NCode VILO miRNA cDNA Synthesis Kit and EXPRESS SYBR
Contents
1. 20 Continued on next page qPCR SuperMix with Premixed ROX continued 384 Well Plate Volumes qPCR Protocol For 384 well plates we recommend a maximum reaction volume of 10 ul per well Use the protocol below as a general starting point for qPCR with EXPRESS SYBR GreenER qPCR SuperMix with Premixed ROX Scale the reaction volume as needed for your real time instrument 1 Set up reactions on ice Volumes for a 20 ul reaction size are provided component volumes can be scaled as needed up to 10 of the qPCR reaction may be undiluted cDNA For 384 well plates we recommend a maximum reaction volume of 10 pl per well Always prepare a master mix of common components for multiple reactions 20 ul rxn EXPRESS SYBR GreenER gPCR SuperMix with Premixed ROX 10 pl 10 uM miRNA specific forward primer 200 nM final 0 4 ul 10 uM Universal qPCR Primer 200 nM final 0 4 ul cDNA up to 2 pl undiluted X ul DEPC treated water to 20 ul 2 Prepare no template control NTC reactions to test for DNA contamination of the enzyme primer mixes 3 Cap or seal each PCR tube plate and gently mix Make sure that all components are at the bottom of the tube plate centrifuge briefly if needed 4 Place reactions in a real time instrument programmed as described on the previous page Collect data and analyze results 5 Optional The specificity of the PCR products can be checked by agarose gel electrophoresis 21 Troubl2. Yekta S Burge C B Bartel D P 2003 Vertebrate microRNA Genes Science 299 1540 Lindahl T Ljungquist S Siegert W Nyberg B and Sperens B 1977 DNA N glycosidases properties of uracil DNA glycosidase from Escherichia coli J Biol Chem 252 3286 3294 Longo M Berninger M and Hartley J 1990 Use of uracil DNA glycosylase to control carry over contamination in polymerase chain reactions Gene 93 125 128 Maden B E H 1990 The numerous modified nucleotides in eukaryotic ribosomal RNA Prog Nucleic Acid Res Mol Biol 39 241 303 Nakahara K and Carthew R W 2004 Expanding roles for miRNAs and siRNAs in cell regulation Curr Opin Cell Biol 16 127 133 Okazaki Y Furuno M Kasukawa T and Adachi J 2002 Analysis of the mouse transcriptome based on functional annotation of 60 770 full length cDNAs Nature 420 563 573 Stark A Brennecke J Russell R B and Cohen S M 2003 Identification of Drosophila MicroRNA Targets PLoS Biol 1 E60 2009 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 28 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
3. hypothesized may contribute to eukaryotic complexity Bentwich et al 2005 Imanishi et al 2004 Okazaki et al 2002 They are cleaved from hairpin precursors and are believed play an important role in translation regulation of target mRNAs by binding to partially complementary sites in the 3 untranslated regions UTRs of the message Lim 2003 Though hundreds of miRNAs have been discovered little is known about their cellular function They have been implicated in regulation of developmental timing and pattern formation Lagos Quintana et al 2001 restriction of differentiation potential Nakahara amp Carthew 2004 regulation of insulin secretion Stark et al 2003 and genomic rearrangements John et al 2004 Several unique physical attributes of miRNAs including their small size lack of poly adenylated tails and tendency to bind their mRNA targets with imperfect sequence homology have made them elusive and challenging to study In addition strong conservation between miRNA family members means that any detection technology must be able to distinguish between 22 base sequences that differ by only 1 2 nucleotides Recent advances in microarray and qPCR detection have enabled the use of these technologies for miRNA screening With the maturation of deep sequencing platforms many other novel classes of small RNA have been discovered including snoRNA Maden 1990 piRNA Lau et al 2006 and promoter associa
4. see page 16 1 Set up reactions on ice Volumes for a 20 ul reaction size are provided component volumes can be scaled as needed up to 10 of the qPCR reaction may be undiluted cDNA For 384 well plates we recommend a maximum reaction volume of 10 ul per well Always prepare a master mix of common components for multiple reactions 20 ul rxn EXPRESS SYBR GreenER qPCR SuperMix Universal 10 pl 10 uM miRNA specific forward primer 200 nM final 0 4 ul 10 uM Universal qPCR Primer 200 nM final 0 4 ul ROX Reference Dye 25 uM 0 4 pl 0 04 ul cDNA up to 2 pl undiluted X ul DEPC treated water to 20 ul Consult instrument documentation The iCycler uses fluorescein instead of ROX for Dynamic Well Factor readings 10 20 nM final concentration see page 16 See the table on page 15 for the amount concentration of ROX to use for your specific instrument 2 Prepare no template control NTC reactions to test for DNA contamination of the enzyme primer mixes 3 Cap or seal each PCR tube plate and gently mix Make sure that all components are at the bottom of the tube plate centrifuge briefly if needed 4 Place reactions in a real time instrument programmed as described on the previous pages Collect data and analyze results 5 Optional The specificity of the PCR products can be checked by agarose gel electrophoresis 19 qPCR SuperMix with Premixed ROX Guidelines and Protocols Introduction Additional Ma
5. software programs or primer databases 22 Continued on next page Troubleshooting continued Problem Cause Solution PCR product is qPCR instrument Confirm that you are using the evident on a gel but settings are correct instrument settings dye not in the qPCR incorrect selection reference dye filters and graph acquisition points Problems with your See your instrument manual for tips specific qPCR and troubleshooting instrument PCR efficiency is Template contains Purify or re purify your template above 11096 inhibitors nucleases or proteases or has otherwise been degraded Too much sample added to reactions Inhibitors in the template may result in changes in PCR efficiency between dilutions Decrease the concentration of cDNA see the guidelines for cDNA concentration on page 12 Nonspecific products may be amplified Use melting curve analysis if possible and or run the PCR products on a 4 agarose gel after the reaction to identify contaminants Suboptimal primer design may lead to nonspecific products Use validated pre designed primers or design primers using dedicated software programs or primer databases PCR efficiency is below 90 The PCR conditions are suboptimal Verify that the reagents you are using have not been freeze thawed multiple times and have not remained at room temperature for too long Verify that the amount of primers you are usi
6. 3000P Mx3005 Mx40005 Rotor Gene DNA Engine Opticon Chromo 4 Smart Cycler LightCycler Mastercyler are trademarks or registered trademarks of their respective companies StepOne StepOnePlus PRISM and GeneAmp are trademarks or registered trademarks of Applera Corporation 27 References Bentwich I Avniel A Karov Y Aharonov R Gilad S Barad O Barzilai A Einat P Einav U Meiri E Sharon E Spector Y and Bentwich Z 2005 Identification of hundreds of conserved and nonconserved human microRNAs Nat Genet 37 766 770 Goff L A Yang M Bowers J Getts R C Padgett R W and Hart R P 2005 Rational probe optimization and enhanced detection strategy for microRNAs using microarrays RNA Biology 2 published online Imanishi T Itoh T Suzuki Y and O Donovan C 2004 Integrative annotation of 21 037 human genes validated by full length cDNA clones PLoS Biol 2 e162 John B Enright A J Aravin A Tuschl T Sander C and Marks D S 2004 Human MicroRNA Targets PLoS Biol 2 e363 Lagos Quintana M Rauhut R Lendeckel W and Tuschl T 2001 Identification of novel genes coding for small expressed RNAs Science 294 853 858 Lau N C Seto A G Kim J Kuramochi Miyagawa S Nakano T Bartel D P and Kingston R E 2006 Characterization of the piRNA complex from rat testes Science 313 305 306 Lim L P Glasner M E
7. NA plus the Universal qPCR Primer Other qPCR reagents must be ordered separately 10X SuperScript Enzyme Mix 5X Reaction Mix 10 uM Universal qPCR Primer 250 pl DEPC Treated Water NCode EXPRESS SYBR GreenER miRNA qRT PCR Kit Universal A11193 051 includes components for 50 cDNA synthesis reactions and 200 qPCR reactions EXPRESS SYBR GreenER qPCR SuperMix Universal ROX Reference Dye 500 ul NCode VILO miRNA cDNA Synthesis Kit 50 rxns see components listed above 20 ul each NCode EXPRESS SYBR GreenER miRNA qRT PCR Kit with Premixed ROX A11193 052 includes components for 50 cDNA synthesis reactions and 200 qPCR reactions with ROX at a premixed concentration in the qPCR SuperMix EXPRESS SYBR GreenER gPCR SuperMix with Premixed ROX ROX Reference Dye 500 ul NCode VILO miRNA cDNA Synthesis Kit 50 rxns see components listed above 20 ul each Product The Certificate of Analysis CofA provides detailed quality Qualification control information for each product The CofA is available on our website at www invitrogen com cofa and is searchable by product lot number which is printed on each box Additional Products Additional The NCode system is an integrated miRNA expression Products profiling system that includes miRNA isolation amplification purification quantification labeling and array hybridization components Additional products are available separately f
8. NCode miRNA Database at http escience invitrogen com ncode and searching for the mature miRNA name accession number or sequence of interest Click on the link in the search results to view the record for that miRNA which contains the suggested qPCR primer sequence s You can then order a sequence directly from Invitrogen by clicking on the primer link in the miRNA record Please note that not all of the primer sequences in the database have been bench validated For additional forward primer design guidelines see the recommendations on page 13 ROX Reference Dye is either premixed in the qPCR SuperMix or included as a separate component to normalize the fluorescent signal between reactions for instruments that are compatible with this option Continued on next page 3 Overview continued Heat labile Uracil DNA Glycosylase UDG MicroRNAs and Small RNAs Heat labile UDG and dUTP in the qPCR SuperMixes prevent the reamplification of carryover PCR products between reactions Lindahl et al 1977 Longo et al 1990 dUTP ensures that any amplified DNA will contain uracil while heat labile UDG removes uracil residues from single or double stranded DNA The heat labile form of UDG is completely inactivated at temperatures of 50 C and higher and will not degrade amplicons following qPCR MicroRNAs miRNAs are a recently discovered class of small 19 23 nucleotide non coding RNA molecules that several groups have
9. PCR reaction volumes can be scaled up to 100 ul depending on the instrument e Forinstrument specific guidelines see the section for each type of SuperMix Melting curve analysis should always be performed following real time qPCR to identify the presence of primer dimers and analyze the specificity of the reaction Program your instrument for melting curve analysis using the instructions provided with your specific instrument You can use up to 10 of undiluted cDNA in the qPCR reaction e g for a 20 ul qPCR use up to 2 ul of undiluted cDNA Use the Universal qPCR Primer provided as a separate tube in the NCode VILO kit as the reverse primer in the qPCR reaction TM If you are using archived cDNA from the old NCode miRNA First Strand cDNA Synthesis Kit catalog no MIRC 10 or MIRC 50 you must use the Universal qPCR Primer provided with that kit in the qPCR reaction cDNA generated using that kit is not compatible with the new Universal qPCR Primer in the current NCode VILO Kit Continued on next page General qPCR Guidelines and Parameters continued Forward qPCR Primer Designs NCode miRNA Database Additional Forward qPCR Primer Design Criteria To design the miRNA specific forward primer we recommend starting with the qPCR primer designs provided in the NCode miRNA Database Go to http escience invitrogen com ncode and search for the mature miRNA name accession number or sequence
10. Reference Dye at a final concentration of 500 nM These include the following Applied Biosystems instruments 7900HT 7300 StepOne GeneAmp 5700 PRISM 7000 and 7700 Methods Poly A Tailing and cDNA Synthesis Introduction This section provides guidelines and a protocol for poly A tailing of all the miRNAs and other small RNAs in a total RNA sample and then synthesizing cDNA from the tailed population in a single reaction Mixes The NCode VILO miRNA cDNA Synthesis Kit includes Provided in two mixes that are used for the tailing cDNA synthesis the Kit reaction The 10X SuperScript Enzyme Mix includes SuperScript III RT RNaseOUT Recombinant Ribonuclease Inhibitor and a proprietary helper protein The 5X Reaction Mix includes poly A polymerase ATP a universal RT primer MgCb and dNTPs in an optimized buffer formulation Isolating Total To isolate total RNA we recommend TRIzol Reagent RNA which preserves the low molecular weight LMW RNA in the sample see page vi for ordering information Enrichment for small RNAs is typically not necessary and may result in the loss of sample Important Do not use the PureLink Micro to Midi Total RNA Purification System to isolate total RNA samples as this purification method does not preserve LMW RNA Total RNA e The optimal amount of starting material is 100 pg to Guidelines 1 ug of total RNA though we have obtained good results with as little as 10 pg of to
11. Tailing and cDNA Synthesis continued Determining Total RNA Yield 10 Total RNA can be quantitated using the Quant iT RNA Assay Kit or UV absorbance at 260 nm Quant iT RNA Assay Kit The Quant iI RNA Assay Kit provides a rapid sensitive and specific method for RNA quantitation with minimal interference from DNA protein or other common contaminants that affect UV absorbance readings The kit contains a quantitation reagent and pre diluted standards for a standard curve The assay is performed in a microtiter plate and can be read using a standard fluorescent microplate reader UV Absorbance 1 Dilutean aliquot of the total RNA sample in 10 mM Tris HCl pH 7 5 Mix well Transfer to a cuvette 1 cm path length Note The RNA must be in a neutral pH buffer to accurately measure the UV absorbance 2 Determine the OD o of the solution using a spectrophotometer blanked against the buffer alone 10 mM Tris HCI pH 7 5 3 Calculate the amount of total RNA using the following formula Total RNA ug OD o x 40 ug 1 OD o x 1 ml x dilution factor x total sample volume ml Example Total RNA was eluted in water in a total volume of 150 pl A 40 l aliquot of the eluate was diluted to 500 ul in 10 mM Tris HCl pH 7 5 An OD of 0 188 was obtained The amount of RNA in the sample is Total RNA ug 0 188 x 40 ug 1 OD260 x 1 ml x 12 5 x 0 15 14 1 pg Continued on next page Poly A Tailing and cDNA Syn
12. V3 microarrays This control sequence has been tested for cross reactivity with endogenous miRNAs from model organisms and is provided at a concentration compatible with endogenous miRNA expression levels The following items are supplied by the user Total RNA isolated by a method such as TRIzol Reagent that preserves low molecular weight LMW RNA A forward qPCR primer specific for the miRNA of interest Microcentrifuge RNase free pipette tips 1 5 ml RNase free microcentrifuge tubes Disposable gloves Ice qPCR instrument Appropriate PCR plates tubes for instrument Optional Normalization dye for instruments that do not use ROX Instrument Compatibility qPCR EXPRESS SYBR GreenER qPCR SuperMix Universal SuperMix includes ROX Reference Dye as a separate tube and can be Universal used with a wide range of real time instruments including the following Applied Biosystems 7900HT 7300 7500 StepOne StepOnePlus GeneAmp 5700 and PRISM 7000 and 7700 Bio Rad MJ Research iCycler iQ iQ5 and MyiQ DNA Engine Opticon and Opticon 2 and Chromo4 Real Time Detector Cepheid Smart Cycler Corbett Research Rotor Gene 3000 Eppendorf Mastercycler ep realplex Roche LightCycler 480 Stratagene Mx3000P Mx3005P and Mx4000 qPCR EXPRESS SYBR GreenER qPCR SuperMix with Premixed SuperMix with ROX can be used with real time instruments that are Premixed ROX compatible with ROX
13. aturation step Continued on next page 16 qPCR SuperMix Universal continued General Cycling Programs The following cycling programs have been developed as a general starting point when using EXPRESS SYBR GreenER qPCR SuperMix Universal The fast cycling program was developed using the AB 7500 in Fast mode Note This mix is highly robust and can be used with a wide range of cycling programs on different instruments If you have an alternative program that you want to use test it with this mix Fast Cycling Program developed using the AB 7500 in Fast mode 95 C for 20 seconds 40 cycles of 95 C for 1 second 60 C for 20 seconds Optional Melting curve analysis 60 C 95 C refer to instrument manual for specific programming Standard Cycling Program 50 C for 2 minutes UDG incubation 95 C for 2 minutes 40 cycles of 95 C for 15 seconds 60 C for 1 minute Optional Melting curve analysis 60 C 95 C refer to instrument manual for specific programming Continued on next page 17 qPCR SuperMix Universal continued Roche The following cycling program is specific for the Roche Lig htCycler LightCycler 480 with a 96 well or 384 well plate when 480 Cycling using EXPRESS SYBR GreenER qPCR SuperMix Program Universal For detailed programming instructions consult the instrument manual Program Name Cycles Analysis Mode Pre
14. cial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the most restrictive terms apply Invitrogen Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Invitrogen Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensi
15. e calculated using an additional fluorophore fluorescein Well factors are collected using either a separate plate containing fluorescein in each well External Well Factors or the experimental plate with fluorescein spiked into the qPCR master mix Dynamic Well Factors You must select the method when you start each run using the iCycler Fluorescein is available separately from Bio Rad or Fluorescein NIST Traceable Standard is available from Invitrogen as a 50 uM solution see page vi for ordering information External Well Factors The Bio Rad iCycler instruction manual provides instructions on preparing and using the External Well Factor plate The iCycler will automatically insert a 3 cycle program before your experimental cycling program to perform the External Well Factor reading Note The iCycler iQ5 and MyiQ systems allow you to save the data from an External Well Factor reading as a separate file which can then be referenced for future readings Select the Persistent Well Factor setting when you are entering the cycling program to reference this saved file Dynamic Well Factors For Dynamic Well Factor readings the user must add fluorescein to the qPCR master mix at a final concentration of 10 20 nM Consult your Bio Rad iCycler instruction manual for details Note that if you select the Dynamic Well Factor option the instrument will automatically insert a 90 second incubation at 95 C before the initial 95 C den
16. end while at the same time adding A s to the 3 end Continued on next page 13 General qPCR Guidelines and Parameters continued Forward Primer Design Examples Ordering the Forward qPCR Primer 14 Example 1 1 3 The Tm for the entire miR 106b sequence as a primer TAAAGTGCTGACAGTGCAGAT is 56 2 C Adding combinations of G s and C s to the 5 end of the miR results in the following Tm s GGTAAAGTGCTGACAGTGCAGAT Tm 60 7 C CCTAAAGTGCTGACAGTGCAGAT Tm 60 9 C GCTAAAGTGCTGACAGTGCAGAT Tm 61 0 C All of these designs work when tested with a human pooled tissue cDNA sample Example 2 1 The Tm for the entire miR 324 sequence as a primer CGCATCCCCTAGGGCATTGGTGT is 71 8 C Bases were truncated from the 5 end until the Tm was in an acceptable range A few more truncated primers were designed with A s on the 3 end to bring the Tm closer to 60 C ATCCCCTAGGGCATTGGTGT Tm 62 7 TCCCCTAGGGCATTGGTGT Tm 62 6 CCCCTAGGGCATTGGTGT Tm 60 7 CCCCTAGGGCATTGGTGTA Tm 60 7 CCCCTAGGGCATTGGTGTAA Tm 62 0 When these sequences were tested the bottom two primer designs worked best Adding an A or two A s while truncating from the 5 end adds more specificity back to the primer design helping it anchor to the poly T tail in the cDNA After you have designed the miRNA specific forward primer you can order it from Invitrogen by visiting www invitrogen com oligos qPCR SuperMix U
17. ent detection in real time quantitative PCR qPCR These kits have been optimized for the detection and quantification of miRNA from 100 pg to 1 ug of total RNA with the amount of starting material ranging as low as 10 pg Using the NCode VILO miRNA cDNA Synthesis Kit the polyadenylation of miRNAs and reverse transcription from the tailed population occur in a single step for a more streamlined workflow and greater sensitivity SuperScript III Reverse Transcriptase RT in the reaction ensures high specificity and high yields of CDNA from small amounts of starting material EXPRESS SYBR GreenER qPCR SuperMixes include Platinum Taq DNA polymerase SYBR GreenER fluorescent dye MgCl heat labile uracil DNA glycosylase UDG dNTPs with dUTP instead of dTTP and stabilizers SYBR GreenER is a novel fluorescent double stranded DNA binding dye for both higher sensitivity and lower PCR inhibition than other fluorescent double stranded DNA binding dyes It can be used on real time PCR instruments calibrated for SYBR Green I without any change of filters or settings e qPCR SuperMix with Premixed ROX The qPCR SuperMix with premixed ROX includes ROX Reference Dye at a final concentration of 500 nM to normalize the fluorescent signal on instruments that are compatible with this option e Universal qPCR SuperMix The Universal SuperMix includes ROX as a separate component for instruments that use ROX at a different co
18. eshooting Problem Cause Solution Signals are present in no template controls and or multiple peaks are present in the melting curve graph Reagents are contaminated by nucleic acids Use melting curve analysis and or run the PCR products on a 4 agarose gel after the reaction to identify contaminants Take standard precautions to avoid contamination when preparing your PCR reactions Ideally amplification reactions should be assembled in a DNA free environment We recommend using aerosol resistant barrier tips Primer dimers or other primer artifacts are present Use melting curve analysis to identify primer dimers We recommend using validated pre designed primer sets or design primers using dedicated software programs or primer databases Primer contamination or truncated or degraded primers can lead to artifacts Check the purity of your primers by gel electrophoresis No PCR product is evident either in the qPCR graph or on a gel The protocol was not followed correctly Verify that all steps have been followed and the correct reagents dilutions volumes and cycling parameters have been used Template contains inhibitors nucleases or proteases or has otherwise been degraded Purify or re purify your template Primer design is suboptimal Verify your primer selection We recommend using validated pre designed primers or design primers using dedicated
19. ical Support continued Limited Warranty Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service please contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to the specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special inciden
20. incubation 1 None Amplification 40 45 Quantification Melting Curve 1 Melting Curves Cooling 1 None Target C Acquisition Mode aie 9 Ramp Rat al Pre incubation 95 None 00 05 00 4 4 or 2 0 4 8 Amplification 95 None 00 00 10 4 4 or 2 0 4 8 Primer Tm None 00 00 05 2 2 2 5 minus 5 C 00 00 20 72 Single 00 00 05 4 4 or 2 0 4 8 00 00 20 9 Melting Curoe 95 None 00 00 05 2 0 2 0 65 None 00 01 00 2 0 2 0 97 Continuous 5 10 acquisitions per C Cooling 40 None 00 00 10 2 0 2 0 greater 0 A ramp rate of 2 0 C s is recommended for reaction volumes of 50 ul or The annealing temperature will vary depending on the melting temperature Tm of the primers Use primer Tm minus 5 C as a general starting point 3 Longer annealing and extension times may result in greater precision in target quantification For 384 well plates we recommend a maximum reaction volume of 10 ul per well 384 Well Plate Volumes Continued on next page 18 qPCR SuperMix Universal continued qPCR Use the protocol below as a general starting point for qPCR Protocol with EXPRESS SYBR GreenER qPCR SuperMix Universal Scale the reaction volume as needed for your real time instrument ROX is recommended for Applied Biosystems instruments and optional for Stratagene and Eppendorf instruments see page 15 Bio Rad iCycler instruments use fluorescein instead of ROX for Dynamic Well Factor readings
21. invitrogen NCode VILO miRNA cDNA Synthesis Kit and EXPRESS SYBR GreenER miRNA qRT PCR Kits Catalog nos A11193 050 A11193 051 and A11193 052 Version A 12 February 2009 A11176 ii Table of Contents Kit Contents and Storage sess V Additional Products utens ettet eiae teca io vi OvervieW arsen 1 Instrument Compatibility seen 7 Methods neret xri tr nx retento n cuu ct aono asma sag r an pul cass aun ki cUs 8 Poly A Tailing and cDNA Synthesis esses 8 General qPCR Guidelines and Parameters ssssss 12 qPCR SuperMix Universal Guidelines and Protocols 15 qPCR SuperMix with Premixed ROX Guidelines and Protocols inne Rd petii hth re ee UBER Ree 20 TroubleshoOUng uar od diee diee viet per psndtegude ets 22 AppendDC iinad enisi ain ruine cx de agn d om dasx Eae e d Uber arua e ieu Fin IURE Des 24 Technical Support 24 Purchaser Notification see eene nennen 26 R fer nces ias iiie eertibe ig a deb op bandied 28 iii iv Kit Contents and Storage Kit This manual is for use with the kits listed below Each kit is Components shipped on dry ice Store all components at 20 C for long and Storage term storage EXPRESS qPCR SuperMixes may be stored at 4 8 C for up to one month NCode VILO miRNA cDNA Synthesis Kit A11193 050 includes components for 50 cDNA synthesis reactions from miR
22. ncentration or do not require ROX Continued on next page Overview continued Advantages of the Kits Workflow Overview The NCode kits have the following advantages e Enable poly A tailing of all the small RNAs including miRNA in a total RNA sample and then synthesizing cDNA from the tailed population in a single reaction e The optimal amount of starting material is 100 pg to 1 ug total RNA and can range as low 10 pg e No proprietary primers or primer probe assays required for qPCR you can design your own primer for any miRNA or other small RNA sequence from any species e Allows profiling of small RNAs miRNAs or mRNAs from a single cDNA synthesis reaction e Can discriminate between miRNAs that differ by a single nucleotide for profiling closely related templates e The Universal qPCR Primer included in the NCode VILO miRNA cDNA Synthesis Kit gives you the flexibility to order your qPCR detection reagents separately if desired e EXPRESS SYBR GreenER qPCR SuperMixes included in the qRT PCR kits ensure optimal sensitivity and performance in qPCR using a novel fluorescent dsDNA binding dye e Heat labile UDG and dUTP in the qPCR SuperMixes prevent amplification of carryover PCR products between reactions the heat labile form of the enzyme is completely inactivated during normal qPCR cycling e Designed and developed as part of the comprehensive NCode system which includes the NCode miRNA Mic
23. ndard DNA microarray surfaces The NCode Human miRNA Microarray Probe Set V3 includes probes provided on the V3 microarray dried down in 384 well plates at 500 pmoles per well and ready for printing The NCode Rapid miRNA Labeling System is a robust and efficient system for labeling RNA samples and hybridizing the labeled miRNA to NCode microarrays for expression profiling analysis Using this kit you ligate a DNA polymer labeled with highly fluorescent Alexa Fluor dye molecules to a total RNA sample and then hybridize the labeled miRNA in the sample to an array The system is designed to ensure maximum signal and strong signal correlations Product list continued on next page Continued on next page Overview continued Other Products in the NCode System continued Materials Supplied by the User Product list continued from previous page The NCode miRNA Amplification System is a robust system for amplifying sense RNA molecules from minute quantities lt 30 ng of miRNA The system provides consistent and accurate 21000 fold amplification while preserving the relative abundance of the miRNA sequences in the original sample allowing you to compare relative quantities across experiments The NCode Multi Species miRNA Microarray Control V2 is a synthetic 22 nucleotide miRNA sequence that has been designed and screened as a positive control for use with NCode system It works with NCode V2 and
24. ng invitrogen com Continued on next page Purchaser Notification continued Limited Use Label License No 276 Dye Intercalation Detection Assays Trademarks of Other Companies The purchase price of this product includes a limited non transferable immunity from suit under U S Patents Nos 5 994 056 and 6 171 785 and corresponding patent claims outside the United States owned by Roche Molecular Systems Inc or F Hoffmann La Roche Ltd Roche for using only this amount of product for dsDNA binding dye processes covered by said patents solely for the purchaser s own internal research and development activities This product is also a Licensed Dye Binding Kit for use with service sublicenses available from Applied Biosystems No right under any other patent claims such as apparatus or system claims in U S Patent No 6 814 934 and no right to use this product for any other purpose or for commercial services of any kind including without limitation reporting the results of purchaser s activities for a fee or other commercial consideration is hereby granted expressly by implication or by estoppel This product is for research purposes only Diagnostic uses require a separate license from Roche Further information regarding licenses for ds DNA binding dye processes may be obtained by contacting the Director of Licensing Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 USA iCycler MyIQ Mx
25. ng is correct 23 Appendix Technical Support World Wide Visit the Invitrogen website at www invitrogen com for Web e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail E mail E mail tech_support invitrogen com jpinfoGinvitrogen com eurotech invitrogen com MSDS Material Safety Data Sheets MSDSs are available on our website at www invitrogen com msds Certificate of The Certificate of Analysis CofA for this product is Analysis available on our website by product lot number at www invitrogen com cofa Continued on next page 24 Techn
26. niversal Guidelines and Protocols Introduction Additional Materials Required ROX Reference Dye Concentration This section provides guidelines and protocols for using the EXPRESS SYBR GreenER qPCR SuperMix Universal The following items are supplied by the user e miRNA specific forward primer e Microcentrifuge e qPCR instrument e PCR tubes plates ROX Reference Dye is supplied as a separate tube in the Universal Kit ROX is recommended for fluorescence normalization on Applied Biosystems instruments and is optional for Stratagene and Eppendorf instruments It is not required on other instruments ROX is composed of a glycine conjugate of 5 carboxy X rhodamine succinimidyl ester and is supplied at a concentration of 25 pM Use the following table to determine the amount of 25 uM ROX to use with a particular instrument Amount of Effective Fold Final ROX Instrument ROX per 20 pl Concentration of Concentralion reaction 25 uM ROX AB 7300 7900HT StepOne and PRISM 0 4 ul 50X 500 nM 7000 and 7700 AB 7500 and StepOnePlus Stratagene AOP Ma a00 E 0 04 pl 500X 50nM Mx40009 Continued on next page 15 qPCR SuperMix Universal continued Fluorescein Bio Rad iCycler instruments require the collection of well for Bio Rad factors before each run to compensate for any instrument iCycler or pipetting non uniformity Well factors for SYBR Instruments GreenER experiments ar
27. of interest Click on the link in the search results to view the record for that miRNA which contains the suggested qPCR primer sequence s You can then order a sequence directly from Invitrogen by clicking on the primer link in the miRNA record Please note that not all of the primer sequences in the miRNA database have been bench validated If you choose to design the miRNA specific forward qPCR primer yourself keep in mind the following guidelines e Start with the entire miRNA sequence in DNA primer form i e T s in place of U s TM e Usea primer design program such as OligoPerfect available on the Web at www invitrogen com oligos or Vector NTI to determine the primer Tm 3 stability self complementarity and end self complementarity e The optimal primer Tm is 60 C e Ifthe Tm for the entire miRNA sequence is too low try adding non templated bases to the 5 end of the primer usually G s and C s in random combinations although A s and T s may also be used Also adding one or more A s to the 3 end of the primer is acceptable and sometimes helps the primer overcome high 3 stability or self complementarity issues to pass the primer checker e If the Tm is too high truncate from the 5 end of the primer only Truncating from the 3 end will lose specificity to the target due to the 3 variability of miRNAs To achieve an optimal Tm of around 60 C you can truncate bases from the 5
28. roarrays V2 and V3 Probe Sets V2 and V3 Control V2 Rapid miRNA Labeling System and Amplification System Following isolation of total RNA all the miRNAs in the sample are polyadenlyated and reverse transcribed using poly A polymerase ATP SuperScript III RT and a specially designed universal RT primer in a single reaction The first strand cDNA is ready for analysis in qPCR using EXPRESS SYBR GreenER detection reagents the Universal qPCR Primer provided in the kit and a forward primer designed by the user that targets the specific miRNA sequence of interest Continued on next page Overview Workflow Diagram Forward Primer Design for qPCR ROX Reference Dye continued 5 3 MRNA in a total RNA sample Poly A tailing plus first strand cDNA synthesis with SuperScript amp lll RT and a universal RT primer Poly A tail m 3 MRNA j m EEM 5 First strand cDNA Universal RT Primer qPCR with EXPRESS SYBRGGreenER SuperMix the Universal Primer and an miRNA specific forward primer miRNA specific Primer 3 3 5 AG Universal qPCR Primer Data analysis The Universal qPCR Primer provided in the VILO kit is used as the reverse primer in the qPCR reaction The forward qPCR primer is specific for the miRNA sequence of interest and must be ordered separately by the user To design the forward primer we recommend visiting the
29. rom Invitrogen Ordering information is provided below For more information visit our Web site at www invitrogen com or contact Technical Support page 24 RNase Away Reagent 250ml 10328 011 DNase I Amplification Grade 18068 015 TRIzol Reagent 100 ml 15596 026 200 ml 15596 018 Quant iT RNA Assay Kit Q 33140 Quant iT DNA Assay Kit High Sensitivity 1000 assays Q33120 NCode miRNA Amplification System MIRAS 20 NCode Rapid miRNA Labeling System 20 labeling rxns MIRLSRPD 20 NCode Rapid Alexa Fluor 3 miRNA 20 labeling rxns MIRLSA3 20 Labeling System NCode Multi Species miRNA Microarray 5 slides MIRA2 05 V2 NCode Multi Species miRNA Microarray 10 pl MIRAC2 01 Control V2 NCode Multi Species miRNA Microarray 3 x 384 well plates MIRMPS2 01 Probe Set V2 500 pmol per well NCode Human miRNA Microarray MIRAH3 05 NCode Human miRNA Microarray Probe 4 x 384 well plates MIRHPS3 01 Set V3 500 pmol per well Quant4T DNA Assay Kit Broad Range 1000 assays Q33130 Fluorescein NIST Traceable Standard 5x1ml F36915 50 uM Custom Primers visit www invitrogen com oligos vi Overview System Overview The NCode VILO miRNA cDNA Synthesis Kit and NCode EXPRESS SYBR GreenER miRNA qRT PCR Kits provide qualified reagents for the tailing of microRNAs miRNAs and other small RNAs in a total RNA population synthesis of first strand cDNA from the tailed RNA and subsequ
30. tal indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 25 Purchaser Notification Limited Use Label License No 14 Direct Inhibition by Anti polymerase Antibodies Limited Use Label License No 5 Invitrogen Technology 26 Licensed to Invitrogen Corporation under U S Patent Nos 5 338 671 5 587 287 and foreign equivalents for use in research only The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commer
31. tal RNA e High quality intact RNA is essential for accurate quantification e DNase I Amplification Grade may be used to eliminate genomic DNA contamination from the total RNA see page vi for ordering information Continued on next page Poly A Tailing and cDNA Synthesis continued General Handling of RNA Determining Total RNA Quality When working with RNA e Use proper microbiological aseptic technique e Wear latex gloves while handling reagents materials and RNA samples to prevent RNase contamination e Use disposable individually wrapped sterile plasticware for all procedures e Use aerosol resistant pipette tips e Dedicate a separate set of pipettes buffers and enzymes for RNA work e Use RNase free microcentrifuge tubes To decontaminate untreated tubes soak overnight in a 0 01 v v aqueous solution of diethylpyrocarbonate DEPC rinse with sterile distilled water and autoclave RNase Away Reagent a non toxic solution available from Invitrogen can be used to remove RNase contamination from surfaces Total RNA quality can be analyzed using a bioanalyzer such as the Agilent 2100 bioanalyzer with an RNA LabChip Alternatively total RNA can be analyzed by agarose gel electrophoresis RNA isolated using TRIzol Reagent typically has a 28S to 18S band ratio of gt 1 5 RNA is judged to be intact if discreet 28S and 18S ribosomal RNA bands are observed Continued on next page Poly A
32. ted RNA Although the function of these RNAs remains unclear their validation and characterization is critical to gene expression research Continued on next page Overview continued Other Products in the NCode System The following products are available separately from Invitrogen for ordering information see page vi The NCode Multi Species miRNA Microarray V2 consists of 5 Corning Epoxide Coated Glass Slides each printed with optimized probe sequences targeting all of the known mature miRNAs in miRBase Release 9 0 http microrna sanger ac uk for human mouse rat D melanogaster C elegans and Zebrafish The probes were designed using an algorithm that generates miRNA sequences with enhanced hybridization properties Goff et al 2005 Each slide comes blocked and ready to use The NCode Human miRNA Microarray V3 consists of 5 Corning Epoxide Coated Glass Slides each printed with optimized probe sequences for all known mature human miRNAs in the miRBase Sequence Database Release 10 0 http microrna sanger ac uk as well as putative novel human miRNAs discovered through deep sequencing and validated by qRT PCR and array profiling You can use each microarray to screen dye labeled human miRNA samples The NCode Multi Species miRNA Microarray Probe Set V2 includes the probe sequences provided on the V2 microarray dried down in 384 well plates at 500 pmoles per well and ready for printing on sta
33. terials Required Premixed ROX Concentration Cycling Programs This section provides guidelines and protocols for using the EXPRESS SYBR GreenER qPCR SuperMix with Premixed ROX The following items are supplied by the user e miRNA specific forward primer e Microcentrifuge e qPCR instrument e PCR tubes plates ROX Reference Dye is included in the SuperMix at a final concentration of 500 nM which is compatible with Applied Biosystems 7900HT 7300 StepOne GeneAmp 5700 and PRISM 7000 and 7700 The following general cycling programs have been developed as a starting point when using the EXPRESS SYBR GreenER qPCR SuperMix with Premixed ROX on various instruments The fast cycling program is designed for the AB 7900HT and StepOne Note This mix is highly robust and can be used with a wide range of cycling programs on different instruments If you have an alternative program that you want to use test it with this mix Fast Cycling Program developed using the AB 7500 in Fast mode Standard Cycling Program 50 C for 2 minutes UDG incubation 95 C for 20 seconds 95 C for 2 minutes 40 cycles of 40 cycles of 95 C for 1 second 95 C for 15 seconds 60 C for 20 seconds Optional Melting curve analysis 60 C 95 C refer to instrument manual for specific programming 60 C for 1 minute Optional Melting curve analysis 60 C 95 C refer to instrument manual for specific programming
34. thesis continued Reaction The 37 C incubation for 60 minutes combines both poly A Guidelines tailing of miRNAs small RNAs with cDNA synthesis of the tailed population The reaction is terminated with the 95 C incubation Poly A Tailing The following reaction volume may be scaled as needed up and cDNA to 100 ul Synthesis Protocol 3 4 9 For a single reaction combine the following components in a tube on ice For multiple reactions prepare a master mix without RNA 5X Reaction Mix 4ul 10X SuperScript Enzyme Mix 2 ul Total RNA 100 pg to 1 ug X ul DEPC treated water to 20 ul Cap the tube gently vortex to mix and centrifuge briefly to collect the contents Incubate tube at 37 C for 60 minutes Terminate the reaction at 95 C at 5 minutes Hold the reaction at 4 C until use Use the undiluted cDNA in qPCR For long term storage store the cDNA at 20 C 11 General qPCR Guidelines and Parameters Introduction qPCR Setup and Conditions Melting Curve Analysis Amount of cDNA Reverse qPCR Primer Note 12 This section provides general qPCR guidelines as well as guidance on designing the forward qPCR primer that is specific for the miRNA sequence of interest e Maintain a sterile environment when handling the cDNA to avoid any contamination from DNases e Make sure all equipment that comes in contact with the cDNA is sterile including pipette tips and microcentrifuge tubes e q
Download Pdf Manuals
Related Search