as template the PCR step generates double stranded DNA suitable for sequencing The PCR primers in this reaction specifically amplify the HIV protease and the 5 end of the RT gene AmpliTaq Gold is used for PCR because it provides an invisible hot start which improves the specificity and efficiency of the reaction Note The MULV reverse transcriptase was inactivated by the previous thermal cycling step in which the samples were incubated at 99 C for 5 minutes You will perform the following steps to amplify your DNA samples Single stranded cDNA in RT reaction tubes Add Perform the PCR Prepare a PCR master mix HIV Genotyping Chemistry Protocol 4 13 Preparing the PCR Prepare the PCR master mix as follows Master Mix Step Action 1 Prepare the PCR master mix by combining the following reagents Volume for Volume for 16 One Reaction Reactions Reagent pL pL HIV PCR Mix 29 5 472 AmpliTaq Gold 0 5 8 AmpErase UNG 1 16 Final volume 31 0 496 CAUTION CHEMICAL HAZARD Amp
35. refer to the ABI PRISM 310 Genetic Analyzer User s Manual P N 903565 Using the 310 Genetic Analyzer 5 1 Overview of the Procedure At This Stage Following ethanol precipitation the samples are dye labeled sequence ladders that are ready to be run on an automated DNA sequencer The samples may be run in 1 5 mL microcentrifuge tubes MicroAmp 8 Strip Reaction Tubes or MicroAmp Optical 96 Well Reaction Plates Flow Diagram An overview of a sequencing run is shown below Prepare the ABI PRISM 310 y Genetic Analyzer and if necessary Install the run module s Install the dye set primer file Prepare a dRhodamine matrix D Prepare the Sample Sheet _ C Prepare the Injection List i Denature the samples Start the run JZ i Sn Sequencing Analysis Sofware 5 2 Using the 310 Genetic Analyzer Preparing the Instrument For First Time Users Run Modules About the Dye Set Primer File Obtaining the Dye Set Primer File If you are using the HIV Genotyping System for the first time you Will need to install the appropriate run modules May need to Make a dRhodamine matrix file Install the appropriate dye set primer mobility file Arun module is a file that is used to define the run conditions during data collection on the 310 Genetic Analyzer Run conditions include electrophoresis voltage temperature and run time Use the
36. reference strain Insertion A set of three or multiple of three bases that cannot be aligned with the HIV 1 pNL4 3 reference strain but that are present in more than one segment and are believed to have biological significance While the consensus reference sequence will be aligned and not showing the insertion the segments will show the insertion and they will not be in alignment with the consensus reference sequence The box shown in electropherograms in the View Edit window see below represents the sequence that is not shown in the consensus reference sequence GCCATAAAGAAAAAAGACAG TACTAAATGGAGAAAAT GTCATAAAGAAAAAAGAOA STGCT AAATGGAGAAAAT Note The insertion box is controlled by the Toggle Position Cursor T from the Edit menu If the Toggle Position Cursor command is off then the insertion box is not visible 7 30 Analyzing HIV Sequencing Data Callout number Feature Description 2 Segment electropherogram Electropherogram of a sequence segment The name and orientation of the segment is shown in the box to the right of the segment electropherogram An example is shown below See callout number 6 on page 7 31 TAAI See callout number 5 on Reference page 7 31 Consensus W 307QA10 B 2 See callout number 4 on me ae 7 31 32 QA10 D 2 347QA10 6 2 3 Position of interest Designates the currently active position of interest currently active according to th
37. the Applied Biosystems Technical Support Internet for fax Web site at or e mail http www appliedbiosystems com techsupp delivery b Under Resource Libraries click the type of document you want c Enter or select the requested information in the displayed form then click Search d In the displayed search results select a check box for the method of delivery for each document that matches your criteria then click Deliver Selected Documents Now or click the PDF icon for the document to download it immediately e Fill in the information form if you have not previously done so then click Deliver Selected Documents Now to submit your order Note There is a limit of five documents per request for fax delivery but no limit on the number of documents you can order for e mail delivery 1 30 Introduction Laboratory Guidelines Chapter Overview Introduction This chapter gives guidelines for the safe and effective use of the ViroSeq HIV 1 Genotyping System In This Chapter The following topics are covered in this chapter Topic See Page General Guidelines 2 2 Background to Laboratory Setup 2 4 Laboratory Design and Organization 2 6 Infectious Material Work Area 2 9 RT PCR Setup Work Area 2 10 Amplified DNA Work Area 2 11 Safety Guidelines 2 13 Laboratory Guidelines 2 1 General Guidelines Collecting and Storing Samples Before You Begin Sample Handling Pro
38. uL into lane 2 Pipette accurately because these standards are used as references to determine PCR product dilutions 6 Load the entire 10 uL samples onto the remaining gel lanes 7 Electrophorese at 10 V cm until the bromphenol blue has migrated at least 5 cm into the gel 8 Examine the gel under UV light 9 Photograph your gel using an exposure time that does not saturate the film and shows the differences in intensity of the mass ladder fragments The correct exposure of the photograph is important because you will use the information from the gel to determine PCR product dilutions 4 18 HIV Genotyping Chemistry Protocol Diluting the PCR The PCR products must be diluted before being sequenced Follow the Products for table below to determine the correct dilution Sequencing T3 dilute the PCR products Step Action 1 Compare the intensity of each PCR product band to the intensities of the Low Mass Ladder bands From your comparison estimate the mass of DNA in the sample Dilute your sample which has a volume of 25 45 pL according to the table immediately below If the mass of the 1 8 kb product band is Then greater than 100 ng add 315 pL of sterile deionized water to the sample between 60 100 ng add 105 uL of sterile deionized water to the sample between 40 60 ng add 35 pL of sterile deionized water to the sample between 20 40 ng add water to a final volume of 60 pL
39. 00 Red 1 Store this module at 15 to 25 C in a manual defrost freezer that is designated amplicon dirty RNA Control Prt 5 RT Color of No of Tube Name Volume pL Tube Cap Tubes RNA Control Prt 5 RT 50 Clear 1 v2 Store this module at 15 to 25 C in a manual defrost freezer that is designated amplicon free clean 1 18 Introduction Run Module Kit Validation The run modules used with the Data Collection software are provided on the CD The names of the run modules are listed below for the different instruments Instrument Run Module ABI PRISM 310 Genetic Analyzer HIV 310 Run ModuleH ABI PRISM 377 DNA Sequencer HIV Run Module 377 36 IMPORTANT See page 5 4 ABI PRISM 310 Genetic Analyzer or page 6 4 ABI PRism 377 DNA Sequencer for the directions for installing run modules This RT PCR procedure has been validated using only the materials specified in this manual The use of alternative materials and equipment is likely to produce unreliable results For example MicroAmp tubes are manufactured to have a highly uniform wall thickness which gives consistent heating and cooling properties Other tubes may not be manufactured to the same specifications and can lead to poor results The use of thermal cyclers other than those listed can result in considerable variability because of differences in Temperature ramping ti
40. 1 16 user supplied equipment 1 22 to 1 24 user supplied materials 1 20 to 1 21 microcentrifuge tubes sterilizing 2 9 microcentrifuge tubes using to purify DNA 4 23 to 4 26 mismatch defined Glossary 1 Mixture definition Glossary 1 multibase position defined Glossary 1 MuLV reverse transcriptase enzyme description of 1 10 1 17 to N negative control described 1 11 noise troubleshooting 8 5 P PCR GeneAmp PCR System 9600 and 9700 3 3 product carryover as a source of contamination 2 4 product carryover source of laboratory contamination 2 4 troubleshooting 8 1 to 8 2 PCR product precautions 2 4 plates using 96 well Centri Sep plate 4 29 to 4 30 using to purify DNA 4 27 to 4 28 positive RNA control described 1 11 Index 3 precautions setting up amplified DNA work area 2 11 PCR work area 2 10 RNA extraction work area 2 9 to 2 10 primer file 310 Genetic Analyzer 5 3 6 3 printing reports 7 41 projects about 7 15 adding segments 7 24 to 7 25 defined Glossary 1 exporting in FASTA format 7 40 exporting in Genotype format 7 40 opening 7 18 removing segments 7 25 working with 1 15 purifying dye labeled DNA in microcentrifuge tubes 4 23 to 4 26 in plates or trays 4 27 to 4 28 using 96 well Centri Sep plate 4 29 to 4 30 Q quality standards judging A 1 to A 2 R reagents 1 20 to 1 21 removing segments from a project 7 25 report generating 7 41 resistance mutations defined 7 39 Revert button 7 32 RNA B 1 to B
41. 1 Genotyping System Software uses the sample name to group sequencing data for a given plasma sample All information to the left of the open square bracket must be identical for all sequencing files from the plasma sample The bracket and any information to the right of the bracket is ignored by the software with regard to grouping and may be used for comments such as the date and the primer name Sample Naming Example For the ViroSeq HIV 1 Genotyping System Software to recognize the HIV data files created by the Data Collection software the samples loaded onto the instrument may be named using the ACTG 320 file naming conventions The conventions specify that the following information is provided in the sample name in the order given Name Part Example Sample identification number 630417L Date of visit to the lab 021599 Lab code number Not included in this example Open square bracket Primer letter A Date of sample analysis 021699 For the example given in the table the full sample name would be 63041 7L021599 A021699 Projects Multibase Analysis Computer Requirements Samples with the same name to the left of the square bracket are automatically grouped together by the HIV 1 Genotyping System Software into a single project Samples in a project are assembled by the software into a single sequence A prerequisite for grouping particular samples into a project is that they
42. 638 5884 Worldwide Sales Offices Applied Biosystems vast distribution and service network composed of highly trained support and applications personnel reaches into 150 countries on six continents For international office locations please call our local office or refer to our web site at www appliedbiosystems com www appliedbiosystems com Applied KS Biosystems Applied Biosystems is committed to providing the world s leading technology and information for life scientists Printed in the USA 12 2000 Part Number 4315267_Rev3
43. 99 added segment 35eQ410 H 2 Mon Aug 23 12 43 26 PDT 1999 added segment 31eQ410 C 2 Mon Aug 23 12 48 48 PDT 1999 33 QA10 F 2 trimmed to 199 248 Mon Aug 23 12 48 48 PDT 1999 29 Q410 A 2 trimmed to 59 246 Mon Aug 23 12 48 55 PDT 1999 34 Q410 G 2 trimmed to 242 679 Mon Aug 23 12 49 58 PDT 1999 33 QA10 F 2 trimmed to 198 238 Mon Aug 23 12 49 58 PDT 1999 29 QA10 A 2 trimmed to 58 239 Mon Aug 23 12 49 58 PDT 1999 34 QA10 G 2 trimmed to 264 678 Tue Aug 24 14 59 13 PDT 1999 32 QA10 D 2 trimmed to 25 368 Tue Aug 24 14 59 35 PDT 1999 RT22 3 M gt n Tue Aug 24 15 00 07 PDT 1999 saved to file Showing a Log of All Edits When you have edited the consensus sequence select Save from the Edit menu 7 26 Analyzing HIV Sequencing Data The History window shows a permanent record of segments that were added removed rejected trimmed or edited Note The large dot seen after lane number in the Data Collection software and the DNA Sequencing Analysis software is converted by the HIV 1 Genotyping System Software to straight quotes Editing the Sequence About This Step Consensus Sequence Defined Cursor Once the project has been assembled and you have reviewed it in the Navigation window the next step is to review and edit the data A consensus sequence is calculated from the base assignments in each of the sequence segments It may include mixed base positions and deletions and reflect differences amo
44. DNA Waste disposal of amplified DNA solutions Storage of amplified DNA Amplified DNA or equipment and supplies used to handle amplified DNA should not be taken out of the Amplified DNA Work Area Samples that have not yet been amplified should never come into contact with this equipment Even in the Amplified DNA Work Area amplified DNA should be handled carefully to avoid dispersal around the room Reducing the dispersal of amplified DNA within this work area will reduce the potential for transfer of amplified DNA to other work areas Always remove your gloves and lab coat when leaving the Amplified DNA Work Area to avoid the transfer of amplified DNA into other work areas Reduce dispersal of DNA around the work area by changing gloves whenever they may have become contaminated with amplified DNA Avoid splashing by opening tubes that contain amplified DNA carefully It may be helpful to spin down the contents of the amplified DNA tubes before opening A tube decapper device makes it easier to open the tubes Use disposable bench paper to cover the work area used to prepare samples for electrophoresis This prevents the accumulation of amplified DNA on permanent work surfaces A 10 v v bleach solution should be used periodically to wash exposed work surfaces Soap and water can also be used to clean work surfaces Use the thermal cycler for the RT PCR reactions and for the denaturing of the DNA in formamide before sequenci
45. Erase uracil n glycosylase may cause eye and skin irritation Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves For multiple reactions prepare sufficient volume for 1 2 extra reactions as some of the mix will be lost during pipetting Mix the solution thoroughly by flicking the tube with your fingertip Pulse spin the PCR master mix at low speed for 5 10 seconds to collect the contents at the bottom of the tube Preparing the In this part of the procedure the PCR master mix is added to each of PCRs the RT reaction tubes Prepare the PCRs as follows Step Action 1 Add 30 uL of PCR master mix to each RT reaction tube and close the tube cap The final volume is now 50 pL 2 Pulse spin at low speed for 5 10 seconds to collect the contents at the bottom of the tube 4 14 HIV Genotyping Chemistry Protocol Performing the Thermal cycling is performed in a GeneAmp PCR System 9600 or PCR 9700 thermal cycler from Applied Biosystems Note The thermal cycling process should take about 4 hours If it takes 30 minutes less or 30 minutes more there is probably a problem with the ramping times In this situation call a service engineer Follow the steps below to amplify the DNA Step Action 1 Place the MicroAmp Reaction Tubes containing the PCRs into the thermal cycler 2 Select the 9600 or 9700 PCR program show
46. Introduction ViroSeq HIV 1 Genotyping System Components Three Types of Three types of oligonucleotide primers are provided preformulated Primers are with the HIV 1 Genotyping System Provided Single primer for reverse transcription Sequence specific primers for PCR forward and reverse in the figure below Sequence specific primers for cycle sequencing A B C D F G and H in the figure below A Forward primer pd B Cc 5 gt 2 gt gt gt 3 Protease Reverse Transcriptase Integrase 3 lt lt lt T F G Reverse primer n T rn Ty Tt T eel T 500 1000 1500 2000 Bases Sequence The seven HIV 1 sequence specific primers hybridize to the PCR Generated product as shown in the figure above A sequence in both directions for all regions improves the accuracy of the data analysis Primers A and D Why Primers A and D Were Created Two primers A and D have been provided for sequencing the 5 end of the PCR product Due to known sequence polymorphism upstream of the protease gene it has been necessary to design these two different sequencing primers Note If throughput is not an issue for your laboratory you may choose to use both primers for every sample Introduction 1 9 About Primers A and D The following table describes the two primers Primer Description A This is the preferred primer because it will provide the forward sequence of the entire protease gene
47. Sequence defined Glossary 1 AutoLaunch 7 43 to 7 45 B biological safety cabinet to prevent contamination 2 6 C carryover as a source of laboratory contamination 2 4 chloroform hazard B 2 codes amino acid table of D 1 computer requirements 1 15 consensus sequence restoring original 7 32 consumables user supplied contamination sources of laboratory contamination 2 4 to 2 5 by equipment or work environment 2 4 cross contamination during sample prep 2 4 PCR product carryover 2 4 crucial position defined Glossary 1 cursor toggling 7 30 customer support e mail address 1 25 help 1 25 to 1 30 Internet address 1 29 1 22 to 1 24 Index 1 telephone fax 1 26 to 1 28 cycle sequencing performing the reactions 4 21 to 4 22 primers 1 9 to 1 10 D Data Collection software described 1 12 denaturing samples 310 Genetic Analyzer 5 8 377 DNA Sequencer 6 8 discrepancy defined Glossary 1 DNA for sequencing preparation of 1 21 Sequencing Analysis software 1 13 DNA extraction work area 2 9 to 2 10 Documents on Demand 1 30 dye set 310 Genetic Analyzer 5 3 6 3 E editing restoring original consensus 7 32 showing history of edits 7 26 trimming sequence segments 7 33 e mail address for technical support 1 25 enzymes provided with system 1 10 ethidium bromide hazard 4 18 evidence handling work area 2 9 exporting projects 7 40 F FASTA format saving in format 7 40 Feature Selection window using 7 38 to 7 39 G g
48. Store all reagents according to the directions starting on page 1 17 Keep all reagents on ice when setting up assays Do not freeze thaw the RNA control more than four times Always wear gloves when working with RNA 2 2 Laboratory Guidelines General PCR Practices For more information about handling RNA see Appendix B Preventing RNA Degradation PCR is a sensitive technique that can amplify single DNA molecules Mullis et al 1987 Saiki et al 1985 Saiki et al 1988 To prevent DNA contamination which can give failed or false positive results follow these general guidelines Kwok and Higuchi 1989 Designate separate areas equipment and supplies for Reagent storage and preparation RNA preparation RT and PCR setup PCR amplification and sequencing Wear a new or designated lab coat for each area Change gloves often and before beginning each step Follow a disciplined work flow i e sample prep to RT PCR to sequencing Once you have worked with open amplicon post PCR do not return to pre PCR areas until the following day Keep caps on reagents and sample tubes when they are not being used Minimize arm movements over open tubes during pipetting Regularly clean lab benches and equipment with a solution of 10 bleach Laboratory Guidelines 2 3 Background to Laboratory Setup Sensitivity of PCR Sources of Contamination The ViroSeq HIV 1 Genotyping System and other PCR b
49. V 1 Genotyping System includes four modules which contain the HIV 1 Genotyping main consumable materials needed to perform the sample preparation System RT PCR sequencing and quality control for 48 reactions HIV 1 Genotyping System Software Parts Sold Separately 1 16 Introduction For more information about these modules see Modules and Storage Conditions on page 1 17 The contents of this HIV 1 Genotyping System P N 4315425 are listed below Materials Part Number HIV Sample Prep Module RUO 4306027 ViroSeq HIV 1 RT PCR Module RUO version 2 4314888 HIV Sequencing Module RUO 4305611 HIV RNA Control Module RUO version 2 4315236 MSDS Formamide Recrystallized L0044 MSDS HIV Sample Prep 4306194 MSDS DTT 100mM 4315270 Microcon YM 100 microconcentrators 4312669 MicroAmp Tubes M0035 The HIV 1 Genotyping System Software is sold separately Item Part Number ViroSeq HIV 1 Genotyping System Software v2 x 4307816 The following components are sold as part of the complete kit but can also be purchased individually Note The ViroSeq RT PCR module is not sold separately Parts Sold Separately Item Part Number ViroSeq HIV 1 Genotyping System User s Manual 4315267 ViroSeq HIV 1 Genotyping System Quick Reference 4315422 Guide available spring 2000 Modules and Storage Conditions Parts Sold Separately continued
50. ViroSeq HIV 1 Genotyping System Version 2 User s Manual Applied KS Biosystems Copyright 2000 2011 Applied Biosystems For Research Use Only Not for use in diagnostic procedures ABI PRISM and its design AmpErase Applied Biosystems BioMerge and MicroAmp are registered trademarks and BigDye BioLIMS POP POP 6 SQL GT and ViroSeq are trademarks of Applied Biosystems or its subsidiaries in the U S and certain other countries AmpliTaq AmpliTaq Gold and GeneAmp are registered trademarks of Roche Molecular Systems Inc Apple Macintosh and Power Macintosh are registered trademarks of Apple Computer Inc JAVA is a registered trade mark of the Sun Microsystems Inc Long Ranger is a registered trademark of FMC Corporation Microcon is a registered trademark of Millipore Corporation or an affiliated company All other trademarks are the sole property of their respective owners Contents 1 Introduction Chapter OVerview so o nae n C8 eee hig kee he Se ok eee Eee wee aoa os 1 1 Safety suisse dara arent area eas Sie eee A We ee 1 2 The ViroSeq HIV 1 Genotyping System 00 0000 1 5 ViroSeq HIV 1 Genotyping System Components 1 9 ViroSeq HIV 1 Genotyping System Software 0 1 12 Materials and Equipment 00 0 cece eee eee eee 1 16 User Supplied Materials and Reagents 0 0000005 1 20 Technical Support resres eta eho Se ede eee be H
51. a Prepare about 10 more solution than you need 2 Add 52 uL of the sodium acetate ethanol solution to each sequencing reaction Cover the Optical 96 Well Reaction Plate with 3M 425 3 adhesive backed aluminum foil tape Seal the tape to the tops of the wells by pressing firmly HIV Genotyping Chemistry Protocol 4 27 To purify the products of the sequencing reactions continued Step Action 5 Mix by either inverting three times or vortexing IMPORTANT Thorough mixing at this step is essential for efficient precipitation Centrifuge at 2000 x g for 20 minutes Remove the foil tape Invert the plate on a folded lab tissue and centrifuge at 150 x g for 1 minute Add 150 pL of 70 ethanol to each well 10 Centrifuge at 2000 x g for 5 minutes 11 Invert the plate on a folded lab tissue and centrifuge at 150 x g for 1 0 1 5 minutes 12 If you plan to perform electrophoresis now see Chapter 5 Using the 310 Genetic Analyzer Chapter 6 Using the 377 DNA Sequencer If you do not plan to perform electrophoresis now seal the tubes and store at 15 to 25 C 4 28 HIV Genotyping Chemistry Protocol Purifying Sequencing Reactions Using a 96 Well Centri Sep Plate About Using the An alternative method to ethanol precipitation that allows purification of Centri Sep Plate sequencing reactions in a 96 well format is the Centri
52. ad samples onto the gel Step Action 1 Pause the prerun This allows the instrument to continue heating while the samples are loaded Load the samples into alternate lanes for example lanes WB To Use the table below to select a sample volume to load Comb Size Sample Loading Volume pL 36 1 5 48 1 0 64 0 8 Prerun samples into the gel for 2 minutes Pause the electrophoresis prerun Load the remaining samples into the remaining alternate lanes for example lanes 2 4 6 8 Starting the Run To start the run Step Action 1 In the Run window click Cancel 2 Click Terminate This ends the prerun Note Itis very important to terminate the prerun Data will not be collected in the prerun mode Click Run Name the gel file Using the 377 DNA Sequencer 6 9 To start the run continued Step Action 5 Click Save to save the gel file into your run folder The run takes 7 hours The Status window should show the following setpoints Setpoint Value EP Voltage 1680 V EP Current 50 pA EP Power 150 W Gel Temperature 51 C Laser Power 40 mW 6 10 Using the 377 DNA Sequencer Running Samples on a 96 Lane Gel About Running Samples on a 96 Lane Gel Sequencing Reaction Methods Running samples on a 96 lane gel involves some protocol modificatio
53. after each addition Negative Positive Control Control RNA RNA Diluent Control RT master RT master mix mix HIV samples RT master mix Note The final volume of the reaction mixes is 20 pL Pulse spin at low speed for 5 10 seconds to collect the contents at the bottom of the tube IMPORTANT These tubes should be placed on ice until starting the RT reactions HIV Genotyping Chemistry Protocol 4 11 Performing the RT To ensure reproducibility perform the reverse transcription reactions in Reactions MicroAmp Reaction Tubes and use a calibrated thermal cycler for the incubation step IMPORTANT Use the correct tray and retainer assemblies for the tubes and thermal cycler IMPORTANT The efficiency of the reverse transcription reaction is highly dependent on the conditions of the incubation Do not vary from the procedure described in the table below To perform the RT reaction Step Action 1 Select the RT program Review your thermal cycler program for correctness Temperature Time C min Process 42 60 Reverse transcribes RNA 99 5 Denatures MuLV reverse transcriptase 4 Hold Holds until you are ready Make sure that the thermal cycler is at 42 C Transfer the MicroAmp Reaction Tubes that are on ice into the preheated thermal cycler Start the thermal cycler 5 When the program has finished either hold the samples at 4 C until you are
54. al load of 2000 750 000 cp mL The blood used to prepare the plasma samples must be collected with ACD A or EDTA anticoagulants Do not use samples containing heparin Flow Diagram The following diagram summarizes the procedure for isolating and purifying the viral RNA Precool the microcentrifuge Centrifuge the plasma samples to pellet the virus Prepare 70 ethanol and place on ice to chill a Lyse the virus to free the RN Precipitate the viral RNA i Wash the RNA pellet For viral loads of 2000 15 000 cp mL resuspend the RNA pellet in 50 uL of RNA Diluent C NLL Y Y WY For viral loads gt 15 000 cp mL resuspend the RNA pellet in 100 uL of RNA Diluent Store at 80 C or go to Store at 80 C or go to reverse transcription reverse transcription 4 4 HIV Genotyping Chemistry Protocol Precooling the To precool a refrigerated benchtop centrifuge Centrifuge Step Action 1 Install an empty centrifuge rotor according to the manufacturer s instructions 2 Start a run with the temperature set to 2 6 C Pelleting the Virus The HIV is isolated from each plasma sample by centrifugation The viruses form a pellet and the plasma supernatant is removed To pellet the virus Step Action 1 Thaw the plasma samples 2 Briefly vortex 3 Aliquot 0 5 mL of the blood plasma into each Sarstedt screw cap tube
55. and screw on the tube cap 4 IMPORTANT Place an orientation mark on the side of the tube and on the cap 5 Insert the microcentrifuge tubes into the precooled microcentrifuge rotor with the orientation mark facing the outside rim of the rotor This will help you locate the pellet after centrifugation 6 Centrifuge at 4 C at 21 000 25 000 x g for 1 hr During the centrifugation a Prepare 70 ethanol and place on ice b Thaw the Viral Lysis Buffer by either Heating the tubes at 37 C Leaving the tubes at room temperature until they are thawed c Briefly vortex the Viral Lysis Buffer tubes and keep them at room temperature until needed d Store the RNA diluent on ice until needed Note If you use the room temperature method and a precipitate forms heat the buffer to 37 C 8 Remove the tubes as soon as the centrifuge rotor stops HIV Genotyping Chemistry Protocol 4 5 To pellet the virus continued Step Action 9 Without disturbing the pellets which may not be visible remove the residual supernatants with a disposable fine tipped transfer pipette IMPORTANT Remove the residual supernatant by pipetting from the side opposite the orientation mark WARNING BLOODBORNE INFECTIOUS WASTE HAZARD Discard the supernatants following recognized disinfection procedures and in accordance with all local state and national bloodborne infections regulations 10 Screw
56. anual trimming is normally performed when the data quality of one segment is causing excessive mismatches By trimming that region of the segment the number of mismatches can be minimized To Manually Trim Regions Step Action 1 Click the position in the electropherogram where you want to start the trimming procedure The inverted selection extends either to the right or to the left depending on which end of the segment is closest and trims the sequence to the nearest end Note To undo the trim selection drag it off the window using the mouse 2 Click the Trim button A progress dialog box appears About Manually Untrimming Untrimming is the process of changing the region of sequence that the HIV 1 Genotyping System Software has automatically trimmed If Then you feel that too much sequence has you can manually change the been trimmed automatically and if trimmed region the data quality for that region is acceptable Analyzing HIV Sequencing Data 7 33 To Manually Untrim Regions Step Action 1 Click on the portion in the electropherogram where you want the trimmed region to end The portion of the trimmed electropherogram that is not selected will remain trimmed The deselected portion that is gray will be white and untrimmed Click the Trim button Setting Active What Are Active Positions of Interest Positions of active positions
57. appears For more information see The History Window on page 7 26 7 12 Analyzing HIV Sequencing Data To use the HIV 1 Genotyping System Software continued Step Action 10 To review the electropherogram or make additional edits If Then you want to review the go to the Feature Selection electropherograms window and select the features that you would like to inspect For more information see Setting Active Positions of Interest on page 7 34 you make additional changes save them as in step 8 on page 7 12 11 From the File menu select Print P to print a report For more information see Printing a Report on page 7 41 Analyzing HIV Sequencing Data 7 13 HIV Genotyping Folder Organization Introduction During installation the HIV 1 Genotyping System Software installer creates folders that are used to store your data before during and after analysis Folder Diagram The following diagram shows the contents of the HIV Genotyping folder O uly Genotyping 9 items 172 8 MB available Projects JavaClasses jar quitCaP q closeCAP AutoLaunch folder HIV Genotyping The following table describes the items in the HIV Genotyping folder Poder Contents Contents of the HIV Genotyping Folder This folder Contains Config Resources that are used by the softwar
58. are and assembles the six or seven sequence segments into a single sequence which is then compared to the reference strain After editing a ViroSeq HIV 1 Genotyping System Report of the data is generated For more information about the ViroSeq HIV 1 Genotyping System Software see page 1 12 Introduction 1 7 ViroSeq HIV 1 The following diagram summarizes the HIV genotyping process Genotyping Process Summary Blood Plasma Diagram Isolated HIV t Purified HIV RNA Reverse transcription reaction MuLYV reverse transcriptase cDNA PCR AmpliTaq Gold DNA Polymerase Amplified DNA t Purified DNA Check for yield and purity with AJ e e 22 agarose gel electrophoresis i l 3 3 l Divide DNA into six or seven A BJ c F G H tubes one tube per primer Vf W VE AoA A and or D B C F G H Ue ee gg BigDye terminator cycle sequencing reaction AmpliTaq DNA Polymerase FS Dye Labeled U DNA Fragments j Purified Dye Labeled DNA Fragments Gel electrophoresis Capillary electrophoresis Collect raw data with Data Collection software Determine DNA sequences of DNA segments with Sequencing Analysis software DNA Sequence Data Complete genotyping analysis with HIV Genotyping System Software Assemble sequence segments into a single sequence Edit the assembled sequence to make a consensus sequence GR1151 HIV Genotyping Report 1 8
59. as a mixed position if in one segment the smaller peak is at least 30 of the larger peak and a second segment shows the presence of the smaller peak The segments are compared to the reference sequence pNL4 3 to determine segment identity Based on the segment identity regions of poor or unnecessary sequences are automatically inactivated or trimmed The sequence in a trimmed region plays no further role in the analysis It is however available for viewing 7 8 Analyzing HIV Sequencing Data Automated software processing sequence continued Step Action 4 The trimmed segments are assembled and a project consensus sequence is derived using the CAP assembly algorithm Huang 1992 Positions that disagree between two overlapping segments are categorized as Mismatches Mismatches can be either individual basecall differences as well as insertions and deletions indels 5 The consensus is compared to the pNL4 3 reference sequence Positions within the consensus sequence that disagree with the reference sequence are categorized as variants see step 6 below for further discussion of variants 6 The consensus is compared to the table of known HIV antiviral resistance mutations Korber et al 1997 Consensus positions that vary from the reference and Are categorized as match the table of known HIV antiviral Reported Variant resistant mutations are not included
60. ased tests are so sensitive that minute amounts of DNA can be amplified Precautions must therefore be taken to prevent contamination of samples that have not yet been amplified Kwok and Higuchi 1989 While contamination of amplified DNA with unamplified DNA genomic DNA does not pose a problem ordinary precautions such as changing pipette tips between samples should be taken when handling and analyzing PCR product This action should effectively prevent cross contamination between samples of amplified DNA There are three potential sources of laboratory contamination Contamination by Human Genomic DNA from Equipment or the Work Environment Because of the specificity of the HIV Genotpying System amplification contamination of samples with non HIV DNA will not affect results However care should be taken while handling and processing samples to prevent chance contamination by human DNA Gloves should be worn at all times and changed frequently Sample tubes should be closed when not in use Dispersal of aerosols should be limited through careful handling of sample tubes and reagents Cross Contamination During Sample Preparation Extra care should be taken during DNA extraction and RT PCR setup to prevent transfer of DNA from one sample to another Use a new filter plugged pipette tip for each sample open tubes carefully and keep sample tubes closed when you are not using them PCR Product Carryover PCR product carryover oc
61. been specifically validated for use as a disinfectant for work with HIV Sterile deionized RNase free water MLS a Store at 20 C and keep bottles tightly closed to minimize dilution with water vapor in the air b American Chemical Society c Environmental Protection Agency 1 20 Introduction Preparation of PCR Products for Sequencing Sequencing Reactions A list of materials specific for the preparation of PCR products for sequencing is given below Description Supplier Sterile deionized water MLS Agarose Nucleic acid electrophoresis grade Ethidium bromide MLS A list of materials specific for the sequencing reactions and purification of sequencing ladders is given below For a list of tube options see the thermal cycling materials list on page 1 22 Description Supplier and Part Number Sodium acetate 3 M pH 4 6 Applied Biosystems P N 400320 Ethanol 95 and 70 nondenatured ACS Reagent Grade MLS Centri Sep 96 plates Princeton Separations P N CS 961 Sterile deionized water MLS Scotch tape 425 3 for plate precipitation 3M Company a Store at 20 C and keep bottles tightly closed to minimize dilution with water vapor in the air General A list of general laboratory equipment needed to perform the assay is Laboratory Equipment given below Description Supplier and
62. ce Mutations Mutations The mutations that are listed in the Los Alamos database Korber et al 1977 have been reported to confer resistance to a specific antiviral drug The HIV 1 Genotyping System Software contains an internal table that lists all of the resistance mutations known at the time of the software release This table will be updated annually Changing Positions of Interest to Review in the Report To Then review only those positions that will change the genotyping results of the analysis on the report in the Feature Selection window see Setting Active Positions of Interest on page 7 34 Uncheck all selections in the Global Settings section Check the Show Resistance positions checkbox in the Features from Gene Profile section For information about printing the report see page 7 41 Analyzing HIV Sequencing Data 7 39 Saving Projects Formats in Which From the File menu you can save projects in the following formats to Save Projects Choose To Save 36 S save the manual edits made in the project Save FASTA 36 F save the assembled sequence in the standard FASTA format Many bioinformatics programs can read this format The FASTA files are saved to the Report folder located in Projects Completed folder Save Genotype 36 G save the assembled sequence in a tab delimited format that can be imported into spreadshee
63. colors within the assembled consensus sequence graphic Color Meaning gray Background no differences relative to the reference red Active position of interest Note A red line from top to bottom in the navigation bar denotes an insertion black Mismatches between segments green Known or unknown variant between reference and consensus blue Multibase position yellow Shows where the assembled consensus uses data from only one sequence segment or no sequence segments 4 Alignment View The sequence segments graphic displays the sequence segments in a project labeled with the name and showing overlap Verify that the location and orientation of the segments are similar to the figure in the Navigation Window Example on page 7 21 The segments are depicted as follows Feature Meaning Right arrow Forward sequences generated with primers A D Left arrow Reverse sequences generated with primers F H Analyzing HIV Sequencing Data 7 23 Adding Segments About Adding Segments to a Project to a Project In certain situations you may find it necessary to add or remove individual segments to a project Adding segments in this way allows the user to specify which files are to be used in generating the project Typically you will add or remove segments manually if The original sample name was incorrect Asegment sequence was repeated to improve data quality The location of the segment wa
64. cordance with all local state and national bloodborne infections regulations Washing the RNA To wash the RNA pellet Pellet Step Action 1 Add 1 0 mL of freshly prepared 70 ethanol precooled to 4 C to each tube and then cap WARNING CHEMICAL HAZARD Ethanol is a flammable liquid and vapor It may cause eye skin and upper respiratory tract irritation Prolonged or repeated contact may dry skin Exposure may cause central nervous system depression and liver damage Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Vortex gently for 3 5 seconds You do not need to not dislodge the pellet Replace the microcentrifuge tubes in the rotor with the orientation mark facing the outside rim of the rotor Centrifuge samples at room temperature and 12 500 15 000 x g for 5 minutes Without disturbing the pellets which may not be visible remove the supernatants with a fine tipped transfer pipette WARNING BLOODBORNE INFECTIOUS WASTE HAZARD Discard the supernatants following recognized disinfection procedures and in accordance with all local state and national bloodborne infections regulations Pulse spin at low speed for 5 10 seconds to collect the residual ethanol at the bottom of the tube HIV Genotyping Chemistry Protocol 4 7 To wash the RNA pellet continued Step Action 7 Re
65. ct are identified by a unique sample name The name of the project is the same as the sample name How Sequence The sequence segments that are contained in a project are defined by Segments are the Defined Folder in which the sample files are stored Sample name that you assigned the segments when filling out the sample sheet of the Data Collection software For more information on sample naming see page 1 14 Analyzing HIV Sequencing Data 7 15 Starting the Software Before Starting the Software Creating Projects Manually Procedure Ensure that there is sufficient Finder memory by closing all nonessential applications To Check the Amount of Memory Available From the Apple menu select About This Computer Make sure that at least 32 MB of memory is available The following table describes how to create projects manually To Then manually create individual projects place into one folder all the data files for the sample that you wish to assemble Note Commonly these files will already be part of a run folder If sample files for more than one project are included in a folder projects will be sorted according to the sample name To start the HIV 1 Genotyping System Software Step Action 1 Double click HIV Analysis This opens the HIV 1 Genotyping System Software and the Project Status window appears 2 If you want to Then see page Create a new
66. curs when amplified DNA contaminates a sample which has not yet been amplified It is important to isolate and contain amplified PCR product to prevent it from coming into contact with unamplified samples Carryover is a concern because PCR product serves as an ideal template for subsequent amplifications of that same target A single PCR amplification produces an enormous number of copies as many 2 4 Laboratory Guidelines as 1013 that can potentially contaminate samples that have not yet been amplified Minute amounts of DNA can be transferred between samples by splashing or the movement of aerosols As the number of copies of amplified DNA in a completed PCR reaction is so high inadvertent transfer to one that has not yet been amplified may result in the amplification and detection of the contaminating sequence For example if reuse of a pipette tip transfers 0 1 uL of a completed PCR amplification then as many as 101 copies of amplifiable sequence will be added to the unamplified sample By comparison a nanogram of human genomic DNA contains only about 10 copies of a single copy locus such as FGA UNG AmpErase UNG uracil N glycosylase is included in the Version 2 kit It is used during the 50 C incubation just before AmpliTaq Gold activation It destroys the PCR product that is carried over from previous HIV 1 Genotyping System version 2 amplification reactions Laboratory Guidelines 2 5 Laboratory Design and Organi
67. e Project The following items Folder Description Demo Contains data for demonstrating this software Completed Contains completed project files Also contains the Reports folder where completed Genotype gt and FASTA fasta reports are placed Archives folder Initially this folder is empty Move the files that you want to save for future reference into this folder 7 14 Analyzing HIV Sequencing Data Contents of the HIV Genotyping Folder continued This folder Contains Do Not Modify the Following Items AutoLaunch AutoLaunch application Use to set the day and the folder in which the HIV 1 Genotyping System Software polls the DNA Sequencing Analysis software for sample files see Setting Up the Application on page 7 44 quitCAP runCAP Utility files that are used by the software to perform and closeCAP sequence assembly Scripts Cap Sequence assembly software module JavaClasses jar All the classes of executable software HIV Analysis Application software About Projects and Sequence Segments What Is a Project A project is the organization and assembly of the six or seven sequence segments that are generated from a single RT PCR product The project will also contain all user defined edits and changes to the sequence data All the necessary data for each segment is included in the appropriate project Segments belonging to a proje
68. e current feature selections 4 Consensus sequence Sequence calculated from the base assignments in each of the sequence segments It may include mixed base positions and deletions and reflect differences among segments 5 Reference sequence The sequence of the HIV 1 pNL4 3 reference strain 6 One letter amino acid code Identifies all possible amino acid translations of each codon in the consensus sequence Note When two or more amino acids are displayed in the translation information for one codon this is displayed in the printed report as A1 PositionN A2 A1 PositionN A3 that is L331 L33V A Amino Acid 7 Codon number Identifies the codon of the gene you are editing Jump to leftmost position of Click this button to move the cursor to the leftmost interest Tj position of interest Analyzing HIV Sequencing Data 7 31 Callout number Feature Description 9 Reverse Jump button _ lt _ Click this button to move the cursor to the previous position of interest You may also use the Reverse Arrow key on the Macintosh computer expanded keyboard 10 Trim button mmm See Trimming Sequence Segments on page 7 33 11 Revert button Reverts the active position of interest in the consensus sequence to the original base assignments regardless of any manual edits performed 12 IUB code buttons Editing Palette Use to edit the cons
69. e figure below click the button that corresponds to the IUB one letter code for the replacement base Note You may also use the letters on the Macintosh computer keyboard to edit the sequence C Auto jump on edits Reverse jump trim B amp Is Note The IUB one letter codes are listed in Appendix E IUB Codes 3 Click the right arrow This moves the current position of interest to the next active position of interest If Then you first select the Auto jump you do not need to click the on edits checkbox right arrow The cursor automatically jumps to the next position of interest once the edit has been made Analyzing HIV Sequencing Data 7 35 interest Moving Among The following are the cursor controls for moving among the positions of Positions of Interest Cursor Control Using the View Edit Menu Cursor Control Using the Navigation Window Cursor Control Using the View Edit Menu For more information see Editing the Consensus Sequence Using the View Edit Window on page 7 28 View Edit menu Cursor Controls Control Feature on the View Edit menu Take this action Forward jump button right arrow Click to move to the next active position of interest to the right Note You may also use the Forward Arrow on the Macintosh computer expanded keyboard Reverse jump button left arrow Click to move to the next active position of interest to the left
70. e provided by Princeton Separations on a 96 well base then place the Cenitri Sep 96 plate on top Tape the plates to the 96 well base making sure that you align the alphanumeric indices on all the plates HIV Genotyping Chemistry Protocol 4 29 To purify the sequencing reactions continued Step Action 7 Centrifuge at 700 x g for 2 minutes You should recover approximately 20 uL from each well Remove the 96 well collection plate Dry the samples in a speed vac equipped with the appropriate rotor 10 Seal the plate with ThermaSeal included in the Centri Sep 96 plate package for storage at 2 to 8 C in a dark box Note The products of sequencing reactions are light sensitive 4 30 HIV Genotyping Chemistry Protocol Using the 310 Genetic Analyzer Introduction In This Chapter This chapter describes the operation of the ABI PRISM 310 Genetic Analyzer used its the corresponding autosampler tray The following topics are covered in this chapter Topic See Page Overview of the Procedure 5 2 Preparing the Instrument 5 3 Preparing the Sample Sheet and Injection List 5 6 Denaturing the Samples and Starting the Run 5 8 Analyzing the Sequencing Data 5 9 Assumptions The instructions in this chapter assume that you are already familiar with the ABI PRISM 310 instrument For more detailed information about how to perform a sequencing run
71. e sequencing is shown below PCR product purified and diluted Add Perform cycle sequencing in thermal cycler Seven HIV SEQ MIXES are provided one for each sequence specific primer Specific HIV SEQ MIX You have the option of using six primers A B C F G and H or seven including D for your initial sequencing run For more information about sequencing primers see Primers A and D on page 1 9 IMPORTANT Do not expose mixes to light for extended periods HIV Genotyping Chemistry Protocol 4 21 Preparing To prepare the sequencing reactions Action Prepare the following sequencing reaction mixes in either One MicroAmp Reaction Tube for each HIV SEQ MIX MicroAmp 8 Strip Reaction Tubes in a MicroAmp Tray An Optical 96 Well Reaction Plate Volume for One Component Reaction pL Add one of the following HIV SEQ mixes to each tube or plate well HIV SEQ MIX A 12 HIV SEQ MIX B HIV SEQ MIX C HIV SEQ MIX D HIV SEQ MIX F HIV SEQ MIX G HIV SEQ MIX H Diluted purified PCR product 8 Final Volume 20 Close the tube caps or place a MicroAmp Full Plate Cover over the plate Spin at room temperature and at low speed for 5 10 seconds to collect the contents at the bottom of the tube Load the MicroAmp tubes plate or tray into the thermal cycler Select the Cycle Sequencing program Review your thermal cycler program fo
72. ear band And Mass ladder is clear and well defined Residual ethanol supernatant was left in the tubes during the RNA washing steps Viral RNA pellet may have been lost after precipitation Carefully remove the ethanol supernatant following the instructions at each step see Washing the RNA Pellet on page 4 7 Allow ethanol to evaporate by leaving the tube cap open The orientation mark on the tube should face the outside rim of the rotor during centrifugation and the supernatant must be carefully removed from the side opposite the orientation mark see Precipitating Viral RNA on page 4 6 PCR product for a sample is not visible on the agarose gel And PCR product for the Positive Control is not visible But Mass ladder is clear and well defined Thermal cycler used for RT or PCR is not calibrated correctly Check calibration of the thermal cycler RNase contamination leading to degradation of RNA Decontaminate your work space and tools Use fresh reagents Repeat RT PCR with positive control Poor yield of PCR product after Microcon purification Repeat RT PCR Load product onto an agarose gel before Microcon purification If smear is seen at approximately 100 bp amplicon contamination of PCR may be suspected Make sure that the thermal cycler was preheated to 42 C before inserting the reaction tubes for the RT reaction
73. ect Matrix is appropriate for the analysis To display the View Edit window double click anywhere in the navigation bar in the Navigation window For an example of the Navigation window see page 7 21 and for a description of the bar see callout 3 on page 7 23 Window Example The following is an example of the View Edit window Translation Reference Consensus ATAAAGAAAAAAGACAGT ACT AAATGGAGAAAAT TAG ATAAAGAAAAAAGACAG TAAATGGAGAAAAT TAG 30 QA10 B 2 Al A Aand A ATATA 327Q0A10 D 2 34 QA10 G 2 Ay Analyzing HIV Sequencing Data 7 29 Features of the The following table describes the callout numbers in the previous figure View Edit Window Callout number Feature Description 1 Position Information box Explains why a position in the consensus has been identified as a position of interest The following table describes positions of interest and their definitions Item Definition Novel Variant Change in the sequence that has not been reported as a resistance mutation in the Los Alamos HIV database Reported A variant that is reported in the Los Alamos HIV database Variant Mismatch When two or more segment sequences do not agree at a given position Mixture More than one nucleotide present at a single position Indel A base insertion or deletion in a sequence that cannot be aligned with other segments or with the HIV 1 pNL4 3
74. ed Materials and Reagents 1 20 Technical Support 1 25 Introduction 1 1 Safety Documentation User Attention Words Chemical Hazard Warning 1 2 Introduction Five user attention words appear in the text of all Applied Biosystems user documentation Each word implies a particular level of observation or action as described below Note Calls attention to useful information IMPORTANT Indicates information that is necessary for proper instrument operation CAUTION Cautions the user that a potentially hazardous situation could occur causing injury to the user or damage to the instrument if this information is ignored WARNING Warns the user that serious physical injury or death to the user or other persons could result if these precautions are not taken DANGER Indicates an imminently hazardous situation that if not avoided will result in death or serious injury WARNING CHEMICAL HAZARD Some of the chemicals used with Applied Biosystems instruments and protocols are potentially hazardous and can cause injury illness or death Read and understand the material safety data sheets MSDSs provided by the chemical manufacturer before you store handle or work with any chemicals or hazardous materials Minimize contact with and inhalation of chemicals Wear appropriate personal protective equipment when handling chemicals e g safety glasses gloves or clothing For additional safety guidelines
75. ee additional copies of MSDSs for chemicals manufactured or distributed by Applied Biosystems using the contact information below To order MSDSs Then Over the Internet Go to our web site at www appliedbiosystems com techsupport a Click on MSDSs b Enter keywords or partial words or a part number or the MSDSs Documents on Demand index number c Click on Search d Click on the Adobe Acrobat symbol to view print or download the document or check the box of the desired document and delivery method fax or e mail By automated Use To Obtain Documents on Demand on telephone service from page 1 30 any country Introduction 1 3 To order MSDSs Then By telephone in the Dial 1 800 327 3002 then press 1 United States By telephone from Canada Then dial 1 800 668 6913 To order in and English Press 1 then 2 then 1 again French Press 2 then 2 then 1 By telephone from any See To Contact Technical Support by Telephone other country or Fax on page 1 26 For chemicals not manufactured or distributed by Applied Biosystems call the chemical manufacturer 1 4 Introduction The ViroSeq HIV 1 Genotyping System Intended Use Facilitates Study of Mutations and Viral Resistance For Research Use Only Features of the ViroSeq HIV 1 Genotyping System The ViroSeq HIV 1 Genotyping System is used for identifying mutation
76. ee tes 1 25 2 Laboratory Guidelines Chapter OVErvieW rre no ea ak eee a Se ee Oh aS a S 2 1 General Guidelines ressa t un sac ee ete RE Eee ia eee A 2 2 Background to Laboratory Setup 20 0 eee cece eee eee 2 4 Laboratory Design and Organization 0 0c eee eee 2 6 Infectious Material Work Area 0 0 cee cee eee eee 2 9 RT PCR Setup Work Area 1 2 eee eee ee 2 10 Amplified DNA Work Area 0 cece ee eens 2 11 Safety Guidelines eon m feds ia cage Rega sah aca aa a a R aaa 2 13 Thermal Cycler Settings Chapter Overview oiaoi e oa E Ea Grease e Ma ee E E E a E RL 3 1 General Information ssc i is ee eee ne p a ee ee E e 3 2 Reverse Transcription Thermal Cycling 000 3 2 HIV Amplification Program 0 0 0 eee ee ee 3 3 HIV Sequencing Program 0 0 ee eee ee 3 3 4 HIV Genotyping Chemistry Protocol Chapter OVErViewW 2 bce eee Boag Mabe thew EEE aed A 4 1 Planning Your Work socere iasan Se ede Ne he aa ae eee 4 2 Isolating Viral RNA from Blood Plasma 0005 4 4 Reverse Transcription Reactions 0 0 ee eee eee ee 4 9 Amplifying Viral cDNA by PCR 0 0 0 0 eee eee eee 4 13 Preparing PCR Products for the Sequencing Reactions 4 16 Performing the Cycle Sequencing Reactions 4 21 Purifying the Sequencing Reactions in Microcentrifuge Tubes 4 23 Purifying the Sequencing Reac
77. efore loading your samples they must be dissolved in a gel loading Sequencing buffer solution and denatured We recommend preparing an excess of Reactions formamide loading buffer solution The volumes in the following table will provide sufficient excess solution for the indicated number of reactions Step Action 1 Prepare the following loading buffer formamide solution in a 1 5 mL microcentrifuge tube You need 5 pL for each sequencing reaction Prepare a fresh mix for each use Volumes for 1 36 48 64 and 96 Chemical Reactions pL 1 36 48 64 96 Formamide 5 190 250 330 500 Loading buffer 1 38 50 66 100 Final Volume 6 228 300 396 600 WARNING CHEMICAL HAZARD Formamide is harmful if absorbed through the skin and may cause irritation to the eyes skin and respiratory tract It may cause damage to the central nervous system and the male and female reproductive system and is a possible birth defect hazard Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Resuspend each sample pellet in 5 yL of the above solution and vortex for 3 5 seconds Pulse spin at room temperature and low speed for 5 10 seconds Heat the samples in a thermal cycler at 95 C for 2 minutes 6 8 Using the 377 DNA Sequencer Loading the Gel and Starting the Run for 36 48 and 64 Lanes Loading Samples To lo
78. el loading and starting run 6 9 preparing the gel 6 5 running samples on a 96 lane gel 6 11 to 6 12 GeneAmp PCR System 9600 and 9700 3 3 Genotype format saving in format 7 40 genotyping HIV changing analysis settings 7 38 to 7 39 Index 2 editing the sequence about 7 27 editing the sequence using the View Edit window 7 28 to 7 37 folder organization 7 14 generating areport 7 41 installing 7 2 to 7 5 opening a project 7 18 overview of the procedure 7 6 to 7 9 projects and sequence segments about 7 15 quality standards judging A 1 to A 2 reviewing the assembled sequence 7 20 to 7 26 saving projects 7 40 starting the software 7 16 tutorial using the software 7 10 to 7 13 genotyping process described 1 6 guidelines laboratory setup design and organization 2 6 to 2 12 DNA extraction work area 2 9 to 2 10 evidence handling work area 2 9 PCR setup work area 2 10 sources of laboratory contamination 2 4 to 2 5 cross contamination during sample prep 2 4 from equipment or work environment 2 4 PCR product carryover 2 4 H help e mail address 1 25 Internet address 1 29 telephone hours 1 25 telephone fax 1 26 to 1 28 troubleshooting table 8 1 to 8 5 History window about 7 26 HIV Genotyping System about 1 5 to 1 9 component information 1 9 to 1 11 controls 1 11 materials and equipment 1 16 to 1 19 software 1 12 to 1 15 installing 7 2 to 7 5 user supplied equipment and consumables 1 22 to 1 24 user supplied materia
79. ell 402177 64 well 402180 96 well 0 4 mm mylar sharks 4305385 tooth 0 4 mm single use 4309457 sharks tooth comb TBE 10X buffer MLS 890 mM Tris 890 mM boric acid 20 mM EDTA Long Ranger Singel The FMC Corporation 50696 pack for ABI sequencers 377 36 cm 8 well syringe loader Kloehn Ltd 18597 Needles Kloehn Ltd 18663 Technical Support Contacting Technical Support To Contact Technical Support by E Mail Hours for Telephone Technical Support You can contact Applied Biosystems for technical support by telephone or fax by e mail or through the Internet You can order Applied Biosystems user documents MSDSs certificates of analysis and other related documents 24 hours a day In addition you can download documents in PDF format from the Applied Biosystems Web site please see the section To Obtain Documents on Demand following the telephone information below Contact technical support by e mail for help in the following product areas Product Area E mail address Genetic Analysis DNA galab appliedbiosystems com Sequencing Sequence Detection Systems and pcrlab appliedbiosystems com PCR Protein Sequencing corelab appliedbiosystems com Peptide and DNA Synthesis Biochromatography PerSeptive tsupport appliedbiosystems com DNA PNA and Peptide Synthesis systems CytoFluor FMAT Voyager and Mariner Mass Spectrometers Applied Biosystems MDS Sciex api3 sup
80. em Software continued Step Action 10 Click Restart Continue or Quit The following dialog box opens Installation was successful In order to take is advantage of the new software your Macintosh needs to be restarted esar 11 a Click Restart b Turn on the extensions that you want to use in the Macintosh computer Control Panels Extensions Manager c Restart the computer a second time to register the changes to the Extensions Manager Analyzing HIV Sequencing Data 7 5 Using the ViroSeq HIV 1 Genotyping System Software Software Overview Genotype analysis of the sequencing data is performed using the HIV 1 Genotyping System Software This software processes the six or seven sample files that correspond to a single plasma sample to generate a project A project is an assembly of the sample files containing all the sequencing information required to produce a genotyping result The project format supports manual review and editing of the electropherogram data to generate a final consensus sequence for the HIV protease and RT genes Sources of The HIV 1 Genotyping System Software uses three sources of Information information in the analysis process The following table describes where these information containing files are located File Where located Segments created from the DNA In the folder selected when creating Sequencing Analysis files the files pNL4 3 reference sequ
81. ence within the software as part of the GenBank Accession Number gene profile M19921 Compendium of known resistance mutations from the Los Alamos Database see step 6 on page 7 9 For More For more information about using the HIV 1 Genotyping System Information Software the following have been included Item See Page Flow Diagram 7 7 Automated Processes 7 8 Tutorial Using the HIV 1 Genotyping System Software 7 10 7 6 Analyzing HIV Sequencing Data Flow Diagram The following flow diagram shows the software steps involved in the genotyping process Install the HIV Genotyping System software first time Start the HIV Genotyping System software m gt Create a new project by choosing New Project from the File menu or Project Status window which produces an assembled sequence Briefly review the automatically assembled sequence to verify and correct automatic trimming Open an existing project from the Project Status window with an existing assembled sequence Define Feature Selection as Multibase positions and Mismatches between segments Review the Multibase positions and Mismatches between segments to confirm the basecalls in the consensus sequence and edit bases where applicable Define Feature Selection as Novel variants from reference Show resistance positions Show saved edits Insertions i
82. enotyping System Software Assembles the six or seven sequences obtained from a single plasma sample into a project Compares the overlapping segments to each other and to the sequence of the HIV 1 pNL4 3 reference strain Allows you to examine the electropherograms of the sequence segments and assembled sequence and then edit the assembled sequence to eliminate regions of poor quality data and correct for basecalling errors This produces a consensus sequence Automatically analyses the consensus sequence to show the position of interest defined as the following options Base mismatches between sequence segments Multibase positions those that indicate detectable levels of more than one genotype in the HIV population of the plasma sample Discrepancies between the consensus sequence and reference sequence Base mutations that result in amino acid changes Base mutations that correlate with base mutations reported to confer resistance to specific drugs Bases that you have edited Generates a genotype report Introduction 1 13 Sample Naming 1 14 Introduction Saving Files with a FASTA File Format If you want to compare two or more assembled or consensus sequences the HIV 1 Genotyping System Software will allow you to save your files with a FASTA file format which you can export to other sequence comparison programs Sample Naming Requirement IMPORTANT The ViroSeg HIV
83. ensus sequence window For a list of the International Union of Biochemists IUB codes see Appendix E IUB Codes 13 Auto jump on edits checkbox See Moving Among Positions of Interest on Auto jump on edits page 7 36 14 Reverse jump checkbox Reverse jump Note This is only active when the checkbox labeled Auto jump on edits is selected 15 Feature Selection button Click this button to display the feature selection en window For more information on See Page using the Feature Selection window 7 34 to set active positions of interest 16 Forward Jump button EJE Click this button to move the cursor to the next position of interest Note You may also use the Forward Arrow gt key on the Macintosh computer expanded keyboard 17 Jump to the rightmost position of Click this button to move the cursor to the rightmost interest _ gt _ position of interest 7 32 Analyzing HIV Sequencing Data Trimming About Trimming Sequences Sequence The HIV 1 Genotyping System Software automatically trims data at the Segments ends of the segments based on recognition of the sequence segments being analyzed Regions of an electropherogram that have been trimmed are indicated by a gray background Trimmed regions remain visible but are not used to calculate the consensus sequence About Manual Trimming There are certain situations in which you may wish to manually modify the trimmed regions M
84. ents 0 0000005 7 15 Starting the Software 2 eee eee 7 16 Creating a New Project ic ssinens iiaei fies nota Reta aod ets Ste ced 7 17 Opening a Previously Created Project 0 0 0 0 02 ee eee 7 18 Reviewing the Assembled Sequence 0 0 00 e eee eee 7 20 Editing the Sequence 2 2 0 eee eee ee ee eee eens 7 27 Editing the Consensus Sequence Using the View Edit Window 7 28 Reconciling Segment Mismatches 00 00 cee eee eee 7 38 Saving Projects 425 800 keine i soe te ede aw diay wad daie cea eee 7 40 Printing a Report i 620 gee ee auld Se eee i eee a 7 41 Setting AutoLaunch 12 2 ee ee eee ects 7 43 Troubleshooting Troubleshooting Table 2 0 0 2 eee cee eee 8 1 Quality Standards Preventing RNA Degradation Reference Amino Acid Codes IUB Codes iii Glossary Index Introduction Chapter Overview Introduction This chapter describes the conventions used in this manual provides an overview of the ViroSeq HIV 1 Genotyping System lists materials needed to use the system and tells you how to get help from Applied Biosystems Technical Support In This Chapter The following topics are covered in this chapter Topic See Page Safety 1 2 The ViroSeq HIV 1 Genotyping System 1 5 ViroSeq HIV 1 Genotyping System Components 1 9 ViroSeq HIV 1 Genotyping System Software 1 12 Materials and Equipment 1 16 User Suppli
85. f desired Save consensus in FASTA format to export the consensus sequence to another sequencing analysis program Save report as Genotype gt file to import into a spreadsheet or database Review the Positions of Interest Print a Final Report Analyzing HIV Sequencing Data 7 7 Automated The results are stored in the project file Processes Automated software processing sequence Step Action 1 The sample data files are imported into the HIV 1 Genotyping System Software The relevant segment information are automatically extracted from a folder that you select and are used to create the project file The sample name is used to group the files into projects All titles with identical sample names will be grouped for analysis Note The sample file name is not used to group the projects If Then you want to include comments use the open square bracket unique to a particular sample to separate this information file e g the primer name from the sample name Note Any information to the right of the open bracket is ignored For more information about See page Sample naming 1 14 After the project file is created the segment electropherogram data are automatically analyzed for mixed base positions and the appropriate International Union of Biochemists IUB letter codes are assigned See Appendix E IUB Codes A position is defined
86. f samples you are processing and your familiarity with the procedure Times for Each Step Step Approximate Time hours Isolating viral RNA from blood plasma 3 3 5 for 6 16 samples Reverse transcription 1 5 PCR 4 5 Agarose gel electrophoresis Sequencing reactions HIV Genotyping Chemistry Protocol Times for Each Step continued Genetic Analyzer Step Approximate Time hours Either Ethanol precipitation 1 0 Cleanup using the Centri Sep 96 plate 15 Sequencing on the ABI PRism 377 DNA 8 Sequencer Sequencing on the ABI PRISM 310 2 per Sequencing reaction Stopping Points If you are unable to perform the entire procedure without interruption stop the protocol and store your samples only at certain points The acceptable stopping places are After you have Store at See page Purified the HIV RNA 80 C 4 8 Performed the reverse transcription 15 to 25 C 4 12 Performed the PCR 15 to 25 C 4 15 Purified the PCR products 15 to 25 C 4 16 Purified the cycle sequencing 15 to 25 C 4 26 or reaction products 4 28 or 4 30 You will be reminded in the text when you reach these stopping points HIV Genotyping Chemistry Protocol 4 3 Isolating Viral RNA from Blood Plasma About the The procedure for isolating viral RNA from blood plasma begins with Procedure samples of blood plasma with vir
87. fects RNA Purification Viral RNA is purified from HIV particles that are isolated from plasma by centrifugation 1 6 Introduction Reverse Transcription PCR Sequencing Data Analysis The target for reverse transcription is the HIV 1 RNA prepared from plasma The procedure is carried out using a single primer and the enzyme murine leukemia virus MuLV reverse transcriptase This reaction produces a mixture of single stranded cDNA fragments of varying length which represent the entire HIV 1 pol gene The cDNA products from the RT reaction are amplified The resulting amplicon encompasses the entire HIV protease gene and the 5 end of the RT gene The PCR procedure employs AmpliTaq Gold for high specificity and efficiency and AmpErase UNG anticontamination chemistry to eliminate false genotyping For more information about the PCR procedure see ViroSeq HIV 1 Genotyping Process Summary Diagram on page 1 8 The PCR products are sequenced using custom primers formulated with the BigDye Terminator sequencing chemistry The sequencing products are analyzed on an ABI PRISM 310 Genetic Analyzer or 377 DNA Sequencer DNA basecalling is performed by the DNA Sequencing Analysis software For more information about sequencing chemistry see the Automated DNA Sequencing Chemistry Guide P N 4305080 The ViroSeq HIV 1 Genotyping System Software automatically imports the sequence data from the DNA Sequencing Analysis softw
88. ful with this genotyping procedure it is essential to prevent degradation of your RNA samples RNA is degraded by RNases These enzymes occur naturally in cells and are liberated during cell lysis RNases can remain in samples derived from cells if purification is not complete In addition RNases can be introduced into samples by contact with surfaces that we have touched This is because our skin secretes RNases RNases are very stable and do not need any cofactors so they linger on surfaces and remain functional under a wide range of environmental conditions They have a high activity so only a small amount of contamination can cause significant loss of a sample of RNA Sources of RNase contamination include General laboratory glassware and plasticware Hands Contaminated solutions Preventing RNA Degradation B 1 Precautions Follow these precautions during the genotyping procedure to help prevent RNA degradation Sambrook et al 1989 Purchase gel solutions from a MLS which has analyzed solutions for the absence of RNases and DNases Use only new sterile plasticware Keep separate stocks of chemicals for use with RNA only Keep a selection of glassware plasticware and chemicals for use with RNA sample preparation only Bake all glassware and metal spatulas in an oven at 300 C for at least 4 hours Wear gloves at all times and change them frequently Select plasticware that is resistent to chloroform and eit
89. fying the PCR Product Step Action 1 Assemble the microconcentrator by inserting a Microcon 100 spin column into one of the supplied 1 5 mL collection tubes Make sure that the white membrane is face up 2 Pipette 300 pL of sterile deionized water onto the top of the microconcentrator IMPORTANT Avoid touching the membrane with the pipette tip 3 Pipette the entire 50 yL PCR product into the water in the microconcentrator IMPORTANT Avoid touching the membrane with the pipette tip 4 Seal firmly with the attached tube cap 5 Centrifuge the prepared microconcentrator in a fixed angle rotor at room temperature and at 450 550 x g for 15 minutes 6 Open the tube cap and pipette 35 uL of sterile deionized water into the center of the microconcentrator IMPORTANT Avoid touching the membrane with the pipette tip 4 16 HIV Genotyping Chemistry Protocol To concentrate and purify the PCR product continued Step Action 7 a Remove the microconcentrator from the tube containing filtrate b Place the microconcentrator upside down on top of a new 1 5 mL tube c Discard the tube with the old filtrate 8 Centrifuge again at room temperature and at 450 550 x g for 5 minutes This step transfers approximately 30 50 pL of the purified PCR product to the new tube Remove the microconcentrator and discard it 10 Close the sample tube and either place your samples on ice un
90. has been edited to produce the consensus sequence Additional groups of 3 bases that cannot be aligned with the HIV 1 pNL4 3 reference strain but that are found in all segments and are believed to have biological significance The instance when two or more segment sequences do not agree The state of more than one nucleotide showing at a single position ina segment A base position that the DNA Sequencing Analysis software basecaller has been unable to call as a single specified base A change in the sequence that produces an amino acid change that is not associated with a resistance mutation reported in the Los Alamos HIV database The sequence segments assembled sequence and consensus sequence that are all part of a single genotyping analysis Glossary 1 Resistance Position Known Variant Reported Variant ACTG Segment Unknown Variant Glossary 2 A base position that is known to produce an amino acid change that confers resistance to one or more particular anti HIV drugs An amino acid variant that is reported in the Los Alamos HIV database Abbreviation for Aids Clinical Trials Group A single sequence derived from one primer and stored as one sample file A base position that is identified as an amino acid mutation that has not previously been documented Index Numerics 310 Genetic Analyzer analyzing the sequencing data 5 9 to 5 10 denaturing samples and starting the run 5 8 preparing the Injecti
91. her Rinse with chloroform WARNING CHEMICAL HAZARD Chloroform is extremely toxic and a potential human carcinogen This chemical is highly corrosive to skin and eyes Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Treat all water and salt solutions with diethylpyrocarbonate DEPC which inactivates RNases Solutions containing EDTA cannot be treated with DEPC To treat solutions Step Action 1 Add DEPC to a concentration of 0 2 v v CAUTION CHEMICAL HAZARD Diethylpyrocarbonate DEPC is a combustible liquid and vapor It may be harmful if swallowed or inhaled Exposure may cause irritation to the eyes skin and respiratory tract Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Store for at least 12 hours at 37 C Heat to 100 C for 15 minutes or autoclave for 15 minutes at 15 Ib sq in on the liquid cycle B 2 Preventing RNA Degradation Reference DAIDS Virology Manual for HIV Laboratories 1977 Publication NIH 97 3828 U S Department of Health and Human Services Washington D C Huang X 1992 A contig assembly program based on sensitive detection of fragment overlaps Genomics 14 18 25 Korber B et_al eds 1997 Human Retroviruses and AIDS 1997 A Compilation and Analysis of Nucleic Acid and Amino Acid Sequences Los Alam
92. in the table Novel Variant 7 Any position along the consensus in which at least one of the segments has a multibase position is categorized as a Multibase Position The smaller peak height must be at least 30 of the height of the larger peak If Then this multibase position results each is listed by the single in one or more amino acids for letter amino acid code in the this codon translation Analyzing HIV Sequencing Data 7 9 Tutorial Using the HIV 1 Genotyping System Software Steps to Using the To use the HIV 1 Genotyping System Software Software Step Action 1 From the Apple menu select About This Computer Make sure that there is a minimum of 32 MB of memory available by closing nonessential applications Open the HIV 1 Genotyping System Software by double clicking the icon for HIV Analysis The HIV 1 Genotyping System Software startup display appears followed by the Project Status window The Project Status window can be empty or it may contain a list of projects that are currently in the Completed folder In the Project Status window click the New button to begin a new project If you want to open a project that has already been analyzed but is not in the Completed folder a Click the Find button The Macintosh computer navigation window opens b Scroll to the location of the project and click Open a Locate the QA10 set of data file
93. ing Step Action 1 Start the DNA Sequencing Analysis software 2 Select Preferences from the Edit menu 3 Select Basecaller Settings The Preferences dialog box opens 4 Click the Create a set button The title of the button changes to Save this set as Using the 310 Genetic Analyzer 5 9 To create a new Basecaller Setting continued Step Action 5 Select the checkbox labeled Set endpoint after n bases and enter 580 in the text box The Basecaller Settings should now look like this Preferences Page Basecaller Settings Basecaller Settings untitled set endpoint at PCR stop Cl set endpoint after E C Set endpoint after cc Ns E Set endpoint after 580 _ bases Default Settings Remove this set Save this set as Cw Click the Save this set as button The following dialog box opens Save this set as HIV 580 Enter HIV 580 in the text box Click Save 5 10 Using the 310 Genetic Analyzer Using the 377 DNA Sequencer Chapter Overview Introduction This chapter describes the operation of the ABI PRISM 377 DNA Sequencer used with its corresponding autosampler tray In This Chapter The following topics are covered in this chapter Topic See Page Overview of the Procedure 6 2 Preparing the Instrument 6 3 Denaturing the Sam
94. ing table lists the actions to take before running your samples and explains where to get additional information If Then you have not already generated an instrument file for use with the dRhodamine Matrix Standards Kit and an HIV Run Module 377 36 on the ABI PRISM 377 DNA Sequencer you will need to do this while running your first samples For more information about Refer to generating an instrument file directions in the following The ABI PRISM dRhodamine Matrix Standards Kit User Bulletin P N 904917 or The ABI PRISM 377 DNA Sequencer User s Manual P N 4303613 Note Although BigDye terminators and dRhodamine terminators require different Dye Set Primer files both chemistries use the same instrument matrix file made with the dRhodamine matrix standards 6 4 Using the 377 DNA Sequencer Preparing the Gel Filling Out the Sample Sheet Note The instrument matrix file that you generate is specific to a particular instrument and dye set You cannot use an instrument matrix file that has been created on a different instrument or with a different dye set Follow the directions in the Long Ranger Singel pack for ABI PRISM sequencers 377 36 cm to prepare the gel for 36 48 and 64 lanes Instructions for preparing a 96 lane gel are on page 6 11 For information on plate spacer and comb information see Sequencing on page 1 23 DANGER CHEMICAL HAZARD
95. ions 4 9 Amplifying Viral cDNA by PCR 4 13 Preparing PCR Products for the Sequencing Reactions 4 16 Performing the Cycle Sequencing Reactions 4 21 Purifying the Sequencing Reactions in Microcentrifuge Tubes 4 23 Purifying the Sequencing Reactions in 96 Well Plates or Trays 4 27 Purifying Sequencing Reactions Using a 96 Well Centri Sep 4 29 Plate HIV Genotyping Chemistry Protocol 4 1 Planning Your Work Organizing Your Samples Three Procedures 4 2 Described Timing You have three options for organizing your samples You can use Individual MicroAmp Reaction Tubes in a MicroAmp 9600 Tray Retainer set MicroAmp 8 Strip Reaction Tubes in MicroAmp 9600 Tray Retainer set MicroAmp Optical 96 Well Reaction Plates If you have a small number of samples it may be more convenient to use individual tubes Otherwise use Optical 96 Well Reaction Plates to hold your samples There are three procedures for performing sequencing reactions in this manual The procedures are for samples contained in Individual MicroAmp Reaction Tubes Either MicroAmp Optical 96 Well Reaction Plates or 8 Strip Reaction Tubes in MicroAmp Trays Cenitri Sep 96 plates Use the procedure that is correct for the type of sample container you are using To help you plan your work the approximate time required for each step in the HIV genotyping procedure is shown below The actual time will depend on the number o
96. ive equipment when handling chemicals e g safety glasses gloves or clothing Seal the waste container with the cap provided after disposing of the contents Dispose of the contents of the waste tray and waste bottle in accordance with good laboratory practices and local state provincial or national environmental and health regulations Always use adequate ventilation such as that provided by a fume hood When working with human blood or blood products always observe Universal Precautions and follow these general guidelines Never pipette by mouth Do not eat drink or smoke in the laboratory Laboratory Guidelines 2 13 2 14 Laboratory Guidelines Wear two pairs of disposable gloves sleeve covers on the glove cuffs a laboratory coat and eye protection at all times during the procedure Wear any other personal protective equipment that may be required Use sterile disposable filter plugged pipette tips Dispose of unused reagents and waste in accordance with county federal state and local regulations Do not use this kit after its expiration date Read the Material Safety Data Sheets relating to the reagents used in this users manual Clean and disinfect all work surfaces with 10 v v Clorox bleach or other EPA Environmental Protection Agency approved disinfectant Autoclave any equipment or materials that have come into contact with blood products Do not touch anything outside the hood un
97. ix made with the dRhodamine matrix standards Note Matrix files are specific to a particular instrument polymer and dye set 5 4 Using the 310 Genetic Analyzer Preparing the To prepare the ABI PRISM 310 Genetic Analyzer Instrument Step Action 1 Prepare 1X Genetic Analysis Buffer by mixing Reagent Volume mL ABI PRISM 310 Genetic Analyzer Buffer with 1 5 EDTA Deionized water 13 5 Final Volume 15 0 If switching applications or if the sequencing polymer has not been used for more than one week discard the polymer and flush water through the pump block Inspect and clean the detector window Install the 61 cm capillary Select Autosampler Calibration from the Instrument menu of the Data Collection software Follow the prompts to calibrate the autosampler Verify that there are no visible crystals in the POP 6 polymer If you do see crystals leave the polymer at room temperature until they are completely dissolved CAUTION CHEMICAL HAZARD POP 6 polymer may cause eye skin and respiratory tract irritation Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Use for R amp D purposes only Take up approximately 0 5 mL of POP 6 into the 1 mL glass syringe Install the 1 mL glass syringe on the pump block Prime the block with polymer 10 Load 1X Genetic Analysis Buffer
98. ken out of the designated work area If the work area for amplified DNA is in a separate but contiguous room the user should make sure that air flows toward the amplified DNA area In addition it is helpful if there is a separate exit from the Amplified DNA Work Area that does not exit into the pre PCR work areas Laboratory Guidelines 2 7 Work Area INFECTIOUS MATERIAL WORK AREA Diagram Specimen handling RNA extraction Storage of extracted RNA samples RT PCR SETUP WORK AREA RT PCR reagent and DNA sample additions 4A AMPLIFIED DNA WORK AREA GeneAmp PCR System 9600 and 9700 TERT ABI PRISM 377 and DNA quantitation ABI Prisme 310 instruments agarose gel Gel pouring Storage of amplified DNA Microcon cleanup of sequence samples reaction setups 2 8 Laboratory Guidelines Infectious Material Work Area Overview This work area should be used for Special Precautions Specimen handling Extraction of RNA Storage of RNA samples The work surface equipment and supplies used in this area must be clean and free of PCR product The reagents used for RNA extraction should be prepared in this work area Portions of the samples to be tested are transferred from this area to the RT PCR setup Work Area for processing Limit the number of samples processed at the same time to a manageable number This precaution will reduce the risk of sample mix up and the potential for sample to sample contamina
99. l Application Installs HIY Genotyping Software plus all required system resources This option will require you to restart your computer Install System items on the folowing disk Hard Drive ew PPulll down menu Installation requires 21866K Crs 5 If you Then select are installing the software for Full Install the first time reinstalling the software Reinstall Application Analyzing HIV Sequencing Data 7 3 To install the HIV 1 Genotyping System Software continued Step Action 6 Use the pull down menu to select the disk onto which the program will be installed You will usually select the name that is assigned to your hard drive icon in the Finder for example Hard Drive Click Install The following dialog box opens Select disk to install onto a Hard Drive Switch Disk J Cancel J Click Install An alert box will remind you that after installation the computer will have to be restarted At this time you have the option to cancel the installation installation is complete Do you wish to Your Macintosh needs to be restarted after continue Click Yes If the installation is successful the following message box opens Installation was successful Choose Quit or Restart if you are finished or Continue to perform further installations 7 4 Analyzing HIV Sequencing Data To install the HIV 1 Genotyping Syst
100. lectrophoresis now seal the tubes and store at 15 to 25 C 4 26 HIV Genotyping Chemistry Protocol Purifying the Sequencing Reactions in 96 Well Plates or Trays Overview The procedure for purifying the sequencing reactions in plates or trays is similar to the procedure for purifying the sequencing reactions in MicroAmp Reaction Tubes The main differences are in the number of samples processed and the centrifugation steps Ethanol Quality Itis important to use absolute ethanol to precipitate the sequencing reactions If there is too much water in the ethanol the precipitation will be less efficient and less DNA will be recovered Purification To purify the products of the sequencing reactions Step Action 1 Prepare the sodium acetate ethanol solution IMPORTANT A fresh solution must be made for each set of precipitations WARNING CHEMICAL HAZARD Ethanol is a flammable liquid and vapor It may cause eye skin and upper respiratory tract irritation Prolonged or repeated contact may dry skin Exposure may cause central nervous system depression and liver damage Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Reagent pL HL Volume for One Volume for 13 Plasma Reaction Samples using 7 Primers 3 0 M sodium acetate 2 0 182 pH 4 6 100 ethanol 50 4 550 Final Volume 52 4 732
101. less than 20 ng the sample may not be suitable for sequencing because there may not be enough DNA The table below lists the masses of the DNA fragments in each band of the 3 yL and 6 uL Low Mass Ladders gel lanes Band Mass ng kb 6 pL Mass 3 pL Mass Ladder Ladder in a Lane in a Lane 2 0 100 50 1 2 60 30 0 8 40 20 0 4 20 10 0 2 10 5 Note The 0 4 kb and 0 2 kb bands may not be visible on the gel HIV Genotyping Chemistry Protocol 4 19 To dilute the PCR products continued Step Action 6uL DNA 3uL DNA Sample 1 Sample 2 Sample 3 Sample 4 Sample 5 Mass Ladder Mass Ladder 2 0kb 1 2kb 315uL 105uL Add water Not H20 H20 H20 to 60L suitable for sequencing 0 8kb 0 4kb ETEL Ke 0 2kb 0 1kb Vortex briefly Pulse spin at low speed for 5 10 seconds to collect the contents at the bottom of the tube IMPORTANT Keep the diluted reactions on ice 4 20 HIV Genotyping Chemistry Protocol Performing the Cycle Sequencing Reactions Overview The sequencing mixes provided with the HIV Genotyping System About the HIV SEQ MIXES and Primers contain custom sequencing primers formulated with the BigDye Terminator sequencing chemistry The PCR products are used as templates in the cycle sequencing reactions which generate fluorescently labeled DNA size ladders for sequencing A summary of the preparation for cycl
102. lowing Example table describes the contents of each area in Report Callout number Heading 1 Quality Control Information In each pair of histogram bars the left bar represents the number before editing and the right bar is the total number after editing Insertions Total number of nucleotide insertions Novel nucleotide variants Total number of nucleotide changes that result in novel amino acid variants that are not reported in the Los Alamos HIV database Reported nucleotide variants Total number of nucleotide changes that result in amino acid variants that are reported in the Los Alamos HIV database HIV 1 Genotyping System Software version number and the version of database Sample Name Date the report was printed Summary of project consensus sequence Olo NI O Reported variants at the amino acid level Novel variants at the amino acid level i O Quality Control Information legend Heading Description Mismatches Nucleotide bases in a segment that do not agree with the bases in the overlapping segment s Variants Amino acid changes resulting from nucleotide changes Mixtures More than one nucleotide detected at a single position due to a mixture of viral strains Singles Positions of interest in single coverage area Edits Total number of edits performed 7 42 Analy
103. ls and reagents 1 20 to 1 21 HIV Genotyping System Software about 1 12 to 1 15 changing analysis settings 7 38 to 7 39 editing the sequence 7 27 to 7 37 folder organization 7 14 generating areport 7 41 installing 7 2 to 7 5 opening a project 7 18 overview of procedure 7 6 to 7 9 projects and sequence segments about 7 15 quality standards judging A 1 to A 2 reviewing the assembled sequence 7 20 to 7 26 saving projects 7 40 setting folder for analyzed files 7 43 to 7 45 software 1 12to 1 15 starting the software 7 16 tutorial using the software 7 10 to 7 13 I Injection List preparing 5 7 insertion box toggling using the Toggle Position Cursor command 7 30 Insertion definition Glossary 1 installing HIV software 7 2 to 7 5 run modules and dye set primer files 5 4 instrument file preparing for 377 DNA Sequencer 6 4 Internet address Documents on Demand 1 30 isolating the virus 4 4 to 4 8 L laboratory setup amplified DNA work area 2 11 design and organization 2 6 to 2 12 DNA extraction work area 2 9 to 2 10 evidence handling work area 2 9 PCR setup work area 2 10 sources of laboratory contamination 2 4 to 2 5 cross contamination during sample prep 2 4 from equipment or work environment 2 4 PCR product carryover 2 4 loading volume 6 9 M materials and equipment contents of system 1 16 kit validation 1 19 modules and storage conditions 1 18 parts sold separately 1 16 run modules 1 19 software
104. matches About Reconciling The following table describes how to reconcile segment mismatches Segment Mismatches TO Then reconcile segment mismatches after a Examine the consensus editing the consensus sequence sequence in more detail b Adjust the active positions of interest The active positions of interest are set using the feature selection window Active positions of interest are those that are available for editing Analysis Options The following table describes the analysis options Description of Analysis Options Option Description Novel variants from reference Locates unreported differences relative to the reference Multibase positions Allows you to go to the consensus sequence positions that are derived from segments that have more than one nucleotide at a position Mismatches between segments Locates differences in a consensus sequence position that is derived from segments that do not agree at that position Show saved positions Locates bases that were manually edited and saved in the project Insertions Locates extra bases that code for amino acid s that cannot be aligned with the HIV 1 pNL4 3 reference strain Show Resistance positions Locates positions in the consensus sequence that are found in the resistance mutations table see Resistance Mutations below 7 38 Analyzing HIV Sequencing Data Resistance Definition of Resistan
105. mes The point at which the timing of each step begins Temperature calibration Note Itis recommended that you regularly calibrate your thermal cyclers Note The HIV 1 Genotyping System entitles you to full customer support for the product when you follow this procedure exactly as written Only the procedure described in this manual has been validated to work correctly Introduction 1 19 User Supplied Materials and Reagents Preparation of A list of materials that you must supply for the preparation of viral RNA Viral RNA is given below These materials should be dedicated to biohazard preparations and not be part of general laboratory equipment Description Supplier Microcentrifuge tubes 1 5 mL sterile and RNase free Sarstedt P N 72 692 005 or equivalent Microcentrifuge refrigerated Choose one of the following 17R 22R or 28R Biofuge GS 15R Note The requirements for this centrifuge are that it must be Refrigerated Able to centrifuge samples to 21 000 25 000 x g Baxter Heraeus Beckman Ethanol 95 nondenatured ACSP Reagent Grade Major laboratory suppliers MLS Isopropanol 2 propanol 100 MLS anhydrous Pipettes filter plugged tips MLS Clorox bleach or other EPA c approved disinfectant This must be purchased through a laboratory supply company and not bought from a general store Note Clorox bleach purchased through laboratory suppliers has
106. move any residual supernatant with a fine pipette tip e g a Gilson P 200 micropipette tip or a fine tipped transfer pipette The pellets should still be visible IMPORTANT All ethanol must be removed Any residual ethanol will inhibit the reverse transcription reaction WARNING BLOODBORNE INFECTIOUS WASTE HAZARD Discard the supernatants following recognized disinfection procedures and in accordance with all local state and national bloodborne infections regulations If there is still some residual ethanol in the tubes leave the tube caps open for 1 minute or longer Resuspending the Use the following procedure to resuspend the washed RNA pellets RNA before storing them IMPORTANT From this point forward unless otherwise specified all steps must be performed on ice To resuspend the RNA Step Action 1 If Then the viral load is known to be less add 50 pL of RNA Diluent than 15 000 cp mL the viral load is known to be greater add 100 yL of RNA than 15 000 cp mL Diluent Screw on the microcentrifuge tube caps Resuspend the RNA pellets by vigorously vortexing for 10 seconds Pulse spin at low speed for 5 10 seconds to collect the contents at the bottom of the tube Immediately place on ice Either Or proceed immediately to the RT step store the RNA at 60 to 80 C See Reverse Transcription Reactions on page 4
107. mproves the lane tracking after electrophoresis It also results in straighter tracking on the outside lanes of the gel Note Using an 8 channel gel loader helps to load 96 samples A Kloehn loader is recommended Using the 377 DNA Sequencer 6 11 To run samples on a 96 lane gel continued Step Action 6 Prerun the samples onto the gel for 2 minutes 7 End the prerun 8 Remove the comb from the gel and rinse the surface of the gel with a syringe Add 60 mL of 10X TBE to the upper buffer chamber and mix completely 6 12 Using the 377 DNA Sequencer Analyzing the Sequencing Data Steps Before Before processing the data with the DNA Sequencing Analysis Processing Data software perform the following steps for each sequence Step Action 1 Check the tracking for each lane on the gel image 2 If the lane tracking is Then acceptable proceed using the DNA Sequencing Analysis software not acceptable retrack the lane Refer to the DNA Sequencing Analysis Software User s Manual Extract data from all retracked lanes then proceed with the DNA Sequencing Analysis software Sequencing The following table lists the settings to use in the Sample Manager Analysis Settings window Once the settings have been verified click the Start button After analysis check the data for each sequence to determine if the sta
108. n Process 42 60 Reverse transcription 99 5 MuLV Reverse Transcriptase denaturation 4 HOLD Holds for at least 10 min 3 2 Thermal Cycler Settings HIV Amplification Program GeneAmp PCR The following table describes the thermal cycling program for the HIV System 9600 and PCR amplification on the GeneAmp PCR Systems 9600 and 9700 9700 Note Set the 9700 for MaxMode not 9600 emulation mode Number Temperature of Cycles C Time Process 1 50 10 min AmpErase UNG contamination control 1 93 12 min AmpliTaq Gold activation 40 93 20 sec DNA denaturation 64 45 sec Primer annealing 66 3 min Primer extension 1 72 10 min Final extension 4 HOLD HIV Sequencing Program Programming The following table describes the thermal cycling program for Settings sequencing the PCR products using the GeneAmp PCR System 9600 and 9700 Number Temperature of Cycles C Time Process 25 96 10 sec DNA denaturation 50 5 sec Primer annealing 60 4 min Primer extension 4 HOLD Thermal Cycler Settings 3 3 HIV Genotyping Chemistry Protocol Chapter Overview Introduction This chapter describes the chemistry related procedures used to prepare samples for sequencing In This Chapter The following topics are covered in this chapter Topic See Page Planning Your Work 4 2 Isolating Viral RNA from Blood Plasma 4 4 Reverse Transcription React
109. n below Review your thermal cycler program for correctness GeneAmp PCR System 9600 or 9700 Number Temperature of Cycles C Time Process 1 50 10 AmpErase UNG activation 1 93 12 min AmpliTaq Gold activation 40 93 20 sec DNA Denaturation 64 45 sec Primer Annealing 66 3 min Primer Extension 1 72 10 min Final Extension 4 HOLDa a Do not leave tubes on hold for more than 24 hours because residual UNG activity may destroy your amplified DNA If the reactions cannot be analyzed within 24 hours store them at 15 to 25 C 3 Start the thermal cycler When the program is complete either remove the tubes and continue or store your samples at 15 to 25 C HIV Genotyping Chemistry Protocol 4 15 Preparing PCR Products for the Sequencing Reactions Overview At this point the sample tubes contain double stranded DNA PCR products with the 5 end of the RT gene and the entire protease gene Before sequencing these PCR products they must be purified to eliminate unreacted primers and dNTPs Purify the PCR products using a Microcon 100 microconcentrator A summary of the preparation steps is shown below Purify the PCR products with Microcon 100 microconcentrators Check for yield and purity of the PCR with agarose gel electrophoresis C Dilute the PCR products Concentrating and To concentrate and purify the PCR product Puri
110. ng Laboratory Guidelines 2 11 Quantitation of amplified DNA by gel electrophoresis may be performed in this room Do not remove DNA samples from the Amplified DNA Work Area Store tubes of amplified DNA in this area 2 12 Laboratory Guidelines Safety Guidelines BIOHAZARD Warning Hazardous Waste Precautions WARNING BIOHAZARD Biological samples such as tissues and blood have the potential to transmit infectious diseases Follow the U S Department of Health and Human Services guidelines published in Biosafety in Microbiological and Biomedical Laboratories stock no 017 040 00547 4 and in Occupational Safety and Health Standards Toxic and Hazardous Substances 29 CFR 1910 1030 or international equivalents concerning the principles of risk assessment biological containment and safe laboratory practices for activities involving clinical specimens You can obtain additional information by connecting to the government web site http www cdc gov WARNING CHEMICAL WASTE HAZARD Wastes produced by Applied Biosystems instruments are potentially hazardous and can cause injury illness or death Read and understand the material safety data sheets MSDSs provided by the manufacturers of the chemicals in the waste container before you store handle or dispose of chemical waste Handle chemical wastes in a fume hood Minimize contact with and inhalation of chemical waste Wear appropriate personal protect
111. ng segments The following table describes how to show the cursor line To Then show the cursor line in the View Edit window select Toggle Position Cursor 3 T from the Edit menu turn the cursor line off select Toggle Position Cursor again Overview of the To edit the sequence Editing Procedure Procedure See Page Trim the ends of each segment if needed to remove poor quality base calls Trimming Sequence Segments on page 7 33 Verify multibase positions Setting Active Positions of Interest on page 7 34 Reconcile mismatched bases those bases in overlapping segments that do not agree with each other Editing Bases on page 7 35 Analyzing HIV Sequencing Data 7 27 Editing the Consensus Sequence Using the View Edit Window The Editing Process Before Manually Editing the Project Displaying the Window 7 28 Analyzing HIV Sequencing Data Trimming and base editing are carried out using the features of the View Edit window as follows Step Action See Page 1 Trimming Sequence Segments 7 33 2 Edit positions of interest to generate an edited 7 35 consensus sequence Before manually editing the HIV 1 Genotyping System Software project make sure that in the DNA Sequencing Analysis Software the Tracking is correct gt gt Start and stop points are correct Sample naming is corr
112. ns as outlined in the procedure below The plates are prepared using special stepped front plates and the upper buffer chamber contains water not 1X TBE during the prerun step These modifications help to improve sequence quality when the samples are loaded Once the gel is loaded and prerun for 2 minutes 10X TBE is added to the upper buffer chamber to produce 1X TBE To prepare the sequencing reactions for the 96 lane sequencing gel use either of the following methods Method See Page Purifying the Sequencing Reactions in 96 Well Plates or Trays 4 27 Purifying Sequencing Reactions Using a 96 Well Centri Sep 4 29 Plate Procedure To run samples on a 96 lane gel Step Action 1 Prepare the sequencing gel with the stepped front glass plate and using the smooth flat side of a 96 lane sharks tooth comb 2 After the gel is polymerized place it on the ABI PRISM 377 instrument 3 Prepare a 1X TBE buffer solution in the lower buffer chamber 4 Add 540 mL of deionized water to the upper buffer chamber Note Running the samples into the gel with water in the upper chamber will improve the sequence resolution 5 Load 1 pL of each sample onto the gel using a multichannel loader Note If you are not loading all 96 lanes of the gel make sure that you add loading buffer formamide mix to the empty wells Loading buffer formamide mix helps to minimize differences in salt concentration between lanes and i
113. oLaunch 7 43 Analyzing HIV Sequencing Data 7 1 Installing the Software Introduction The HIV 1 Genotyping System Software is supplied on the CD provided with the HIV Genotyping System Starter Kit Before Installing Make sure that your computer meets the minimum requirements for the Software running the software For more information about computer requirements see page 1 15 Procedure To install the HIV 1 Genotyping System Software Step Action Turning Off Extensions and Disabling Virus Protection 1 Close all applications 2 Turn off all extensions in the Macintosh Control Panels Extensions Manager except for the Apple CD ROM extension If you turn off the CD ROM extension you will not be able to use the CD 3 Disable any virus protection software Restart the computer to register the changes to the Extensions Manager Installing the Software 1 Insert the CD into the CD drive The icon for the CD will appear on the desktop Double click the icon for the CD Double click HIV Genotyper Installer ce HI Genotyper Installer A startup display appears 7 2 Analyzing HIV Sequencing Data To install the HIV 1 Genotyping System Software continued Step Action HGS 2 2 Not for use in diagnostic procedures a Bs d PN SIER 4 Click Continue The following message box appears Install the following reinstal
114. on List 5 7 preparing the instrument 5 3 to 5 5 preparing the Sample Sheet 5 6 procedure overview 5 2 table of modules 5 3 6 3 377 DNA Sequencer using analyzing the sequencing data 6 13 to 6 15 denaturing the samples 6 8 loading the gel and starting the run 6 9 preparing the instrument 6 3 to 6 7 procedure overview 6 2 running samples on a 96 lane gel 6 12 96 lane gel running samples 6 11 to 6 12 96 well ethanol precipitation of sequencing reactions in plates or trays 4 27 to 4 28 purifying sequencing reactions using Cenitri Sep plate 4 29 to 4 30 6 11 to A ABI Prism 310 analyzing the sequencing data 5 9 to 5 10 denaturing samples and starting the run 5 8 preparing the Injection List 5 7 preparing the instrument 5 3 to 5 5 preparing the Sample Sheet 5 6 procedure overview 5 2 ABI Prism 377 using analyzing the sequencing data 6 13 to 6 15 denaturing the samples 6 8 loading the gel and starting the run 6 9 preparing the instrument 6 3 to 6 7 procedure overview 6 2 running samples on a 96 lane gel 6 12 ACTG defined Glossary 2 6 11 to adding segments to a project 7 24 to 7 25 AIDS Clinical Trial Group defined Glossary 2 amino acid codes table of D 1 amplified DNA work area 2 11 AmpliTaq DNA Polymerase enzyme description of 1 10 AmpliTaq Gold DNA Polymerase enzyme description of 1 10 analysis settings changing 7 38 to 7 39 analyzing sequencing data ABI Prism 310 5 9 to 5 10 ABI Prism 377 6 13 to 6 15 assembled
115. on software DNA Sequencing ViroSeq HIV Genotyping Analysis software System Software The data from the Data Collection software are analyzed by the DNA Sequencing Analysis software and automatically imported into the HIV 1 Genotyping System Software ABI Prism 377 Data Collection software You can run the HIV 1 Genotyping System Software on the collection computer or export the data to a separate computer The Data Collection software should already be installed on your computer but you will need to configure it before running your samples see Chapter 5 Using the 310 Genetic Analyzer and Chapter 6 Using the 377 DNA Sequencer Note The Data Collection software is different for the ABI PRISM 310 and ABI PRISM 377 instruments DNA Sequencing Analysis Software ViroSeq HIV 1 Genotyping System Software The DNA Sequencing Analysis software is the same for the ABI PRISM 310 Genetic Analyzer and the ABI PRISM 377 DNA Sequencer It was supplied with your instrument and should already be installed on your computer For more information about this software see the ABI Prism DNA Sequencing Analysis Software User s Manual P N 903564 About the HIV 1 Genotyping System Software The ViroSeq HIV 1 Genotyping System Software is provided on a CD It is used with the DNA Sequencing Analysis software and will analyze data from either instrument What the HIV 1 Genotyping System Software Does The HIV 1 G
116. on window provides an overview of the overlap in the sequence segments and the number of positions of interest How You Can Use This Window The following table describes actions you can perform from this window You can For more information see add and remove segments from the Adding Segments to a Project project on page 7 24 Removing Segments from a Project on page 7 25 Select an area of interest in the page 7 21 Navigation bar and jump to the area of interest in the View Edit window 7 20 Analyzing HIV Sequencing Data Navigation Window Example The following figure shows an entire assembled project displayed in the Navigation window Navigation QA10 v lt 33 QA10 F 2 Q gt 30 QA10 B 2 gt u aE Features of the Navigation Window The following table describes the callouts in the Navigation Window Example above Navigation Window Features Page 7 21 Callout Feature Description 1 Turn Triangle Clicking the turn triangle toggles between the option of Displaying a graphical representation of the sequence segments alignment Not displaying the graphic Analyzing HIV Sequencing Data 7 21 Navigation Window Features continued Page 7 21 Callout Feature Description 2 Vertical colored bars indicate positions of interest They are represen
117. os NM Theoretical Biology and Biophysics Group Los Alamos National Laboratory http hiv web lanl gov HTML compendium html Accessed 16 Aug 1999 Kwok S and Higuchi R 1989 Avoiding false positives with PCR Nature 339 237 238 Mullis K B and Faloona F A 1987 Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction Methods Enzymol 155 335 350 Saiki R K et al 1985 Enzymatic amplification of B globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia Science 230 1350 1354 Saiki R K et al 1988 Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase Science 239 487 491 Sambrook J et al 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbor NY Cold Spring Harbor Laboratory Press 3 v U S Department of Health and Human Services Occupational Safety and Health Administration 1998 Occupational Safety and Health Standards Toxic and Hazardous Substances Bloodborne pathogens 29 CFR 1910 1030 Reference C 1 Amino Acid Codes The following table lists the amino acids and the corresponding three letter and one letter codes Three Letter Amino Acid Code One Letter Code Alanine Ala A Arginine Arg R Asparagine Asn N Aspartate or Aspartic acid Asp D Cysteine Cys C Glutamine Gin Q Glutamate or Glutamic acid Glu E Glycine Gly G Histidine His H I
118. ping procedure in place of viral RNA at the RT step and are processed the same way as the HIV 1 RNA samples from blood plasma Positive and Negative Controls Described Conirol Description Positive RNA The positive control RNA Control PRT 5 RT allows Control the effectiveness of the procedure to be monitored A 2 8 kb fragment of RNA contains the entire protease gene and the 5 end of the reverse transcriptase gene In the RT PCR reactions a 1 8 kb product is generated To prevent contamination of reagents do not store the positive RNA control in the RT PCR module Note The positive RNA control is not infectious IMPORTANT Keep the positive RNA control on ice during use Negative Control The RNA Diluent supplied with the HIV 1 Genotyping System is used as a negative control as well as being used to dilute RNA samples The negative control provides a check for the contamination of any reagents used in the procedure Introduction 1 11 ViroSeq HIV 1 Genotyping System Software Overview Data Flow Diagram Data Collection Software 1 12 Introduction Three different types of software are used with the HIV 1 Genotyping System Data Collection software for an ABI PRISM instrument ABI PRISM DNA Sequencing Analysis software ViroSeq HIV 1 Genotyping System Software The flow of data between the different software applications is shown below ABI Prism 310 Data Collecti
119. ples 6 8 Loading the Gel and Starting the Run for 36 48 and 64 Lanes 6 9 Running Samples on a 96 Lane Gel 6 11 Analyzing the Sequencing Data 6 13 Assumptions The instructions in this chapter assume that you are already familiar with the ABI PRISM 377 DNA Sequencer For more information about performing a sequencing run see the ABI PRISM 377 DNA Sequencer User s Manual P N 4303613 Using the 377 DNA Sequencer 6 1 Overview of the Procedure At This Stage Following ethanol precipitation the samples are ready to be run on an automated DNA sequencer The sequences may be in 1 5 mL microcentrifuge tubes MicroAmp 8 Sirip Reaction Tubes or MicroAmp Optical 96 Well Reaction Plates shown below Prepare the ABI PRISM 377 and if necessary Install the run module Install the dye set primer file Prepare a dRhodamine matrix p P th C repare the ge J Mount the gel on the instrument t N 3 i A N Start the Data Collection software f Perform a plate check j Fill the buffer reservoirs with TBE buffer CN ANF O OV CO 6 2 Using the 377 DNA Sequencer Flow Diagram An overview of the procedure used to complete the sequencing is Attach the heat plate and hoses Prerun the gel f Denature the samples 4 N Configure the Data Collection software Ro A f Load the samples f Run the gel i
120. port sciex com Chemiluminescence Tropix tropix appliedbiosystems com In the United States and Canada technical support is available at the following times Product Hours Chemiluminescence 8 30 a m to 5 30 p m Eastern Time Framingham support 8 00 a m to 6 00 p m Eastern Time All Other Products 5 30 a m to 5 00 p m Pacific Time Introduction 1 25 To Contact Technical Support by Telephone or Fax 1 26 Introduction In North America To contact Applied Biosystems Technical Support use the telephone or fax numbers given below To open a service call for other support needs or in case of an emergency dial 1 800 831 6844 and press 1 Product or Product Area Telephone Dial Fax Dial ABI Prism 3700 DNA Analyzer 1 800 831 6844 then press 8 1 650 638 5981 DNA Synthesis 1 800 831 6844 then press 21 1 650 638 5981 Fluorescent DNA Sequencing 1 800 831 6844 then press 22 1 650 638 5981 Fluorescent Fragment Analysis includes GeneScan applications 1 800 831 6844 then press 23 1 650 638 5981 Integrated Thermal Cyclers ABI PRISM 877 and Catalyst 800 instruments 1 800 831 6844 then press 24 1 650 638 5981 ABI PRISM 3100 Genetic Analyzer 1 800 831 6844 then press 26 1 650 638 5981 Biolnformatics includes BioLIMS BioMerge and SQL GT applications 1 800 831 6844 then pre
121. positions of interest will be apparent on the Navigation Bar i e the number of colored vertical lines will decrease C Click the Auto jump on edits button so that as you make the edits the cursor moves automatically to the next position of interest to the right If Then you do not edit a position click the right arrow of interest button to move to the next position of interest Analyzing HIV Sequencing Data 7 11 To use the HIV 1 Genotyping System Software continued Step Action 7 Continue editing until all currently selected positions of interest have been reviewed You can take the following actions To Then make edits use letters on the keyboard or use the buttons on the Editing Palette see Editing Bases on page 7 35 perform any trimming or see Trimming Sequence untrimming that is necessary Segments on page 7 33 8 When you are satisfied with your edits you can take the following actions To Then save the project select Save from the File menu save the project in the FASTA select Save Fasta 3 F or or GT format Save Genotype 3 G from the File menu For more information see Saving Projects on page 7 40 9 Review the automated processing and edits To review the automated processing and your manual edits to this point select History from the Window menu The History window
122. precipitate the sequencing reactions with ethanol in one of Precipitation three ways Choices Individual microcentrifuge tubes MicroAmp 8 Strip Reaction Tubes in a MicroAmp Tray MicroAmp Optical 96 Well Reaction Plates If you are purifying the sequencing reactions in Then individual microcentrifuge tubes follow the protocol in this section a MicroAmp Optical 96 Well go to page 4 27 Reaction Plate or MicroAmp 8 Strip ReactionTubes in a MicroAmp Tray Purifying the To purify the sequencing reactions in tubes Sequencing Reactions in Tubes Step Action 1 Label a 1 5 mL microcentrifuge tube for each sample 2 Begin preheating a heat block that holds 1 5 mL tubes to 95 C 3 Prepare a sodium acetate ethanol solution IMPORTANT A fresh batch of this solution must be made for each set of precipitations WARNING CHEMICAL HAZARD Ethanol is a flammable liquid and vapor It may cause eye skin and upper respiratory tract irritation Prolonged or repeated contact may dry skin Exposure may cause central nervous system depression and liver damage Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves 4 24 HIV Genotyping Chemistry Protocol To purify the sequencing reactions in tubes continued Step Action Volume for One Volume for 13 Plasma Reaction Samples using 7 Primers Reagent
123. r a labcoat dedicated to pre amplification sample handling when working in the Infectious Material Work Area RT PCR Setup Work Area Overview This work area is used for combining PCR reagents and extracted RNA to the appropriate reaction tubes Special Precautions 2 10 Laboratory Guidelines Use dedicated pipettors for adding RNA sample to the PCR reaction mixture Use a new sterile disposable hydrophobic filter plugged pipette tip for each RNA sample addition to a PCR reaction tube Discard used pipette tips To minimize cross contamination always add the RNA to the PCR tubes last Make additions to the negative control no RNA added tube last This control will provide a check for contamination occurring during RT PCR setup Avoid handling the inside surface of the tube caps Change gloves frequently whenever they may have been contaminated with DNA or RNA or were used to handle anything outside of the RT PCR setup Work Area Store the RT PCR reagents in a refrigerator that is located in the Infectious Material Work Area Do not store the reagents close to samples containing high levels of DNA and RNA Amplified DNA Work Area Overview This work area should be a physically separate area used only for those activities that involve the handling of amplified DNA These activities include the Dedicated Equipment and Supplies Special Precautions gt gt Pouring of gels Electrophoresis of amplified
124. r correctness Number of Cycles Temperature C Time 25 96 10 sec 50 5 sec 60 4 min 4 HOLD Sequencing 5 Reactions tep 1 2 3 5 6 Start the thermal cycler 4 22 HIV Genotyping Chemistry Protocol Purifying the Sequencing Reactions in Microcentrifuge Tubes Overview Flow Diagram At the end of the cycle sequencing reactions each tube contains a fluorescently labeled DNA sequence ladder Before electrophoresis each sequence must be purified to remove unincorporated dyes and salts both of which can interfere with the electrophoresis and data analysis The sequences can be purified by Ethanol precipitation in individual tubes or 96 well trays or Spin column filtration using Centri Sep 96 plates The procedure for purifying the sequencing reactions by ethanol precipitation is outlined below Sequencing reactions 70 EtOH solution Place on ice Preheat a heat block to 05 C Prepare a sodium acetate ethanol solution Sequencing reactions precipitate by centrifugation 70 ethanol wash to remove salt i Dry the pellets HIV Genotyping Chemistry Protocol 4 23 Ethanol Quality Itis important to use absolute ethanol to precipitate the sequencing reactions If there is too much water in the ethanol the precipitation will be less efficient and less DNA will be recovered Ethanol You can
125. rt point is appropriately set Parameter Select Basecaller ABI100 Basecaller Settings HIV 580 See Creating a New Basecaller Setting below Dye Set Primer file DT BD Set Any Primer Instrument file The file you have generated on the ABI PRISM 377 using the dRhodamine Matrix Standards Kit and the HIV Run Module 377 36 Using the 377 DNA Sequencer 6 13 Creating a New About Basecaller Settings Basecaller Setting The Basecaller setting in the DNA Sequencing Analysis software allows you to define automatically the number of bases that you want to process in your sequence data files For the data files generated with the ViroSeq HIV Genotyping System all sequences must be processed to stop at 580 bases Procedure To create a new Basecaller Setting Step Action 1 Start the DNA Sequencing Analysis software and select Preferences from the Edit menu and Basecaller Settings from the submenu The Preferences dialog box opens Click the Create a set button The title of the button changes to Save this set as Select the checkbox labeled Set endpoint after n bases and enter 580 in the text box The Basecaller Settings should now look like this Preferences Page Basecaller Settings Basecaller Settings untitled set endpoint at PCR stop set endpoint after E Ns in Hg set endpoint after z ns ii Set endpoint after 580 bases
126. run module named HIV 310 Run ModuleH that is included on the CD ROM provided with the HIV Genotyping System Do not use the other run modules on this CD ROM because they define run conditions that are inappropriate for the current kit configuration A dye set primer file is used by the ABI PRISM DNA Sequencing Analysis software to compensate for the mobility effects that different dyes impart on the fragments of the sequence ladder during electrophoresis Use of the proper dye set primer file will result in more evenly spaced peaks in the electropherograms For the sequences generated with the HIV Genotyping System use the dye set primer file named DT POP 6 BD Set Any Primer If you do not already have the dye set primer file named DT POP 6 BD Set Any Primer you can obtain it from The Applied Biosystems Product Software Library web site at http www appliedbiosystems com techsupport Your local Field Applications Specialist Call Applied Biosystems Technical Support or your local sales office for more information IMPORTANT Dye set primer file names for the BigDye terminators are similar to those for the dRhodamine terminators If you inadvertently select a dye set primer file for the dRhodamine terminators it is possible to reanalyze the data with the correct file Using the 310 Genetic Analyzer 5 3 Installing the Run To install the run modules and dye set primer file Module and Dye Set Primer File Step Ac
127. s in the pol gene of the human immunodeficiency virus type one HIV 1 The entire Protease gene and approximately two thirds of the Reverse Transcriptase RT gene in the pol open reading frame are amplified approximately 1 8 kilobases kb This amplicon is subsequently used as a sequencing template to generate approximately 1 2 kb of sequence data Genotypic analysis of this region of HIV 1 facilitates the study of the relationship between mutations and viral resistance to anti retroviral drugs specifically the protease and RT inhibitors The ViroSeq HIV 1 Genotyping System can be used to process samples with viral loads between 2000 and 750 000 copies per milliliter cp mL The ViroSeq HIV 1 Genotyping System is for research use only not for use in diagnostic procedures The ViroSeq HIV 1 Genotyping System Includes the reagents needed to purify the viral RNA from human blood plasma Uses a reverse transcription polymerase chain reaction RT PCR to generate amplified DNA from viral RNA Incorporates the AmpErase Uracil N glycosylase UNG contamination control system to safeguard against false genotyping Uses BigDye terminator sequencing chemistry Uses a single tube for the RT and PCR for speed and convenience Sequences both strands of amplified DNA to increase accuracy gt gt gt Contains a synthetic noninfectious positive RNA control including the entire protease gene and the 5 945 nucleotides
128. s in the QA10 folder The QA10 folder is located within the Demo folder in the Projects folder of the HIV Genotyping folder b Click Open when you see the list of sequence data files A progress box appears showing how the HIV 1 Genotyping System Software is processing the set of data files When processing is complete the Navigation window opens Click the blue turn triangle to view the entire Navigation window with the Alignment View of the segment assembly For more information see Reviewing the Assembled Sequence on page 7 20 7 10 Analyzing HIV Sequencing Data To use the HIV 1 Genotyping System Software continued Step Action 6 Click on the left end of the Navigation bar to open the View Edit window This presents the first position of interest in the sequence for the 5 end of the alignment primers A D and F You can take the following actions Step Action a To select the positions of interest that you want to examine in your initial review of the data a Click the Feature Selection button in the View Edit window The Feature Selection window appears b Select the checkboxes labeled Multibase Positions and Mismatches Between Segments For more information see Setting Active Positions of Interest on page 7 34 b Close the Feature Selection window by clicking the close box The selection is automatically saved The change in the number of
129. s incorrect e g the start and stop points were incorrectly set so that the read length was inappropriate Procedure Note When adding segments to a project be careful not to add a sequence data file that is already part of the project To add segments to a current project Step Action 1 Open the project to which you will add the segment 2 Select Add Segment 3 A from the Edit menu The following window appears see below O SSS Add to Project SS H H Sample file 7 24 Analyzing HIV Sequencing Data To add segments to a current project continued Step Action 3 Click the Add button The standard Macintosh computer navigation box appears Hard Drive 310 assem Eject 63041 7L021599 A 630417L021599 B T 630417L021599 C 630417L021599 F cancel 630417L021599 G e 630417L021599 H 4 Navigate to the folder that contains the sample files you want to add 5 You can either Select the file and click Open or Double click the selected file The sample file is listed in the text area of the Add to Project window 6 Repeat step 5 as needed Click Submit The progress window appears describing the process of adding the segment to the project Removing About Removing Segments from a Project Segments from a Project It may be necessary to remove a segment from a project if Excessive mismatches
130. servation Possible Causes Recommended Action Sequencing electropherogram fluorescence intensity is too low lt 100 The concentration of the sequencing template is below the range of the assay The sample was lost during ethanol precipitation If sufficient PCR product remains repeat the sequencing reactions If necessary repeat the RT PCR reaction and Microcon purification Use a lower dilution of the PCR product and repeat the sequencing reactions Make sure that the absolute ethanol you used is fresh If in doubt start again with a new bottle Make sure that the proper volume of 3 M sodium acetate was added to the sodium acetate EtOH mixture used for the precipitation steps Thorough mixing at this step is very important Make sure that you do not disturb the pellet when aspirating supernatant After resequencing the sample resuspend the dried pellet in 3 yL rather than 5 pL Formamide Loading Buffer Run a BigDye sequencing standard P N 4304154 to verify Gel quality That the instrument is operating within specifications Centrifugation forces for the precipitation steps were incorrect Follow instructions for the precipitation steps exactly as written Sequencing electropherogram fluorescence intensity is too high peak tops are cut off peaks are too wide at the beginning of the run The concentration of the sequencing template is
131. soleucine lle Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valine Val V Amino Acid Codes D 1 IUB Codes The following table lists the International Union of Biochemists IUB codes and complements IUB Codes Complements A adenosine S Gor C Strong 3 H A TJR Y bonds U C cytidine W Aor T Weak 2 H bonds C G Y R G guanosine Y C or T pYrimidine G CIK M T thymidine B C G orT T AJM K U uracil D A G orT U AJS W K Gor T Keto H A C orT D HIW S M A or C aMino V A C or G H D B V R AorG N aNy base N NJIV B puRine TUB Codes E 1 Glossary This glossary includes some of the special terms used in this manual If a special term is not defined here check the index to see if it is explained elsewhere in the manual Assembled Sequence Consensus Sequence Crucial Position Discrepancy Edited Position Insertion Mismatch Mixture Multibase Position Novel Variant Project A sequence that is assembled from individual sequence segments but which has not been edited to make a consensus sequence A sequence that results after the assembled sequence is edited A base that if changed will change the genotypic assignment The state that exists when the consensus sequence does not agree with the reference sequence A base that
132. ss 25 1 505 982 7690 Peptide Synthesis 433 and 43X Systems 1 800 831 6844 then press 31 1 650 638 5981 Protein Sequencing Procise Protein Sequencing Systems 1 800 831 6844 then press 32 1 650 638 5981 PCR and Sequence Detection 1 800 762 4001 then press 1 for PCR 2 for the 7700 or 5700 6 for the 6700 or dial 1 800 831 6844 then press 5 1 240 453 4613 Product or Product Area Telephone Dial Fax Dial Voyager MALDI TOF Biospectrometry and Mariner ESI TOF Mass Spectrometry Workstations 1 800 899 5858 then press 13 1 508 383 7855 Biochromatography BioCAD Workstations and Poros Perfusion Chromatography Products 1 800 899 5858 then press 14 1 508 383 7855 Expedite Nucleic acid Synthesis Systems 1 800 899 5858 then press 15 1 508 383 7855 Peptide Synthesis Pioneer and 9050 Plus Peptide Synthesizers 1 800 899 5858 then press 15 1 508 383 7855 PNA Custom and Synthesis 1 800 899 5858 then press 15 1 508 383 7855 FMAT 8100 HTS System and Cytofluor 4000 Fluorescence Plate Reader 1 800 899 5858 then press 16 1 508 383 7855 Chemiluminescence Tropix 1 800 542 2369 U S only or 1 781 271 0045 1 781 275 8581 Applied Biosystems MDS Sciex 1 800 952 4716 1 650 638 6223 Outside North America Telephone Fax Region
133. t Any Primer you can obtain it from The Applied Biosystems Product Software Library web site at http www appliedbiosystems com techsupport Your local Field Applications Specialist Call Applied Biosystems Technical Support or your local sales office for more information IMPORTANT Dye set primer file names for the BigDye terminators are similar to those for the dRhodamine terminators If you inadvertently select a dye set primer file for the dRhodamine terminators it is possible to reprocess the data with the correct file Using the 377 DNA Sequencer 6 3 Installing the Run To install the run modules and Dye Set Primer file Modules and Dye Set Primer File Preparing an Instrument Matrix File Preparing an Instrument Matrix File Step Action Collection software folder Genotyping System 1 Copy the HIV Run Module 377 36 into the Module folder within the The run module is on the CD ROM supplied with the HIV 2 If necessary copy the DT BD Set Any Primer file for your instrument into the ABI folder within the System folder 3 Restart the Data Collection software and or DNA Sequencing Analysis software if either was open when the files were installed How Instrument Matrix Files Are Used Instrument matrix files are used by the ABI PRISM DNA Sequencing Analysis software to compensate for the overlapping fluorescence emission spectra of the different dyes in a dye set The follow
134. t instrument is used Analyzing HIV Sequencing Data 7 45 Troubleshooting Troubleshooting Table How to Use Use the following troubleshooting table to diagnose and solve problems The troubleshooting recommendations are based on the assumption that all kit reagents are stored according to their manufacturers specifications and that the directions in this manual have been followed correctly Troubleshooting Table Observation Possible Causes Recommended Action Presence of precipitate in Viral Lysis Buffer Storage temperature is too low Performance is not affected once the precipitate is redissolved Warm the buffer in a 37 C water bath until the precipitate is dissolved Store at 2 8 C PCR product for a sample is not visible on the agarose gel But Positive Control shows a clear band And Mass ladder is clear and well defined Not enough RNA in RT PCR If the sample was Then resuspended in Repeat DNA 100 pL Sample purification step Diluent but resuspend RNA in 50 yL Sample Diluent resuspended in Repeat RNA 50 pL Sample Diluent purification step but this time start with 1 mL plasma Troubleshooting 8 1 Troubleshooting Table continued Observation Possible Causes Recommended Action PCR product for a sample is not visible on the agarose gel But Positive Control shows a Cl
135. ted by color coded vertical lines on the Navigation bar A position of interest is any base in the consensus that is Different from the HIV 1 pNL4 3 reference strain Found in the lookup table of known resistance positions Resistance mutations are those mutations reported to confer resistance to a specific anti viral drug The HIV 1 Genotyping System Software contains an internal table that lists all of the resistance mutations known at the time of release This table is derived from the Los Alamos HIV database and is updated annually Designated as mixed base in at least one segment at that position A deletion relative to the reference sequence An insertion at that position Identified to have mismatches between the segments The default is to have all of the feature selections chosen To See change the position of Setting Active interest criteria use the Positions of Interest Feature Selection on page 7 34 window 7 22 Analyzing HIV Sequencing Data Navigation Window Features continued Page 7 21 Callout Feature Description 3 Navigation Bar A graphical representation of the assembled a sequence with an amino acid numbering scale Note Aconsensus position can be a position of interest based on The positions of interest are displayed within the more than one criterion graphic The following table defines the
136. tep Action 1 Access the Applied Biosystems Technical Support Web site 2 Under the Troubleshooting heading click Support Request area of interest Forms then select the relevant support region for the product 3 Enter the requested information and your question in the yellow text displayed form then click Ask Us RIGHT NOW blue button with 4 Enter the required information in the next form if you have not already done so then click Ask Us RIGHT NOW You will receive an e mail reply to your question from one of our technical experts within 24 to 48 hours Introduction 1 29 To Obtain Free 24 hour access to Applied Biosystems technical documents Documents on including MSDSs is available by fax or e mail or by download from our Demand Web site To order documents Then by index a Access the Applied Biosystems Technical Support number Web site at http www appliedbiosystems com techsupp b Click the Index link for the document type you want then find the document you want and record the index number c Use the index number when requesting documents following the procedures below by phone for a From the U S or Canada call 1 800 487 6809 or fax delivery from outside the U S and Canada call 1 858 712 0317 b Follow the voice instructions to order the documents you want Note There is a limit of five documents per request through the a Access
137. til ready for the next step or store at 15 to 25 C Evaluating the You may see variability in the yield and purity of the PCR products This PCR Products for reflects variability in the viral load of the original plasma samples Melon Eorily To maximize the quality of the sequencing reactions evaluate the quality of the PCR products before sequencing To do this run the PCR products on an agarose gel and compare them to a DNA Mass Ladder containing DNA fragments of known sizes and amounts Use this information to determine how much to dilute the PCR product before performing sequencing HIV Genotyping Chemistry Protocol 4 17 Running the Follow the procedure below to electrophorese your PCR products Agarose Gel 8 To run the agarose gel Step Action 1 Prepare A1 agarose gel Gel buffer containing 0 5 g mL of ethidium bromide Note CHEMICAL HAZARD Ethidium bromide is a known mutagen i e it can change genetic material in a living cell and has the potential to cause cancer Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Note You can either prepare your own gels or purchase prepared gels 2 For each sample mix 5 uL of Gel Loading Buffer and 5 yL of purified PCR product 3 Briefly vortex the tubes Pulse spin the tubes at low speed 5 Load 6 pL of the DNA Mass Ladder solution into lane 1 and 3
138. til you have changed your outer gloves Dispose of all human blood products and associated materials according to your institution s safety guidelines When you finish your work wash your hands thoroughly with soap and water Thermal Cycler Settings Chapter Overview Introduction This chapter describes the thermal cycler settings for the GeneAmp PCR Systems 9600 and 9700 For complete operating instructions refer to the following manuals Operating Instruction for Manual GeneAmp PCR System 9700 96 Well Sample Base Module GeneAmp PCR System 9700 Base Module User s Manual P N 4303481 96 Well Sample Block Module GeneAmp PCR System 96 Well Sample Block Module User s Manual P N 4303480 GeneAmp PCR System 9600 GeneAmp PCR System 9600 User s Manual P N 0993 8660 In This Chapter The following topics are covered in this chapter Topic See Page General Information 3 2 Reverse Transcription Thermal Cycling 3 2 HIV Amplification Program 3 3 HIV Sequencing Program 3 3 Thermal Cycler Settings 3 1 General Information Ramping Times For all thermal cycling profiles select the shortest ramping times possible Reverse Transcription Thermal Cycling Programming The following table describes the thermal cycler program for the reverse Settings transcription step using the GeneAmp PCR Systems 9600 and 9700 Temperature C Time mi
139. tion 1 Copy the run module HIV 310 RunModuleH into the Module folder located within the Collection software folder of your computer 2 If necessary copy the DT POP6 BD Set Any Primer dye set primer file for the ABI PRISM 310 Genetic Analyzer into the ABI folder within the System Folder 3 Restart the Data Collection software and or DNA Sequencing Analysis software if either was open while the files were installed Preparing an How Instrument Matrix Files Are Used Instrument Matrix lt trument matrix files are used by the ABI Prism DNA Sequencing File Analysis software to compensate for the overlapping fluorescence emission spectra of the different dyes in a dye set Before Running Your Samples The following table lists the actions to take before running your samples and explains where to get additional information If Then you have not already generated a you will need to do this when you run matrix file on the ABI PRISM 310 your first samples Genetic Analyzer using the dRhodamine Matrix Standards Kit the HIV 310 RunModuleH and POP 6 polymer For more information about Refer to making the matrix file The ABI PRISM 310 Genetic Analyzer User s Manual P N 903565 and The Automated DNA Sequencing Chemistry Guide P N 4305080 Note Although BigDye terminators and dRhodamine terminators require different dye set primer files both chemistries use a matr
140. tion Use disposable gloves at all times Change gloves frequently to avoid sample to sample contamination Change gloves whenever they might have been contaminated with DNA and whenever you are leaving the work area Use sterile disposable hydrophobic filter plugged pipette tips and microcentrifuge tubes IMPORTANT Do not use gamma irradiation to sterilize microcentrifuge tubes as this may inhibit PCR subsequently carried out in these tubes Always change pipette tips before handling a different sample Store reagents as small aliquots to minimize the number of times a given tube of reagent is opened Record the lot numbers of reagents used in each set of samples so that if contamination occurs it can be more readily traced Avoid splashes Some types of sample tubes have tightly fitting caps which may cause splashing when they are forced open Centrifuge all liquid to the bottom of the closed tube before opening it Use a tube decapper device to open tubes more easily Clean the tube decapper device often Include reagent blank controls with each set of DNA extractions to check for the presence of contaminating DNA in the reagents Laboratory Guidelines 2 9 Before setting up the Infectious Material Work Area clean all work surfaces thoroughly with a 10 v v bleach solution Use disposable bench paper for example Benchkote sheets on permanent work surfaces to prevent the accumulation of human DNA Wea
141. tion which has the following icon AutoLaunch The following window opens HGS AutoLaunch aiting till Fri Mar 05 06 00 00 PST 1999 Navigate to the Run folder and click Open The Run folder is located in the Collection Software folder in the ABI PRISM 377 and ABI PRiSmM 310 Data Collection software Use the Earlier and Later buttons to adjust the hour Close the dialog box The program is still running AutoLaunch runs as follows a Polls the folder at the set time waits 5 minutes before polling the folder again to ensure that the folder is stable before to launching the HIV 1 Genotyping System Software b The application sets the polling time for one day later and runs in the background Reopening or The following table explains how to reopen and quit the AutoLaunch Quitting application AutoLaunch To Go to reopen the AutoLaunch window the Apple menu and select About About Quit Q 7 44 Analyzing HIV Sequencing Data To Go to quit the AutoLaunch application the Apple menu and select Quit 3 Q To See create projects manually inthe HIV 1 Creating a New Project on Genotyping System Software page 7 17 Before Manual Verify the following Editing ofthe 4 The tracking is correct Projects The start and stop points are appropriate The samples are named properly The matrix from the correc
142. tions in 96 Well Plates or Trays 4 27 Purifying Sequencing Reactions Using a 96 Well Centri Sep Plate 4 29 5 Using the 310 Genetic Analyzer Introduction i ea wes Sevan coe wg pee ae a TE eden ogee eee God A 5 1 Overview of the Procedure 0 0 eee eee eee eee 5 2 Preparing the Instrument 0 0 0 eee eee eee eee eee 5 3 Preparing the Sample Sheet and Injection List 5 6 Denaturing the Samples and Starting the Run 5 8 Analyzing the Sequencing Data 0 0 0 eee eee eee 5 9 6 Using the 377 DNA Sequencer Chapter Overview irei ih R ac pans seer elated Danae hte o 6 1 Overview of the Procedure 0 2 0 eee cee ee eee 6 2 Preparing the Instrument 0 0 00 eee eee eee eee 6 3 Denaturing the Samples 0 00 cece cee eee eee 6 8 Loading the Gel and Starting the Run for 36 48 and 64 Lanes 6 9 Running Samples on a 96 Lane Gel 0 0 0 0 00 eee eee 6 11 Analyzing the Sequencing Data 00 02 e eee eee eee 6 13 7 Analyzing HIV Sequencing Data TACO GUC EON zy sess fate A sack sear ashe A A oak N wee aeeeese 7 1 Installing the Software cae conien reien eee eee eee 7 2 Using the ViroSeq HIV 1 Genotyping System Software 7 6 Tutorial Using the HIV 1 Genotyping System Software 7 10 HIV Genotyping Folder Organization 00 0000 00005 7 14 About Projects and Sequence Segm
143. tocol Preventing RNA Degradation Samples must be collected and stored according to the methods discussed in the DAIDS Virology Manual for HIV Laboratories or other relevant regulations and guidelines see Appendix C Reference Before you begin this protocol you must Make sure that your lab has been prepared for work with HIV and is in compliance with all applicable regulations Make sure that all lab personnel know how to work safely with HIV and blood products See the BIOHAZARD Warning on page 2 13 Know how to protect RNA samples from degradation by RNase enzymes See Appendix B Preventing RNA Degradation Understand the principles of reverse transcription PCR and dye terminator cycle sequencing Add reagents to individual tubes or wells in exactly the order given in this manual Keep only the working sample tube open All other sample tubes should be capped to resirict sample cross contamination Pay special attention to the stated working temperature Many reactions are prepared on ice IMPORTANT Viral pellets and precipitated RNA are nearly invisible and can be dislodged when the supernatant is removed Laboratory personnel should read and follow the protocol very carefully at these points in the assay RNA is easily degraded by RNases that are present on hands lab surfaces and glassware etc Take all precautions to prevent RNase contamination of reagents and mixes Specifically
144. ts or database programs The genotype files are saved to the Report folder located in Projects Completed folder 7 40 Analyzing HIV Sequencing Data Printing a Report About the Report Generate a project report after you have edited and reviewed the consensus sequence The report summarizes the genotype and quality control information for the project IMPORTANT Before printing a final report examine the quality standards in Appendix A Printing the Note Before printing you must select a printer from the Chooser Report From the File menu select Print Report 88 P and click Print when the Print dialog box appears The report is not displayed on the computer screen Report Example An example of a report is shown next I PE Biosystems HIV G cyping f rt Sample QA10 eno el JPNJ Repo Date August 19 1999 11 02 43 AM HGS 2 1 Reference Los Alamos July 1998 fs Reported nucleotide variants y in the foljoing 3 rao acid changos Protease tau z1 Wie 7 RT ELTA E L EN ko Novel nucleotide variants a the fo Protease alia wmv kom Pas har RT Insertions Protease RT EES QC Information s0 40 30 20 Intha Cimormatia k gond ha 10 lighter colored barr rapransttia data after adRing o mismatch variants mixtures For Research Use Only Not for use in diagnostic procedures Analyzing HIV Sequencing Data 7 41 Report Description The fol
145. zation Isolating Work Special consideration should be given to the design and organization of Areas the laboratory The laboratory must be organized so that the area where amplified DNA is handled is physically isolated from the work areas for DNA extraction and RT PCR setup Different parts of the HIV Genotyping procedure should be performed in different work areas each ideally with dedicated equipment and supplies to minimize the likelihood of contamination The three suggested work areas are Infectious Material Work Area This work space is for performing the extraction steps RI PCR Setup Work Area RT and PCR reagents and DNA sample additions are made here Amplified DNA Work Area This area is dedicated to PCR amplification and detection and other activities that require handling of amplified DNA If possible the Infectious Material Work Area and RT PCR Setup Work Areas should be separate from each other to prevent potential transfer of exogenous RNA and DNA into the RT PCR Setup Work Area If the DNA extraction and RT PCR Setup Work Areas are in the same room they should be clearly delineated Benchtop biological safety cabinets may serve to isolate areas within a room The pipettors and other equipment used for RNA extraction are routinely exposed to relatively high concentrations of human genomic DNA and should not be used for RT PCR setup Dedicated pipettors and plugged pipette tips should be used for setting up
146. zing HIV Sequencing Data Setting AutoLaunch About AutoLaunch How to Use AutoLaunch Automatically Starting AutoLaunch The AutoLaunch folder contains the AutoLaunch application AutoLaunch is an independent program that allows the HGS software to create projects automatically from sample files in a run folder Note Using the AutoLaunch application is optional Start this application and leave it running The AutoLaunch program must be running to launch the analysis You can specify a time each day for the AutoLaunch program to review the contents of a run folder to determine if new sample files have been generated from which projects can be created The AutoLaunch program is particularly useful if you have performed an overnight sequencing run because it can create projects that will be ready for review If you make an alias of the AutoLaunch application and put the alias in your startup folder when you turn on your Macintosh computer the application will start To make an alias of the application select the icon and click M Put the alias in your Startup Items folder which is located in the System Folder Analyzing HIV Sequencing Data 7 43 Setting Up the To set AutoLaunch Application Step Action 1 Open the HIV Genotyping folder open the AutoLaunch folder and take the following action a Place the folder titled PutMelnYourRunFolder in the Run folder b Double click the AutoLaunch applica

Download Pdf Manuals

Related Search

Related Contents

YAMAHA WR250R/X `07  Toshiba L670D Laptop User Manual  Polaris Predator User's Manual  Local System Update for PRIMERGY Servers  S4M User Guide  Concord Camera 3132z Digital Camera User Manual  Manuel d`utilisation CNC PILOT 4290 V7.1  

Copyright © All rights reserved. Failed to retrieve file